Journal articles: 'Urbana High School (Urbana, Ohio)'

1

Shaw, Brian P. "Music Education Opportunities in Ohio K–12 Public and Charter Schools." Journal of Research in Music Education 69, no. 3 (February 8, 2021): 303–20. http://dx.doi.org/10.1177/0022429420986123.

Full text

Abstract:

The purpose of this study was to examine which Ohio schools offered curricular music courses and the rates at which students participated in those courses. The analysis involved descriptive statistics, analysis of variance, logistic regression, and partially nested multilevel modeling using data from the Ohio Department of Education ( N = 3,222 schools). The investigation revealed that charter schools offered music courses far less often than public schools. However, in charter schools that did offer music, students participated at higher rates than those in public schools. Nearly all public schools featured music classes. The exception was high schools in the highest poverty urban neighborhoods, 31% of which had no curricular music. Students identified as Black, Hispanic, or indigenous were more likely to attend schools without music programs. Elementary students enrolled in an average of 1.00 music classes per year, whereas middle and high school students enrolled in 0.67 and 0.35 music classes per year, respectively. Suburban districts saw the greatest decline in music participation as students progressed to high school. Urban schools with greater percentages of white, non-Hispanic students had higher music enrollment rates.

APA, Harvard, Vancouver, ISO, and other styles

2

Wiggan, Greg, and Marcia J. Watson-Vandiver. "Urban School Success: Lessons From a High-Achieving Urban School, and Students’ Reactions to Ferguson, Missouri." Education and Urban Society 51, no. 8 (January 20, 2018): 1074–105. http://dx.doi.org/10.1177/0013124517751721.

Full text

Abstract:

Due to the recent racially motivated killings in Ferguson, Missouri (2014); Staten Island, New York (2014); Cleveland, Ohio (2014); Charleston, South Carolina (2015); Baton Rouge, Louisiana (2016); and Dallas, Texas (2016), racial and ethnic tensions have heightened across the United States. Whereas schools would seem like optimal spaces for racial inquiry and promoting understanding, most classroom lessons have been standardized to avoid critical race discussions. Thus, the transformative power of education is restricted when conversations about real issues in society are avoided. This qualitative case study examines Fannie Lou Hamer Academy (FLHA)—pseudonym, a high-performing urban school that utilizes critical antiracism education. The findings suggest that multicultural curriculum helps students develop “self-knowledge,” meaning a personal awareness of their race and identity. Participants describe how self-knowledge provides corrective history, a response to negative media portrayals of minorities, and helps students understand current events such as the racial unrest in Ferguson, Missouri. The implications of these findings reveal the central role of the curriculum in shaping positive student identities and helping to mediate social conflicts.

APA, Harvard, Vancouver, ISO, and other styles

3

Forrest, Denise. "Projects: Young Scholars Program." Mathematics Teacher 93, no. 4 (April 2000): 357. http://dx.doi.org/10.5951/mt.93.4.0357.

Full text

Abstract:

The Young Scholars Program in Ohio is a cooperative effort of nine urban school districts and several major institutions of higher education in Ohio. The program identifies minority youths with college potential who might drop out of school. The students are selected in the sixth grade by a committee of educators from their local school districts. Selection criteria include a written essay, grades, and a standardized test. Students are advised and mentored in various ways during their high school and college years. They must maintain a 3.0 gradepoint average in high school and take collegepreparatory classes to remain eligible for the program. Middle school students take mathematics classes on Saturday mornings, and high school students attend two-hour tutoring sessions twice weekly after school. The program's developers believe that it is very successful. Students who have been through the program can succeed in nearly all the academic disciplines at the college level. A notable exception to this rule is mathematics.

APA, Harvard, Vancouver, ISO, and other styles

4

Hyder, Ayaz, Anne Trinh, Pranav Padmanabhan, John Marschhausen, Alexander Wu, Alexander Evans, Radhika Iyer, and Alexandria Jones. "COVID-19 Surveillance for Local Decision Making." Public Health Reports 136, no. 4 (May 12, 2021): 403–12. http://dx.doi.org/10.1177/00333549211018203.

Full text

Abstract:

Objective Data-informed decision making is valued among school districts, but challenges remain for local health departments to provide data, especially during a pandemic. We describe the rapid planning and deployment of a school-based COVID-19 surveillance system in a metropolitan US county. Methods In 2020, we used several data sources to construct disease- and school-based indicators for COVID-19 surveillance in Franklin County, an urban county in central Ohio. We collected, processed, analyzed, and visualized data in the COVID-19 Analytics and Targeted Surveillance System for Schools (CATS). CATS included web-based applications (public and secure versions), automated alerts, and weekly reports for the general public and decision makers, including school administrators, school boards, and local health departments. Results We deployed a pilot version of CATS in less than 2 months (August–September 2020) and added 21 school districts in central Ohio (15 in Franklin County and 6 outside the county) into CATS during the subsequent months. Public-facing web-based applications provided parents and students with local information for data-informed decision making. We created an algorithm to enable local health departments to precisely identify school districts and school buildings at high risk of an outbreak and active SARS-CoV-2 transmission in school settings. Practice Implications Piloting a surveillance system with diverse school districts helps scale up to other districts. Leveraging past relationships and identifying emerging partner needs were critical to rapid and sustainable collaboration. Valuing diverse skill sets is key to rapid deployment of proactive and innovative public health practices during a global pandemic.

APA, Harvard, Vancouver, ISO, and other styles

5

Aragão, João Paulo Gomes de Vasconcelos. "PROBLEMÁTICA SOCIOAMBIENTAL URBANA E POSSIBILIDADES DE ABORDAGEM EM SALA DE AULA." Revista Brasileira de Educação em Geografia 10, no. 20 (December 31, 2020): 373–98. http://dx.doi.org/10.46789/edugeo.v10i20.924.

Full text

Abstract:

Que reflexões e práticas são possíveis ao professor(a) de Geografia no desenvolvimento da problemática socioambiental urbana em sala de aula? O objetivo deste artigo foi apresentar algumas atividades metodológicas práticas aplicadas a estudantes do Ensino Médio e como elas possibilitaram o ensino de temas relacionados a problemática socioambiental urbana. Constituindo uma temática relevante na ciência geográfica para docentes e estudantes, acredita-se competir aos docentes a reflexão teórica, acompanhada do planejamento e execução de estratégias metodológicas que permitam aos estudantes uma leitura geográfica do mundo vivido. Neste trabalho, são realizados apontamentos sobre as possibilidades teóricas e alçadas alternativas metodológicas para a prática pedagógica, a partir da experiência docente do autor com estudantes de nível médio. Sem a finalidade de esgotar o amplo debate interdisciplinar sobre a questão ambiental urbana e as metodologias existentes, destaca-se a importância de o professor(a) de Geografia, enquanto agente atento às condições da vida no lugar, no bairro ou cidade onde está a escola, refletir a complexa realidade que o urbano abrange. A problemática socioambiental deve ser incluída a partir das categorias e métodos disponíveis na própria Geografia, seja como forma de reafirmar a importância da disciplina nesse debate, bem como construindo com os estudantes um processo de aprendizagens significativas. PALAVRAS-CHAVE Ensino de Geografia, Meio ambiente, Problemática socioambiental urbana. URBAN SOCIO-ENVIRONMENTAL PROBLEM AND POSSIBILITIES OF A CLASSROOM APPROACH ABSTRACT What reflections and practices are possible for the geography teacher in the development of urban socio-environmental problems in the classroom? The purpose of this article was to present some practical methodological activities applied to high school students and how they made it possible to teach themes related to urban socio-environmental issues. Constituting a relevant theme in geographic science for teachers and students, it is believed that the theoretical reflection will be competed by teachers, accompanied by the planning and execution of methodological strategies that allow students to geographically read the lived world. In this work, notes are made on the theoretical possibilities and alternative methodological approaches to pedagogical practice, based on the author's teaching experience with high school students. Without the aim of exhausting the broad interdisciplinary debate on the urban environmental issue and existing methodologies, the importance of the Geography teacher, as an agent attentive to the conditions of life in the place, in the neighborhood or city where the school is located, is highlighted. the complex reality that the urban encompasses. The socio-environmental issue should be included from the categories and methods available in Geography itself, either as a way of reaffirming the importance of the discipline in this debate, as well as building a significant learning process with students. KEYWORDS Geography teaching; Environment, Urban socio-environmental problem.

APA, Harvard, Vancouver, ISO, and other styles

6

Sanoff, Henry. "Research Based Design of an Eelementary School." Open House International 34, no. 1 (March 1, 2009): 9–16. http://dx.doi.org/10.1108/ohi-01-2009-b0002.

Full text

Abstract:

The aim of this paper was to examine current learning styles and teaching methods in order to suggest a new form of learning environment for young students. Features such as different activity settings and small group activities aimed at enhancing learning resulted from the participation of students, teachers and parents in the design of the Gibsonville Elementary School. Teachers, working in small groups, compared different classroom arrangements along with criteria to compare and evaluate each alternative and unanimously selected an “L” shape classroom, which became the basis for the design of the school. Another critical design feature that emerged from the teacher workshop was direct access from each classroom to the outdoors, allowing teachers to create outdoor classrooms that could enhance student's ecological awareness. The final design featured four academic houses of six L shaped classrooms each around an open courtyard to provide a resource for students, parents, and teachers to collectively explore and maintain outdoor environmental themes. A post occupancy evaluation was conducted several months after completion of construction and revealed a high level of satisfaction; however, the findings pointed to the need for a subsequent workshop to focus on the effective arrangement of furniture in L shaped classrooms. The participatory process was identified by the students and teachers as the key factor contributing to the design, which of one of the first schools of its type in the United States.

APA, Harvard, Vancouver, ISO, and other styles

7

Edgerton, Adam K., and Laura M. Desimone. "Teacher Implementation of College- and Career-Readiness Standards: Links Among Policy, Instruction, Challenges, and Resources." AERA Open 4, no. 4 (October 2018): 233285841880686. http://dx.doi.org/10.1177/2332858418806863.

Full text

Abstract:

Using state-representative teacher surveys in three states—Texas, Ohio, and Kentucky—we examine teachers’ implementation of college- and career-readiness (CCR) standards. What do teachers report about the specificity, authority, consistency, power, and stability of their standards environment? How does their policy environment predict standards-emphasized instruction? Do these relationships differ for those who teach different subjects (math and English Language Arts [ELA]), different grades (elementary or high school), different populations (English Language Learners [ELLs], students with disabilities [SWDs]), and in different areas (rural, urban, or suburban)? We found elementary math teachers taught significantly more standards-emphasized content than elementary ELA teachers, whereas secondary ELA teachers taught significantly more standards-emphasized content than secondary math teachers. Teachers of SWDs and rural teachers taught significantly less of the emphasized content. In all three states, we found greater buy-in (authority) predicted increased emphasized content coverage among ELA teachers but not among math teachers.

APA, Harvard, Vancouver, ISO, and other styles

8

Mania, Lia, Ketevan Nanobashvili, and Ilona Sakvarelidze. "Determining Oral Health Status and Lifestyle related Behaviors on the Example of 149 Children Aged 7 to 12 Years Old Living in Tbilisi." Caucasus Journal of Social Sciences 16, no. 1 (April 9, 2024): 109–21. http://dx.doi.org/10.62343/cjss.2023.235.

Full text

Abstract:

The level of oral hygiene in school-aged children in different countries is primarily low. Behavioral factors are the most important contributors to this low level of hygiene. It is also important to note that identifying the specific behaviors that significantly reduce disease burden is critical. The research was provided in Tbilisi, in public schools, to evaluate Oral health indicators (OHI, DMF, def), mean value of intensity of caries in school-aged children (7 to 12 years old), the role of behavioral factors in relation to oral hygiene and carbohydrate nutrition, and the popularity and relevance of preventive measures were determined. A cross-sectional study was conducted, where 149 children aged 7 to 12 were selected by simple random sampling from Tbilisi public schools. Evaluation of DEF, def, and S-OHI indices was carried out. Based on the oral health questionnaire, children’s oral care and carbohydrate nutrition behaviors were assessed, as well as attitudes toward preventive interventions. SPSS version 23 software for statistical data processing was used for statistical analysis. On the example of 149 children in the 7-12-year-old population of Tbilisi, the simplified hygiene index is evaluated by the criterion average (1.56). Urban distribution affects the hygiene index, which is statistically significant (P=0.009). Caries intensity and hygiene index in primary and permanent dentition do not depend on gender - statistical certainty is not fixed. Caries intensity is “medium” for both permanent (3.2) and primary dentition (3.9), and the mean value of caries intensity for the whole population is 6.31, which is rated as “high.” The popularity and relevance of preventive measures are low. Lifestyle behaviors related to both oral hygiene and carbohydrate-rich diets are not consistent with the recommendations provided by the FDI to reduce caries burden.

APA, Harvard, Vancouver, ISO, and other styles

9

Stewart, L. R., P. A. Paul, F. Qu, M. G. Redinbaugh, H. Miao, J. Todd, and M. Jones. "Wheat mosaic virus (WMoV), the Causal Agent of High Plains Disease, is Present in Ohio Wheat Fields." Plant Disease 97, no. 8 (August 2013): 1125. http://dx.doi.org/10.1094/pdis-03-13-0243-pdn.

Full text

Abstract:

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat. References: (1) S. G. Jensen et al. Plant Dis. 80:1387, 1996. (2) N. Mielke-Ehred and H.-P. Muhlbach. Viruses 4:1515, 2012. (3) J. M. Skare et al. Virology 347:343, 2006. (4) R. Louie et al. J. Virol. Methods 135:214, 2006.

APA, Harvard, Vancouver, ISO, and other styles

10

Akalin, Aysu, Kemal Yildirim, Christopher Wilson, and Aysun Saylan. "Users' Evaluations of House FaÇades: Preference, Complexity and Impressivenes." Open House International 35, no. 1 (March 1, 2010): 57–65. http://dx.doi.org/10.1108/ohi-01-2010-b0006.

Full text

Abstract:

This research solicits the opinions of the residents of the Keçiören district of Ankara, Turkey, in order to learn their preferences about their local postmodern environment where the municipality forces all contractors and architects to adhere to strict planning laws requiring Turkish folk and Islamic architectural references. The Municipality of Keçiören, as an agent of civil power, manages the architectural and urban transformation of the area from a district formerly composed of squatter housing to one comprised of, in the words of Robert Venturi, “decorated sheds,” in an effort to create a different looking environment rich in nostalgia and excitement. In this research, a total of 7 different sets of apartment façades were analyzed, with each set comprising three examples each of minimum complexity (representing the former condition of the district), intermediate complexity (representing “high” architecture designed by an architect, which does not exist in the district) and maximum complexity (representing the present postmodern condition of the district). The main hypothesis of the study was that preference rates would be high for intermediately altered “high style” houses by showing the existence of a U-shaped relationship between preference and complexity. That is, façades representing an intermediate level of complexity would be favored over less complex and more complex façades. It was also assumed that there would be a difference in the ratings of different age groups. A questionnaire was carried out with 50 adults (aged 30-45) and 50 high school students (aged 18-20) of Keçiören, who were asked to rate a total of 21 photographs from 7 apartment complexes with the help of a five-point semantic differential scales under three headings: preference, complexity and impressiveness. The results proved the existence of a U-shaped relationship between preference and complexity. On the other hand, younger respondents, compared to older respondents, gave more favorable ratings to the physical qualities of the photographed buildings.

APA, Harvard, Vancouver, ISO, and other styles

11

Falcão, Julio Ferreira, Edmundo Rodrigues do Nascimento, Francisco Antônio da Silva Carvalho, Jorge Wagner Nascimento, Emily Lira Simões, and Emilia Souza Arrua. "BUILDING A HYDROPONIC SYSTEM FOR VEGETABLES: EXPERIENCE REPORT OF TECHNICAL HIGH SCHOOL STUDENTS IN AGRICULTURE AT IFAM, CAMPUS LÁBREA." Revista Ibero-Americana de Humanidades, Ciências e Educação 10, no. 5 (May 20, 2024): 3510–22. http://dx.doi.org/10.51891/rease.v10i5.14040.

Full text

Abstract:

Projeto de Conclusão de Curso Técnico foi realizado por alunos do 3º ano do Curso Técnico em Agropecuária no IFAM campus Lábrea. O foco do projeto foi a implantação de um sistema hidropônico em pequena escala, escolhido devido à crescente importância da agricultura urbana e sustentável em regiões com acesso limitado a solo fértil. A pesquisa, desenvolvida de abril a novembro de 2023, buscou preencher lacunas de conhecimento local sobre sistemas hidropônicos. A metodologia incluiu um extenso levantamento bibliográfico, com a escolha criteriosa do local de implantação do sistema de hidroponia, montagem da estrutura da casa de vegetação, e programação do temporizador para o sistema Nutrient Film Technique (NFT). Uma análise de custos revelou que os materiais necessários foram doados pelo proprietário da propriedade, resultando em um custo total de R$2524,00 reais. O projeto envolve desafios, exigindo criatividade e aprendizado contínuo dos alunos, contribuindo para a formação técnica e a aplicação prá tica de conhecimentos adquiridos ao longo do curso. A execução do projeto desafiou desafios, mas atingiu objetivos, contribuindo para a formação técnica dos alunos. A conclusão destaca a importância da pesquisa científica nos cursos técnicos, promovendo habilidades práticas e conhecimento. O projeto amplia o conhecimento e a inovação prática inovadoras, fortalecendo a formação técnica e contribuindo para a sustentabilidade agrícola em Lábrea, Amazonas.

APA, Harvard, Vancouver, ISO, and other styles

12

Roche, Rosellen, Joel Manzi, Terra Ndubuizu, and Samantha Baker. "Self-Efficacy as an Indicator for Success in a Premedical Curriculum for Underrepresented Minority High School Students." Journal of Medical Education and Curricular Development 7 (January 2020): 238212052094066. http://dx.doi.org/10.1177/2382120520940661.

Full text

Abstract:

Context: The Aspiring DOctors PreCollege Program at the Ohio University Heritage College of Osteopathic Medicine Cleveland Campus is unique among other precollege pipeline and mini-medical school programs in that it engages learners from urban underserved communities for an entire academic year as a cocurricular adjunct to their high school course load. One day per month, students are brought to the medical college campus and introduced to the field of osteopathic medicine. Students also participate in activities related to preparing for college admissions, diversity in higher education, mental health and wellness, and financial stewardship. All these activities are done with the goal of increasing the number of underrepresented minority (URM) students in the health care professions. Objective: Self-efficacy has been identified as a measure of internal motivation and belief in one’s ability to succeed in the face of challenges. The purpose of this study is to determine what effect, if any, participation in this program has on URM student self-efficacy. Methods: Students were asked to complete a validated self-efficacy questionnaire at the start and end of this program to determine their levels of self-efficacy and if there were changes after participating in this program. Results: Ten of the 12 seniors completed pre- and post-self-efficacy surveys. Two main discoveries were made through this pilot. First, when tested at the beginning of the program, all students had high levels of self-efficacy (mean score, 4.45 of 5). Second, 2 items were specifically increased by a statistically significant amount. The students increased in self-efficacy concerning the responses “I can learn what is being taught in class this year” ( P = .024) and “My ability grows with effort” ( P = .015). Conclusions: With the competitive standards of acceptance into the Aspiring DOctors PreCollege Program, students enrolled in this program had high levels of self-efficacy from the onset. While there was modest increase across the board, many of these indicators remained consistently high after the program. Using self-efficacy as a screening tool for premedical students may be helpful in identifying candidates likely to succeed in a future medical career.

APA, Harvard, Vancouver, ISO, and other styles

13

Tang, Ming, and Dihua Yang. "Real-Time Visualization in the Design Context." Open House International 32, no. 2 (June 1, 2007): 7–16. http://dx.doi.org/10.1108/ohi-02-2007-b0002.

Full text

Abstract:

Having been a promising visualization tool since 1950s, ironically, virtual reality is not widely used in the architectural design and evaluation process due to several constrains, such as the high cost of equipments and advanced programming skills required. This paper described the collaboration between design computing courses and architecture design studios that have been taught at Savannah College of Art and Design (SCAD) in 2004 and 2005. These courses explored several practical methods to integrate Low Cost Virtual Reality Aided Design (LC-VRAD) in the architectural design process. As a summary of the collaboration, this paper refers to three main aspects: (1) How to use game engine to design an affordable VR system in the ordinary studio environment. (2) How to integrate VR, into the design process, not only as a visualization tool, but also as a design instrument. (3) How to evaluate different methods of representing architectural models based on the efficiency of workflow, rendering quality and users' feedback. Support by the Game and Interactive Design Department at SCAD, students in the School of Building Arts implemented two Low Cost VRAD methods in various design phases, starting from site analysis, schematic design, design development to the final presentation. Two popular game engines, Epic Game's Unreal engine and Director MX's Shockwave engine, were introduced to students to visualize their project in real-time. We discussed computer-aided design theories including the application of VR, as well as digital computing and human computer interaction. At the end of each quarter, feedbacks from students and faculties were collected and analyzed. These methods were revised and improved consistently across 2004 and 2005 academic year.

APA, Harvard, Vancouver, ISO, and other styles

14

Dey, Sanjay, Amita Patra, Dillip Giri, and Kanak Madrecha. "From traditional leadership to transformative leadership: A conceptual study on the Leadership Style of the School Principals." International Journal of Management and Development Studies 11, no. 02 (February 25, 2022): 01–14. http://dx.doi.org/10.53983/ijmds.v11n02.001.

Full text

Abstract:

Introduction: The effectiveness of a school is largely dependent upon its principal. His behavior influences the way a school functions. The most crucial factor in any school is the leadership behavior of the principal and how the principal carries out his leadership behavior and how that reflects the efficiency of school functioning. Today one can notice there is a phenomenal change in the leadership behavior of the principal. Now the environment they are working in is very competitive, advanced, and technical. There are a lot of risks they are encountering in every situation to give their school a sustainable future. In one way they have to address the expectation of society and in the other, they are to meet the expectation of the management. Though their position is tough yet they have to continue their performance up to the satisfaction of the stakeholders. Rationale: The previous research studies were mostly centered on a traditional concept of the leadership style of the principal, which narrows down the role of the principal, and most considered him an instructional leader. Considering this is a research gap the researchers conducted qualitative research on the transformative leadership style of the principal. The ethnographic interview and ethnographic observation established the authenticity and internal consistency of the data and the results thus derived were with a high level of validity. Objective: The purpose of the study was to study the leadership behavior of the school principal concerning transformative leadership style and also to compare the effectiveness of transformative leadership styles concerning the outcomes of the school. Methods: This is a Qualitative Research (QR). Considering the nature of the research, the researchers decided to use a typical research design named concept analysis, since the research tries to identify the insight of the principal towards transformative leadership style through the opinion of their staff members. Research Tools: The Researcher prepared an interview schedule with the questions which were modified from the original questionnaire named, Leadership Behaviors Development Questionnaire (LBDQ) developed by Ohio State University, USA. Data Collection techniques: The data was collected through an Ethnographic interview and Ethnographic observation schedule over an extended period and the writing of extensive field notes by the researchers. Data analysis and interpretation: As this is a qualitative research design, after the data was collected, an in-depth analysis was done, to remove data redundancy, bring stability to the opinion of the respondents, to compare & contrast the opinion of the participants in non-contrived situations. Results: It was found that mostly the principals of urban-based secondary schools are much more aware, motivated, and active in the implementation of transformational leadership style compared to their counterparts in the schools located in the rural area. Again, the ethnographic observations reported that there was a very significant relationship between transformative leadership and the job satisfaction of the staff members. The attrition rate of the staff member was found less and the performance of the school was also continuously better compared to the school leaders having a negative mindset towards transformation. It was also found that transformative leaderships are good for emotional control, social adjustment, and creativity in the professional environment. It was also revealed that the schools with transformative leadership are more advanced in the achievements of many key performance indicators (KPIs). Conclusion: The study concluded that it is very much indispensable for the principals to understand the expectations of the stakeholders and bring innovation to the school. This is required to bring sustainability to the school and rise in a competitive environment.

APA, Harvard, Vancouver, ISO, and other styles

15

Praptiwi, Yenni Hendriani, Natanael Dwi Prayitno, and Susi Sukmasari. "Prevalence of Molar Incisors Hypomineralisation (MIH) in primary school children." Padjadjaran Journal of Dentistry 31, no. 2 (July 31, 2019): 79. http://dx.doi.org/10.24198/pjd.vol31no2.18995.

Full text

Abstract:

Introduction: Molar Incisor Hypomineralisation (MIH) is an enamel defect with white, yellow or black colour due to minerals insufficient during tooth development. The abnormality of prismatic enamel structures and tooth hypersensitivity on patients with MIH may disturb the success rate of restoration. The objective of this research was to determine the prevalence of MIH in primary school children. Methods: A cross-sectional study with purposive sampling on 619 primary school children at Pasteur Urban Village of Bandung City, Indonesia. All dentition were scored using the European Association of Paediatric Dentist (EAPD) MIH scoring sheet, and oral hygiene status assessment with simplified OHI. All data were descriptively described using distribution table. Results: Distribution of MIH on total of 619 children were scored as follows: 0,1,1a, 2, 2a, 3, 4, 5, 6, 7, 8, 9,10 (0 = free enamel defect; 6, 7, and 8 = alteration to non MIH; 1 -5 and 9 -10 = MIH) with frequencies 417(67.36%), 39(6.30%), 60(.65%), 13(2.10%), 0(0.00%), 7(1.13%), 0(0.00%), 4(0.65%), 0(0.00%), 26(4.20%), 58(9.36%), 0(0.00%), and 49(7.91%) respectively. Conclusion: Prevalence of children with MIH in primary school is quite high (19% (118 out of 619 participants)). The highest prevalence is found at the 11 years old group with 49 participants (36.84%), while the prevalence in boys (83 (62.4%)) is found to be higher than girls (50 (37.59%)).Keywords: Prevalence, Molar Incisor Hypomineralisation (MIH), primary school children

APA, Harvard, Vancouver, ISO, and other styles

16

Silva, Laiz Stephane Veiga da, Nayana Cristina Gomes Teles, Lindomar Cordeiro Antunes de Araújo, and Margarida Carmo de Souza. "Formação, metodologias e estratégias de professores que lecionam física e matemática em escolas de ensino médio do município de Itacoatiara - AM / Analysis of training, methodologies and strategies of teachers who teach physics and mathematics to high school students in schools in the municipality of Itacoatiara - AM." Brazilian Journal of Development 8, no. 7 (July 13, 2022): 51025–36. http://dx.doi.org/10.34117/bjdv8n7-156.

Full text

Abstract:

O presente estudo visou identificar o perfil dos professores que ministravam as disciplinas de Matemática e Física nas escolas de ensino médio da zona urbana do município de Itacoatiara-AM. Buscou-se ainda, delinear as principais metodologias e estratégias de ensino-aprendizagem utilizadas pelos docentes. Para tanto, utilizou-se uma pesquisa qualitativa, onde a coleta de dados foi realizada entre os meses de março a julho de 2021, através do aplicativo de questionários virtuais Survey Monkey. Os dados obtidos revelaram que mais da metade dos docentes inclusos na pesquisa eram do sexo feminino. Observou-se também que a maioria dos docentes concluíram seus cursos entre 2000 e 2005. Constatou-se ainda que, a maioria possuía pós-graduação, atuavam no ensino fundamental e médio, utilizavam metodologias, estratégias e recursos didáticos tradicionais, predominando a aula expositiva, com o uso da lousa, pincel e livros didáticos em suas aulas.

APA, Harvard, Vancouver, ISO, and other styles

17

Gallegos-Sánchez, Jesús José, Francisco Ruiz-Juan, Mario Alberto Villarreal-Angeles, and Jorge Isabel Zamarripa Rivera. "Etapas de cambio en la práctica de actividad física de tiempo libre en estudiantes de secundaria de Victoria de Durango, México. (Change stages to practice of physical activity within free time in high school students of Victoria of Durango, Mexico)." Retos, no. 35 (September 13, 2018): 196–200. http://dx.doi.org/10.47197/retos.v0i35.66878.

Full text

Abstract:

El propósito del estudio fue analizar las etapas de cambio ante la práctica de actividad física en el tiempo libre en estudiantes de educación secundaria de la Ciudad de Victoria de Durango, México. El marco teórico empleado fue el Modelo Transteórico. Se diseñó un estudio cuantitativo, observacional-descriptivo de corte transversal. La muestra fue 1112 estudiantes de secundaria, edades entre los 12 y 15 años (M= 13.52; ±.92); el 52.6% fueron chicas y 47.4% chicos; 37.2% de primer curso, 33.9% segundo, 28.9% de tercero; 69% de turno matutino y 31% vespertino; el 25.5% inscritos en de secundarias Generales Federales, 36.6% Técnicas Federales y 37.9% Estatales; 15.5% en secundarias con índice de marginación urbana alto, 29% medio, 12.2% bajo y 43.4% muy bajo. Se administró el cuestionario de etapas de cambio hacia la práctica del ejercicio físico. El análisis de datos fue realizado por medio de estadística descriptiva y prueba de Chi2. Los principales resultados advierten que la mayoría de los estudiantes(60.4%) están en etapas de cambio poco activas o inactivas (no ofrecen beneficios a la salud); los chicos son más activos (51.7%)que las chicas (29.1%); los estudiantes más activos son los de secundarias Federales Generales así como los de primer curso; cuando el índice de Marginación Urbana bajael porcentaje de estudiantes en etapas más activas o con beneficios para la salud aumenta. Concluyendo que es importante considerar las etapas de cambio de comportamiento para planificar estrategias de modelos educativos. The purpose of the study was to analyze the change stages to practice of physical activity within free time in high school students of the City of Victoria of Durango, México. The theoretical framework used was the trans-theoretical model. It was designed a quantitative, observational-descriptive cross-sectional study. The sample was 1112 high school students, with ages between 12 and 15 years (M = 13.52; ± .92), (52.6% girls and 47.4% boys, 37.2% first, 33.9% second and 28.9% of third deggre 69% morning shift and 31% evening shift, 25.5% Federal General High Schools, 36.6% Federal Techniques and 37.9% Local, 15.5% high urban marginalization index, 29% medium level, 12.2% low and 43.4% very low. The questionnaire of stages of change towards the practice of physical exercise was administered. The data analysis was performed by means of descriptive statistics and proof of Chi2. The main results the majority of students (60.4%) are established in non-active or inactive stages of change that do not offer any health benefits; boys are more active (51.7%) than girls (29.1%); the students of the Federal General High Schools are the most active, as well as those in the first year; In relation to the IMU, as it improves, the percentages of students increases with more active stages or with health benefits. Concluding It is important to consider the stages of behavior change to plan strategies for educational models.

APA, Harvard, Vancouver, ISO, and other styles

18

Alves, João Paulo Da Conceição, and Quésia De Oliveira Cardoso. "A educação básica na Amazônia e seus indicadores de qualidade social: contradições e desafios para o Ensino Médio no Amapá / The basic education in the Amazon..." Cadernos CIMEAC 9, no. 2 (October 22, 2019): 16. http://dx.doi.org/10.18554/cimeac.v9i2.3507.

Full text

Abstract:

O Ensino Médio corresponde a um nível de ensino propício à construção da identidade, projetos de vida e trajetória profissional dos sujeitos. O objetivo deste trabalho é analisar o Ensino Médio no estado do Amapá, considerando a sua qualidade social, tendo como base os indicadores educacionais oficiais. Utilizamos o levantamento bibliográfico para analisar o ensino médio público brasileiro, suas características e a seus indicadores de qualidade; além disso, utilizaremos dados do INEP sobre os indicadores educacionais de rendimento do Ensino Médio amapaense em 2015, para o desenvolvimento de análises correlacionadas aos índices de Desenvolvimento Humano dos Municípios – IDHM, índice de GINI e o índice de Pobreza. Nossas análises evidenciaram que o Ensino Médio no Amapá, apresentou índices negativos em relação à zona urbana, pois as taxas de Reprovação e Abandono no ano de 2015 foram elevadas. Diferente da zona rural que demonstrou dados positivos referentes ao fluxo no Ensino Médio, no entanto com baixos indicadores de qualidade social. Os maiores centros urbanos do estado, mesmo com a melhor estrutura, não apresentaram os melhores índices de ensino. De forma geral, os dados relacionados ao ensino apresentam disparidades em relação aos índices de desenvolvimento social e humano.Palavras-chave: Ensino Médio; Indicadores educacionais; Qualidade social; Amapá. ABSTRACT: The High School corresponds to a level of education conducive to the construction of the identity, life projects and professional trajectory of the subjects. The objective of this study is to analyze the High School in the state of Amapá, considering its social quality, based on official educational indicators. We used the bibliographic survey to analyze the Brazilian public secondary education, its characteristics and its quality indicators; In addition, we will use INEP data on educational indicators of high school income in amapaense in 2015, for the development of analyzes correlated to the Human Development Indexes of Municipalities - IDHM, GINI index and the Poverty index. Our analyzes showed that the high school in Amapá had negative indices in relation to the urban zone, since the rates of Reprobation and Abandonment in 2015 were high. Different from the rural area that showed positive data regarding the flow in High School, however with low indicators of social quality. The largest urban centers in the state, even with the best structure, did not have the best levels of education. In general, data related to education show differences in relation to social and human development indexes.Keywords: High School; Educational indicators; Social quality; Amapá.

APA, Harvard, Vancouver, ISO, and other styles

19

Brito, Dayane Galdino, and Josandra Araújo Barreto de Melo. "TRABALHANDO A PROBLEMÁTICA AMBIENTAL URBANA NAS AULAS DE GEOGRAFIA: experiência com vídeos e maquetes em escola pública de Campina Grande/PB." Revista Brasileira de Educação em Geografia 8, no. 15 (July 30, 2018): 279–99. http://dx.doi.org/10.46789/edugeo.v8i15.456.

Full text

Abstract:

Este trabalho discute o projeto de intervenção desenvolvido no âmbito do Programa Institucional de Bolsas de Iniciação à Docência – PIBID/CAPES/UEPB, realizado em uma turma do 1° ano do Ensino Médio, na Escola Estadual de Ensino Fundamental e Médio São Sebastião, Campina Grande-PB, pautando-se na abordagem da problemática ambiental urbana. Teve como objetivo principal auxiliar o ensino e a aprendizagem da disciplina de Geografia na abordagem dos problemas ambientais urbanos, a partir da realidade vivenciada pelos discentes. Como objetivos específicos, buscou-se compreender as causas, consequências e apontar possíveis alternativas para superação/minimização destes fenômenos; entender que um eficiente planejamento urbano deve contemplar as características físico-naturais do sítio urbano, bem como seus aspectos sociais; e, por fim, fomentar uma formação cidadã crítica e participativa. Utilizou-se como metodologia a elaboração de vídeos, cujas temáticas representam espaços da cidade em questão e seus respectivos problemas ambientais e, em seguida, a construção de maquetes que representam estes espaços apresentando alternativas. Dentre os resultados obtidos, destaca-se a participação dos discentes no desenvolvimento das propostas, a compreensão do meio ambiente urbano e reflexões acerca das possibilidades de interferir na produção espacial de maneira menos danosa ao ambiente. Portanto, a prática desenvolvida contribuiu com a formação de um entendimento da importância do ambiente para a manutenção da qualidade de vida na cidade.PALAVRAS-CHAVEEspaço urbano. Problemas ambientais. Ensino de Geografia. WORKING THE URBAN ENVIROMENTAL PROBLEMATIC IN GEOGRAPHY CLASSES: experience with videos and models in the public school in Campina Grande/PBABSTRACTThis paper discusses the intervention project developed in the scope of the Programa Institucional de Bolsas de Iniciação à Docência- PIBID / CAPES / UEPB, carried out in a class of the 1st year of High School, in the Escola Estadual de Ensino Fundamental e Médio São Sebastião, Campina Grande-PB, focusing on the approach to urban environmental problems. The objective was to assist the teaching and learning of the discipline of Geography in the approach to urban environmental problems, based on the reality experienced by the students. As specific objectives, we sought to understand the causes, consequences and to point out possible alternatives for overcoming / minimizing these phenomena; understand that an efficient urban planning must contemplate the physical-natural characteristics of the urban site, as well as its social aspects; and, finally, to promote a critical and participative citizen formation. It was used like methodology of elaboration of videos, whose subjects represent spaces of the city in question and its respective environmental problems and, next, a construction of models that represent these spaces presenting alternatives. Among the results obtained, stands out the participation of the students in the development of proposals, the understand of the urban environment and reflections about the possibilities to interfere in space production in the way less harmful to the environment. Therefore, the practice developed contributed to the formation of an understanding of the importance of an environment to maintenance of quality of life in the city.KEYWORDSUrban space. Environmental problems. Geography teaching.ISSN: 2236-3904REVISTA BRASILEIRA DE EDUCAÇÃO EM GEOGRAFIA - RBEGwww.revistaedugeo.com.br - revistaedugeo@revistaedugeo.com.br

APA, Harvard, Vancouver, ISO, and other styles

20

Ruby, Mendenhall, Butler-DeLong Tramayne, Lee Meggan J, and Langford Kiara. "Designing a Community Health Worker (CHW) Certificate Training that Centers Marginalized Youth’s Health and Wellness." Journal of Community Medicine and Health Solutions 5, no. 1 (April 23, 2024): 052–56. http://dx.doi.org/10.29328/journal.jcmhs.1001047.

Full text

Abstract:

The genesis of the youth Community Health Worker (CHW) and Citizen/Community Science (CS) training is rooted in interdisciplinary research and the lived experiences of families in Chicago and Urbana-Champaign. Dr. Mendenhall and colleagues’ (Drs. Robinson, Roberts and Rodriquez-Zas) South Chicago’s Black Mothers’ Resiliency Project provide dinsights into Black women’s experiences with genomics, trauma, and community science. Black women’s testimonies highlighted the health impacts of living in neighborhoods with high levels of gun violence and the resilience strategies they employ. This led to the development of a youth-centered CHW and CS training program, aimed at addressing health disparities. The program trained high school students and young adults (up to age 24) as CHWs and CSs, focusing on the objectives of (1) embedding culturally competent health workers in marginalized communities; (2) amplifying community voices; (3) collecting, analyzing, and quantifying observational data to inform policy decision-making; (4) amplifying community voices in healthcare discussions and (5) creating community health care worker training certification for youth. Over three years, the program trained over 50 participants, incorporating elements of wellness, art, and entrepreneurship.Based on ethnographic notes participants reported increases in wellness such as reduced anxiety and increased empowerment. The program’s long-term goals include creating employment opportunities for graduates and contributing to improved community health outcomes. This initiative represents a step towards addressing racial trauma and promoting community healing through youth-led innovation and empowerment.

APA, Harvard, Vancouver, ISO, and other styles

21

Delgadillo Castañeda, Rodolfo. "Body mass index and blood pressure in adolescents from an urban area in Mexico." Revista de la Facultad de Medicina Humana 24, no. 2 (April 29, 2024): 63–71. http://dx.doi.org/10.25176/rfmh.v24i2.6406.

Full text

Abstract:

Introduction: The changes brought about by the COVID-19 pandemic in adolescent activities have affected recreational aspects due to limited contact to prevent virus spread. This has contributed to increased indicators of overweight and obesity and could impact blood pressure levels. Objective: To determine the degree of association between Body Mass Index (BMI) and systemic blood pressure in adolescents. Methods: Systemic blood pressure was measured using continuous ambulatory blood pressure monitoring over 24 hours (ABPM). The sample consisted of 42 high school students with similar urban geographic characteristics in Mexico. All participants underwent anthropometric evaluation to identify notable group characteristics. The correlation was assessed using Spearman's Rho test. Results: Of the 42 participants included, 28.5% showed obesity, 21.45% were overweight, and no patient had hypertension. However, 23.8% showed prehypertension. A significant correlation was evidenced between BMI and both systolic and diastolic blood pressure values, at 0.390 and 0.382, respectively (p-value: 0.013 and 0.015, respectively). Conclusion: BMI was significantly associated with systolic and diastolic blood pressure levels in adolescents from an urban area in Mexico.

APA, Harvard, Vancouver, ISO, and other styles

22

Ribeiro, Fabyanne Oliveira Montelo, Thelma Pontes Borges, and Miguel Pacífico Filho. "COVID-19 NA AMAZÔNIA LEGAL: a centralidade do trabalho e a disseminação em Araguaína-TO." InterEspaço: Revista de Geografia e Interdisciplinaridade 7, no. 20 (October 14, 2021): 202131. http://dx.doi.org/10.18764/2446-6549.e202131.

Full text

Abstract:

COVID-19 IN THE LEGAL AMAZON: the centrality of the work and its dissemination in Araguaína-TOCOVID-19 EN LA AMAZONIA LEGAL: la centralidad del trabajo y su difusión en Araguaína-TORESUMOEm 2020, o mundo foi assolado pela COVID-19, fazendo com que países se organizassem para frear a contaminação e tratar os infectados. No Brasil, o coronavírus também se espalhou, atingindo todas as regiões. Araguaína, por ser um polo de atração econômica na Amazônia Legal, foi a primeira cidade além da capital do Tocantins, Palmas, a notificar casos. Considerando a centralidade que a atividade laboral tem no tecido social, verificamos como a doença se comportou entre os trabalhadores que, em razão de suas atividades, estão mais expostos ao contágio. Para tanto, identificamos perfil socioeconômico a partir de dados de notificação de agravo ao Centro de Referência de Saúde do Trabalhador. Como resultados gerais, temos a notificação de 522 registros, em sua maioria referentes a mulheres, pardas e com até o ensino médio. A doença afetou mais profissionais menos qualificados e com menor escolaridade. Concluímos que o controle da pandemia passa por uma atenção maior às medidas de proteção aos trabalhadores, uma vez que estão expostos à mobilidade urbana e ao próprio ambiente laboral.Palavras-chave: COVID-19; Trabalho; Araguaína.ABSTRACT In 2020, the world was devastated by COVID-19, causing countries to organize themselves to curb contamination and treat the infected; in Brazil, the coronavirus has also spread to all regions. The city of Araguaína, being a pole of economic attraction in the Legal Amazon, was the first city besides the capital of Tocantins, Palmas, to notify cases. Considering the centrality that work has in the social fabric, we check how the disease behaved among workers, who, due to their activities, are more exposed to contagion; and we identified socioeconomic profile from data on notification of injury to CEREST. As general results we have the notification of 522 records, mostly referring to women, mixed race and with up to high school. The disease affected more less qualified and less educated professionals. We conclude that the control of the pandemic requires greater attention to measures to protect workers, since they are exposed to urban mobility and the working environment itself.Keywords: COVID-19; Work; Araguaína.RESUMENEn 2020, el mundo fue devastado por COVID-19, lo que provocó que los países se organizaran para frenar la contaminación y tratar a los infectados; en Brasil, el coronavirus también se ha extendido a todas las regiones. La ciudad de Araguaína, al ser un polo de atracción económica en la Amazonía Legal, fue la primera ciudad además de la capital de Tocantins, Palmas, en notificar casos. Considerando la centralidad que tiene el trabajo en el tejido social, comprobamos cómo se comportó la enfermedad entre los trabajadores, quienes por sus actividades están más expuestos al contagio; e identificamos el perfil socioeconómico a partir de los datos sobre la notificación de lesiones al CEREST. Como resultados generales tenemos la notificación de 522 registros, mayoritariamente referidos a mujeres, mestizos y con hasta bachillerato. La enfermedad afectó a profesionales más menos calificados y menos educados. Concluimos que el control de la pandemia requiere una mayor atención a las medidas de protección de los trabajadores, ya que están expuestos a la movilidad urbana y al propio entorno laboral.Palabras clave: COVID-19; Trabajo; Araguaína.

APA, Harvard, Vancouver, ISO, and other styles

23

Sulistianingsih, Ellese, and M. Mukminan. "THE DEVELOPMENT OF WEB-BASED LEARNING MULTIMEDIA FOR HIGH SCHOOL STUDENTS’ LITHOSPHERE MATERIAL." Geosfera Indonesia 4, no. 1 (April 29, 2019): 11. http://dx.doi.org/10.19184/geosi.v4i1.9882.

Full text

Abstract:

Science and Technology develop very fast in every aspect of life, including in the aspect of education. As the development of science and technology, guiding teachers to be able to make use various kinds of creative and innovative learning media in learning process at school is needed in order to increase the effectivity of the learning process which will have impact on the students’ learning motivation and learning outcomes. According to the explanation, learning multimedia needs to be developed in order to increase the students’ learning motivation and learning outcomes. This research is a research and development (R&D), which is then modified by using Tessmer formative evaluation. The analysis results show that the web-based learning multimedia for lithosphere material has been proven its eligibility, that the web-based learning is valid, practical, to be used in learning process and is effective in increasing students learning motivation and learning outcomes. References Bowman, S. F. (2015). Evaluation in Instructional Design Practice: A View from The Stakeholders. (Dissertation Doctor, Capella University, 2015). Retrieved from https://search. proquest.com/docview/1707694509/fulltext PDF/D439E6E103D04792PQ/6?accountid=31324. Cahyono, K. (2013). Penggunaan Media Interaktif Berbasis Web untuk Meningkatkan Motivasi dan hasil Belajar. Jurnal Teknik Informatika Abdurrab University. Retrieved from http://binaprajajournal.com/ojs/index. php/jbp/article/view/117. Daljoeni, N. (2014). Pengantar Geografi. Yogyakarta: Ombak. Day, T. (2012). Undergraduate Teaching and Learning in Physical Geography. Journal Physical Geography, 36(3). Retrieved fom https://search. proquest. com/doc view/1019246195/B5C4C63F0A8F4962PQ/1?accountid=31324. Fadli, M. S. & Ikawati, H. D. (2017). Penggunaan Multimedia untuk Meningkatkan Motivasi Belajar Siswa. Jurnal Teknologi Pendidikan, 2(2). Retrieved from http://ojs.ikipmataram.ac.id/index.php/jtp/article/view/598. Gilakjani, A. P. (2012). The Significant Role of Multimedia in Motivating EFL Learners’ Interest in English Language Learning. Journal Modern Education and Computer Science, 4(4). Retrieved from https://search. proquest.com/docview/1627735482/509798BC9EC481FPQ/1?accountid=31324. Hake, R. R. (1999). Analyzing Change/Gain Score. Dept. of Physics, Indiana University. Retrieved from http://www.physics.indiana.edu/~sdi/Analyzing Change-Gain. Hawley, D & Lyon, J. (2017). Plate Update: Refreshing Ideas for Teaching Plate Tectonics. Teaching Geography, 42(1). Retrieved from https://search.pro quest.com/docview/1952375936/73816528324E4DACPQ/1?accountid=31324. Huang, Q. (2012). Action Research on Motivation in English Reading. Journal Theory and Practice in Language Studies, 2(8). Retrieved from https://search. proquest.com/docview/1619300790/fulltextPDF/D04EC91FA9214B89PQ/2?accountid=31324. Kusumaningtias, A. D. & Mukminan. (2014). Pengembangan Multimedia Pembelajaran Geografi dengan Materi Litosfer dan Pedosfer untuk SMA Kelas X. Jurnal Ilmu-ilmu Sosial, 11(1). Retrieved from https://jurnal.uny.ac.id/index.php/sosia/article/download/5284/4583. Milovanovic, M. Perisic, J., Vukotic, S. Bugarcic, M. Radovanovic, L. &Ristic, M. (2016). Learning Mathematic Using Multimedia in Engineering Education. Journal Acta Technica Corviniensis – Bulleting of Engineering, 9(1). Retrieved from https://search.proquest.com/docview/1767584934/559B63 F69E094F98PQ/1?accountid=31324. Moeed, A. (2015). Science Investigation Students View about Learning, Motivation and Assessment. Singapore: Springer. Mohasin, S. F., Shinde, P. A. &Khaparde. (2013). E-Learning: A Tool for Library and Information Services. Journal of Library & Information Science, 3(2). Retrieved from https://search.proquest.com/docview/1440877148/fulltext PDF/33223E6022A248ECPQ/1?accountid=31324. Permadi, A. A. (2016). Pengembangan Media Pembelajaran Interaktif Berbasis Web dengan Pemanfaatan Video Conference Mata Pelajaran Produktif Teknik Komputer dan jaringan di Sekolah Menengah Kejuruan. Jurnal Pendidikan Teknologi dan Kejuruan. Retrieved from http://jural.unm.ac.id/ 3123/1/Jurnal.pdf. Presiden Republik Indonesia. (2000). Keputusan Presiden Republik Indonesia Nomor 50 Tahun 2000 Tentang Tim Koordinasi Telematika Indonesia. Robb, C. (2010). The Impact of Motivational Messages on Student Performance in Community College Online Courses. (Dissertation Doctor, University of Illinois at Urbana-Champaign, 2010). Retrieved from https://search.proquest.com/docview/778224030/18ED422A32FC4231PQ/3?accountid=31324 Sahrir, M. S., Alias, N. A., Ismail, Z., & Osman, N. (2012). Employing Design and Development Research (DDR): Approaches in the Design and Development of Online Arabic Vocabulary Learning Games Prototype. Journal of Educational Technology, 11(2). Retrieved from https://search. proquest.com/docview/1288340626/fulltextPDF/D439E6E103D04792PQ/1?accountid=31324. Sari, H. V. & Suswanto, H. (2017). Pengembangan media pembelajaran Berbasis Web Untuk mengukur hasil Belajar siswa pada mata pelajaran Komputer Jaringan Dasar program Keahlian teknik komputer dan jaringan.Jurnal Pendidikan, 2(7). Retrieved from http://journal.um.ac.id/index.php/jptpp/ article/view/9734/4593. Su, C. H. (2016). The effects of students' motivation, cognitive load and learning anxiety in gamification software engineering education: a structural equation modeling study. Journal Multimedia Tools Application, 75(16). Retrieved from https://search.proquest.com/docview/1867930658/fulltextPDF/9482B 31FA03D4E7CPQ/1?accountid=31324. Tessmer, M. (1998). Planning and Conducting Formative Evaluation. London: Kogan Page Limited. Tsai, M. J. (2009). The Model of Strategic e-Learning: Understanding and Evaluating Student E-Learning from Metacognitive Perspectives. Journal Educational Technology & Society, 12(1). Retrieved from https://search. p1roquest.com/docview/1287039259/20B52566A67140DBPQ/1?accountid=31324. Umar. (2013). Studi Komparatif Penguasaan Konsep Ulumul Qur’an Dalam Pembelajaran Yang Menggunakan Full E-Learning Dan Blended E-Learning. Jurnal TAPIS, 13(1). Retrieved from http://id.portalgaruda.org/? ref=browse&mod=viewarticle&article=252276. Wiyani, N. A. (2012). Desain Pembelajaran Pendidikan: Tata Rancang Pembelajaran Menuju Pencapaian Kompetensi. Yogyakarta: Ar-Ruzz Media. Copyright (c) 2018 Geosfera Indonesia Journal and Department of Geography Education, University of Jember This work is licensed under a Creative Commons Attribution-Share A like 4.0 International License

APA, Harvard, Vancouver, ISO, and other styles

24

Veiga, Luciene Dias Bispo, Claudio Bispo de Almeida, Paulo Da Fonseca Valença Neto, Adriana Alves Nery, Djanilson Barbosa dos Santos, and Cezar Augusto Casotti. "Factors associated with cigarette experimentation among adolescents." Enfermería Global 18, no. 3 (June 10, 2019): 421–54. http://dx.doi.org/10.6018/eglobal.18.3.331811.

Full text

Abstract:

Objetivo: El presente estudio pretende identificar la prevalencia y factores asociados a la experimentación de tabaco en adolescentes.Método: El estudio epidemiológico, transversal, descriptivo y analítico realizado con una muestra aleatoria simple de escolares con edad de 14 a 19 años, matriculados en escuelas públicas de enseñanza media de la red estadual del área urbana del municipio de Jequié-BA. Se utilizó un cuestionario auto-aplicable de llenado voluntario, tras la firma del término de consentimiento libre y aclarado por el responsable cuando menor de 18 años. Se empleó el programa Epi DATA para la digitación de los datos y programa SPSS para calcular la razón de prevalencia y realizar la regresión de Poisson. Resultados: En el estudio de 765 adolescentes, siendo 59,9% del sexo femenino, 80,4% de etnia no blanca, 71,4% sin ocupación remunerada, 74% menos favorecidos económicamente y 37,9% consumen bebida alcohólica. El promedio de edad fue de 16,55 años (dp ± 1,33) años. La prevalencia de la experimentación de tabaco fue del 22,4%. Las variables: padres fuman (RP = 1,57, IC95%: 1,15-2,12), amigos fuman (RP = 2,15, IC95%: 1,56-2,95), uso de bebidas alcohólicas PR = 2,05; IC del 95%: 1.46 a 2.88) y la edad (OR = 1,36; IC del 95%: 1,01-1,84) fueron los que permitieron predecir mejor el riesgo de que un escolar experimente con el tabaco. Conclusiones: La prevalencia de experimentación fue 22,4%, y las variables que mejor permitieron predecir la predisposición de un escolar a experimentar el tabaco fueron tener padres fumadores, tener amigos que fuman, hacer uso de bebidas alcohólicas y ser del grupo de edad de 17 a 19 años. Objective: The present study aims to identify the prevalence and factors associated with cigarette experimentation among adolescents.Method: Cross-sectional, descriptive and analytical epidemiological study carried out with a simple random sample of students aged 14-19 years enrolled in public high schools in the urban area of the city of Jequié, in the state of Bahia. After the A self-administered questionnaire of voluntary completion was used after the participants (or their parents/guardians in the case of participants under 18) signed the free informed consent form. Data was entered with Epi DATA software and SPSS software was used to calculate the prevalence ratio and perform Poisson regression. Results: The study sample consisted of 765 adolescents, as follows: 59.9% were female individuals, 80.4% were non-white, 71.4% did not have a paid job, 74% lived in low-income families, and 37.9% used alcohol. The mean age was 16.55 years (sd ± 1.33) years. The prevalence of smoking experimentation was 22.4%. The variables: parental smoking (PR = 1.57, 95% CI: 1.15-2.12), smoking friends (RP = 2.15, 95% CI: 1.56-2.95), alcohol drinking (OR = 2.05, 95% CI: 1.46-2.88), and age group (RP = 1.36, 95% CI: 1.01-1.84) were the best predictors of the risk for experimentation with cigarettes among high school students.Conclusions: The prevalence of experimentation was 22.4%, and the variables that best predicted the likelihood of experimenting with tobacco among high school students were smoking parents, smoking friends, alcohol use and aged 17-19 years. Objetivo: O presente estudo visa identificar a prevalência e fatores associados à experimentação de tabaco em adolescentes.Método: Estudo epidemiológico, transversal, descritivo e analítico realizado com uma amostra aleatória simples, de escolares com idade de 14 a 19 anos, matriculada em escolas públicas de ensino médio da rede estadual da área urbana do município de Jequié-BA. Utilizou-se um questionário auto-aplicável de preenchimento voluntário, após assinatura do termo de consentimento livre e esclarecido pelo responsável quando menor de 18 anos. Empregou-se o programa Epi DATA para a digitação dos dados e programa SPSS para calcular a razão de prevalência e realizar a regressão de Poisson.Resultados: Participaram do estudo 765 adolescentes, sendo 59,9% do sexo feminino, 80,4% de etnia não branca, 71,4% sem ocupação remunerada, 74% menos favorecidos economicamente e 37,9% fazem uso de bebida alcoólica. A média de idade foi de 16,55 anos (dp±1,33) anos. A prevalência da experimentação de tabaco foi de 22,4%. As variáveis: pais fumam (RP=1,57; IC95%:1,15-2,12), amigos fumam (RP=2,15; IC95%:1,56-2,95), uso de bebidas alcoólicas (RP=2,05; IC95%:1,46-2,88) e grupo etário (RP= 1,36; IC95%:1,01-1,84) foram as que melhor permitiram prever o risco de um escolar vir a experimentar tabaco.Conclusões: A prevalência de experimentação foi 22,4%, e as variáveis que melhor permitiram prever a predisposição de um escolar vir a experimentar o tabaco foram possuir pais fumantes, ter amigos que fumam, fazer uso de bebidas alcoólicas e serem do grupo etário de 17 a 19 anos.

APA, Harvard, Vancouver, ISO, and other styles

25

Salevouris, Michael J., Robert W. Brown, Linda Frey, Robert Lindsay, Arthur Q. Larson, Calvin H. Allen, Samuel E. Dicks, et al. "Book Reviews." Teaching History: A Journal of Methods 12, no. 1 (May 4, 1987): 31–48. http://dx.doi.org/10.33043/th.12.1.31-48.

Full text

Abstract:

Eliot Wigginton. Sometimes a Shining Moment: The Foxfire Experience-- Twenty Years in a High School Classroom. Garden City, New York: Anchor Press/ Doubleday, 1985. Pp. xiv, 438. Cloth, $19.95. Review by Philip Reed Rulon of Northern Arizona University. Eugene Kuzirian and Larry Madaras, eds. Taking Sides: Clashing Views on Controversial Issues in American History. Vol. I: The Colonial Period to Reconstruction. Guilford , Connecticut: Dushkin Publishing Group, Inc., 1985. Pp. x, 255. Paper, $8.95. Review by Jayme A. Sokolow of the National Endowment for the Humanities. Lois W. Banner. American Beauty. Chicago and London: University of Chicago Press, 1983. Pp. ix, 369. Paper, $9.95. Review by Thomas J. Schlereth of the University of Notre Dame. Alan Heimert and Andrew Delbanco, eds. The Puritans in America: A Narrative Anthology. Cambridge: Harvard University Press, 1985. Pp. xviii, 438. Cloth, $25.00. Review by Raymond C. Bailey of Northern Virginia Community College. Clarence L. Mohr. On the Threshold of Freedom: Masters and Slaves in Civil War Georgia. Athens and London: The University of Georgia Press, 1986. Pp. xxi, 397. Cloth, $35.00. Review by Charles T. Banner-Haley of the Frederick Douglass Institute for African and African-American Studies, University of Rochester. Francis Paul Prucha. The Indians in American Society: From the Revolutionary War to the Present. Berkeley: University of California Press, 1985. Pp. ix, 127. Cloth, $15.95. Review by Darlene E. Fisher of New Trier Township High School, Winnetka, Il. Barry D. Karl. The Uneasy State: The United States from 1915 to 1945. Chicago and London: University of Chicago Press, 1983. Pp. x, 257. Paper, $7.95; Robert D. Marcus and David Burner, eds. America Since 1945. New York: St. Martin's Press, 1985. Fourth edition. Pp. viii, 408. Paper, $11.95. Review by David L. Nass of Southwest State University, Mn. Michael P. Sullivan. The Vietnam War: A Study in the Making of American Policy. Lexington: The University Press of Kentucky, 1985. Pp. 198. Cloth, $20.00. Review by Joseph L. Arbena of Clemson University. N. Ray Hiner and Joseph M. Hawes, eds. Growing Up In America: Children in Historical Perspective. Urbana and Chicago: University of Illinois Press, 1985. Pp. xxv, 310. Cloth, $27.50; Paper, $9.95. Review by Brian Boland of Lockport Central High School, Lockport, IL. Linda A. Pollock. Forgotten Children: Parent-Child Relations from 1500 to 1900. Cambridge: Cambridge University Press, 1983. Pp. xi, 334. Cloth, $49.50; Paper, $16.95. Review by Samuel E. Dicks of Emporia State University. Yahya Armajani and Thomas M. Ricks. Middle East: Past and Present. Englewood Cliffs, New Jersey: Prentice-Hall, Inc., 1986. Second edition. Pp. xiv, 466. Cloth, $16.95. Review by Calvin H. Allen, Jr of The School of the Ozarks. Henry C. Boren. The Ancient World: An Historical Perspective. Englewood Cliffs, New Jersey: Prentice-Hall, Inc., 1986. Pp. xx, 407. Paper, $22.95. Review by Arthur Q. Larson of Westmar College (Ret.) Geoffrey Treasure. The Making of Modern Europe, 1648-1780. London and New York: Methuen, 1985. Pp. xvii, 647. Cloth, $35.00; Paper, $16.95. Review by Robert Lindsay of the University of Montana. Alexander Rudhart. Twentieth Century Europe. Englewood Cliffs, New Jersey: Prentice-Hall, Inc., 1986. Pp. xiv, 462. Paper, $22.95. Review by Linda Frey of the University of Montana. Jonathan Powis. Aristocracy. New York: Basil Blackwell, 1984. Pp. ix, 110. Cloth, $24.95; Paper, $8.95. Review by Robert W. Brown of Pembroke State University. A. J. Youngson. The Prince and the Pretender: A Study in the Writing of History. Dover, New Hampshire: Croom Helm, Ltd., 1985. Pp. 270. Cloth, $29.00. Review Michael J. Salevouris of Webster University.

APA, Harvard, Vancouver, ISO, and other styles

26

Rigotti, Victor Luiz Duarte, Thaís Vasconcelos Silva, Maria Aparecida da Silva Alves, and Renata Freitag. "Percepção Ambiental em uma Ação Pedagógica para Alunos do Ensino Médio em Juína-MT: Educação Ambiental em Foco." Revista de Ensino, Educação e Ciências Humanas 20, no. 2 (June 27, 2019): 126. http://dx.doi.org/10.17921/2447-8733.2019v20n2p126-131.

Full text

Abstract:

A Lei nº 9.795 de 27 de abril de 1999, que institui a Política Nacional de Educação Ambiental, em seu artigo 5º, recomenda como referência os Parâmetros e as Diretrizes Curriculares Nacionais, na inclusão da Educação Ambiental, em todos os níveis e modalidades de ensino, observando-se que deve haver a integração da educação ambiental às disciplinas de modo transversal, contínuo e permanente. Diante deste cenário, o presente trabalho teve como objetivo verificar a percepção de estudantes do Ensino Médio na identificação dos tipos de poluição encontrados em ruas, na cidade de Juína-MT. A atividade foi desenvolvida na Escola Estadual Dr. Artur Antunes Maciel durante as aulas da disciplina de biologia no ano letivo de 2014. A pesquisa foi realizada com alunos do terceiro ano matutino. A turma foi dividida em três grupos, cada qual se comprometeu em fazer 40 imagens fotográficas com registros de poluição em quatro ruas urbanas. Todos os resultados foram tabelados e classificados em poluição do ar, da água, do solo e sonora. Esta pesquisa otimizou a relação entre os alunos e a sociedade, sendo uma excelente proposta para demais profissionais da educação. Portanto, a educação é o ponto chave para o desenvolvimento sustentável, e que é preciso reestruturar o processo de ensino, rever as atitudes e o comportamento em busca do equilíbrio entre o Homem e a Natureza. Palavras-chave: Poluição Urbana. Educação Ambiental. Sensibilização Ambiental. AbstractLaw N°. 9,795 of April 27, 1999, which establishes a National Environmental Education Policy, in its article 5, as a reference to the National Curriculum Guidelines and Parameters, in the Inclusion of Environmental Education at all levels and observing that there must be an integration of the information to the disciplines in a transversal, continuous and permanent way. Given this scenario, the present work had the objective of identifying high school students in the identification of the types of media found in the city of Juína-MT. The class was developed at the State School Dr. Artur Antunes Maciel during biology classes in the academic year of 2014. The class was divided into three groups, each of which committed to make 40 photographic images with pollution records on four urban streets. The results were tabulated and classified as air, water, soil and noise pollution. This research optimized the relationship between students and society, being one of the proposals presented for the number of education professionals. Therefore, education is the key to sustainable development, which is necessary for the teaching process, to revise attitudes and behavior in search of the balance between Man and Nature. Keywords: Urban Pollution. Environmental Education. Environmental Awareness.

APA, Harvard, Vancouver, ISO, and other styles

27

Crouch, Amy, and Andy Crouch. "My Tech-Wise Life: Growing Up and Making Choices in a World of Devices." Perspectives on Science and Christian Faith 73, no. 2 (June 2021): 124. http://dx.doi.org/10.56315/pscf6-21crouch.

Full text

Abstract:

MY TECH-WISE LIFE: Growing Up and Making Choices in a World of Devices by Amy Crouch and Andy Crouch. Grand Rapids, MI: Baker Books, 2020. 208¬†pages. Hardcover; $15.99. ISBN: 9780801018671. *My Tech-Wise Life is a book about life before it is a book about technology. Through a discussion of her own experience growing up in a "tech-wise family," Amy Crouch shares her struggles and successes as a young adult navigating a world that is obsessed with technology. She honestly shares how she doesn't have it all figured out, while describing the ways that she keeps technology in its place as a tool in her life, rather than as a controlling force. *Technology causes us problems that aren't rooted in technology. It changes the problems that we face, but it doesn't create fundamentally new problems. Sometimes it exacerbates problems that we have always faced, such as distraction. Other times, it covers up problems--this sounds good, until you realize that it also covers up the solutions. We experienced distraction and loneliness long before the distractions from phone notifications, and the loneliness from seeing Instagram posts of parties we weren't invited to. This book is about how to live--with and without technology. *In each chapter, Amy tackles a different facet of technology, exploring how we can be free of the demands of technology in a way that helps us to be more engaged in our own lives. Some chapters address specific technologies: for example, social media, and how "we don't have to compare ourselves" (chapter 1). Other chapters cover how we can use all of our technology better so that "we don't have to be exhausted" (chapter 7). *Each chapter is paired with a letter from her dad, Andy Crouch, the popular Christian author of The Tech-Wise Family. Each chapter also ends with "What to Do Next," beginning with questions of reflection, then moving toward the challenges of how to start conversations with your family and friends about how you want to be using technology, and ending with suggestions for how to change your habits surrounding technology. *My Tech-Wise Life reads more as an invitation than as a lecture. It is encouraging to hear this from Amy's perspective, as someone who grew up with smartphones and Instagram as a central part of high school. Amy is honest about how she struggles with what she's writing about--including issues of secrecy, loneliness, and exhaustion. These negative effects aren't invented by tech companies, but they are reframed and coded into the devices we carry around. She doesn't pretend that our problems can be fixed by purging our life of technology. Yet our situation isn't hopeless; Amy offers stories of her successes too. We are not inevitably going to lose to technology. There are ways to live a more meaningful life and to not succumb to the exhaustion of the endless scroll. *The book would be a valuable read for any young adult, but it is written to be most relevant for teens. This is apparent in some of her prompts to discuss technology use with parents, as well as in the emphasis placed on the teen demographic in the Barna research statistics scattered throughout the book. These statistics are based on surveys of young adults, so they primarily add confirmation that everyone else is struggling with the same technology problems. Aside from the statistics and a few of the prompts, the book is applicable to anyone who grew up with digital technology and is needing to reassess their relationship with it. *With its easy-to-read style, My Tech-Wise Life is a quick read, and would fit well for a small group wanting to read a book together. It is a hopeful, yet realistic book. It is honest about the problems that we face in using technology wisely, but it also offers concrete suggestions to be more mindful of technology use. Amy invites us into a life that is shaped around relationships and wonder rather than around technology. *Reviewed by Elizabeth Koning, graduate student in the Department of Computer Science, University of Illinois at Urbana-Champaign, Urbana, IL 61801.

APA, Harvard, Vancouver, ISO, and other styles

28

OLIVEIRA, ANDRÉA AZEVEDO DE, and SAULOÉBER TÁRSIO DE SOUZA. "Notas Sobre a História da Educação Física no Triângulo Mineiro (Ituiutaba - 1934-1971) * Notes on the History of Physical Education in the “Triângulo Mineiro” (Ituiutaba – 1934-1971)." História e Cultura 1, no. 2 (March 21, 2013): 21. http://dx.doi.org/10.18223/hiscult.v1i2.735.

Full text

Abstract:

Resumo: O trabalho tem como preocupação a implantação da disciplina de Educação Física nas escolas do município de Ituiutaba (Triângulo Mineiro), no período entre 1934 e 1971. A adoção de atividades físicas nos currículos escolares com o objetivo de disciplinar e higienizar a juventude e a infância local refletia o novo ideal pedagógico voltado ao domínio dos “instintos insubordinados”, buscando-se normatizar condutas e contribuindo para a nova organização social, surgida com a sociedade urbana e industrial, especialmente a partir da Segunda Guerra Mundial. Tal contexto provocou a necessidade de desenvolvimento de um alto grau de eficiência produtiva, onde a educação escolar seria fundamental para atingir tal propósito, além de contribuir para a difusão da idéia de que era necessário garantir uma “educação higiênica” no combate aos grandes surtos epidêmicos. A partir dessa perspectiva, buscamos apontar as especificidades das práticas de professores e alunos nas aulas de Educação Física nas escolas desse município mineiro.Palavras-chave: História da Educação – História da Educação Física – Triângulo Mineiro. Abstract: This article is concerned about the implementation of Physical Education in schools in the city Ituiutaba (Triângulo Mineiro) between 1934 and 1971. The adoption of physical activities in school curriculums aimed to discipline and purify the local youth and children reflected the new pedagogical ideal directed to the control of the "insubordinate instincts", seeking to regulate behaviors and contributing to the new social organization which appeared with the urban and industrial society, especially after the Second World War. Such a context brought about the need for development of a high degree of productive efficiency, where schooling would be essential to achieve such purpose, beyond the contribution to the transmission of the idea which was necessary to ensure a "pure education" in the fight against large epidemic outbreaks. From this perspective, we highlight the specific practices of teachers and students in Physical Education classes in the schools of this city.Keywords: History of Education – History of Physical Education – Triângulo Mineiro.

APA, Harvard, Vancouver, ISO, and other styles

29

De Oliveira, José Rafael, and Marquiana de Freitas Vilas Boas Gomes. "MAPEAMENTO DOS EQUIPAMENTOS URBANOS E COMUNITÁRIOS EM GUARAPUAVA-PR: ELEMENTOS PARA SUBSIDIAR O PROJETO NÓS PROPOMOS! / MAPPING OF THE URBAN AND COMMUNITY EQUIPMENTS IN GUARAPUAVA-PR: ELEMENTS TO SUBSIDIZE THE PROJECT NÓS PROPOMOS!" Geographia Meridionalis 6, no. 1 (December 6, 2021): 49–65. http://dx.doi.org/10.15210/gm.v6i1.20792.

Full text

Abstract:

A maioria das cidades brasileiras cresceu de forma desordenada e sem planejamento urbano, criando espaços segregados e com baixa disponibilidade de infraestrutura, fato que interfere nas condições de vida dos cidadãos. Simultaneamente, cresceu a demanda pela criação de equipamentos urbanos e comunitários que propiciem o bem-estar social da população. Os jovens, particularmente, carecem dos espaços de lazer para educação, recreação, desporto, sociabilidade e saúde, a exemplo dos equipamentos de cultura, lazer e saúde. É nesse contexto, que se insere o presente artigo, cujo objetivo foi identificar os equipamentos urbanos e comunitários na cidade de Guarapuava-PR, com ênfase no bairro Industrial, onde situa-se o Colégio Estadual Dulce Maschio, no qual realizou-se a pesquisa com 25 jovens. A metodologia utilizada foi quanti-qualitativa, combinando mapeamento, questionário e roda de conversa. Os resultados indicaram que a cartografia é um meio importante para localização e identificação da distribuição e concentração dos equipamentos e que a cidade possui uma grande diversidade destes, porém, não estão distribuídos de forma equitativa. A concentração está em bairros centrais e pericentrais, os quais possuem melhor infraestrutura urbana. A dificuldade de acesso gera distorções, pela falta de disponibilidade e distância dos equipamentos. O bairro Industrial, onde encontra-se a escola, possui alguns equipamentos, porém, é populoso o que gera uma desproporção entre a demanda e a oferta dos mesmos. Os bairros vizinhos possuem mais equipamentos, mas só, recentemente, estão mais acessíveis.ABSTRACTMost of the Brazilian cities have grown up in a disorderly way and without urban planning, creating segregated places with low infrastructure availability, fact that interferes in the citizens’ life conditions. Simultaneously, the urban and community equipment demand has increased which provide the social well being of the population. The young people, specially, need the leisure spaces for education, recreation, sport, sociability and health, for example the culture, leisure and health equipments. It is in this context that the present paper is inserted, which aim was to identify the urban and community equipments in Guarapuava,PR-Brazil, giving emphasis in the Industrial neighborhood, where it is the Dulce Maschio State High School, in which the research was performed with 25 youngs. The methodology used was quantitative and qualitative, in it was combining: mapping, questionnaire and conversation circle. The results have pointed that the cartography is an important way to location and identification of the equipments distribution and concentration and that the city have a big variety of them, however, they are not distributed in a equitable way. The concentration is in the central and pericentral neighborhoods, which have better urban infrastructure. The difficulty of access creates distortions, because of the lack of availability and the distance of the equipments. The Industrial neighborhood, where the school is, have some equipments, however, it is crowded what generates a disproportion between the demand of the equipments and its offer. The nearest neighborhoods have more equipments, but, only recently, they are more accessible.Keywords: City; Citizenship; Young people; Cartography; Mapping

APA, Harvard, Vancouver, ISO, and other styles

30

Thomas, Ronay, Patrick T. McGann, Andrew Beck, Amanda Pfeiffer, and Kyesha M. James. "Characterization of Community-Based Socioeconomic Factors, Utilization, and Adherence in Children with Sickle Cell Disease." Blood 134, Supplement_1 (November 13, 2019): 4686. http://dx.doi.org/10.1182/blood-2019-130637.

Full text

Abstract:

Introduction Sickle cell disease (SCD) affects over 100,000 people in the US, the majority of whom are African American. Socioeconomic challenges have a significant impact on both access and adherence to appropriate treatments which, given a history of racial segregation and discrimination, disproportionately burden under-represented minorities. The distribution of socioeconomic factors, like poverty, educational attainment, and housing quality, can now be assessed routinely at the population level, yet the distribution and impact of such contextual risks in the pediatric sickle cell population have not been sufficiently described. Here, we sought to characterize the burden of neighborhood-level socioeconomic challenges and barriers among children with SCD in one large, urban county. We also sought to determine whether these area-level indicators were associated with hospitalizations and markers of adherence to SCD medications. Methods We pursued a retrospective review of electronic health record data from 2011-2017 for children with HbSS disease in the active Cincinnati Children's Hospital Medical Center's SCD registry which includes all children receiving care within the past two years in the Comprehensive Sickle Cell Center and is representative of nearly all children with SCD in Hamilton County, Ohio. The analysis was performed under an IRB-approved study investigating socioeconomic factors for children in Hamilton County. Children within the SCD registry were excluded from this analysis if they had a non-HbSS genotype or an address outside of Hamilton County. Addresses were geocoded and linked to a specific census tract which approximates local neighborhood boundaries. Once linked to a census tract, that address was connected to a pre-determined list of variables present within the 2013-2017 US Census' American Community Survey. Variables included the census tract poverty rate, educational attainment rate (percentage of adults with less than a high school education), and the percentage of vacant housing. A validated census tract-level deprivation index, assembled from 6 such census variables, was also included. Outcomes of interest included number of hospitalizations and ED visits during the study period and %HbF for the subset on hydroxyurea treatment. Descriptive statistics were used to illustrate ecological socioeconomic characteristics among included patients. Associations between area-based socioeconomic deprivation and outcomes of interest were tested using the Kruskal-Wallis Test. Results There were 141 patients with HbSS included in the analysis (53% Male, 82% publicly insured). Mean age at the end of the analysis period was 9.6±6.3 years. Consistent with the aggressive treatment strategy at our center, most (97%) were on disease modifying treatment with either hydroxyurea (81%) or chronic transfusion therapy (16%). Compared to the county as a whole, children in the registry mapped to areas with relatively high rates of poverty (median 26%; IQR 15%-42%), low rates of education attainment (median with high school degree 86%; IQR 78%-91%), and high rates of vacant housing (median 13%; IQR 8%-19%). The deprivation index is scaled between 0 and 1 with higher values indicative of more socioeconomic deprivation. In our population, the deprivation index median was 0.45 (IQR 0.36-0.61). When the sample was categorized into three deprivation groups (low < 25th percentile, medium between 25th and 75th, and high >75th percentile), we found trends toward associations with utilization and adherence measures (Table 1). Conclusion A majority of our SCD patients live in neighborhoods with stark socioeconomic challenges and barriers which have been shown to negatively affect health outcomes. There appears to be a significant trend towards increased utilization among those living in more deprived neighborhoods, although, the link with adherence was less clear. The latter finding, indicative of similar HbF levels across deprivation groupings, may be the result of efforts made by our multidisciplinary comprehensive care team to optimize care for all patients regardless of socioeconomic challenges. The data presented here are novel and likely representative of socioeconomic challenges of most SCD patients living in the US. Future, larger, multi-center studies should focus on identifying and addressing social determinants of health within this population. Disclosures No relevant conflicts of interest to declare.

APA, Harvard, Vancouver, ISO, and other styles

31

Antonelli, Daniel. "Cultural and Cognitive Syntheses After Short-Term Music Study Abroad." Frontiers: The Interdisciplinary Journal of Study Abroad 36, no. 1 (April 16, 2024): 61–80. http://dx.doi.org/10.36366/frontiers.v36i1.823.

Full text

Abstract:

The purpose of this focused qualitative study was to examine two urban high school students’ perceptions of a study-abroad experience, five years after the fact, with the intention of assessing long-term effects on increased global competency and awareness. The interviewees, selected from 11 participants, brought an already rich intercultural perspective and as such, their experiences illuminated the profound benefits of short-term study abroad experiences. Interviews were designed to elicit whether the principle of global competency could be discerned along two basic criteria, acquisition of cultural knowledge, and capacity/desire for close observation and self-reflection. Viewed through the theories of experiential learning, this paper will explore related pedagogical themes as well as point to the cognitive issues at stake in a longitudinal approach to qualitative research. Abstract in Spanish El propósito de este estudio cualitativo estuvo enfocado en examinar las percepciones de dos estudiantes de una escuela secundaria urbana sobre sus experiencias de estudio en el extranjero, cinco años después de ocurridas las mismas, con la intención de evaluar los efectos a largo plazo sobre una mayor competencia y conciencia global (global competency). Los entrevistados, seleccionados de entre 11 participantes, ya contaban con una perspectiva intercultural enriquecida y, como tal, sus experiencias iluminaron los profundos beneficios de las experiencias de estudios de corta duración en el extranjero. Las entrevistas fueron diseñadas para determinar si el principio de competencia global podía discernirse mediante dos criterios básicos: adquisición de conocimientos culturales y capacidad/deseo de observación minuciosa y de autorreflexión. Visto a través de las teorías de aprendizaje experiencial (experiential learning), este artículo explorará temas pedagógicos relacionados y destacará las cuestiones cognitivas en juego en un enfoque longitudinal de la investigación cualitativa. Abstract in German Ziel dieser fokussiert-qualitativen Studie war es, die Wahrnehmung von zwei städtischen Gymnasiasten über einen Studienaufenthalt im Ausland fünf Jahre später in der Rückschau zu erfassen, um so die langfristigen Auswirkungen einer solchen Erfahrung auf die Ausprägung globaler Kompetenz (global competency) und interkulturellen Bewusstseins zu bewerten. Die Befragten, die aus 11 TeilnehmerInnen ausgewählt wurden, verfügten bereits über eine vertiefte interkulturelle Perspektive. Ihre in dieser Studie beschriebenen Erfahrungen verdeutlichen die tiefgreifenden Vorteile von kurzen Studienaufenthalten im Ausland. Die Interviews wurden so gestaltet, dass bestimmt werden konnte, ob das Konzept der globalen Kompetenz anhand zweier grundlegender Kriterien - dem Erwerb kulturellen Wissens und der Fähigkeit zur genauen Beobachtung und Selbstreflexion - erkannt werden kann. Ausgehend von den Theorien des erfahrungsorientierten Lernens (experiential learning) untersucht dieser Artikel verwandte pädagogische Themen und weist auf eine Reihe kognitiver Fragen hin, die bei einem längsschnittigen Ansatz in der qualitativen Forschung von Relevanz sind.

APA, Harvard, Vancouver, ISO, and other styles

32

Lindsay, Robert, H. Roger Grant, Marsha L. Frey, John T. Reilly, James F. Marran, Victoria L. Enders, Benjamin Tate, et al. "Book Reviews." Teaching History: A Journal of Methods 14, no. 1 (May 5, 1989): 36–56. http://dx.doi.org/10.33043/th.14.1.36-56.

Full text

Abstract:

Martin K. Sorge. The Other Price of Hitler's War. German Military and Civilian Losses Resulting from World War II. Westport, CT: Greenwood Press, 1986. Pp. xx, 175. Cloth, $32.95; M. K. Dziewanowski. War At Any Price: World War II in Europe, 1939-1945. Englewood Cliffs, NJ: Prentice-Hall, 1987. Pp. xiv, 386. Paper, $25.67. Review by Lawrence S. Rines of Quincy Community College. David Goldfield. Promised Land: The South Since 1945. Arlington Heights, IL: Harlan Davidson, Inc., 1987. Pp. xiii, 262. Cloth, $19.95, Paper, $9.95; Alexander P. Lamis. The Two Party South. New York: Oxford University Press, 1984. Pp. x, 317. Cloth, $25.00; Paper, $8.95. Review by Ann W. Ellis of Kennesaw College. Walter J. Fraser, Jr., R. Frank Saunders, Jr., and Jon L. Wakelyn, eds. The Web of Southern Social Relations: Women, Family, and Education. Athens: University of Georgia Press, 1985. Pp. XVII, 257. Paper, $12.95. Review by Thomas F. Armstrong of Georgia College. William H. Pease and Jane H. Pease. The Web of Progress: Private Values and Public Styles in Boston and Charleston, 1828-1842. New York and Oxford: Oxford University Press, 1985. Pp. xiv, 334. Paper, $12.95. Review by Peter Gregg Slater of Mercy College. Stephen J. Lee. The European Dictatorships, 1918-1945. London and New York: Methuen, 1987. Pp. xv, 343. Cloth, $47.50; Paper, $15.95. Review by Brian Boland of Lockport Central High School, Lockport, IL. Todd Gitlin. The Sixties: Days of Hope, Days of Rage. New York: Bantam, 1987. Pp. 483. Cloth, $19.95; Maurice Isserman. IF I HAD A HAMMER... : The Death of the Old Left and the Birth of the New Left. New York: Basic Books, 1987. Pp. xx, 244. Cloth, $18.95. Review by Charles T. Banner-Haley of Martin Luther King, Jr. Center for Nonviolent Social Change, Inc. Donald Alexander Downs. Nazis in Skokie: Freedom, Community, and the First Amendment. Notre Dame IN: Notre Dame Press, 1985. Pp. 227. Paper, $9.95. Review by Benjamin Tate of Macon Junior College. Paul Preston, The Triumph of Democracy in Spain. London and New York: Methuen, 1986. Pp. 227. Cloth, $32.00. Review by Victoria L. Enders of Northern Arizona University. Robert B. Downs. Images of America: Travelers from Abroad in the New World. Urbana and Chicago: University of Illinois Press, 1987. Pp. 232. Cloth, $24.95. Review by James F. Marran of New Trier Township High School, Winnetka, IL. Joel H. Silbey. The Partisan Imperative: The Dynamics of American Politics Before the Civil War. New York and Oxford: Oxford University Press, 1985. Pp. viii, 234. Paper, $8.95. Review by John T. Reilly of Mount Saint Mary College. Barbara J. Howe, Dolores A. Fleming, Emory L. Kemp, and Ruth Ann Overbeck. Houses and Homes: Exploring Their History. Nashville: The American Association for State and Local History, 1987. Pp. xii, 168. Paper, $13.95; $11.95 to AASLH members. Review by Marsha L. Frey of Kansas State University. Thomas C. Cochran. Challenges to American Values: Society, Business and Religion. New York and Oxford: Oxford University Press, 1987. Pp. 147. Paper, $6.95. Review by H. Roger Grant of University of Akron. M.S. Anderson. Europe in the Eighteenth Century, 1713-1783. London and New York: Longman, 1987. Third Edition. Pp. xii, 539. Cloth, $34.95. Review by Robert Lindsay of the University of Montana.

APA, Harvard, Vancouver, ISO, and other styles

33

Drewes, G. W. J., Taufik Abdullah, Th End, T. Valentino Sitoy, R. Hagesteijn, David G. Marr, R. Hagesteijn, et al. "Book Reviews." Bijdragen tot de taal-, land- en volkenkunde / Journal of the Humanities and Social Sciences of Southeast Asia 143, no. 4 (1987): 555–613. http://dx.doi.org/10.1163/22134379-90003324.

Full text

Abstract:

- G.W.J. Drewes, Taufik Abdullah, Islam and society in Southeast Asia, Institute of Southeast Asian studies, Singapore, 1986, XII and 348 pp., Sharon Siddique (eds.) - Th. van den End, T.Valentino Sitoy, A history of Christianity in the Philippines. The initial encounter , Vol. I, Quezon City (Philippines): New day publishers, 1985. - R. Hagesteijn, David G. Marr, Southeast Asia in the 9th to 14th centuries, Singapore: Institute of Southeast Asian studies and the research school of Pacific studies of the Australian National University, 1986, 416 pp., A.C. Milner (eds.) - R. Hagesteijn, Constance M. Wilson, The Burma-Thai frontier over sixteen decades - Three descriptive documents, Ohio University monographs in international studies, Southeast Asia series No. 70, 1985,120 pp., Lucien M. Hanks (eds.) - Barbara Harrisson, John S. Guy, Oriental trade ceramics in South-east Asia, ninth to sixteenth century, Oxford University Press, Singapore, 1986. [Revised, updated version of an exhibition catalogue issued in Australia in 1980, in the enlarged format of the Oxford in Asia studies of ceramic series.] 161 pp. with figs. and maps, 197 catalogue ills., numerous thereof in colour, extensive bibliography, chronol. tables, glossary, index. - V.J.H. Houben, G.D. Larson, Prelude to revolution. Palaces and politics in Surakarta, 1912-1942. VKI 124, Dordrecht/Providence: Foris publications 1987. - Marijke J. Klokke, Stephanie Morgan, Aesthetic tradition and cultural transition in Java and Bali. University of Wisconsin, Center for Southeast Asian studies, Monograph 2, 1984., Laurie Jo Sears (eds.) - Liaw Yock Fang, Mohamad Jajuli, The undang-undang; A mid-eighteenth century law text, Center for South-East Asian studies, University of Kent at Canterbury, Occasional paper No. 6, 1986, VIII + 104 + 16 pp. - S.D.G. de Lima, A.B. Adam, The vernacular press and the emergence of modern Indonesian consciousness (1855-1913), unpublished Ph. D. thesis, School of Oriental and African studies, University of London, 1984, 366 pp. - J. Thomas Lindblad, K.M. Robinson, Stepchildren of progress; The political economy of development in an Indonesian mining town, Albany: State University of New York Press, 1986, xv + 315 pp. - Pauline Lunsingh Scheurleer, J.E. van Lohuizen-de Leeuw, Indo-Javanese Metalwork, Linden-Museum, Stuttgart, Staatliches Museum für Völkerkunde, 1984, 218 pp. - H.M.J. Maier, V. Matheson, Perceptions of the Haj; Five Malay texts, Singapore: Institute of Southeast Asian studies (Research notes and discussions paper no. 46), 1984; 63 pp., A.C. Milner (eds.) - Wolfgang Marschall, Sandra A. Niessen, Motifs of life in Toba Batak texts and textiles, Verhandelingen KITLV 110. Dordrecht/Cinnaminson: Foris publications, 1985. VIII + 249 pp., 60 ills. - Peter Meel, Ben Scholtens, Opkomende arbeidersbeweging in Suriname. Doedel, Liesdek, De Sanders, De kom en de werklozenonrust 1931-1933, Nijmegen: Transculturele Uitgeverij Masusa, 1986, 224 pp. - Anke Niehof, Patrick Guinness, Harmony and hierarchy in a Javanese kampung, Asian Studies Association of Australia, Singapore: Oxford University Press, 1986, 191 pp. - C.H.M. Nooy-Palm, Toby Alice Volkman, Feasts of honor; Ritual and change in the Toraja Highlands, Urbana and Chicago: University of Illinois Press, Illinois Studies in Anthropology no. 16, 1985, IX + 217 pp., 2 maps, black and white photographs. - Gert J. Oostindie, Jean Louis Poulalion, Le Surinam; Des origines à l’indépendance. La Chapelle Monligeon, s.n., 1986, 93 pp. - Harry A. Poeze, Bob Hering, The PKI’s aborted revolt: Some selected documents, Townsville: James Cook University of North Queensland. (Occasional Paper 17.) IV + 100 pp. - Harry A. Poeze, Biografisch woordenboek van het socialisme en de arbeidersbeweging in Nederland; Deel I, Amsterdam: Stichting tot Beheer van Materialen op het Gebied van de Sociale Geschiedenis IISG, 1986. XXIV + 184 pp. - S. Pompe, Philipus M. Hadjon, Perlindungan hukum bagi rakyat di Indonesia, Ph.D thesis Airlangga University, Surabaya: Airlangga University Press, 1985, xviii + 308 pp. - J.M.C. Pragt, Volker Moeller, Javanische bronzen, Staatliche Museen Preussischer Kulturbesitz, Museum für Indische Kunst, Berlin, 1985. Bilderheft 51. 62 pp., ill. - J.J. Ras, Friedrich Seltmann, Die Kalang. Eine Volksgruppe auf Java und ihre Stamm-Myth. Ein beitrag zur kulturgeschichte Javas, Stuttgart: Franz Steiner Verlag Wiesbaden GmbH, 1987, 430 pp. - R. Roolvink, Russell Jones, Hikayat Sultan Ibrahim ibn Adham, Berkeley: Center for South and Southeast Asia Studies, University of California, Monograph Series no. 57, 1985. ix, 332 pp. - R. Roolvink, Russell Jones, Hikayat Sultan Ibrahim, Dordrecht/Cinnaminson: Foris, KITLV, Bibliotheca Indonesica vol. 24, 1983. 75 pp. - Wim Rutgers, Harry Theirlynck, Van Maria tot Rosy: Over Antilliaanse literatuur, Antillen Working Papers 11, Caraïbische Afdeling, Koninklijk Instituut voor Taal-, Land- en Volkenkunde, Leiden, 1986, 107 pp. - C. Salmon, John R. Clammer, ‘Studies in Chinese folk religion in Singapore and Malaysia’, Contributions to Southeast Asian Ethnography no. 2, Singapore, August 1983, 178 pp. - C. Salmon, Ingo Wandelt, Wihara Kencana - Zur chinesischen Heilkunde in Jakarta, unter Mitarbeit bei der Feldforschung und Texttranskription von Hwie-Ing Harsono [The Wihara Kencana and Chinese Therapeutics in Jakarta, with the cooperation of Hwie-Ing Harsono for the fieldwork and text transcriptions], Kölner ethopgraphische Studien Bd. 10, Berlin: Dietrich Reimer Verlag, 1985, 155 pp., 1 plate. - Mathieu Schoffeleers, 100 jaar fraters op de Nederlandse Antillen, Zutphen: De Walburg Pers, 1986, 191 pp. - Mathieu Schoffeleers, Jules de Palm, Kinderen van de fraters, Amsterdam: De Bezige Bij, 1986, 199 pp. - Henk Schulte Nordholt, H. von Saher, Emanuel Rodenburg, of wat er op het eiland Bali geschiedde toen de eerste Nederlanders daar in 1597 voet aan wal zetten. De Walburg Pers, Zutphen, 1986, 104 pp., 13 ills. and map. - G.J. Schutte, W.Ph. Coolhaas, Generale missiven van Gouverneurs-Generaal en Raden aan Heren XVII der Verenigde Oostindische Compagnie, VIII: 1725-1729, Rijks Geschiedkundige Publicatiën, Grote Serie 193, ‘s-Gravenhage, 1985, 275 pp. - H. Steinhauer, Jeff Siegel, Language contact in a plantation environment. A sociolinguistic history of Fiji, Cambridge: Cambridge University Press, 1987, xiv + 305 pp. [Studies in the social and cultural foundations of language 5.] - H. Steinhauer, L.E. Visser, Sahu-Indonesian-English Dictionary and Sahu grammar sketch, Verhandelingen van het KITLV 126, Dordrecht: Foris Publications, 1987, xiv + 258 pp., C.L. Voorhoeve (eds.) - Taufik Abdullah, H.A.J. Klooster, Indonesiërs schrijven hun geschiedenis: De ontwikkeling van de Indonesische geschiedbeoefening in theorie en praktijk, 1900-1980, Verhandelingen KITLV 113, Dordrecht/Cinnaminson: Foris Publications, 1985, Bibl., Index, 264 pp. - Maarten van der Wee, Jan Breman, Control of land and labour in colonial Java: A case study of agrarian crisis and reform in the region of Ceribon during the first decades of the 20th century, Verhandelingen of the Royal Institute of Linguistics and Anthropology, Leiden, No. 101, Dordrecht: Foris Publications, 1983. xi + 159 pp.

APA, Harvard, Vancouver, ISO, and other styles

34

Rosidi, Rosidi, and Irwan Setiadi. "Peranan Anggota DPRD Provinsi DKI Jakarta Komisi E Dalam Menyerap Aspirasi Masyarakat Di Bidang Pendidikan." Jurnal Wahana Bina Pemerintahan 4, no. 2 (November 20, 2017): 198–219. http://dx.doi.org/10.55745/jwbp.v4i2.83.

Full text

Abstract:

This research was conducted to analyze and describe the role of the members of the Regional Representative Council (DPRD) of the DKI Jakarta Province E Commission 2014-2019 in absorbing the aspirations of the community in the field of education. The research method uses qualitative methods with a descriptive approach. Based on the results of the study that the role of the DKI Jakarta Provincial Parliament Member Commission E in absorbing community aspirations in the education sector still has to be optimized with efforts to intensify programs / activities carried out to the community intensively, so that the public can know the policies produced, and establish an information center and community service so that it can help facilitate the public in expressing their aspirations. School enrollment rates in Jakarta must be increased, the dropout rate at the Jakarta high school level is quite high. This large gap between regions indicates that there is still a need for encouragement for certain regions to be able to catch up with other regions. Because of the importance of the role of the DKI Jakarta Regional Representative Council (DPRD), especially Commission E in the field of community welfare, it is expected to be able to automate the use of IT technology in community management and services concerning community aspirations. Daftar PustakaA. Referensi BukuAmbar Teguh Sulistyani, Kemitraan dan Model-Model Pember-dayaan, Yogyakarta: Graha Ilmu, 2004.Budiarjo, Miriam, Pengertian – Pengertian Masyarakat, Jakarta: Rajawali Pers, 1992.C.S.T Kansil dan Christine S.T. Kansil, Sistem Pemerintahan Indonesia, Jakarta: PT. Bumi Aksara, Cetakan kedua, 2005.Chambers, R., Lembaga Penelitian, Pendidikan, Penerangan Ekonomi dan Sosial, Pembangunan Desa Mulai dari Belakang, Jakarta, 1995.Dahl, Robert Alan., On Democracy. Connecticut: Yale University Press, 1999.Deutsch, Karl W. et al., Comparative Government: Politics of Industrialised and Developing Nations, Boston: Houghton Mifflan, 1981.Dwiyanto, Agusdkk, Reformasi Tata Pemerintahan Dan Otonomi Daerah, Yogyakarta: PSKK-UGM, 2003.Freidmann J, Empowerment: The Politics of Alternative Development, Cambridge: Blacwell, 1992.Heywood, Andrew, Politics 4th edition, Terj. Ahmad Lintang Lazuardi, Yogyakarta: Pustaka Pelajar, 2013._______________, Politics, 2nd ed. New York: Palgrave, 2002.Hurlock, E. B. 1979. Personality Development. Second Edition. New Delhi :McGraw-Hill.Ife, Jim, Community Development: Creating Community Alternatives, Vision, Analysis & Practice, Australia: Logman,1995.Lasswell, Harold, The Structure and Function of Communication in Society, dalam Mass Communications, a Book of Readings Selected and Edited by the Director of the Institute for Communication Research at Stanford University, Editor: Wilbur Schramm, Urbana: University of Illinois Press, 1960. Malinowski, Bronislaw K., A Scientific Theory of Culture, New York: The University of North Carolina Press, 1944.Mas’oed, Mohtar., Politik, Birokrasi dan Pembangunan, Yogyakarta: Pustaka Pelajar. 2003.Miles, M. B. Dan Hubermen, A. M., Analisis Data Kualitatif Buku Sumber Sumber tentang Metode – Metode Baru, Alih Bahasa Tjetjep Rohendi Rohidi, Jakarta: UI-Press, 1984.Moh. Nazir, MetodePenelitian, Jakarta: Ghalia Indonesia, 1988.Nasikun, SistemSosial Indonesia, Jakarta: Penerbit Raja GrafindoPersada, 1995.Ndraha, Taliziduhu, Budaya Organisasi, Jakarta: Rineka Cipta, 2003_______________, Metodologi Ilmu Penelitian, Jakarta: PT. Rineka Cipta, 1997.Pamudji S, Kerjasama Antar Daerah Dalam Rangka Pembinaan Wilayah, Jakarta: Bina Aksara, 1985.Parson, et. Al, The Integration Of Social Work Practice, California Wardworth.inc., 1994.Prijono, O.S. dan Pranaka A.M.W.(ed), Pemberdayaan: Konsep, Kebijakan dan Implementasi, Jakarta: CSIS, 1996.Rappaport, J., Studies in empowerment: Introduction to the issue, prevention in human issue, New York, 1984.Rousseau, Jean Jacques, Kontrak Sosial, Terjemahan, Sumardjo, Jakarta: Erlangga, 1986.Slameto, Belajar dan Faktor-faktor yang Mempengaru-hinya. Jakarta: Rineka Cipta, 2003.Soekanto, Soerjono, Sosiologi Suatu Pengantar. Jakarta: Raja Grafindo Persada, 2007._______________, Sosiologi Suatu Pengantar. Jakarta: Rajawali Pers, 2012.Soetrisno, Loekman.,Menuju Masyarakat Partisipatif, Yogyakarta: Kanisius, 1995.Sugiyono, Memahami Penelitian Kualitatif. Bandung: Afabet, 2005.Suharto,Edi.,Membangaun Masyara-kat Memberdayakan Rakyat, Bandung: Refika Aditama, 2006. Suradinata, Ermaya, Peranan Kepala Wilayah Dalam Analisis Masalah dan Potensi Wilayah, Bandung: Ramadan, 1995._____________,Manajemen Sumber Daya Manusia. Bandung: CV Ramadhan, 1996._______________,Pemimpin dan Kepemimpinan Pemerintah Suatu Pendekatan Budaya, Jakarta: PT. Gramedia Pustaka Utama, 1997.Surbakti, Ramlan, Memahami Ilmu Politik, Jakarta: Gramedia Widya Sarana, 1992.Suyanto, Bagong, Metode Penelitian Sosial: Berbagai Alternatif Pendekatan, Jakarta: Prenada Media, 2005.Swift, C. dan G. Levin., Empowerment: An emerging mental health technology, New York: Journal of primary prevention,1987.Syafiie, Inu Kencana, Kepemimpinan Pemerintahan Indonesia, Bandung:Refika Aditama, 2003._______________,Sistem Pemerin-tahan Indonesia. Jakarta: Rineka Cipta, 2002.Tannen baum, R, et al, Partisipasi dan Dinamika Kelompok, Cetakan Pertama, Semarang: Dahara Pres, 1992.Walter S. Jones., Logika Hubungan Internasional; Kekuasaan, Ekonomi Politik Internasional dan Tatanan Dunia, Jakarta: PT. Gramedia Pustaka Utama, 1993. B. Dokumen Undang-Undang Dasar Negara Republik Indonesia 1945 Amandemen ke 4 tentang Hak dan Kewajiban Negara, Pasal 31 ayat (4)Undang-Undang Nomor 20 tahun 2003 pasal 1 Tentang Sistem Pendidikan Nasional, Pasal 49 ayat (1)Undang-Undang Nomor 32 Tahun 2004 tentang Pemerintah Daerah, Pasal 46.Undang-Undang Nomor 20 tahun 2003 pasal 1 Tentang Sistem Pendidikan Nasioal, Pasal 49.Undang-Undang Nomor 32 Tahun 2004 tentang Pemerintah Daerah, Pasal 46.Undang-Undang Negara Republik Indonesia Tahun 1945 tentang MPR, Pasal 3 ayat (1)Undang-Undang Negara Republik Indonesia Tahun 1945 tentang Presiden Republik Indonesia memegang kekuasaan Pemerintahan menurut Undang-undang Dasar, Pasal 4 ayat (1)Undang-Undang Negara Republik Indonesia Tahun 1945 tentang Dewan Perwakilan Rakyat memegang kekuasaan membentuk undang-undang, Pasal 20 ayat (1)Undang-Undang Negara Republik Indonesia Tahun 1945 tetang Kekuasaan kehakiman, Pasal 24 ayat (2).Undang-Undang Negara Republik Indonesia Tahun 1945 tentang pengelolaan dan tanggung-jawab tentang keuangan negara, Pasal 23 E ayat (1).Undang-Undang Negara Republik Indonesia Tahun 1945 tentang Otonomi Daerah, Pasal 18 ayat (1).Undang-Undang Nomor 17 Tahun 2014 tentang MPR, DPR, DPD, dan DPRD, Bab V DPRD Provinsi, dan pasal 217.Undang-Undang Nomor 23 Tahun 2014 tentang Pemerintah Daerah dan Tata Tertib DPRDPeraturan Pemerintah Nomor 25 Tahun 2004 tentang Pedoman Penyusunan Tata Tertib DPRD, Pasal 43.Putusan Mahkamah Konstitusi Nomor : 013/PUU-VI/2008, Perihal Pengujian UU No 15 Tahun 2008.Peraturan DPRD Provinsi DKI Jakarta No. 1 Tahun 2014 tentang Tata Tertib Anggota Dewan Perwakilan Rakyat Daerah.BPS Prov DKI Jakarta, Statistik Kesejahteraan Jakarta,2016. C. Internethttp://jakarta.bps.go.id/backend/pdf_publikasi/Jakarta-Dalam-Angka-2016.pdf http://dprd-dkijakartaprov.go.id/ http://peraturan.go.id/pp/nomor-25-tahun-2004 11e44c4edccf11e0b846313231373132.html

APA, Harvard, Vancouver, ISO, and other styles

35

Sims, Robert C., Darlene E. Fisher, Steven A. Leibo, Pasquale E. Micciche, Fred R. Van Hartesveldt, W. Benjamin Kennedy, C. Ashley Ellefson, et al. "Book Reviews." Teaching History: A Journal of Methods 13, no. 2 (May 5, 1988): 80–104. http://dx.doi.org/10.33043/th.13.2.80-104.

Full text

Abstract:

Michael B. Katz. Reconstructing American Education. Cambridge and London: Harvard University Press, 1987. Pp. viii, 212. Cloth, $22.50; E. D. Hirsch, Jr. Cultural Literacy: What Every American Needs to Know. Boston: Houghton Mifflin Co., 1987. Pp. xvii, 251. Cloth, $16.45; Diana Ravitch and Chester E. Finn, Jr. What Do Our 17-Year-Olds Know? A Report on the First National Assessment of History and Literature. New York: Harper & Row, 1987. Pp. ix, 293. Cloth, $15.95. Review by Richard A. Diem of The University of Texas at San Antonio. Henry J. Steffens and Mary Jane Dickerson. Writer's Guide: History. Lexington, Massachusetts, and Toronto: D. C. Heath and Company, 1987. Pp. x, 211. Paper, $6.95. Review by William G. Wraga of Bernards Township Public Schools, Basking Ridge, New Jersey. J. Kelley Sowards, ed. Makers of the Western Tradition: Portraits from History. New York: St. Martin's Press, 1987. Fourth edition. Vol: 1: Pp. ix, 306. Paper, $12.70. Vol. 2: Pp. ix, 325. Paper, $12.70. Review by Robert B. Luehrs of Fort Hays State University. John L. Beatty and Oliver A. Johnson, eds. Heritage of Western Civilization. Englewood Cliffs, New Jersey: Prentice-Hall, Inc., 1987. Sixth Edition. Volume I: Pp. xi, 465. Paper, $16.00; Volume II: pp. xi, 404. Paper, $16.00. Review by Dav Levinson of Thayer Academy, Braintree, Massachusetts. Lynn H. Nelson, ed. The Human Perspective: Readings in World Civilization. New York: Harcourt Brace Jovanovich, 1987. Vol. I: The Ancient World to the Early Modern Era. Pp. viii, 328. Paper, $10.50. Vol. II: The Modern World Through the Twentieth Century. Pp, x, 386. Paper, 10.50. Review by Gerald H. Davis of Georgia State University. Gerald N. Grob and George Attan Billias, eds. Interpretations of American History: Patterns and Perspectives. New York: The Free Press, 1987. Fifth Edition. Volume I: Pp. xi, 499. Paper, $20.00: Volume II: Pp. ix, 502. Paper, $20.00. Review by Larry Madaras of Howard Community College. Eugene Kuzirian and Larry Madaras, eds. Taking Sides: Clashing Views on Controversial Issues in American History. -- Volume II: Reconstruction to the Present. Guilford, Connecticut: The Dushkin Publishing Groups, Inc., 1987. Pp. xii, 384. Paper, $9.50. Review by James F. Adomanis of Anne Arundel County Public Schools, Annapolis, Maryland. Joann P. Krieg, ed. To Know the Place: Teaching Local History. Hempstead, New York: Hofstra University Long Island Studies Institute, 1986. Pp. 30. Paper, $4.95. Review by Marilyn E. Weigold of Pace University. Roger Lane. Roots of Violence in Black Philadelphia, 1860-1900. Cambridge, Massachusetts, and London: Harvard University Press, 1986. Pp. 213. Cloth, $25.00. Review by Ronald E. Butchart of SUNY College at Cortland. Pete Daniel. Breaking the Land: The Transformation of Cotton, Tobacco, and Rice Cultures since 1880. Urbana and Chicago: University of Illinois Press, 1985. Pp. xvi, 352. Paper, $22.50. Review by Thomas S. Isern of Emporia State University. Norman L. Rosenberg and Emily S. Rosenberg. In Our Times: America Since World War II. Englewood Cliffs, New Jersey: Prentice-Hall, 1987. Third edition. Pp. xi, 316. Paper, $20.00; William H. Chafe and Harvard Sitkoff, eds. A History of Our Time: Readings on Postwar America. New York: Oxford University Press, 1987. Second edition. Pp. xiii, 453. Paper, $12.95. Review by Monroe Billington of New Mexico State University. Frank W. Porter III, ed. Strategies for Survival: American Indians in the Eastern United States. New York, Westport, Connecticut, and London: Greenwood Press, 1986. Pp. xvi, 232. Cloth, $35.00. Review by Richard Robertson of St. Charles County Community College. Kevin Sharpe, ed. Faction & Parliament: Essays on Early Stuart History. London and New York: Methuen, 1985. Pp. xvii, 292. Paper, $13.95; Derek Hirst. Authority and Conflict: England, 1603-1658. Cambridge: Harvard University Press, 1986. Pp. viii, 390. Cloth, $35.00. Review by K. Gird Romer of Kennesaw College. N. F. R. Crafts. British Economic Growth During the Industrial Revolution. New York: Oxford University Press, 1985. Pp. 193. Paper, $11.95; Maxine Berg. The Age of Manufactures, 1700-1820. New York: Oxford University Press, 1985. Pp. 378. Paper, $10.95. Review by C. Ashley Ellefson of SUNY College at Cortland. J. M. Thompson. The French Revolution. New York: Basil Blackwell, 1985 reissue. Pp. xvi, 544. Cloth, $45.00; Paper, $12.95. Review by W. Benjamin Kennedy of West Georgia College. J. P. T. Bury. France, 1814-1940. London and New York: Methuen, 1985. Fifth edition. Pp. viii, 288. Paper, $13.95; Roger Magraw. France, 1815-1914: The Bourgeois Century. New York and Oxford: Oxford University Press, 1985. Pp. 375. Cloth, $24.95; Paper, $9.95; D. M.G. Sutherland. France, 1789-1815: Revolution and Counterrevolution. New York and Oxford: Oxford University Press, 1986. Pp. 242. Cloth, $32.50; Paper, $12.95. Review by Fred R. van Hartesveldt of Fort Valley State College. Woodford McClellan. Russia: A History of the Soviet Period. Englewood Cliffs, New Jersey: Prentice-Hall, 1986. Pp. xi, 387. Paper, $23.95. Review by Pasquale E. Micciche of Fitchburg State College. Ranbir Vohra. China's Path to Modernization: A Historical Review from 1800 to the Present. Englewood Cliffs, New Jersey: Prentice-Hall, 1987. Pp. xiii, 302. Paper, $22.95. Reivew by Steven A. Leibo of Russell Sage College. John King Fairbank. China Watch. Cambridge and London: Harvard University Press, 1987. Pp. viii, Cloth, $20.00. Review by Darlene E. Fisher of New Trier Township High School, Winnetka, Illinois. Ronald Takaki, ed. From Different Shores: Perspectives on Race and Ethnicity in America. New York and Oxford: Oxford University Press, 1987. Pp. 253. Paper, $13.95. Review by Robert C. Sims of Boise State University.

APA, Harvard, Vancouver, ISO, and other styles

36

Woolf, D. R. "Puritans, Politics, and Popular Culture in Seventeenth-Century BritainThe Road to Revolution: Scotland under Charles I, by Maurice Lee, Jr., Urbana and Chicago: University of Illinois Press, 1985, xvi, 259 pp., cloth. $29.95 U.S.Serving God and Mammon: William Juxon, 1582-1663, Bishop of London, Lord High Treasurer of England, and Archbishop of Canterbury, by Thomas A. Mason, Newark: University of Delaware Press, London and Toronto: Associated University Presses: 1985, 205 pp., cloth. $29.50 U.S.Dangerous Positions: Mixed Government, the Estates of the Realm, and the Answer to the xix Propositions, by Michael Mendle, University, Alabama: University of Alabama Press, 1985, x, 257 pp., cloth. $28.50 U.S.Popular Culture in Seventeenth-Century England, ed. Barry Reay, London and Sydney: Croom Helm, 1985,319 pp., cloth. $19.95.Schemes and Undertakings: a Study of English Politics in the Seventeenth Century, by Clayton Roberts, Columbus, Ohio: Ohio State University Press, 1985, vii, 333 pp., cloth. $35.00 U.S.Wallington’s World: a Puritan Artisan in Seventeenth-Century London, by Paul S. Seaver, Stanford, California: Stanford University Press, 1985, ix, 258 pp., cloth. $29.50 U.S." Canadian Journal of History 21, no. 2 (August 1986): 215–32. http://dx.doi.org/10.3138/cjh.21.2.215.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

McGee, Ben, null null, null null, and null null. "A Partnership Plan to Support High-Quality Instruction in Ohio’s Urban School Districts." Academic Leadership: The Online Journal, 2010. http://dx.doi.org/10.58809/hxsk5512.

Full text

Abstract:

Establishing work practices that allow for effective communication, collaboration, and negotiationsbetween state departments of education (DOEs) and their large urban districts is a significantundertaking in the national reform effort. The Ohio Department of Education (ODE) has had a uniqueopportunity to investigate how to establish an effective framework to build the necessary relationshipsbetween large urban districts and the supervising state educational agency (SEA) through fundsprovided by a Wallace Foundation grant and Harvard University’s leadership facilitation. The Wallacefunding and partnership with Harvard provided four of Ohio’s largest urban school districts with theresources and expertise to reflect and investigate how to best negotiate a productive relationshipbetween these elements in a system dedicated to shared work and a common mission.

APA, Harvard, Vancouver, ISO, and other styles

38

Goldman, Jennifer L., Jennifer E. Schuster, Vanessa F. Maier, Rohit Anand, Elizabeth E. Hill, Sabrina M. Butteris, Gregory P. DeMuri, et al. "Urban Classification, Not COVID-19 Community Rates, Was Associated With Modes of Learning in US K–12 Schools?" Pediatrics 149, Supplement_2 (February 1, 2022). http://dx.doi.org/10.1542/peds.2021-054268m.

Full text

Abstract:

OBJECTIVES To identify factors associated with the decision to provide in-person, hybrid, and remote learning in kindergarten through 12th grade school districts during the 2020–2021 school year. METHODS We performed a retrospective study evaluating school district mode of learning and community coronavirus 2019 (COVID-19) incidence and percentage positivity rates at 3 time points during the pandemic: (1) September 15, 2020 (the beginning of the school year, before Centers for Disease Control and Prevention guidance); (2) November 15, 2020 (midsemester after the release of Centers for Disease Control and Prevention guidance and an increase of COVID-19 cases); and (3) January 15, 2021 (start of the second semester and peak COVID-19 rates). Five states were included in the analysis: Michigan, Missouri, North Carolina, Ohio, and Wisconsin. The primary outcome was mode of learning in elementary, middle, and high schools during 3 time points. The measures included community COVID-19 incidence and percentage positivity rates, school and student demographics, and county size classification of school location. RESULTS No relationship between mode of learning and community COVID-19 rates was observed. County urban classification of school location was associated with mode of learning with school districts in nonmetropolitan and small metropolitan counties more likely to be in-person. CONCLUSIONS Community COVID-19 rates did not appear to influence the decision of when to provide in-person learning. Further understanding of factors driving the decisions to bring children back into the classroom are needed. Standardizing policies on how schools apply national guidance to local decision-making may decrease disparities in emergent crises.

APA, Harvard, Vancouver, ISO, and other styles

39

Beth Schlemper, M., Sujata Shetty, Owusua Yamoah, Kevin Czajkowski, and Victoria Stewart. "Culturally Responsive Teaching through Spatial Justice in Urban Neighborhoods." Urban Education, February 14, 2023, 004208592311534. http://dx.doi.org/10.1177/00420859231153411.

Full text

Abstract:

As part of a National Science Foundation (NSF)-funded project to create culturally responsive curriculum that uses critical spatial thinking and geospatial technologies to address spatial justice in urban neighborhoods, students from a predominantly African American inner-city public high school in Toledo, Ohio participated in two summer workshops in 2015 and 2016. Using a range of data sources including sketch maps, interviews, and neighborhood-based student projects, this paper addresses two research questions: (a) How did students’ spatial narratives of their community change as a result of using a culturally responsive teaching approach to explore neighborhood challenges? (b) How does a culturally responsive teaching approach and a critical geography perspective support spatial justice among youth?

APA, Harvard, Vancouver, ISO, and other styles

40

Davis, Kathleen M., and Joseph J. Muskin. "Engaging High School Students in University Research." MRS Proceedings 1320 (2011). http://dx.doi.org/10.1557/opl.2011.540.

Full text

Abstract:

ABSTRACTThe absence of engineering from K-12 curricula and mainstream media often causes students to refer back to historical stereotypes regarding what engineers look like and the type of work they do. Such misconceptions may prevent high school students from pursuing engineering as a field of study and increase the need for engineering educational programs [1]. Nano-Challenge is an outreach program that orients high school students to engineering through a one-year research internship. The program is held at the Center for Nanoscale Chemical, Electrical, Mechanical Manufacturing Systems (Nano-CEMMS) at the University of Illinois at Urbana-Champaign. A major focus of the program is to involve students from groups traditionally underrepresented in STEM fields and inform them about engineering earlier in their careers. An external program evaluation provides anecdotal information about the students’ experiences and gives feedback to inform program improvement.

APA, Harvard, Vancouver, ISO, and other styles

41

McMillian, Rachel. "Our Eyes are Watching God: Bearing Witness to Black Life and the Complexities of Black Joy on Death Row." Urban Education, January 22, 2024. http://dx.doi.org/10.1177/00420859241227949.

Full text

Abstract:

The purpose of this article is to paint a narrative in exploration of the following research question: What can we learn about Black life and Black Joy from the voices of those who are incarcerated? Utilizing the historical tradition of Black testimony, this article will explore this research question within the context of an urban high school book club co-led by Keith LaMar—a wrongfully convicted Black man currently on death row in Ohio. That said, this article aims to document the complexities of Black life and Black Joy in the midst of anti-Blackness by prompting readers to bear witness to the fullness and richness of Keith's life; a life that is irreducible to anti-Blackness or the tortures of prison.

APA, Harvard, Vancouver, ISO, and other styles

42

Craigmile, Peter F., Nathaniel Onnen, Elli Schwartz, Allison Glasser, and Megan E. Roberts. "Evaluating how licensing-law strategies will impact disparities in tobacco retailer density: a simulation in Ohio." Tobacco Control, August 21, 2020, tobaccocontrol—2020–055622. http://dx.doi.org/10.1136/tobaccocontrol-2020-055622.

Full text

Abstract:

ObjectivesTo assess tobacco licensing-law strategies (eg, restricting the sale of tobacco near schools, banning the sale of tobacco in pharmacies) in terms of the equity of their impact and ability to correct existing disparities in tobacco retailer density.MethodsWe geocoded all 11 392 tobacco retailers in Ohio, categorised neighbourhoods based on their demographic characteristics and calculated current disparities in tobacco retailer density. We next simulated the four main types of licensing-law strategies (capping-based, declustering-based, school-based and pharmacy-based), as well as strategy combinations. Finally, using statistical methods that account for residual spatial dependence, we evaluated how each strategy would impact density disparities.FindingsThe most impactful licensing-law strategy depended on the type of community. School-based reductions were equitable for low-income, African–American and urban neighbourhoods (eg, eliminating retailers from 1000 feet of all schools produced a 9.2% reduction in the log retailer rate for neighbourhoods with a low prevalence of African–Americans and a 17.7% reduction for neighbourhoods with a high prevalence of African–Americans). Conversely, capping-based reductions were equitable for rural neighbourhoods. Pharmacy-based reductions demonstrated inequitable impacts.ConclusionLicensing-law strategies could be a central tobacco control effort that benefits both the overall population and vulnerable communities. Policymakers will need to consider their community’s characteristics when selecting licensing-law strategies to correct (rather than inadvertently widen) density disparities. But when matched with the appropriate strategy, high-risk communities could remove over 20% of their tobacco retailers.

APA, Harvard, Vancouver, ISO, and other styles

43

Ikusika, Oluwafeyisayo Francis, Albert Faiva Zirra, Afamdi Iwuchukwu, Chukwuemeka Raymond Ngwu, and Farida Bappah. "UNMET PROSTHODONTIC NEEDS AND ORAL HEALTH RELATED QUALITY OF LIFE AMONG TRADERS IN AN URBAN KANO MARKET: A PILOT SURVEY." Nigerian Dental Journal 32, no. 2 (June 25, 2024). http://dx.doi.org/10.61172/ndj.v32i2.288.

Full text

Abstract:

ABSTRACT: Objectives: Prosthodontic needs may affect oral health quality of life among subsets of an urban population like traders in urban markets. This study therefore aimed to evaluate the impact of unmet prosthetic needs on Oral Health Related Quality of Life (OHRQoL) among traders in urban markets within Kano metropolis. Materials and Methods: Institutional Ethical approval was obtained. Study location was selected after a stratified sampling of available markets. A study proforma retrieving information on sociodemographic, prosthetic status and needs; and, the Oral Health Impact Profile-14 (OHIP-14) was administered on consenting participants. Retrieved data were summarized as frequencies, percentages and means. Prosthetic needs were quantified and assessed to derive patterns and odds ratios across participants sociodemographic characteristics. Rank Correlation and subgroup analyses were to assess the relationship between prosthetic need and OHIP-14 scores and how this is influenced by gender and age. Results: A total of 360 individuals participated in the study. There were 274 (76%) males and 86 (24%) females. Their ages ranged from 18 to 85 years with a mean age of 35.9 ± 14.8 years. A comparable percentage of participants were either married (48%), or had never been married (44.1%). Participants who identified as Muslim (84.7%) predominated, and Hausa/Fulani (69.4%) were the predominant ethnic identity. Many (48.1%) of participants had at least a secondary school level of education. About a fifth (79 or 21.9%) of the participants had a prosthodontic need. Unmet needs were present in 51(64.6%) of this segment of the participants. Females were more likely to have a prosthesis (OR = 2.01; 95% CI: 0.90, 4.74). Prostheses were more common among participants 50 years or older (OR=7.49; 95% CI:1.50, 37.29) and were about 3.5 times more likely to be found in individuals who had at least a secondary school education. Mean OHIP-14 scores was 1.3±3.9 in those without prosthetic needs and 13.1±12.7 for those with needs. Prosthetic need influenced OHIP=14 scores in all tested domains (p<0.001). Prosthetic needs correlated with OHIP-14 scores (rs=0.64, p<0.001). The correlation between prosthetic needs and OHIP-14 scores was stronger in females (p<0.001) and with increasing age (p<0.001). Conclusion: There was a high level of unmet prosthetic need within the studied population. Prosthetic need was inversely related to Oral Health Related Quality of Life. Increasing age and female gender were directly related to prosthetic needs and prosthetic status.

APA, Harvard, Vancouver, ISO, and other styles

44

"Projects: Office for Mathematics, Science, and Technology Education (MSTE), University of Illinois at Urbana-Champaign." Mathematics Teacher 96, no. 8 (November 2003): 607. http://dx.doi.org/10.5951/mt.96.8.0607.

Full text

Abstract:

“Building models for technology-intensive mathematics and science education reform” is the motto of this University of Illinois project, which was established by the chancellor's office of the university office nearly ten years ago. The many resources that the Office for Mathematics, Science and Technology Education (MSTE) has for teachers of grades K–16, especially for teachers of middle and high school grades, is readily apparent by going to its Web site, www.mste.uiuc.edu. Testimony to the popularity and usefulness of this site is its number of hits: it currently averages approximately 2.5 million hits per month and more than 200,000 user sessions. The vast majority of those users are classroom teachers, mostly in Illinois, but also located across the United States and around the world.

APA, Harvard, Vancouver, ISO, and other styles

45

Xu, Jie, Supawadee Naorungroj, Nuntiya Pahumunto, and Rawee Teanpaisan. "Prevalence and Associated Factors of Caries and Periodontal Diseases among Adolescents in Kunming: A Cross-sectional Study." Journal of Health Science and Medical Research, October 21, 2022. http://dx.doi.org/10.31584/jhsmr.2022903.

Full text

Abstract:

Objective: To investigate the prevalence of dental caries, and periodontal diseases among adolescents in urban high schools of Kunming and associated factors. Material and Methods: This cross-sectional survey enrolled 560 adolescents (17.3±0.5 years old), with an equal gender ratio. Self-administered questionnaires obtained the sociodemographic and behavioral variables. All subjects were examined for their clinical parameters; including, Decayed, Missing, and Filled Teeth (DMFT), the Simplified Oral Hygiene Index (OHI-S), bleeding on probing (BOP), probing depth (PD) and clinical attachment level (CAL) by two dentists. The correlations of explanatory variables with dental caries and periodontal disease outcomes were investigated using bivariate analysis; via chi-square and t-test. Multivariate regression analysis; including linear regression and logistic regression models, were investigated for related factors of dental caries and periodontal diseases. Results: The prevalence of caries was 72.5%, with a mean DMFT of 3.70±3.65. The DMFT of females was higher than males (p-value<0.001); approximately 12.3% were periodontal healthy. The prevalence of gingivitis and periodontitis was 80.4% and 7.3%, respectively; with no statistical difference between genders (p-value=0.221). Multivariate regression analysis showed that the prevalence of dental caries and periodontal diseases were associated with females and fair/ poor oral hygiene. Additionally, high sugar consumption was a significant risk predictor for dental caries (p-value=0.008). Conclusion: The high prevalence of dental caries and periodontal disease in Kunming urban high school adolescents were associated with females and oral hygiene. Therefore, it is necessary for them to pay more attention to their oral health, and to focus on improving the efficiency of oral hygiene behavior.

APA, Harvard, Vancouver, ISO, and other styles

46

La Grange, Adrienne, and Yung Yau. "Neighbourhood attachment and satisfaction: a Hong Kong’s case study." Open House International ahead-of-print, ahead-of-print (November 19, 2020). http://dx.doi.org/10.1108/ohi-04-2020-0009.

Full text

Abstract:

Purpose This paper aims to study neighbourhood attachment and satisfaction in a middle-class, high-density and semi-gated neighbourhood in Hong Kong. Design/methodology/approach Drawing on the findings of survey on 356 households, a principal component analysis and hierarchical regression analysis were conducted to assess how attachment and satisfaction were manifested and whether they were manifested as separate phenomena. Findings Attachment and satisfaction in neighbourhoods were manifested as separate phenomena. It was further found that residents were broadly attached to and satisfied with their neighbourhood. Of the neighbourhood characteristics identified as influencing satisfaction in previous research, the support was found only for the physical environment and safety but concluded that satisfaction was also influenced by status, neighbourhood youths’ ambition and schools. Contrary to the expectation, the authors did not find support for deeper social bonds as an element of satisfaction. The hierarchical regression analysis indicated that satisfaction may lead to increased attachment. Social implications This study offers policymakers and housing managers’ valuable insights into the management of increasingly large and complex residential neighbourhoods. It helps us understand which initiatives are likely to lead to greater attachment. Originality/value Previous studies have focused on neighbourhood attachment and satisfaction in typical low/medium-density settings. This study extends previous efforts to a high-density housing estate of Hong Kong.

APA, Harvard, Vancouver, ISO, and other styles

47

Saini, Preety, and Debapratim Pandit. "Factors influencing residential location choice: learnings from the Indian context." Open House International, August 22, 2023. http://dx.doi.org/10.1108/ohi-02-2023-0027.

Full text

Abstract:

PurposeThe purpose of the present study is to explore the factors that influence the residential location choice of households in the Indian context.Design/methodology/approachTwo sub-urban towns of Kolkata, i.e. Biddhanagar Municipal Corporation and Rajarhat Newtown, are taken as case studies. In total, 34 variables are considered related to the household's socioeconomic background (10), dwelling (3), travel (2) and level of importance of neighborhood characteristics (19). A revealed preference household survey is conducted, which resulted in the collection of 390 samples. Firstly, 19 level of importance variables are deduced to 3 latent factors using exploratory and confirmatory factor analysis. After that, a utility function is estimated using a multinomial logit regression to identify significant factors.FindingsThe results indicate the significance of car ownership, work travel time, work mode, monthly income, proximity to work, proximity to family/relative/friends, proximity to quality schools, quality of physical infrastructure such as water availability, power availability and housing typology among others in the residential location choice of households.Research limitations/implicationsKolkata, a major metropolitan area in eastern India, has been experiencing space constraints to cater to the housing demand of the ever-increasing population. Although satellite towns are being developed, the infrastructure landscape in such towns is uneven, resulting in more housing demand in one area than another. The study furnishes significant findings to develop more informed policies to attract households in low-demand areas and manage high-demand areas to achieve sustainable planning.Originality/valueConsidering the importance of geographical context, it is the first study on residential location choice, providing a perspective of household behavior from eastern India. It also shows the importance of physical infrastructure attributes in residential location choice for developing countries, which is seldom employed in the current practice. Moreover, previous studies (although few) done in India consider the objective value of location characteristics. The present study focuses on subjective value or the level of importance perceived by respondents.

APA, Harvard, Vancouver, ISO, and other styles

48

Liang, Xiaofan, Seolha Lee, Hanzhou Chen, Benjamin De la Peña, and Clio Andris. "Characteristics of Jetters and Little Boxes: An Extensibility Study Using the Neighborhood Connectivity Survey." Social Inclusion 10, no. 3 (June 21, 2022). http://dx.doi.org/10.17645/si.v10i3.5366.

Full text

Abstract:

Individuals connect to sets of places through travel, migration, telecommunications, and social interactions. This set of multiplex network connections comprises an individual’s “extensibility,” a human geography term that qualifies one’s geographic reach as locally‐focused or globally extensible. Here we ask: Are there clear signals of global vs. local extensibility? If so, what demographic and social life factors correlate with each type of pattern? To answer these questions, we use data from the Neighborhood Connectivity Survey conducted in Akron, Ohio, State College, Pennsylvania, and Philadelphia, Pennsylvania (global sample N = 950; in model n = 903). Based on the location of a variety of connections (travel, phone call patterns, locations of family, migration, etc.), we found that individuals fell into one of four different typologies: (a) hyperlocal, (b) metropolitan, (c) mixed‐many, and (d) regional‐few. We tested whether individuals in each typology had different levels of local social support and different sociodemographic characteristics. We found that respondents who are white, married, and have higher educational attainment are significantly associated with more connections to a wider variety of places (more global connections), while respondents who are Black/African American, single, and with a high school level educational attainment (or lower) have more local social and spatial ties. Accordingly, the “urban poor” may be limited in their ability to interact with a variety of places (yielding a wide set of geographic experiences and influences), suggesting that wide extensibility may be a mark of privileged circumstances and heightened agency.

APA, Harvard, Vancouver, ISO, and other styles

49

Gupta, Nisha R., and Darcy A. Freedman. "Food security moderates relationship between perceived food environment and diet quality among adults in communities with low access to healthy food retail." Public Health Nutrition, July 2, 2020, 1–12. http://dx.doi.org/10.1017/s1368980020001317.

Full text

Abstract:

Abstract Objective: To examine the relationship between food security status, diet quality measured using Healthy Eating Index-2010 (HEI-2010) scores, demographics and the following factors: perceptions of healthy food availability, healthy eating identity and perceived control of healthy eating. Design: A cross-sectional study in 2016–2017 using three 24-h dietary recalls and one psychosocial survey. Setting: Two urban communities in Cleveland and Columbus, Ohio, USA, with low access to healthy food retailers. Participants: Primary food shoppers living in the targeted geographic areas (N 450). Results: Our results indicated that high school graduates had lower HEI-2010 scores compared with participants who had some college education or more (β = –2·77, P = 0·02). Participants receiving Supplemental Nutrition Assistance Program (SNAP) benefits had lower HEI-2010 scores (β = –2·69, P = 0·03). Healthy eating identity was associated with higher HEI-2010 scores (β = 1·85, P = 0·004). Food security status moderated the relationship between perception of healthy food availability and HEI-2010 scores. Among participants with very low food security (VLFS), greater perceptions of healthy food availability were associated with higher HEI-2010 scores (β = 3·25, P = 0·03), compared with food secure participants. Only 14 % of VLFS participants used a personal vehicle as transportation to their primary food shopping store. Conclusions: Findings offer targets for future intervention development and evaluation to promote community nutrition. These targets include strategies to improve the value of SNAP benefits, promote access to quality education, increase transportation options to healthy food retailers and develop nutrition programming to promote healthy eating identity.

APA, Harvard, Vancouver, ISO, and other styles

50

Rubio Granda, Ana, María Fernández Miaja, Sara Delgado Nicolás, Ana Fernández Ibáñez, Mª Eugenia Llaneza Velasco, and Mª Agustina Alonso Álvarez. "Clinical and epidemiologic description of a severe outbreak of Salmonellosis in an urban nursery school." Revista Española de Quimioterapia, April 18, 2022. http://dx.doi.org/10.37201/req/134.2021.

Full text

Abstract:

Objectives. We describe clinically and epidemiologically an outbreak of gastrointestinal infection by Salmonella enterica ser. (serotype) Enteritidis in an urban infant school, which led to high morbidity and significant social alarm. The immediate communication, as well as the adequate study of the outbreak, in both aspects, allowed identifying the pathogen and establishing control measures in a reasonable period of time. Controversial aspects such as the indication of antibiotherapy or the moment of closing the center are discussed. Methods. We retrospectively collected clinical, analytical and epidemiological information and we reviewed the methodology of the outbreak study and its results. Results. A total of 57 children (3-45 months), were affected and had microbiological confirmation. Diarrhea and fever were the main symptoms. 74% went to the hospital and 37% were admitted (mean stay 3.3 days). Factors associated with admission were: dehydration, significant elevation of acute phase reactants and coagulopathy. Twelve patients received parenteral cefotaxime. There were 2 complications: 1 bacteremia and 1 readmission. The initial suspicion of the origin of the outbreak was food, but the analysis of the control samples was negative. Five workers were positive (2 symptomatic). Epidemiologic Surveillance concluded that the probable origin of the outbreak was an asymptomatic carrier and improper diapers handling. The center was closed for 8 days. Cleaning and disinfection measures were carried out, as well as instruction on diaper changing, and the carriers were followed. Conclusions. Clustering in time and space of cases should be reported immediately for early control of the outbreak. Children may present severe forms of Salmonella gastroenteritis.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Urbana High School (Urbana, Ohio)'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles