Journal articles on the topic 'United States. Crop Corps'
To see the other types of publications on this topic, follow the link: United States. Crop Corps.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'United States. Crop Corps.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Wolkoff, Adam. "Every Man His Own Avenger: Landlord Remedies and the Antebellum Roots of the Crop Lien and Chattel Mortgage in the United States." Law and History Review 35, no. 1 (December 5, 2016): 131–54. http://dx.doi.org/10.1017/s0738248016000511.
Full textAbstract:
The crop lien was more than a strange fruit of emancipation, a hard-fought compromise, or a pragmatic choice. Its legal logic rested on several generations’ experience with capitalist social relations in the antebellum North, where intense pressures on land use in urban cores and their agricultural hinterlands promoted contestation and experimentation in the ancient body of landlord–tenant law. Northerners designed the crop lien as a way to disentangle contract from property: to strip the lease of its common law guarantee of exclusive possession and shift the burden onto tenants to bargain for it.1
2
Isakeit, T., G. N. Odvody, and R. A. Shelby. "First Report of Sorghum Ergot Caused by Claviceps africana in the United States." Plant Disease 82, no. 5 (May 1998): 592. http://dx.doi.org/10.1094/pdis.1998.82.5.592a.
Full textAbstract:
In March 1997, ergot was found on sorghum (Sorghum bicolor (L.) Moench) regrowth in several abandoned commercial grain sorghum fields in Cameron and Hidalgo counties in the Lower Rio Grande Valley (LRGV) of Texas. White sphacelia in florets produced honeydew containing macrospores (hyaline, oblong to oval, 10 to 25 μm × 5 to 7 μm) and microspores (hyaline, spherical, 3 μm in diameter). Macrospores germinated iteratively to form secondary conidia when placed on water agar and in situ following rain. Secondary conidia were hyaline, pyriform, with a protruding hilum, and measured 10 to 17 μm × 5 to 7 μm. High-pressure liquid chromatography analysis detected the alkaloid di-hydroergosine in sphacelia, which is unique to C. africana (1). The pathogen was also confirmed on adjacent johnsongrass (S. halepense). The spread of ergot across Texas was associated with the progressive maturation of the commercial sorghum crop as follows: LRGV (mid-May), Coastal Bend near Corpus Christi (June), Winter Garden area southwest of San Antonio (July), and the seed production region of the Texas Panhandle (mid-August). Ergot incidence ranged from a trace to 10% of the heads in (self-fertile) grain sorghum fields of the LRGV. Most heads had only a few infected florets, but a few heads had 35 to 50% of the florets infected. Only trace amounts were found in grain sorghum fields in other areas of the state. Incidence and severity of ergot were greatest in fields of male-sterile sorghums grown for forage. Ergot was generally low in primary heads of male-sterile sorghums in hybrid seed production fields but, in the absence of pollen, axillary tillers sometimes developed high levels of ergot. The major impact of sorghum ergot is expected to be in hybrid seed production fields in the High Plains of Texas. Reference: (1) D. E. Frederickson et al. Mycol. Res. 95:1101, 1991.
3
Guaragna, M. A., J. Lamborn, D. Groth-Helms, S. Juszczak, D. Mollov, B. Lockhart, T. van Schadewijk, J. Hammond, and R. Jordan. "First Report of Nerine yellow stripe virus in Amaryllis in the United States." Plant Disease 97, no. 10 (October 2013): 1389. http://dx.doi.org/10.1094/pdis-11-12-1042-pdn.
Full textAbstract:
Ornamental flower bulbs (including true bulbs, bulbils, corms, tubers, and rhizomes) are increasingly important floriculture crops. Amaryllis is a small genus of flowering bulbs, with two species. The South African native, Amaryllis belladonna, also known as belladonna lily, Jersey lily, naked lady, Amarillo, or March lily, is one of numerous ornamental species with the common name “lily” due to their flower shape and growth habit. Amaryllis are popular for their 6- to 10-inch trumpet shaped colorful flowers that are borne on 1- to 2-foot stalks. In January, 2011, a home gardener in California observed mosaic symptoms on the leaves of A. belladonna growing in her garden. Leaf samples were sent to Agdia Inc. for testing. Samples tested positive for the presence of Potyvirus in a reverse transcription (RT)-PCR screen using universal potyvirus primers (2) yielding the expected ∼1,600-bp product corresponding to the partial nuclear inclusion body (NIb) gene, full-length coat protein (CP) gene, and 3′ end untranslated region (UTR). Electron microscopy of symptomatic leaves confirmed the presence of filamentous potyvirus-like particles. The RT-PCR amplicon was cloned and sequenced (2); the 1,616-bp consensus sequence was deposited in GenBank (Accession No. JX865782). NCBI BLAST analysis of the consensus sequence revealed highest identities with isolates of Nerine yellow stripe virus (NeYSV; family Potyviridae, genus Potyvirus). Pair-wise analyses of the 261 amino acid sequence of the predicted CP had 88% sequence identity with a Stenomesson isolate reported from the Netherlands (EU042758); 87% identity with Hymenocallis and Nerine isolates, both also from the Netherlands (EF362622 and EF362621, respectively); and, 86% with two New Zealand isolates infecting Amaryllis or Vallota (FJ618537 and DQ407932, respectively). The five Netherlands and New Zealand isolates are more closely related to each other than to the U.S. isolate as they share 93 to 98% CP identity. When using viral genome sequence relatedness as a criterion for defining potyvirus species, isolates with CP amino acid identity greater than 80% are considered the same species (1). The predicted coat protein gene of the California isolate was sub-cloned into the bacterial expression vector pET44 EK/LIC. Serological analysis of coat protein expressing clones in ELISA and Western Blot analysis using a potyvirus broad-spectrum reacting monoclonal antibody PTY-2 (3) and a NeYSV-specific rabbit antiserum (Applied Plant Research, Lisse, The Netherlands) resulted in positive reactions. NeYSV has previously been reported in the United Kingdom, the Netherlands, Australia, and New Zealand. Based on the results of electron microscopy, RT-PCR, nucleotide and amino acid identity, and serological reactivity, we identify this virus as a U.S. isolate of NeYSV, NeYSV-US. To our knowledge, this is the first report of Nerine yellow stripe virus in the United States. Development of antisera specific to this U.S. isolate is in progress. References: (1) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (2) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991.
4
Roberts, J. A., and L. P. Tredway. "First Report of Curvularia Blight of Zoysiagrass Caused by Curvularia lunata in the United States." Plant Disease 92, no. 1 (January 2008): 173. http://dx.doi.org/10.1094/pdis-92-1-0173b.
Full textAbstract:
Symptoms of an unknown foliar blight have been observed in zoysiagrass (Zoysia matrella, Z. japonica, and hybrids) landscapes in North Carolina since 2002. Disease activity is most common during spring and summer when temperatures are between 21 and 30°C. Affected leaves initially exhibit small, chocolate brown spots, followed by dieback of leaves from the tips, and eventually blighting of entire tillers. Symptoms appear in small, irregular patches as much as 15 cm in diameter, but numerous patches may coalesce to impact large sections of turf. Infected turf appears tan or brown from a distance, but often turns black during periods of wet or humid weather. Microscopic analysis revealed profuse sporulation of Curvularia spp. on the surface of symptomatic leaves. Leaf sections were surface disinfested in 10% Clorox for 1 to 2 min, blotted dry, then plated on potato dextrose agar (PDA) containing 50 mg/l of tetracycline, streptomycin, and chloramphenicol. Twenty-eight fungal isolates were obtained from six locations. Examination of conidia produced in culture revealed 21 isolates of Curvularia, two isolates of Drechslera, one isolate of Nigrospora, and four unidentified sterile fungi. Curvularia isolates were identified to species on the basis of morphological characteristics (1) and ITS-rDNA sequences. Known isolates of C. eragrostidis, C. geniculata, C. inequalis, C. lunata, C. pallescens, and C. trifolii were obtained from the American Type Culture Collection for comparison. All unknown isolates produced conidia that were characteristic of C. lunata (lacking a protuberant hilum, smooth walled, tri-septate, predominantly curved, and mid- or dark brown, average dimensions 17 to 25 × 8 to 12 μm). Colonies on PDA lacked stroma or the zonate appearance indicative of C. lunata var. aeria. The pathogenicity of C. lunata isolates was tested on zoysiagrass cvs. El Toro (Z. japonica) and Emerald (Z. japonica × matrella). Cores (11.4 cm in diameter) of established zoysiagrass were potted in calcined clay (Turface Allsport; Profile Products LLC, Buffalo Grove, IL), and transferred to a greenhouse where the average temperature was 26°C. Five isolates were selected to represent the geographic range of Curvularia blight in North Carolina, and conidia were produced on PDA under continuous fluorescent illumination. Each isolate was inoculated to one pot of each zoysiagrass variety by spraying with 25 ml of a suspension containing 2 × 105 conidia/ml with an airbrush. Inoculated pots were placed in a sealed, nontransparent plastic container for 48 h at 28°C to encourage infection and then transferred back to the greenhouse bench. Pathogenicity tests were repeated four times over time. Isolates ZFB3 and ZFB28 were most virulent with initial symptoms of foliar dieback appearing within 1 week after inoculation. Continued disease progress resulted in necrosis of the entire plant. Other isolates induced symptoms within 2 to 3 weeks after inoculation; however, disease severity was lower as compared with ZFB3 and ZFB28 throughout each experiment. Cvs. Emerald and El Toro were equally susceptible to infection by C. lunata. To our knowledge, this is the first report of Curvularia blight of zoysiagrass in the United States. This disease was previously described in Japan where it is commonly referred to as ‘dog footprint’ (3) and Brazil (2). References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (2) F. B. Rocha et al. Australas. Plant Pathol. 33:601, 2004. (3) T. Tani and J. B. Beard. Color Atlas of Turfgrass Diseases. Ann Arbor Press, Chelsea, MI, 1997.
5
Sandoya, Germán, Abbas Lafta, and Beiquan Mou. "Heat-tolerant Lettuce Germplasm (Lactuca sativa L.) Identified in Romaine and Butterhead Types for Warmer Plantings." HortScience 59, no. 2 (February 2024): 151–63. http://dx.doi.org/10.21273/hortsci17368-23.
Full textAbstract:
Warmer temperatures during crop production are not desirable for a cool-season crop such as lettuce (Lactuca sativa L.). Lettuce is among the top 10 most consumed vegetables in the United States. Production of this vegetable is concentrated mostly in temperate areas of California, and during the wintertime in Arizona and Florida as a result of their mild climatic conditions. Heat-tolerant cultivars are needed for the leafy vegetable industry to continue thriving. However, there is very little information on heat-tolerant germplasms of lettuce that can be used as a source to improve heat tolerance in lettuce. This is particularly important in romaine and butterhead lettuce, which are two morphological types with increasing demand in the market. Therefore, research was conducted to identify germplasm that performs acceptably in warmer regions in the western United States. This investigation also aimed to understand the reaction of varieties to different environments, which could help plant breeders select and evaluate lettuce plants during the breeding process. Twenty-three and 25 accessions of romaine and butterhead lettuce, respectively, were planted in five trials near Holtville, CA, USA: Five Points, CA, USA, under warmer temperatures and Salinas, CA, USA, under cooler temperatures. Romaine genotypes Bambi, Blonde Lente a Monter, Medallion MT, and Red Eye Cos; and butterhead genotypes Butter King and Margarita had no bolting, an acceptable head weight, short cores, and acceptable head height. Head weight and related traits (including core length, height, width, etc.) and heat-related disorders were significantly different across multiple experiments, indicating genetic variation. The major component of the phenotypic variation in these experiments was a result of environmental factors. Therefore, plant breeders may still need to evaluate progeny in multiple trials and multiple locations to select heat-tolerant romaine and butterhead lettuce effectively.
6
Wintermantel, W. M., and D. Bachinsky. "First Report of Moroccan pepper virus in Association with Yellows on Escarole in the United States and the World." Plant Disease 98, no. 10 (October 2014): 1448. http://dx.doi.org/10.1094/pdis-04-14-0394-pdn.
Full textAbstract:
During the fall of 2013, endive (Cichorium endivia L.) and escarole (C. endivia ssp. latifolia) fields in New Jersey were found with severe disease symptoms. The cores of the heads were necrotic and rotted, while outer leaves were yellow with more pronounced yellowing of veins and occasional veinal necrosis. The disease occurred in plants grown in sandy loam soils, and developed following a period of extended soil moisture; most escarole and endive in the ground at that time developed symptoms. Similar symptoms have been observed for 15 to 20 years in the area and are commonly referred to as yellows. Initial ELISA tests (Agdia) identified tombusvirus infection in two composite samples of 10 plants each from two fields. To confirm tombusvirus infection and determine which tombusvirus was responsible, RNA was extracted from four plant samples using the RNeasy Plant Mini Kit (Qiagen). Complimentary DNA was synthesized using Maxima reverse transcriptase (Fermentas) and random primers. PCR was performed using GenScript enzymes (Genscript) and virus species specific primer sets designed to amplify a portion of the coat protein gene of either Tomato bushy stunt virus (TBSV) or Moroccan pepper virus (MPV) (2,3), the two tombusviruses responsible for a disease of lettuce that develops under similar environmental conditions. All samples tested negative for TBSV, but one sample of escarole was positive for MPV using primers MPVcp2766F 5′ CGGTAAGATTGTAGGGTTCATGGTGG 3′; and MPVcp3603R 5′ TGCTCCAGTGTCACGGAAGT 3′, which amplify an 837-nt section of the MPV coat protein gene. Direct sequencing confirmed 94% identity with an isolate of MPV from Japan (AB704411) and 97% identity to isolates from Morocco (JX197071) and California (JN700748) (3). Secondary confirmation was obtained with an additional primer set designed to amplify a 372-nt region of ORF1 of select tombusviruses (Tombus270F 5′ TGAGATACATGAGGACAGG 3′; and Tombus642R 5′ AGCTTAAATACCGACAGTT 3′). Direct sequencing confirmed 96 (AB704411) to 99% (JX197071) identity to MPV isolates from Japan and Morocco, respectively. Eight additional samples of symptomatic escarole from three farms were tested, and two samples reacted positive to MPV using the methods described above. Attempts at mechanical transmission of virus from escarole to known hosts of MPV were unsuccessful; however, transmission of MPV from infected lettuce (Lactuca sativa L.) is often low efficiency as well; therefore, this result was not surprising. To our knowledge, this is the first report of MPV in escarole anywhere in the world, and the first report of MPV in a United States field crop outside of California and Arizona. MPV and TBSV are known to cause the disease, lettuce dieback, in the western United States. Like yellows on escarole, lettuce dieback is associated with saturated soils (1) and other stress factors (Wintermantel, unpublished). Further studies will be needed to determine if MPV is the sole cause of yellows in escarole and endive or if it is part of a disease complex; however, the identification of MPV in this important leafy greens production region and its association with yellowing and core rot symptoms in escarole warrant further study of the association of MPV and potentially other tombusviruses with yellows of escarole. References: (1) C. Obermeier et al. Phytopathology 91:797, 2001. (2) W. M. Wintermantel and A. G. Anchieta. Arch. Virol. 157:1407, 2012. (3) W. M. Wintermantel and L. L. Hladky. Phytopathology 105:501, 2013.
7
Odvody, G. N., D. T. Rosenow, and M. C. Black. "First Report of Ramulispora sorghicola in the United States Causing Oval Leaf Spot on Johnsongrass and Sorghum in Texas." Plant Disease 90, no. 1 (January 2006): 108. http://dx.doi.org/10.1094/pd-90-0108a.
Full textAbstract:
Oval leaf spot (OLS) caused by Ramulispora sorghicola Harris was observed on grain sorghum, Sorghum bicolor (L.) Moench, and johnsongrass, S. halepense (L.) Pers., near Beeville, TX during August 2002. Symptoms were first observed on several sorghum lines and hybrids in a field nursery including a bulk planting of the line ATx623. Highest incidence of OLS occurred in rows adjacent to johnsongrass with symptoms of OLS. Average lesion size (mm) was 1.3 × 2.8 with a range from 0.5 to 2.5 × 1.5 to 5.0. Lesions had a straw-colored sunken center and on red- and purple-pigmented sorghums, lesion borders were highly pigmented. Cone-shaped conidial masses and superficial sclerotia (subglobose, black, 80 to 190 μm in diameter × 50 to 70 μm high, with spiny setae) were sometimes present or readily produced on lesions within 48 to 72 h after placement in humidity chambers. Conidia were branched, filiform, tapered, and 1.1 to 2.4 × 20 to 75 μm. The pathogen, R. sorghicola, was isolated from conidia and sclerotia. A water suspension of culturally derived conidia of R. sorghicola (3 × 104 conidia per ml) was spray inoculated (5:30 p.m., October 11, 2002) onto four or more upper leaves per plant of six grain sorghum plants (ATx623) and approximately nine johnsongrass plants (three tillers each of three plants) at a Corpus Christi field location where OLS was absent. Three grain sorghum and one johnsongrass plant were sprayed with a water control. Cloudy, wet, and cool conditions after inoculation and increasingly cooler nights probably delayed symptom expression until 3 to 4 weeks after inoculation. Typical lesions were observed simultaneously on both hosts with symptoms restricted to inoculated plants. Lesions from both hosts were placed onto water agar at 25°C for 24 h, and the pathogen was reisolated from field-produced conidia of rehydrated conidial masses. Through 2004, OLS was observed on sorghum hosts in 29 counties from central Texas to the Lower Rio Grande Valley. During the growing season, OLS was predominantly absent in grain and forage sorghum fields and absent or often difficult to detect in johnsongrass. In all 3 years, OLS was most common after the normal growing season from August through December with occurrence primarily on johnsongrass but also on late-planted and feral S. bicolor hosts, especially when proximal to symptomatic johnsongrass. Presence and incidence of OLS was highly variable between and within stands of johnsongrass with incidence ranging from a few to most plants. Incidence in forage or grain sorghum fields was highest at field borders adjacent to johnsongrass with OLS. Disease severity was low except on johnsongrass at a few locations. The pathogen appears to pose low economic risk to any sorghum host in Texas at any time of the year although highly susceptible lines and hybrids should be identified and possibly avoided. The previous most proximal report of R. sorghicola in the Western Hemisphere was in Honduras (1). The widespread distribution of OLS across southern Texas and its pattern of occurrence in johnsongrass suggest that the pathogen may have been unobserved in Texas for several years. Presence of OLS near the Rio Grande indicates probable occurrence in johnsongrass at least in some areas along this river in northeastern Mexico. Reference: (1) G. C. Wall et al. Trop. Pest Manag. 35:57, 1989.
8
Iriarte, F. B., H. C. Wetzel, J. D. Fry, D. L. Martin, and N. A. Tisserat. "Genetic Diversity and Aggressiveness of Ophiosphaerella korrae, a Cause of Spring Dead Spot of Bermudagrass." Plant Disease 88, no. 12 (December 2004): 1341–46. http://dx.doi.org/10.1094/pdis.2004.88.12.1341.
Full textAbstract:
The distribution of three Ophiosphaerella spp. that cause spring dead spot (SDS) of bermudagrass was studied by sampling at 24 locations in the southeastern United States. O. korrae was isolated from 73% of the 204 bermudagrass cores collected and was the only SDS pathogen recovered at most sites. O. herpotricha was isolated at three locations in Kentucky and one in North Carolina, and O. narmari was found at two locations in North Carolina. Most O. korrae isolates collected from Alabama, Kentucky, Mississippi, Tennessee, and Virginia clustered in an amplified fragment length polymorphism group (AFLP group II) that was distinct from Kentucky bluegrass isolates collected throughout North America and similar to bermudagrass isolates from Kansas and Oklahoma (AFLP group I). A third AFLP group (III) consisting of bermudagrass isolates from Mississippi and Virginia was identified. Isolates representing AFLP groups II and III grew more rapidly on potato dextrose agar at 25 and 30°C than those in group I. O. korrae isolates differed in their aggressiveness to two bermudagrass cultivars in greenhouse studies, but these differences were not associated with AFLP group, location, or host from which the isolate was collected.
9
McGroary, P. C., J. L. Cisar, R. M. Giblin-Davis, O. F. Ruiz, and E. J. Nangle. "First Report of Plant-Parasitic Nematodes on Seashore Paspalum (Paspalum vaginatum) in Barbados." Plant Disease 98, no. 7 (July 2014): 1018. http://dx.doi.org/10.1094/pdis-08-13-0832-pdn.
Full textAbstract:
Seashore paspalum (Paspalum vaginatum Swartz) is a warm-season perennial turfgrass commonly used for golf courses that are grown in saline environments or using saline water for irrigation. However, seashore paspalum is also grown in non-saline conditions due to its low fertilizer and water requirements (2). In Barbados, on a newly constructed golf course, seashore paspalum ‘Sea Isle Supreme’ sprigs were imported from Georgia (United States) and were planted over 2006 and 2007 on greens, tees, fairways, and rough. Golf greens were constructed following the United States Golf Association Green Section (Far Hills, NJ) putting green guidelines. Tees and fairways were constructed using native soil. Two years after the grow-in, the putting greens began to exhibit irregular chlorotic patches, followed by gradual thinning and decline of turfgrass stand density in those areas. Additionally, turfgrass roots sampled from those symptomatic patches appeared to be abbreviated compared to non-symptomatic areas of the greens. A survey was conducted in May 2013 to determine if plant-parasitic nematodes were present coinciding with the observed symptoms, which were similar to those described in a previous report (3). Consequently, two samples were collected from each green with a total of four greens sampled. Each sample consisted of 20 soil cores (15 cm depth × 1.2 cm in diameter) from either areas of the greens showing symptoms or from non-symptomatic areas. Nematodes were extracted from 100 cm3 soil samples using a modified centrifugal-sugar flotation technique (4). No plant parasitic nematodes were present in any of the samples from the non-symptomatic areas. Three genera of plant parasitic nematodes were found in all the samples from the symptomatic areas: Helicotylenchus. Mesocriconema, and Pratylenchus. Nematode populations of these genera averaged 30, 60, and 200 nematodes per 100 cm3, respectively. Populations of the genera Helicotylenchus and Mesocriconema were below the action threshold levels for seashore paspalum used by the University of Florida Nematode Assay Laboratory (1). Currently, no threshold exists for Pratylenchus for seashore paspalum. Conversely, the genera Helicotylenchus. Mesocriconema, and Pratylenchus were found associated with the irregular chlorotic patches but not with the non-symptomatic areas. To our knowledge, this is the first report of plant parasitic nematodes associated with seashore paspalum maintained as putting greens in Barbados. References: (1) W. T. Crow. Nematode management for golf courses in Florida. EDIS. Accessed 31 July 2013 from: http://edis.ifas.ufl.edu/in124 , 2001. (2) R. R. Duncan and R. N. Carrow. Seashore Paspalum: The Environmental Turfgrass. John Wiley & Sons, Inc., Hoboken, New Jersey, 2000. (3) A. C. Hixson and W. T. Crow. Plant Dis. 88:680, 2004. (4) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964.
10
Peterson, Anne Palmer. "Academic conceptions of a United States Peace Corps." History of Education 40, no. 2 (March 2011): 229–40. http://dx.doi.org/10.1080/0046760x.2010.526966.
Full text
11
Alexander, Joseph H., and Harry A. Gailey. "Historical Dictionary of the United States Marine Corps." Journal of Military History 63, no. 3 (July 1999): 718. http://dx.doi.org/10.2307/120511.
Full text
12
Tisserat, N., H. Wetzel, J. Fry, and D. L. Martin. "Spring Dead Spot of Buffalograss Caused by Ophiosphaerella herpotricha in Kansas and Oklahoma." Plant Disease 83, no. 2 (February 1999): 199. http://dx.doi.org/10.1094/pdis.1999.83.2.199d.
Full textAbstract:
Buffalograss (Buchloe dactyloides) is widely planted in the Great Plains region of the United States as an amenity turfgrass. In May 1993, we observed circular dead spots in buffalograss lawns that were resuming growth following winter dormancy. The dead spots, 12 to 40 cm in diameter, were slowly filled in by buffalograss during the summer but reappeared in the same locations the following spring. Roots and stolons at the patch margins were colonized by darkly pigmented, ectotrophic fungal hyphae. Ophiosphaerella herpotricha, a cause of spring dead spot disease of bermudagrass (Cynodon spp.), was consistently isolated from diseased buffalograss roots collected in Kansas and Oklahoma. Identification of O. herpotricha was confirmed by the use of species-specific polymerase chain reaction (PCR) primers. To complete Koch's postulates, a 3-year-old stand of buffalograss cv. Sharp's Improved located in Manhattan, KS, was inoculated in September 1994 with O. herpotricha. Eleven soil cores, 10 cm in diameter × 8 cm deep, were removed at 1.2-m intervals across the turf. Five grams of oat seed infested with O. herpotricha (isolate KS221) wasadded to each hole and the soil plug was reinserted. For controls, 5 g of sterile oat seed was inserted in the bottom of each of 11 additional holes. No symptoms developed the following spring, but circular dead spots, ranging in size from 18 to 43 cm in diameter, were observed at 10 of 11 and 6 of 11 inoculation sites in May 1996 and 1997, respectively. No spots were noted in areas amended with sterile oats. O. herpotricha was consistently isolated from the roots at the margins of the patches. This is the first report of O. herpotricha causing spring dead spot in buffalograss.
13
Crossley, Scott, Yu Tian, Perpetual Baffour, Alex Franklin, Youngmeen Kim, Wesley Morris, Meg Benner, Aigner Picou, and Ulrich Boser. "The English Language Learner Insight, Proficiency and Skills Evaluation (ELLIPSE) Corpus." International Journal of Learner Corpus Research 9, no. 2 (December 31, 2023): 248–69. http://dx.doi.org/10.1075/ijlcr.22026.cro.
Full textAbstract:
Abstract This paper introduces the open-source English Language Learning Insight, Proficiency and Skills Evaluation (ELLIPSE) corpus. The corpus comprises ~6,500 essays written by English language learners (ELLs). All essays were written during state-wide standardized annual testing in the United States. The essays were written on 29 different independent prompts that required no background knowledge on the part of the writer. Individual difference information is made available for each essay including economic status, gender, grade level (8–12), and race/ethnicity. Each essay was scored by two trained human raters for English language proficiency including an overall score of English proficiency and analytic scores for cohesion, syntax, vocabulary, phraseology, grammar, and conventions. The paper provides reliability on the human judgments of proficiency reported for the corpus. The ELLIPSE corpus addresses many of the concerns found in existing learner corpora including unique holistic and analytic scores for each ELL essay. The corpus also includes limited demographic and individual difference data for each ELL.
14
Ye, Long, Zhihua Liao, and Yuanyuan Yu. "How Peace Corps volunteers influence the United States: an analysis based on pragmatism." Trans/Form/Ação 46, spe (2023): 185–204. http://dx.doi.org/10.1590/0101-3173.2023.v46esp.p185.
Full textAbstract:
Abstract: From the perspective of pragmatic diplomatic philosophy, Peace Corps can benefit the United States, which is an important reason for the domestic support it receives within the United States. Through the volunteers’ acculturation experience, cultural exchanges between the United States and host countries are promoted and the awareness of the American society about the Third World countries is raised, which is the true value of the Peace Corps from the perspective of American interests. As members of American society, Peace Corps volunteers gain a comprehensive and in-depth understanding of the Third World in their host countries, which is not only an important part of improving the awareness of the American society the Third World, but is also an important bridge to spread this awareness in the United States. When volunteers return to the United States after finishing their service, they bring their understanding of the Third World to different industries and fields in American domestic society. Among them, American education and diplomacy are mostly affected. These are of great significance in improving the international vision and awareness of American education and the reliability of American foreign policy.
15
Yeadon, Steven. "The Problems Facing United States Marine Corps Amphibious Assaults." Journal of Advanced Military Studies 11, no. 2 (December 16, 2020): 141–73. http://dx.doi.org/10.21140/mcuj.20201102008.
Full textAbstract:
There are calls by some experts to accept that an amphibious assault of coastline is simply too risky to attempt due to current threats. So, what are the challenges facing amphibious assaults? Is the amphibious assault still a viable type of military operation in the current threat environment? These questions are at the heart of the mission and role of the United States Marine Corps. This analysis delves deep into the problems facing amphibious assaults, and it serves as a primer for future discussions pertaining to improving amphibious assault capabilities.
16
Connor, Joseph P., Robert B. Teweles, and William P. Cruse. "Leader Development in the United States Army Dental Corps." Military Medicine 155, no. 10 (October 1, 1990): 465–68. http://dx.doi.org/10.1093/milmed/155.10.465.
Full text
17
Krulak, Charles C. "The United States marine corps in the 21st century." RUSI Journal 141, no. 4 (August 1996): 23–26. http://dx.doi.org/10.1080/03071849608446045.
Full text
18
Callahan, Clark, and Jessica Hess. "Experiences of deculturation among United States Peace Corps volunteers." Journal of International Communication 18, no. 1 (April 2012): 49–62. http://dx.doi.org/10.1080/13216597.2012.662167.
Full text
19
Andrews, S. "3 Commando Brigade - United States Marine Corps medical interoperability." Journal of The Royal Naval Medical Service 105, no. 2 (2019): 89–94. http://dx.doi.org/10.1136/jrnms-105-89.
Full textAbstract:
AbstractThis article describes a study investigating the medical interoperability of 3 Commando Brigade (3 Cdo Bde) with the US Marine Corps (USMC), predominately in the Role 2 and overarching Command and Control domain. This was conducted over two main exercise periods in 2017. The information was gathered through coalition casualty serials, face to face interviews, attendance at US training courses and visits to US facilities.The operational patient care pathways are broadly interoperable. There is no critical factor that would prevent medical interoperability between 3 Cdo Bde and the USMC if medical treatment facilities were required to deploy on imminent operations.
20
Pierce, Katherine E., David Broderick, Scott Johnston, and Kathryn J. Holloway. "Embedded Mental Health in the United States Marine Corps." Military Medicine 185, no. 9-10 (June 9, 2020): e1499-e1505. http://dx.doi.org/10.1093/milmed/usaa076.
Full textAbstract:
Abstract Introduction Despite the rich history and progression of mental health assets and their utilization within the Marine Corps, the implementation of these assets has been varied and inconsistent. This article strives to take the lessons learned from the past and improve on them. The goal is to develop a consistent program focused on resiliency and retention, and propose an integrated organized structure across all the Marine Expeditionary Forces (MEF). Means and Methods Review of the literature, current practices, and future recommendations. Results This article demonstrates that continuing to utilize mental health resources at the Regimental level with a focus on community mental health principles rather than the medical model allows for proximity to members and leadership of their primary command, immediate access to them as their Special Staff Officer, the ability to set the expectation of recovery, resiliency, and readiness, and the capability to implement simple principles of nonmedical recuperation and advisement. Conclusions Improving on the organizational structure of mental health in the Marine Corps by placing a mental health Special Staff Officer at the MEF level and focusing on the principles of community mental health will shift the focus back to the primary and secondary prevention care efforts across all levels of the Marine Corps and provide clinical and leadership oversight as it relates to the philosophy, role, and implementation of organic mental health Officers.
21
Kester, Wayne O. "United States Air Force Veterinary Corps: 1949 to 1980." Journal of the American Veterinary Medical Association 203, no. 1 (July 1, 1993): 28–34. http://dx.doi.org/10.2460/javma.1993.203.01.28.
Full text
22
Sumter, Jeffery L., Jill Roberts, Adrienne Goodrich-Doctor, and Thomas J. Mason. "Ebola Response: A study of the Psychosocial Factors of Preparedness Among Commissioned Corps Officers of the United States Public Health Service." Military Medicine 184, no. 9-10 (May 29, 2019): e502-e508. http://dx.doi.org/10.1093/milmed/usz018.
Full textAbstract:
AbstractIntroductionThe purpose of the cross-sectional study was to explore the relationships between occupational and general-self efficacy, and perceived preparedness among Commissioned Corps officers in the United States Public Health Service (Commissioned Corps). Commissioned Corps officers fight to protect the United States from diseases and care for the survivors of natural disasters and terrorist attacks. Commissioned Corps officers play a vital role in the fight to protect the United States from diseases and care for the survivors of natural disasters and terrorist attacks. The Commissioned Corps provided healthcare services in Liberia during the 2014 Ebola crisis that underscored the challenges of emerging diseases in a globalized community. It is imperative that these health professionals maintain a high level of self-efficacy and feel confident in their overall preparedness training as they respond to public health emergencies.Materials and MethodsThis study used assessment instruments derived from Albert Bandura’s concept of self-efficacy to analyze the occupational and general self-efficacy, and perceived preparedness levels of health services officers in the Commissioned Corps. 82 Commissioned Corps officers completed the assessment survey. To date, no study has examined the relationship between these constructs in this population.ResultsThere was a statistically significant relationship between feeling confident in one’s Commissioned Corps training and perceived preparedness (rs = 0.55, p < 0.001).ConclusionThis study reflects the training perceptions and self-beliefs of Commissioned Corps officers, fills an important gap in the empirical research in this population, and advances previous investigations, which suffered from an underrepresentation of female service members.
23
BEYER, GREGG A. "Establishing the United States Asylum Officer Corps: A First Report." International Journal of Refugee Law 4, no. 4 (1992): 455–86. http://dx.doi.org/10.1093/ijrl/4.4.455.
Full text
24
Burnett, Andrew S., David W. Reynolds, and Justin M. Shaw. "An Environmental Awareness Strategy for the United States Peace Corps." Journal of Environmental Education 22, no. 1 (October 1990): 5–8. http://dx.doi.org/10.1080/00958964.1990.9943039.
Full text
25
Odello, Denise. "Ritualized performance and community identity: A historical examination of drum corps competition in the United States." International Journal of Community Music 13, no. 1 (May 1, 2020): 65–79. http://dx.doi.org/10.1386/ijcm_00010_1.
Full textAbstract:
What structures bind musical communities that reach over distances? This article examines the musical community of youth drum corps in the United States and, in particular, the changing performance practices at competitions over time and how those changes influence the identity of the community. Drum corps is a community that exists over increasingly greater distances, yet the identity of this musical community is strong. An important site for discovering this communal identity is in competitive performance. Drum corps performances are strictly regulated because of this competitive context, and the values seen in those competitive regulations reflect the identity of the community. Ritual theory helps to examine the mechanisms by which members of this musical community renegotiate these identity values over decades. This article discusses shifts in performance practices such as instrumentation, repertoire and motion, all of which are reflected in changing competition judging guidelines. Ritual theory is used to understand how members of the drum corps community understood the implementation and official recognition of these changes in competitions as changes to the community’s identity.
26
Berlin, Robert H. "United States Army World War II Corps Commanders: A Composite Biography." Journal of Military History 53, no. 2 (April 1989): 147. http://dx.doi.org/10.2307/1985746.
Full text
27
Crum, Nancy F., Mark R. Wallace, Carla R. Lamb, Ava Marie S. Conlin, Dennis E. Amundson, Patrick E. Olson, Margaret A. K. Ryan, Ted J. Robinson, Gregory C. Gray, and Kenneth C. Earhart. "Halting a pneumococcal pneumonia outbreak among United States Marine Corps trainees." American Journal of Preventive Medicine 25, no. 2 (August 2003): 107–11. http://dx.doi.org/10.1016/s0749-3797(03)00114-4.
Full text
28
Amin, Julius A. "The united states peace corps volunteers in the republic of guinea." South African Journal of International Affairs 5, no. 2 (January 1997): 113–27. http://dx.doi.org/10.1080/10220469709545227.
Full text
29
McFadden, Bridget A., Harry P. Cintineo, Alexa J. Chandler, Patrick Peterson, Mita Lovalekar, Bradley C. Nindl, and Shawn M. Arent. "United States Marine Corps Recruit Training Demands Associated With Performance Outcomes." Military Medicine 189, Supplement_2 (June 26, 2024): 84–93. http://dx.doi.org/10.1093/milmed/usae124.
Full textAbstract:
ABSTRACT Introduction United States Marine Corps’ (USMC) recruit training is a 13-week program designed to maximize physical and mental performance adaptations. The purpose of this study was to evaluate the training demands and characteristics that are associated with performance outcomes during USMC recruit training. Materials and Methods A total of 196 recruits (M = 97 and W = 99) were monitored and tested throughout training. Laboratory-based performance testing occurred at the start of weeks 2 and 11 and consisted of body mass assessments, countermovement vertical jump, and isometric mid-thigh pull. Military-specific performance testing occurred twice within the first 8 weeks of training and included the physical fitness test (PFT) and combat fitness test (CFT) implemented by the USMC. Resilience data were collected at week 2 using the Connor-Davidson Resilience Scale. Workload, sleep, and stress responses were monitored at weeks 2, 7, and 11. Recruits were provided with a wearable tracking device which utilized heart rate and accelerometry-based technology to determine energy expenditure (EE), distances (DIS), and sleep metrics. Data were averaged over a 3-day period. Salivary cortisol testing occurred at the start of each monitoring week. Change scores were calculated for performance tests, and body mass was calculated from data obtained at week 2 to week 11. Area under the curve was calculated for the workload, sleep metrics, and cortisol responses using the trapezoidal method. Pearson product–moment correlations (r) were used to assess the relationships between training demands and performance. An α level of 0.05 was used to establish significance. Results A moderate positive correlation was found between changes in body mass and peak power (P < .001; r = 0.43). Weak positive correlations were found between changes in body mass and peak force (P = .002; r = 0.28), as well as body mass and resilience (P = .03; r = 0.19). A moderate negative correlation was observed between changes in body mass and PFT (P < .001; r = −0.49). A weak negative correlation was found between changes in body mass and EE (P = .003; r = −0.24). A weak negative correlation was found between changes in peak power and EE (P = .001; r = −0.29). A weak positive correlation was found between changes in peak power and changes in CFT (P = .05; r = 0.19) A weak negative correlation was found between changes in sleep continuity and CFT (P = .02; r = −0.20). A weak negative correlation was found between cortisol and changes in PFT (P = .05; r = −0.20). A weak negative correlation was found between cortisol and both EE (P = .001; r = −0.27) and DIS (P = .045; r = −0.16). A weak negative correlation was found between EE and sleep continuity (P < .001; r = −0.34). Weak negative correlations were found between sleep duration and both DIS (P = .01; r = −0.18) and steps (P = .003; r = −0.21). Conclusions Increases in body mass throughout training were positively associated with strength and power changes, but negatively related to PFT scores. Changes in peak power related to improvements in CFT scores; however, higher workloads (i.e., EE) were negatively associated with peak power. The identification of the USMC physical and physiological training demands that are associated with performance outcomes may be a valuable resource to guide conditioning efforts to boost military readiness.
30
Adler, William D. "State Capacity and Bureaucratic Autonomy in the Early United States: The Case of the Army Corps of Topographical Engineers." Studies in American Political Development 26, no. 2 (August 13, 2012): 107–24. http://dx.doi.org/10.1017/s0898588x12000053.
Full textAbstract:
This article reconsiders early American state capacity through a close examination of the U.S. Army Corps of Topographical Engineers. The topographical corps, a bureau in the antebellum War Department, developed a form of conditional bureaucratic autonomy far earlier than recognized in previous scholarship, giving it a central role in shaping national economic development policies, especially in the nation's periphery. Unlike robust bureaucratic autonomy, such as that described by Daniel Carpenter (2001, 2010; see footnote 4), conditional autonomy is highly contingent and can quickly fracture if the surrounding environment changes. The long-serving chief of the corps, Col. John J. Abert, shaped the opinions of his supposed principals by managing the ideas, information, and proposals directed to them. When faced with challenges, the corps proved to be a flexible organization that adapted its methods to accomplish its preferred ultimate goals using different instruments. In the end, however, the corps' autonomy was threatened when it became involved in the sectional politics surrounding the potential building of a transcontinental railroad line. Once the corps lost several of the conditions supporting its autonomy, its downfall was swift. This article thus joins a recent wave of scholarship highlighting strengths within the early American state by foregrounding the role of the armed forces in statebuilding.
31
WARFIELD, PATRICK R. "SOUNDS TO ESTABLISH A CORPS: THE ORIGINS OF THE UNITED STATES MARINE BAND, 1798–1804." Eighteenth Century Music 16, no. 2 (August 20, 2019): 115–32. http://dx.doi.org/10.1017/s1478570619000046.
Full textAbstract:
AbstractThe Jeffersonian rise to power in 1801 ushered in sweeping political changes for the United States of America. It also focused attention on the newly established United States Marine Corps, as a group of hostile Congressmen sought to audit the service, dismiss many of its officers and do away with the executive function of its commandant. But Thomas Jefferson (1743–1826) was also a supporter of the new capital's growing cultural life, and no organization better defined the connection between music and the federal government than the United States Marine Band. While this ensemble was not officially authorized by Congress until 1861, Commandant William Ward Burrows had already transformed his small group of sanctioned field musicians into an ensemble that could provide ceremonial and entertainment music for Washington, DC. This article traces the earliest history of the Marine Band, documents its development from eighteenth-century signalling traditions and suggests the ways in which its presence in the capital helped to stem the growing Republican tide against the Marine Corps itself.
32
Hershman, D. E., R. D. Heinz, and B. S. Kennedy. "Soybean Cyst Nematode, Heterodera glycines, Populations Adapting to Resistant Soybean Cultivars in Kentucky." Plant Disease 92, no. 10 (October 2008): 1475. http://dx.doi.org/10.1094/pdis-92-10-1475b.
Full textAbstract:
Soybean cyst nematode (SCN), Heterodera glycines, is the most limiting biotic factor of soybean (Glycine max) production in Kentucky (KY). Unpublished results of a survey of commercial soybean fields in KY in the late 1980s indicated that H. glycines (HG) type 0 (race 3) was the most common HG type in the state. HG type 0 populations cannot reproduce (female index [FI] <10% compared with reproduction on a standard susceptible cultivar) on PI88788, which is the basis of H. glycines resistance in >90% of the soybean cultivars grown in the United States. Recent reports from Illinois (4), Missouri (3), and North Carolina (2) indicate that most populations of H. glycines in those states are now able to reproduce on resistant soybean cultivars derived from PI88788. Because cultivars derived from PI88788 are grown almost exclusively in KY to manage H. glycines, a limited survey was needed to update information on H. glycines populations. Most soybean fields in KY are grown in a 1-year rotation with corn (Zea mays), a nonhost crop for H. glycines. Therefore, the survey targeted fields that had most recently been in corn. Otherwise, fields were arbitrarily selected for sampling. Composite samples were collected in the fall of 2006 or the spring of 2007 and consisted of 20 soil cores (10 to 15 cm deep × 2.5 cm in diameter) collected following a zigzag pattern. Samples were mixed and stored at 4°C until processing. H. glycines cysts were extracted from soil by a sucrose centrifugation and flotation technique (1). Eggs were liberated by crushing cysts caught on a sieve (250-μm-diameter pores) with a rubber stopper. Liberated eggs were then collected, stained with acid fuchsin, and counted. Up to three samples from each county surveyed were sent to the University of Missouri Nematology Laboratory, Columbia, MO for HG type testing (3). A total of 139 samples, representing 19 major soybean-production counties in KY, were analyzed for H. glycines levels. H. glycines eggs were recovered from 106 (76%) samples and 16 (84%) counties. SCN population densities ranged from 38 to 4,275 eggs per 250 cm3 of soil. HG type tests were conducted on 20 populations from eight counties. HG types 1.2.5.7 (race 2) and 2.5.7 (race 1 or 5) were identified, with HG type 2.5.7 (race 1) being the most common (60% of populations screened). No HG type 0 populations were detected. All populations tested had a FI ≥10% on three of nine indicator lines (PI88788, PI209322, and PI548316). FIs on these indicators ranged from 15 to 80, 11 to 81, and 23 to 88%, respectively. Sixty percent of populations tested had FIs ≥30% on PI88788. Of the populations screened, 25 and 35% had FIs ≥10% on PI548402 (Peking) and Pickett, respectively. All populations tested had FIs = 0 on PI437654. Survey results indicate that cultivars deriving their H. glycines resistance from PI88788 may have reduced effectiveness in suppressing current H. glycines populations in KY. Consequently, producers may need to grow soybean cultivars derived from non-PI88788 resistance sources to successfully manage H. glycines in the future. References: (1) D. E. Hershman et al. Plant Dis. 74:761, 1990. (2) S. R. Koenning. Plant Dis. 88:942, 2004. (3) M. G. Mitchum et al. Plant Dis. 91:1473, 2007. (4) T. L. Niblack et al. Online publication. doi:10.1094/PHP-2008-0118-01-RS. Plant Health Progress, 2008.
33
Gates, William, and Mitchell McCarthy. "United states marine corps aerial refueling requirements: Queuing theory and simulation analysis." Defense & Security Analysis 20, no. 3 (September 2004): 273–87. http://dx.doi.org/10.1080/1475179042000260697.
Full text
34
Bennett, Brad L., David P. Gray, and David A. Wynkoop. "The United States Navy Medical Service Corps: The Golden Anniversary 1947–1997." Military Medicine 162, no. 8 (August 1, 1997): 513–14. http://dx.doi.org/10.1093/milmed/162.8.513.
Full text
35
Martin, Ira H., Trevor Prophet, Christopher Owens, JennyMae Martin, and Gabe Plummer. "“Corps” leadership: a cadet perspective on shared leadership." International Journal of Public Leadership 13, no. 3 (August 14, 2017): 182–89. http://dx.doi.org/10.1108/ijpl-02-2017-0009.
Full textAbstract:
Purpose The purpose of this paper is to enhance understanding of shared leadership in a military academy setting. Design/methodology/approach A qualitative methodology was selected to ask senior cadets about a shared leadership concept at the United States Coast Guard Academy, known as the “corps leading the corps.” Cadets responded to, “what does the corps leading the corps mean to you?” via a paper and pencil survey. Cadet responses were coded using content analysis. Findings Three higher-order dimensions emerged from the data: autonomy and empowerment, developing self and others, and role modeling. Originality/value The paper provides emerging leaders’ commentary to incorporating a shared leadership concept within an educational environment.
36
Nisley, Thomas. "Send in the Corps! The Peace Corps and the Popular Perception of the United States in Latin America." Politics & Policy 41, no. 4 (August 2013): 536–62. http://dx.doi.org/10.1111/polp.12027.
Full text
37
Bruøygard, Terje, and Jørn Qviller. "Marine Corps Force Design 2030 and Implications for Allies and Partners: Case Norway." Journal of Advanced Military Studies 11, no. 2 (December 16, 2020): 198–210. http://dx.doi.org/10.21140/mcuj.20201102010.
Full textAbstract:
Force Design 2030 describes major organizational changes to the U.S. Marine Corps. Arguably, these changes will affect the Joint force, allies, and partners. The United States, and in particular the Marine Corps, is an important part of the deterrence and defense of many countries, especially Norway. Thus, the Norwegian Armed Forces should adapt to these changes to increase interoperability and strengthen the common warfighting capability. A comprehensive implementation plan, including allies and partners to operationalize the changes in the Marine Corps as well as the new U.S. Service and Joint concepts, is needed to succeed in creating an advantage over China and Russia.
38
Magoon, Orville T., Donald D. Treadwell, and Paul S. Atwood. "JETTIES AT BODEGA HARBOR." Coastal Engineering Proceedings 1, no. 32 (February 1, 2011): 52. http://dx.doi.org/10.9753/icce.v32.structures.52.
Full textAbstract:
To create and maintain a navigable entrance for small craft between the Pacific Ocean and the natural lagoon now referred to as Bodega Harbor, the construction of two rubble-mound jetties and the associated dredging of interior channels were authorized by the United States Congress in the late 1930s. The jetties were built by the United States Army Corps of Engineers in the early 1940s. Elements of the planning, design, construction, monitoring, and maintenance of the jetties are discussed herein.
39
Carriker, Roy R. "Wetlands and Environmental Legislation Issues." Journal of Agricultural and Applied Economics 26, no. 1 (July 1994): 80–89. http://dx.doi.org/10.1017/s1074070800019180.
Full textAbstract:
AbstractThe federal government program for wetlands regulation is administered by the United States Army Corps of Engineers pursuant to Section 404 of the Clean Water Act. Proposals for amending and/or reforming the Section 404 program are included in Congressional deliberations regarding Clean Water Act reauthorization. Specific issues of public policy include the definition of “waters of the United States”, criteria for delineation of jurisdictional wetlands, definition of activities exempt from regulation, mitigation and classification of wetlands, and issues of property rights.
40
Putnam Rankin, Caddie, and Todd Lee Matthews. "Patterns of B Corps Certification: The Role of Institutional, Economic, and Political Resources." Societies 10, no. 3 (September 21, 2020): 72. http://dx.doi.org/10.3390/soc10030072.
Full textAbstract:
This paper explores the certification of companies as B Corps from 2007 through 2016, the first 10 years of certification. B Corps are for profit companies that promise to “Be a Force for Good” in our society. Over 2600 companies in over 50 countries are certified as B Corps, responding to demands for higher accountability, ethical behavior, and contributions to their environment and community. We focus here only on B Corps in the United States and analyze a state-level database we have developed of 851 companies that became certified in the first 10 years of certification, between 2007 and 2016. In the paper we ask: What conditions in the macro environment facilitate the spread of B Corps certification? This paper uses the framework of resource dependence theory and institutional theory to explore the diffusion of certification. We hypothesize that institutional, economic, and political resources in the external environment provide conditions that support B Corps certification.
41
Cozzetto, Don. "The Officer Fitness Report as a Performance Appraisal Tool." Public Personnel Management 19, no. 3 (September 1990): 235–44. http://dx.doi.org/10.1177/009102609001900301.
Full textAbstract:
Performance evaluation is an important tool for effective management. Much of the recent literature has focused on the efficacy of civilian performance appraisal systems. As a result, there is a knowledge gap with respect to military appraisal systems in general, and those of the United States Navy and the United States Marine Corps in particular. The 1978 Civil Service Reform Act spawned several performance appraisal systems within each of these agencies; the USMC utilizes five separate systems in the evaluation of civilian and military personnel; the Navy has adopted three separate appraisal mechanisms. This article specifically examines the device used to evaluate senior military staff in the Navy and Marine Corps—the fitness report. Because this particular appraisal methodology differs radically from its federal civilian counterparts, a rather detailed descriptive section serves as an orientation for the reader. The approach is intended to supplement John Pelissero's article on performance evaluation in the Department of the Army (Pelissero, 1984).
42
Hansen, David M., and David A. Clary. "Fortress America: The Corps of Engineers, Hampton Roads, and United States Coastal Defense." Technology and Culture 34, no. 1 (January 1993): 150. http://dx.doi.org/10.2307/3106469.
Full text
43
Hammond, Leroy D., and David A. Clary. "Fortress America: The Corps of Engineers, Hampton Roads, and United States Coastal Defense." Journal of Military History 55, no. 1 (January 1991): 113. http://dx.doi.org/10.2307/1986143.
Full text
44
Shallat, Todd, and David A. Clary. "Fortress America: The Corps of Engineers, Hampton Roads, and United States Coastal Defense." Journal of American History 77, no. 4 (March 1991): 1353. http://dx.doi.org/10.2307/2078306.
Full text
45
Oyos, Matthew. "Courage, Careers, and Comrades: Theodore Roosevelt and the United States Army Officer Corps." Journal of the Gilded Age and Progressive Era 10, no. 1 (January 2011): 23–58. http://dx.doi.org/10.1017/s1537781410000022.
Full textAbstract:
Theodore Roosevelt made reform of the U.S. Army Officer Corps a priority during his presidency. He felt compelled to act because of the problems that the army experienced during the war with Spain. As a volunteer soldier, Roosevelt had witnessed the shortcomings of many of the top-ranking officers in meeting the physical and organizational demands of the fighting, but he also acted because he wanted high-minded, intelligent, and physically fit leaders who could inspire his fellow citizens to a greater sense of duty in post-frontier America. Roosevelt's efforts to promote promising army officers to top commands and mandate physical fitness standards would prove disruptive, as he elevated officers out of the normal line of promotion. These practices would, in turn, generate protests in Congress and from within the military. The resulting controversies would cause Roosevelt to fall short of his goals for improving army leadership, roil civil-military relations, and demonstrate his limits as a political leader.
46
Armor, James B. "Viewpoint: It is Time to Create a United States Air Force Space Corps." Astropolitics 5, no. 3 (November 8, 2007): 273–88. http://dx.doi.org/10.1080/14777620701580851.
Full text
47
Aronson, Keith R., and Daniel F. Perkins. "Challenges Faced by Military Families: Perceptions of United States Marine Corps School Liaisons." Journal of Child and Family Studies 22, no. 4 (June 7, 2012): 516–25. http://dx.doi.org/10.1007/s10826-012-9605-1.
Full text
48
Harrison, Joseph H., and David A. Clary. "Fortress America: The Corps of Engineers, Hampton Roads, and United States Coastal Defense." Journal of Southern History 57, no. 3 (August 1991): 509. http://dx.doi.org/10.2307/2209955.
Full text
49
Sallee, Donald R., John W. Love, and Lynn E. Welling. "The United States Marine Corps Shock Trauma Platoon: The Modern Battlefield's Emergency Room." Prehospital Emergency Care 12, no. 1 (January 2008): 80–86. http://dx.doi.org/10.1080/10903120701707997.
Full text
50
Squillace, Mark. "From "Navigable Waters" to "Constitutional Waters": The Future of Federal Wetlands Regulation." University of Michigan Journal of Law Reform, no. 40.4 (2007): 799. http://dx.doi.org/10.36646/mjlr.40.4.from.
Full textAbstract:
Wetlands regulation in the United States has a tumultuous history. The early European settlers viewed wetlands as obstacles to development, and they drained and filled wetlands and swamps at an astounding rate, often with government support, straight through the middle of the twentieth century. As evidence of the ecological significance of wetlands emerged over the last several decades, programs to protect and restore wetlands became prominent. Most notable among these is the permitting program under section 404 of the Clean Water Act. That provision prohibits dredging or filling of "navigable waters, " defined by law to mean "waters of the United States." Since 1975, the United States Army Corps of Engineers (the Corps), which is primarily responsible for the section 404 permitting program, has construed "navigable waters" expansively to encompass most wetlands that could affect interstate commerce. In three decisions over the course of twenty years, the Supreme Court has expressed increasing skepticism that the phrase "navigable waters" supports the Corps' broad claim of regulatory authority. In its most recent decision, United States v. Rapanos, 126 S.Ct. 2208 (2006), a majority of the Court found that the phrase "navigable waters" encompassed only those waters that met the traditional test for navigability. This Article considers the state of federal wetlands regulation after Rapanos. It begins by describing the significant role that wetlands play in the ecological health of the planet, and the impracticality of setting standards to protect those wetlands at the state or local level. It then examines the history of wetlands regulation, focusing in particular on the Clean Water Act, and the problems encountered with regulating wetlands by federal agencies and in the courts. The Article concludes with recommendations for improving the section 404 program. While the Corps can and perhaps should adopt rules to clarify the law, the time is long overdue for Congress to amend the Clean Water Act to clarify the scope of federal authority over wetlands. In doing so, Congress should affirm its original intent to establish a comprehensive federal program for wetlands regulation under the Clean Water Act. This can best be accomplished by abandoning the ill-fated use of the phrase "navigable waters" and substituting a new phrase such as "constitutional waters," which will clearly convey Congress's intent to encompass all waters that are subject to federal jurisdiction under the constitution.