To see the other types of publications on this topic, follow the link: Transporteur ABC.
Journal articles on the topic 'Transporteur ABC'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Transporteur ABC.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Mosser, J., CO Sarde, JL Mandel, AM Douar, and P. Aubourg. "Le gène de l'adrénoleucodystrophie pourrait coder pour un transporteur ABC." médecine/sciences 9, no. 3 (1993): 319. http://dx.doi.org/10.4267/10608/2915.
Full text
2
ZHAO, Li-Xia, Cheng-Ji ZHOU, Arowu TANAKA, Masanori NAKATA, Takahiro HIRABAYASHI, Teruo AMACHI, Seiji SHIODA, Kazumitsu UEDA, and Nobuya INAGAKI. "Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2." Biochemical Journal 350, no. 3 (September 8, 2000): 865–72. http://dx.doi.org/10.1042/bj3500865.
Full textAbstract:
The ABC1 (ABCA) subfamily of the ATP-binding cassette (ABC) transporter superfamily has a structural feature that distinguishes it from other ABC transporters. Here we report the cloning, molecular characterization and tissue distribution of ABC2/ABCA2, which belongs to the ABC1 subfamily. Rat ABC2 is a protein of 2434 amino acids that has 44.5%, 40.0% and 40.8% identity with mouse ABC1/ABCA1, human ABC3/ABCA3 and human ABCR/ABCA4 respectively. Immunoblot analysis showed that proteins of 260 and 250kDa were detected in COS-1 cells transfected with ABC2 having a haemagglutinin tag, while no band was detected in mock-transfected cells. After incubation with N-glycosidase F, the mobilities of the two proteins increased and a single band was detected, suggesting that ABC2 is a glycoprotein. Photoaffinity labelling with 8-azido-[α-32P]ATP confirmed that ATP binds to the ABC2 protein in the presence of Mg2+. RNA blot analysis showed that ABC2 mRNA is most abundant in rat brain. Examination of brain by in situ hybridization determined that ABC2 is expressed at high levels in the white matter, indicating that it is expressed in the oligodendrocytes. ABC2, therefore, is a glycosylated ABC transporter protein, and may play an especially important role in the brain. In addition, the N-terminal 60-amino-acid sequence of the human ABC1, which was missing from previous reports, has been determined.
3
Väisänen, Enni, Junko Takahashi, Ogonna Obudulu, Joakim Bygdell, Pirkko Karhunen, Olga Blokhina, Teresa Laitinen, et al. "Hunting monolignol transporters: membrane proteomics and biochemical transport assays with membrane vesicles of Norway spruce." Journal of Experimental Botany 71, no. 20 (August 10, 2020): 6379–95. http://dx.doi.org/10.1093/jxb/eraa368.
Full textAbstract:
Abstract Both the mechanisms of monolignol transport and the transported form of monolignols in developing xylem of trees are unknown. We tested the hypothesis of an active, plasma membrane-localized transport of monolignol monomers, dimers, and/or glucosidic forms with membrane vesicles prepared from developing xylem and lignin-forming tissue-cultured cells of Norway spruce (Picea abies L. Karst.), as well as from control materials, comprising non-lignifying Norway spruce phloem and tobacco (Nicotiana tabacum L.) BY-2 cells. Xylem and BY-2 vesicles transported both coniferin and p-coumaryl alcohol glucoside, but inhibitor assays suggested that this transport was through the tonoplast. Membrane vesicles prepared from lignin-forming spruce cells showed coniferin transport, but the Km value for coniferin was much higher than those of xylem and BY-2 cells. Liquid chromatography-mass spectrometry analysis of membrane proteins isolated from spruce developing xylem, phloem, and lignin-forming cultured cells revealed multiple transporters. These were compared with a transporter gene set obtained by a correlation analysis with a selected set of spruce monolignol biosynthesis genes. Biochemical membrane vesicle assays showed no support for ABC-transporter-mediated monolignol transport but point to a role for secondary active transporters (such as MFS or MATE transporters). In contrast, proteomic and co-expression analyses suggested a role for ABC transporters and MFS transporters.
4
Webb, Alexander J., and Arthur H. F. Hosie. "A Member of the Second Carbohydrate Uptake Subfamily of ATP-Binding Cassette Transporters Is Responsible for Ribonucleoside Uptake in Streptococcus mutans." Journal of Bacteriology 188, no. 23 (September 22, 2006): 8005–12. http://dx.doi.org/10.1128/jb.01101-06.
Full textAbstract:
ABSTRACT Streptococcus mutans has a significant number of transporters of the ATP-binding cassette (ABC) superfamily. Members of this superfamily are involved in the translocation of a diverse range of molecules across membranes. However, the functions of many of these members remain unknown. We have investigated the role of the single S. mutans representative of the second subfamily of carbohydrate uptake transporters (CUT2) of the ABC superfamily. The genetic context of genes encoding this transporter indicates that it may have a role in ribonucleoside scavenging. Inactivation of rnsA (ATPase) or rnsB (solute binding protein) resulted in strains resistant to 5-fluorocytidine and 5-fluorouridine (toxic ribonucleoside analogues). As other ribonucleosides including cytidine, uridine, adenosine, 2-deoxyuridine, and 2-deoxycytidine protected S. mutans from 5-fluorocytidine and 5-fluorouridine toxicity, it is likely that this transporter is involved in the uptake of these molecules. Indeed, the rnsA and rnsB mutants were unable to transport [2-14C]cytidine or [2-14C]uridine and had significantly reduced [8-14C]adenosine uptake rates. Characterization of this transporter in wild-type S. mutans indicates that it is a high-affinity (Km = 1 to 2 μM) transporter of cytidine, uridine, and adenosine. The inhibition of [14C]cytidine uptake by a range of structurally related molecules indicates that the CUT2 transporter is involved in the uptake of most ribonucleosides, including 2-deoxyribonucleosides, but not ribose or nucleobases. The characterization of this permease has directly shown for the first time that an ABC transporter is involved in the uptake of ribonucleosides and extends the range of substrates known to be transported by members of the ABC transporter superfamily.
5
Latif, Haythem, Merve Sahin, Janna Tarasova, Yekaterina Tarasova, Vasiliy A. Portnoy, Juan Nogales, and Karsten Zengler. "Adaptive Evolution of Thermotoga maritima Reveals Plasticity of the ABC Transporter Network." Applied and Environmental Microbiology 81, no. 16 (June 5, 2015): 5477–85. http://dx.doi.org/10.1128/aem.01365-15.
Full textAbstract:
ABSTRACTThermotoga maritimais a hyperthermophilic anaerobe that utilizes a vast network of ABC transporters to efficiently metabolize a variety of carbon sources to produce hydrogen. For unknown reasons, this organism does not metabolize glucose as readily as it does glucose di- and polysaccharides. The leading hypothesis implicates the thermolability of glucose at the physiological temperatures at whichT. maritimalives. After a 25-day laboratory evolution, phenotypes were observed with growth rates up to 1.4 times higher than and glucose utilization rates exceeding 50% those of the wild type. Genome resequencing revealed mutations in evolved cultures related to glucose-responsive ABC transporters. The native glucose ABC transporter, GluEFK, has more abundant transcripts either as a result of gene duplication-amplification or through mutations to the operator sequence regulating this operon. Conversely, BglEFGKL, a transporter of beta-glucosides, is substantially downregulated due to a nonsense mutation to the solute binding protein or due to a deletion of the upstream promoter. Analysis of the ABC2 uptake porter families for carbohydrate and peptide transport revealed that the solute binding protein, often among the transcripts detected at the highest levels, is predominantly downregulated in the evolved cultures, while the membrane-spanning domain and nucleotide binding components are less varied. Similar trends were observed in evolved strains grown on glycerol, a substrate that is not dependent on ABC transporters. Therefore, improved growth on glucose is achieved through mutations favoring GluEFK expression over BglEFGKL, and in lieu of carbon catabolite repression, the ABC transporter network is modulated to achieve improved growth fitness.
6
Michaelis, Martin, Florian Rothweiler, Thomas Nerreter, Mohsen Sharifi, Taravat Ghafourian, and Jindrich Cinatl. "Karanjin interferes with ABCB1, ABCC1, and ABCG2." Journal of Pharmacy & Pharmaceutical Sciences 17, no. 1 (March 10, 2014): 92. http://dx.doi.org/10.18433/j3bw2s.
Full textAbstract:
PURPOSE: The prominent ATP-binding cassette (ABC) transporters ABCB1, ABCC1, and ABCG2 are involved in substance transport across physiological barriers and therefore in drug absorption, distribution, and elimination. They also mediate multi-drug resistance in cancer cells. Different flavonoids are known to interfere with different ABC transporters. Here, the effect of the furanoflavonol karanjin, a potential drug with antiglycaemic, gastroprotective, antifungal, and antibacterial effects, was investigated on ABCB1, ABCC1, and ABCG2-mediated drug transport in comparison to the flavonoids apigenin, genistein, and naringenin. METHODS: Cells expressing the relevant transporters (ABCB1: UKF-NB-3ABCB1, UKF-NB-3rVCR10; ABCC1: G62, PC-3rVCR20; ABCG2: UKF-NB-3ABCG2) were used in combination with specific fluorescent and cytotoxic ABC transporter substrates and ABC transporter inhibitors to study ABC transporter function. Moreover, the effects of the investigated flavonoids were determined on the ABC transporter ATPase activities. RESULTS: Karanjin interfered with drug efflux mediated by ABCB1, ABCC1, and ABCG2 and enhanced the ATPase activity of all three transporters. Moreover, karanjin exerted more pronounced effects than the control flavonoids apigenin, genistein, and naringenin on all three transporters. Most notably, karanjin interfered with ABCB1 at low concentrations being about 1µM. CONCLUSIONS: Taken together, these findings should be taken into account during further consideration of karanjin as a potential drug for different therapeutic indications. The effects on ABCB1, ABCC1, and ABCG2 may affect the pharmacokinetics of co-administered drugs. This article is open to POST-PUBLICATION REVIEW. Registered readers (see “For Readers”) may comment by clicking on ABSTRACT on the issue’s contents page.METHODS: Cells expressing the relevant transporters (ABCB1: UKF-NB-3ABCB1, UKF-NB-3rVCR10; ABCC1: G62, PC-3rVCR20; ABCG2: UKF-NB-3ABCG2) were used in combination with specific fluorescent and cytotoxic ABC transporter substrates and ABC transporter inhibitors to study ABC transporter function. Moreover, the effects of the investigated flavonoids were determined on the ABC transporter ATPase activities.RESULTS: Karanjin interfered with drug efflux mediated by ABCB1, ABCC1, and ABCG2 and enhanced the ATPase activity of all three transporters. Moreover, karanjin exerted more pronounced effects than the control flavonoids apigenin, genistein, and naringenin on all three transporters. Most notably, karanjin interfered with ABCB1 at low concentrations being about 1µM.CONCLUSIONS: Taken together, these findings should be taken into account during further consideration of karanjin as a potential drug for different therapeutic indications. The effects on ABCB1, ABCC1, and ABCG2 may affect the pharmacokinetics of co-administered drugs.
7
Schoonbeek, Henk-jan, Jos M. Raaijmakers, and Maarten A. De Waard. "Fungal ABC Transporters and Microbial Interactions in Natural Environments." Molecular Plant-Microbe Interactions® 15, no. 11 (November 2002): 1165–72. http://dx.doi.org/10.1094/mpmi.2002.15.11.1165.
Full textAbstract:
In natural environments, microorganisms are exposed to a wide variety of antibiotic compounds produced by competing organisms. Target organisms have evolved various mechanisms of natural resistance to these metabolites. In this study, the role of ATP-binding cassette (ABC) transporters in interactions between the plant-pathogenic fungus Botrytis cinerea and antibiotic-producing Pseudomonas bacteria was investigated in detail. We discovered that 2,4-diacetylphloroglucinol, phenazine-1-carboxylic acid and phenazine-1-carboxamide (PCN), broad-spectrum antibiotics produced by Pseudomonas spp., induced expression of several ABC transporter genes in B. cinerea. Phenazines strongly induced expression of BcatrB, and ΔBcatrB mutants were significantly more sensitive to these antibiotics than their parental strain. Treatment of B. cinerea germlings with PCN strongly affected the accumulation of [14C]fludioxonil, a phenylpyrrole fungicide known to be transported by BcatrB, indicating that phenazines also are transported by BcatrB. Pseudomonas strains producing phenazines displayed a stronger antagonistic activity in vitro toward ΔBcatrB mutants than to the parental B. cinerea strain. On tomato leaves, phenazine-producing Pseudomonas strains were significantly more effective in reducing gray mold symptoms incited by a ΔBcatrB mutant than by the parental strain. We conclude that the ABC transporter BcatrB provides protection to B. cinerea in phenazine-mediated interactions with Pseudomonas spp. Collectively, these results indicate that fungal ABC transporters can play an important role in antibiotic-mediated interactions between bacteria and fungi in plant-associated environments. The implications of these findings for the implementation and sustainability of crop protection by antagonistic microorganisms are discussed.
8
Ogawa, Atsuko, Takashi Hashida-Okado, Masahiro Endo, Hirofumi Yoshioka, Takashi Tsuruo, Kazutoh Takesako, and Ikunoshin Kato. "Role of ABC Transporters in Aureobasidin A Resistance." Antimicrobial Agents and Chemotherapy 42, no. 4 (April 1, 1998): 755–61. http://dx.doi.org/10.1128/aac.42.4.755.
Full textAbstract:
ABSTRACT Aureobasidin A (AbA) has strong antifungal effects arising from an unusual mechanism. We show that AbA interacts with ATP-binding cassette (ABC) transporters in yeast and mammalian cells. We isolated a gene ofSaccharomyces cerevisiae that conferred resistance to AbA when the gene was present in multiple copies. The gene was identical toYOR1/YRS1, which confers resistance to oligomycin, reveromycin, and organic anions, none of which have structures similar to that of AbA. We also isolated an aur3 Rrecessive mutant of S. cerevisiae with increased resistance to AbA. Northern hybridization showed that theaur3 R mutant expressed not onlyYOR1 but also the ABC transporter-encoding genePDR5 at high levels. Genetic studies showed that theaur3 R mutant had a mutation in thePDR1 gene, which encodes a transcriptional regulator ofPDR5 and YOR1. Analysis of a yor1disruptant of the aur3/pdr1 mutant showed that both the functional YOR1 gene and the mutation in PDR1were necessary for AbA resistance. These results suggest thatYOR1 is more important than PDR5 for AbA resistance. We found in Candida albicans a novel gene whose sequence was similar to the sequence of YOR1 in S. cerevisiae. The amino acid sequence of the C. albicans YOR1 homolog showed no significant similarity to the sequences ofCDR1 and CDR2, which are ABC transporters ofC. albicans. Furthermore, AbA inhibited the efflux of the anticancer agent vincristine through P glycoproteins in cancer cells with multidrug resistance.
9
Zhang, Wandong, Qing Yan Liu, Arsalan S. Haqqani, Ziying Liu, Caroline Sodja, Sonia Leclerc, Ewa Baumann, Christie E. Delaney, Eric Brunette, and Danica B. Stanimirovic. "Differential Expression of ABC Transporter Genes in Brain Vessels vs. Peripheral Tissues and Vessels from Human, Mouse and Rat." Pharmaceutics 15, no. 5 (May 22, 2023): 1563. http://dx.doi.org/10.3390/pharmaceutics15051563.
Full textAbstract:
Background: ATP-binding cassette (ABC) transporters comprise a superfamily of genes encoding membrane proteins with nucleotide-binding domains (NBD). These transporters, including drug efflux across the blood–brain barrier (BBB), carry a variety of substrates through plasma membranes against substrate gradients, fueled by hydrolyzing ATP. The expression patterns/enrichment of ABC transporter genes in brain microvessels compared to peripheral vessels and tissues are largely uncharacterized. Methods: In this study, the expression patterns of ABC transporter genes in brain microvessels, peripheral tissues (lung, liver and spleen) and lung vessels were investigated using RNA-seq and WesTM analyses in three species: human, mouse and rat. Results: The study demonstrated that ABC drug efflux transporter genes (including ABCB1, ABCG2, ABCC4 and ABCC5) were highly expressed in isolated brain microvessels in all three species studied; the expression of ABCB1, ABCG2, ABCC1, ABCC4 and ABCC5 was generally higher in rodent brain microvessels compared to those of humans. In contrast, ABCC2 and ABCC3 expression was low in brain microvessels, but high in rodent liver and lung vessels. Overall, most ABC transporters (with the exception of drug efflux transporters) were enriched in peripheral tissues compared to brain microvessels in humans, while in rodent species, additional ABC transporters were found to be enriched in brain microvessels. Conclusions: This study furthers the understanding of species similarities and differences in the expression patterns of ABC transporter genes; this is important for translational studies in drug development. In particular, CNS drug delivery and toxicity may vary among species depending on their unique profiles of ABC transporter expression in brain microvessels and BBB.
10
Kropf, Christian, Karl Fent, Stephan Fischer, Ayako Casanova, and Helmut Segner. "ABC transporters in gills of rainbow trout (Oncorhynchus mykiss)." Journal of Experimental Biology 223, no. 15 (June 12, 2020): jeb221069. http://dx.doi.org/10.1242/jeb.221069.
Full textAbstract:
ABSTRACTFish gills are a structurally and functionally complex organ at the interface between the organism and the aquatic environment. Gill functions include the transfer of organic molecules, both natural ones and xenobiotic compounds. Whether the branchial exchange of organic molecules involves active transporters is currently not known. Here, we investigated the presence, diversity and functional activity of ATP-binding cassette (ABC) transporters in gills of juvenile rainbow trout. By means of RT-qPCR, gene transcripts of members from the abcb, abcc and abcg subfamilies were identified. Comparisons with mRNA profiles from trout liver and kidney revealed that ABC transporters known to have an apical localization in polarized epithelia, especially abcc2 and abcb1, were under-represented in the gills. In contrast, ABC transporters with mainly basolateral localization showed comparable gene transcript levels in the three organs. The most prominent ABC transporter in gills was an abcb subfamily member, which was annotated as abcb5 based on the synteny and phylogeny. Functional in vivo assays pointed to a role of branchial ABC transporters in branchial solute exchange. We further assessed the utility of primary gill cell cultures to characterize transporter-mediated branchial exchange of organic molecules, by examining ABC transporter gene transcript patterns and functional activity in primary cultures. The gill cultures displayed functional transport activity, but the ABC mRNA expression patterns were different to those of the intact gills. Overall, the findings of this study provide evidence for the presence of functional ABC transporter activity in gills of fish.
11
Tamaki, Akina, Caterina Ierano, Gergely Szakacs, Robert W. Robey, and Susan E. Bates. "The controversial role of ABC transporters in clinical oncology." Essays in Biochemistry 50 (September 7, 2011): 209–32. http://dx.doi.org/10.1042/bse0500209.
Full textAbstract:
The phenomenon of multidrug resistance in cancer is often associated with the overexpression of the ABC (ATP-binding cassette) transporters Pgp (P-glycoprotein) (ABCB1), MRP1 (multidrug resistance-associated protein 1) (ABCC1) and ABCG2 [BCRP (breast cancer resistance protein)]. Since the discovery of Pgp over 35 years ago, studies have convincingly linked ABC transporter expression to poor outcome in several cancer types, leading to the development of transporter inhibitors. Three generations of inhibitors later, we are still no closer to validating the ‘Pgp hypothesis’, the idea that increased chemotherapy efficacy can be achieved by inhibition of transporter-mediated efflux. In this chapter, we highlight the difficulties and past failures encountered in the development of clinical inhibitors of ABC transporters. We discuss the challenges that remain in our effort to exploit decades of work on ABC transporters in oncology. In learning from past mistakes, it is hoped that ABC transporters can be developed as targets for clinical intervention.
12
Wusahaningtyas, Lu’lu’ Sahara, Moh Mirza Nuryady, Lintang Winantya Firdausy, Ahmad Fahrurrozi Zs, and R. Wisnu Nurcahyo. "Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride." BIO Web of Conferences 41 (2021): 06003. http://dx.doi.org/10.1051/bioconf/20214106003.
Full textAbstract:
This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.
13
Langmann, Thomas, Richard Mauerer, and Gerd Schmitz. "Human ATP-Binding Cassette Transporter TaqMan Low-Density Array: Analysis of Macrophage Differentiation and Foam Cell Formation." Clinical Chemistry 52, no. 2 (February 1, 2006): 310–13. http://dx.doi.org/10.1373/clinchem.2005.059774.
Full textAbstract:
Abstract Background: ATP-binding cassette (ABC) transporters cause various diseases and regulate many physiologic processes, such as lipid homeostasis, iron transport, and immune mechanisms. Several ABC transporters are involved in bile acid, phospholipid, and sterol transport, and their expression is itself controlled by lipids. In addition, ABC proteins mediate drug export in tumor cells and promote the development of multidrug resistance. Methods: We created an ABC Transporter TaqMan Low-Density Array based on an Applied Biosystems 7900HT Micro Fluidic Card. We used a 2-μL reaction well with 2 ng of sample. To evaluate this method for lipidomic research and to characterize expression patterns of ABC transporters in cells relevant for atherosclerosis research, we monitored mRNA expression in human primary monocytes, in vitro–differentiated macrophages, and cells stimulated with the liver-X-receptor and retinoid-X-receptor agonists T0901317 and 9-cis retinoic acid, mimicking sterol loading. Results: The method enabled simultaneous analysis of 47 human ABC transporters and the reference gene 18S rRNA in 2 replicates of 4 samples per run. Conclusions: The new system uses only 2 ng of sample and small volumes of reagent, and the precaptured primers and probes avoided labor-intensive pipetting steps. The ABC Transporter TaqMan Low-Density Array may be a useful tool to monitor dysregulated ABC transporter mRNA profiles in human lipid disorders and cancer-related multidrug resistance and to analyze the pharmacologic and metabolic regulation of ABC transporter expression important for drug development in large-scale screening approaches.
14
da Silva, Kaline Martins, Nicolas Gasparine Figueiredo, and Sampaio Cremonesi. "Use of Bioinformatics Techniques in the Characterization of Genes and Proteins Involved in the Transport of Polyamines from Staphylococcus Genus." JSM Bioinformatics, Genomics and Proteomics 6, no. 1 (August 31, 2023): 1–10. http://dx.doi.org/10.47739/2576-1102.bioinformatics.1041.
Full textAbstract:
Polyamines are essential nitrogenous compounds for bacteria, being captured by ABC transporters that recognize and interact with the molecule to be transported. Given the specificity of this interaction, the present work sought to identify genes and proteins of polyamine transporters in S. hyicus using bioinformatics tools. Sequence searches and tests suggest that S. hyicus possesses a spermidine ABC transporter, whose genes form the potABCD operon. From structural homology modeling it was pos sible to identify the specific amino acids in the interaction between PotD and spermidine where the W260 residue, characteristic of spermidine transporters, is predicted to be displaced into the pocket. This shift allows interaction with a minor polyamine such as putrescine whose transporter was not found in the S. hyicus genome. An in silico cloning of the PotD protein was carried out in the pET28a, pET28aSUMO, and pET44aNusA vectors and by submitting them for analysis of the resulting ORFs, strongly suggesting that they have favorable physicochemical qualities and solubility. For the docking, presentations present in the literature that were admired in past studies of polyamine transport inhibitors were selected. We can conclude that the S. hyicus PotABCD complex is a possible spermidine transporter and the inscriptions: AcSpm, NpAcSpm, GLT-Spm, DFMO, and MGBG, are possible competitive inhibitors of spermidine uptake in PotD in S. hyicus bacteria.
15
Wu, Chao, Swapan Chakrabarty, Minghui Jin, Kaiyu Liu, and Yutao Xiao. "Insect ATP-Binding Cassette (ABC) Transporters: Roles in Xenobiotic Detoxification and Bt Insecticidal Activity." International Journal of Molecular Sciences 20, no. 11 (June 10, 2019): 2829. http://dx.doi.org/10.3390/ijms20112829.
Full textAbstract:
ATP-binding cassette (ABC) transporters, a large class of transmembrane proteins, are widely found in organisms and play an important role in the transport of xenobiotics. Insect ABC transporters are involved in insecticide detoxification and Bacillus thuringiensis (Bt) toxin perforation. The complete ABC transporter is composed of two hydrophobic transmembrane domains (TMDs) and two nucleotide binding domains (NBDs). Conformational changes that are needed for their action are mediated by ATP hydrolysis. According to the similarity among their sequences and organization of conserved ATP-binding cassette domains, insect ABC transporters have been divided into eight subfamilies (ABCA–ABCH). This review describes the functions and mechanisms of ABC transporters in insecticide detoxification, plant toxic secondary metabolites transport and insecticidal activity of Bt toxin. With improved understanding of the role and mechanisms of ABC transporter in resistance to insecticides and Bt toxins, we can identify valuable target sites for developing new strategies to control pests and manage resistance and achieve green pest control.
16
Gu, Song, Shao-Wen Xiao, Jian-Wei Zheng, Hong-Ye Li, Jie-Sheng Liu, and Wei-Dong Yang. "ABC Transporters in Prorocentrum lima and Their Expression Under Different Environmental Conditions Including Okadaic Acid Production." Marine Drugs 17, no. 5 (April 30, 2019): 259. http://dx.doi.org/10.3390/md17050259.
Full textAbstract:
Prorocentrum lima is a typical benthic toxic dinoflagellate, which can produce phycotoxins such as okadaic acid (OA). In this study, we identified three ABC transporter genes (ABCB1, ABCC1 and ABCG2) and characterized their expression patterns, as well as OA production under different environmental conditions in P. lima. We found that the three ABC transporters all showed high identity with related ABC proteins from other species, and contained classical features of ABC transport proteins. Among them, ABCG2 was a half size transporter. The three ABC transporter genes displayed various expression profiles under different conditions. The high concentration of Cu2+ could up-regulate ABCB1, ABCC1 and ABCG2 transcripts in P. lima, suggesting the potential defensive role of ABC transporters against metal ions in surrounding waters. Cu2+, in some concentration, could induce OA production; meanwhile, tributyltin inhibited OA accumulation. The grazer Artemia salina could induce OA production, and P. lima displayed some toxicity to the grazer, indicating the possibility of OA as an anti-grazing chemical. Collectively, our results revealed intriguing data about OA production and the expression patterns of three ABC transporter genes. However, we could not find any significant correlation between OA production and expression pattern of the three ABC transporters in P. lima. Our results might provide new molecular insights on the defensive responses of P. lima to the surrounding environment.
17
Kim, Seon Hwa, and Vladimir Vujanovic. "ATP-Binding Cassette (ABC) Transporters in Fusarium Specific Mycoparasite Sphaerodes mycoparasitica during Biotrophic Mycoparasitism." Applied Sciences 12, no. 15 (July 29, 2022): 7641. http://dx.doi.org/10.3390/app12157641.
Full textAbstract:
Recent transcriptomic profiling has revealed importance membrane transporters such as ATP-binding cassette (ABC) transporters in fungal necrotrophic mycoparasites. In this study, RNA-Seq allowed rapid detection of ABC transcripts involved in biotrophic mycoparasitism of Sphaerodes mycoparasitica against the phytopathogenic and mycotoxigenic Fusarium graminearum host, the causal agent of Fusarium head blight (FHB). Transcriptomic analyses of highly expressed S. mycoparasitica genes, and their phylogenetic relationships with other eukaryotic fungi, portrayed the ABC transporters’ evolutionary paths towards biotrophic mycoparasitism. Prior to the in silico phylogenetic analyses, transmission electron microscopy (TEM) was used to confirm the formation of appressorium/haustorium infection structures in S. mycoparasitica during early (1.5 d and 3.5 d) stages of mycoparasitism. Transcripts encoding biotrophy-associated secreted proteins did uncover the enrolment of ABC transporter genes in this specific biocontrol mode of action, while tandem ABC and BUB2 (non-ABC) transcripts seemed to be proper for appressorium development. The next-generation HiSeq transcriptomic profiling of the mycoparasitic hypha samples, revealed 81 transcripts annotated to ABC transporters consisting of a variety of ABC-B (14%), ABC-C (22%), and ABC-G (23%), and to ABC-A, ABC-F, aliphatic sulfonates importer (TC 3.A.1.17.2), BtuF, ribose importer (TC 3.A.1.2.1), and unknown families. The most abundant transcripts belonged to the multidrug resistance exporter (TC 3.A.1.201) subfamily of the ABC-B family, the conjugate transporter (TC 3.A.1.208) subfamily of the ABC-C family, and the pleiotropic drug resistance (PDR) (TC 3.A.1.205) subfamily of the ABC-G family. These findings highlight the significance of ABC transporter genes that control cellular detoxification against toxic substances (e.g., chemical pesticides and mycotoxins) in sustaining a virulence of S. mycoparasitica for effective biotrophic mycoparasitism on the F. graminearum host. The findings of this study provide clues to better understand the biotrophic mycoparasitism of S. mycoparasitica interacting with the Fusarium host, which implies that the ABC transporter group of key proteins is involved in the mycoparasite’s virulence and multidrug resistance to toxic substances including cellular detoxification.
18
Teng, Qiu-Xu, Xiaofang Luo, Zi-Ning Lei, Jing-Quan Wang, John Wurpel, Zuodong Qin, and Dong-Hua Yang. "The Multidrug Resistance-Reversing Activity of a Novel Antimicrobial Peptide." Cancers 12, no. 7 (July 19, 2020): 1963. http://dx.doi.org/10.3390/cancers12071963.
Full textAbstract:
The overexpression of ATP-binding cassette (ABC) transporters is a common cause of multidrug resistance (MDR) in cancers. The intracellular drug concentration of cancer cells can be decreased relative to their normal cell counterparts due to increased expression of ABC transporters acting as efflux pumps of anticancer drugs. Over the past decades, antimicrobial peptides have been investigated as a new generation of anticancer drugs and some of them were reported to have interactions with ABC transporters. In this article, we investigated several novel antimicrobial peptides to see if they could sensitize ABCB1-overexpressing cells to the anticancer drugs paclitaxel and doxorubicin, which are transported by ABCB1. It was found that peptide XH-14C increased the intracellular accumulation of ABCB1 substrate paclitaxel, which demonstrated that XH-14C could reverse ABCB1-mediated MDR. Furthermore, XH-14C could stimulate the ATPase activity of ABCB1 and the molecular dynamic simulation revealed a stable binding pose of XH-14C-ABCB1 complex. There was no change on the expression level or the location of ABCB1 transporter with the treatment of XH-14C. Our results suggest that XH-14C in combination with conventional anticancer agents could be used as a novel strategy for cancer treatment.
19
He, Qiyi, Zhentian Yan, Fengling Si, Yong Zhou, Wenbo Fu, and Bin Chen. "ATP-Binding Cassette (ABC) Transporter Genes Involved in Pyrethroid Resistance in the Malaria Vector Anopheles sinensis: Genome-Wide Identification, Characteristics, Phylogenetics, and Expression Profile." International Journal of Molecular Sciences 20, no. 6 (March 20, 2019): 1409. http://dx.doi.org/10.3390/ijms20061409.
Full textAbstract:
background: The ATP-binding cassette (ABC) transporters family is one of the largest families of membrane proteins existing in all living organisms. Pyrethroid resistance has become the largest unique obstacle for mosquito control worldwide. ABC transporters are thought to be associated with pyrethroid resistance in some agricultural pests, but little information is known for mosquitoes. Herein, we investigated the diversity, location, characteristics, phylogenetics, and evolution of ABC transporter family of genes in the Anopheles sinensis genome, and identified the ABC transporter genes associated with pyrethroid resistance through expression profiles using RNA-seq and qPCR. Results: 61 ABC transporter genes are identified and divided into eight subfamilies (ABCA-H), located on 22 different scaffolds. Phylogenetic and evolution analyses with ABC transporters of A. gambiae, Drosophila melanogaster, and Homo sapiens suggest that the ABCD, ABCG, and ABCH subfamilies are monophyly, and that the ABCC and ABCG subfamilies have experienced a gene duplication event. Both RNA-seq and qPCR analyses show that the AsABCG28 gene is uniquely significantly upregulated gene in all three field pyrethroid-resistant populations (Anhui, Chongqing, and Yunnan provinces) in comparison with a laboratory-susceptible strain from Jiangsu province. The AsABCG28 is significantly upregulated at 12-h and 24-h after deltamethrin exposure in three-day-old female adults. Conclusion: This study provides the information frame for ABC transporter subfamily of genes, and lays an important basis for the better understanding and further research of ABC transporter function in insecticide toxification. The AsABCG28 gene is associated with pyrethroid detoxification, and it functions at later period in the detoxification process for xenobiotics transportation.
20
Wade, Philippa, Hannah Jackson, Louisa Taylor, Alistair Hume, Ian Kerr, and Beth Coyle. "MEDB-25. Do extracellular vesicles transfer a multidrug resistant phenotype via ABC transporters in medulloblastoma?" Neuro-Oncology 24, Supplement_1 (June 1, 2022): i110. http://dx.doi.org/10.1093/neuonc/noac079.399.
Full textAbstract:
Abstract INTRODUCTION: Medulloblastoma is the most common malignant paediatric brain tumour accounting for 20% of all childhood tumours; approximately one-third of patients present with metastatic disease at diagnosis and the outcome for these patients remains very poor. The high frequency of recurrence and metastatic relapse in medulloblastoma supports the idea of intrinsic drug resistance within cells. This work looks at the ATP-binding cassette (ABC) transporters, known to be upregulated in several cancers, and we hypothesise that extracellular vesicles may transfer ABC transporters to surrounding cells, promoting multidrug resistance within tumours. METHODS: The Cavalli dataset, made up of 763 patient samples, was used to assess the gene expression of a number of ABC transporters across medulloblastoma subgroups. ABC transporter gene and protein expression was then further assessed in medulloblastoma cell lines, including drug-tolerant lines, using qPCR and western blot. Cell viability analysis was used to assess changes in drug response. Matched cell and EV protein samples were used for proteomic analysis. RESULTS: Patient gene expression data showed that high expression of two ABC transporters correlated with reduced patient survival in high-risk subgroups. qPCR analysis of medulloblastoma cell lines showed differential subgroup expression patterns. Additionally, qPCR analysis of drug-tolerant cell lines showed significant increases in the expression of specific drug transporters across the subgroups. RNA-seq confirmed the presence of ABC transporter mRNA in exosomes isolated from high-risk medulloblastoma cell lines. Functional studies of EV transference of ABC transporters are ongoing. CONCLUSIONS: Data to date supports the hypothesis that multidrug transporter carrying extracellular vesicles may transfer their multidrug resistant phenotype to surrounding cells in medulloblastoma, promoting drug resistance. Future work will test this hypothesis by knocking down candidate ABC transporters and assessing the effect on transference of drug resistance by extracellular vesicles.
21
Ho, Maria, Donna E. Hogge, and Victor Ling. "Expression of the Human ATP-Binding Cassette Transporter Superfamily in Acute Myeloid Leukemia." Blood 104, no. 11 (November 16, 2004): 1179. http://dx.doi.org/10.1182/blood.v104.11.1179.1179.
Full textAbstract:
Abstract Members of the ATP-Binding-Cassette (ABC) transporter superfamily of proteins are involved in resistance to multiple chemotherapeutic drugs ( Multidrug Resistance or MDR) in a variety of malignant cells including leukemic blasts. Overexpression of some ABC transporters has been demonstrated in acute myeloid leukemia (AML) and is associated with clinical MDR and failure of conventional chemotherapy, which occurs frequently in this leukemia. Recent studies have also demonstrated ABC transporter expression in primitive normal hematopoietic cells, including progenitors which may give rise to AML after malignant transformation. In this study we used quantitative Real-Time PCR to assess and compare the expression level of all 47 known human ABC transporters in AML blasts and normal peripheral blood. Peripheral blood blasts from 17 patients with newly-diagnosed AML who subsequently received conventional remission induction therapy with cytosine arabinoside and daunorubicin were studied; 11 of these subsequently achieved complete remission of their leukemia while the remaining 6 had chemotherapy refractory disease. Contrary to expectations, no consistent difference in mRNA levels was found between the chemotherapy responsive and refractory groups of patient samples for any ABC transporter, including known MDR-related members such as MDR-1 and BCRP. Profiling of the 47 ABC transporters in 12 normal peripheral blood samples (6 mobilized with G-CSF, 6 non-mobilized) showed that TAP1 and MRP3 were 3.3-fold (P = 0.032) and 24-fold (P = 0.012), respectively, higher in normal donors as compared to AML patients. ABCA7, ABCB8, MRP3, MRP7, ALDP, PMP70 and PMP69 were greater than 3-fold higher (P < 0.05) in G-CSF-mobilized as compared to steady state normal blood. These results suggest that levels of ABC transporter mRNA expression in AML blasts prior to chemotherapy are not predictive of treatment response. This raises questions regarding the role of ABC transporters in intrinsic as opposed to induced or acquired chemotherapy drug resistance, which in turn has important implications in clinical usage of ABC-reversal agents. In addition, we identified expression of a variety of ABC transporters in both AML blasts and normal blood cells suggesting that this class of transporter proteins may have importance in both normal and malignant hematopoiesis.
22
Wanner, Christian, and Jörg Soppa. "Genetic Identification of Three ABC Transporters as Essential Elements for Nitrate Respiration in Haloferax volcanii." Genetics 152, no. 4 (August 1, 1999): 1417–28. http://dx.doi.org/10.1093/genetics/152.4.1417.
Full textAbstract:
Abstract More than 40 nitrate respiration-deficient mutants of Haloferax volcanii belonging to three different phenotypic classes were isolated. All 15 mutants of the null phenotype were complemented with a genomic library of the wild type. Wild-type copies of mutated genes were recovered from complemented mutants using two different approaches. The DNA sequences of 13 isolated fragments were determined. Five fragments were found to overlap; therefore nine different genomic regions containing genes essential for nitrate respiration could be identified. Three genomic regions containing genes coding for subunits of ABC transporters were further characterized. In two cases, genes coding for an ATP-binding subunit and a permease subunit were clustered and overlapped by four nucleotides. The third gene for a permease subunit had no additional ABC transporter gene in proximity. One ABC transporter was found to be glucose specific. The mutant reveals that the ABC transporter solely mediates anaerobic glucose transport. Based on sequence similarity, the second ABC transporter is proposed to be molybdate specific, explaining its essential role in nitrate respiration. The third ABC transporter is proposed to be anion specific. Genome sequencing has shown that ABC transporters are widespread in Archaea. Nevertheless, this study represents only the second example of a functional characterization.
23
Sato, Ryoichi, Satomi Adegawa, Xiaoyi Li, Shiho Tanaka, and Haruka Endo. "Function and Role of ATP-Binding Cassette Transporters as Receptors for 3D-Cry Toxins." Toxins 11, no. 2 (February 19, 2019): 124. http://dx.doi.org/10.3390/toxins11020124.
Full textAbstract:
When ABC transporter family C2 (ABCC2) and ABC transporter family B1 (ABCB1) were heterologously expressed in non-susceptible cultured cells, the cells swelled in response to Cry1A and Cry3 toxins, respectively. Consistent with the notion that 3D-Cry toxins form cation-permeable pores, Bombyx mori ABCC2 (BmABCC2) facilitated cation-permeable pore formation by Cry1A when expressed in Xenopus oocytes. Furthermore, BmABCC2 had a high binding affinity (KD) to Cry1Aa of 3.1 × 10−10 M. These findings suggest that ABC transporters, including ABCC2 and ABCB1, are functional receptors for 3D-Cry toxins. In addition, the Cry2 toxins most distant from Cry1A toxins on the phylogenetic tree used ABC transporter A2 as a receptor. These data suggest that 3D-Cry toxins use ABC transporters as receptors. In terms of inducing cell swelling, ABCC2 has greater activity than cadherin-like receptor. The pore opening of ABC transporters was hypothesized to be linked to their receptor function, but this was repudiated by experiments using mutants deficient in export activity. The synergistic relationship between ABCC2 and cadherin-like receptor explains their ability to cause resistance in one species of insect.
24
Jedlitschky, Gabriele, Andreas Greinacher, and Heyo K. Kroemer. "Transporters in human platelets: physiologic function and impact for pharmacotherapy." Blood 119, no. 15 (April 12, 2012): 3394–402. http://dx.doi.org/10.1182/blood-2011-09-336933.
Full textAbstract:
Platelets store signaling molecules (eg, serotonin and ADP) within their granules. Transporters mediate accumulation of these molecules in platelet granules and, on platelet activation, their translocation across the plasma membrane. The balance between transporter-mediated uptake and elimination of signaling molecules and drugs in platelets determines their intracellular concentrations and effects. Several members of the 2 major transporter families, ATP-binding cassette (ABC) transporters and solute carriers (SLCs), have been identified in platelets. An example of an ABC transporter is MRP4 (ABCC4), which facilitates ADP accumulation in dense granules. MRP4 is a versatile transporter, and various additional functions have been proposed, notably lipid mediator release and a role in aspirin resistance. Several other ABC proteins have been detected in platelets with functions in glutathione and lipid homeostasis. The serotonin transporter (SERT, SLC6A4) in the platelet plasma membrane represents a well-characterized example of the SLC family. Moreover, recent experiments indicate expression of OATP2B1 (SLCO2B1), a high affinity transporter for certain statins, in platelets. Changes in transporter localization and expression can affect platelet function and drug sensitivity. This review summarizes available data on the physiologic and pharmacologic role of transporters in platelets.
25
Pinos, Daniel, Anabel Millán-Leiva, Juan Ferré, and Patricia Hernández-Martínez. "New Paralogs of the Heliothis virescens ABCC2 Transporter as Potential Receptors for Bt Cry1A Proteins." Biomolecules 14, no. 4 (March 26, 2024): 397. http://dx.doi.org/10.3390/biom14040397.
Full textAbstract:
The ATP-binding cassette (ABC) transporters are a superfamily of membrane proteins. These active transporters are involved in the export of different substances such as xenobiotics. ABC transporters from subfamily C (ABCC) have also been described as functional receptors for different insecticidal proteins from Bacillus thuringiensis (Bt) in several lepidopteran species. Numerous studies have characterized the relationship between the ABCC2 transporter and Bt Cry1 proteins. Although other ABCC transporters sharing structural and functional similarities have been described, little is known of their role in the mode of action of Bt proteins. For Heliothis virescens, only the ABCC2 transporter and its interaction with Cry1A proteins have been studied to date. Here, we have searched for paralogs to the ABCC2 gene in H. virescens, and identified two new ABC transporter genes: HvABCC3 and HvABCC4. Furthermore, we have characterized their gene expression in the midgut and their protein topology, and compared them with that of ABCC2. Finally, we discuss their possible interaction with Bt proteins by performing protein docking analysis.
26
Borghi, Lorenzo, Joohyun Kang, Donghwi Ko, Youngsook Lee, and Enrico Martinoia. "The role of ABCG-type ABC transporters in phytohormone transport." Biochemical Society Transactions 43, no. 5 (October 1, 2015): 924–30. http://dx.doi.org/10.1042/bst20150106.
Full textAbstract:
Plant hormones (phytohormones) integrate endogenous and exogenous signals thus synchronizing plant growth with environmental and developmental changes. Similar to animals, phytohormones have distinct source and target tissues, hence controlled transport and focused targeting are required for their functions. Many evidences accumulated in the last years about the regulation of long-distance and directional transport of phytohormones. ATP-binding cassette (ABC) transporters turned out to play major roles in routing phytohormones not only in the plant body but also towards the outer environment. The ABCG-type proteins ABCG25 and ABCG40 are high affinity abscisic acid (ABA) transporters. ABCG14 is highly co-expressed with cytokinin biosynthesis and is the major root-to-shoot cytokinin transporter. Pleiotropic drug resistance1 (PDR1) from Petunia hybrida transports strigolactones (SLs) from the root tip to the plant shoot but also outside to the rhizosphere, where SLs are the main attractants to mycorrhizal fungi. Last but not least, ABCG36 and ABCG37 possibly play a dual role in coumarine and IBA transport.
27
Zembruski, Nadine Cécile Luise, Walter Emil Haefeli, and Johanna Weiss. "Interaction Potential of Etravirine with Drug Transporters AssessedIn Vitro." Antimicrobial Agents and Chemotherapy 55, no. 3 (December 28, 2010): 1282–84. http://dx.doi.org/10.1128/aac.01527-10.
Full textAbstract:
ABSTRACTEtravirine is a novel nonnucleoside reverse transcriptase inhibitor (NNRTI) for the treatment of HIV-1 infections. ABC transporters potentially mediate clinically relevant drug-drug interactions. We assessed substrate characteristics and the inhibitory and inductive potential of etravirine on ABC transporters. Etravirine did not inhibit P-gp/ABCB1 and was not transported by the tested ABC transporters but was a potent inhibitor of BCRP/ABCG2. Etravirine induced several ABC transporters, especially BCRP/ABCG2. These data demonstrate that etravirine has the potential for drug-drug interactions by modulation of expression and function of several ABC transporters.
28
Langmann, Thomas, Richard Mauerer, Alexandra Zahn, Christoph Moehle, Mario Probst, Wolfgang Stremmel, and Gerd Schmitz. "Real-Time Reverse Transcription-PCR Expression Profiling of the Complete Human ATP-Binding Cassette Transporter Superfamily in Various Tissues." Clinical Chemistry 49, no. 2 (February 1, 2003): 230–38. http://dx.doi.org/10.1373/49.2.230.
Full textAbstract:
Abstract Background: ATP-binding cassette (ABC) transporters are involved in many physiologic processes, such as lipid transport, sterol homeostasis, immune mechanisms, and drug transport, and cause various human inherited diseases. Thus, the analysis of ABC transporter mRNA expression profiles for basic research, especially in the field of lipid metabolism, for clinical diagnosis, and for monitoring of drug effects is of great interest. Methods: We have developed a rapid, accurate, and highly sensitive real-time reverse transcription-PCR (RT-PCR) method for detection and quantification of all 47 currently known members of the ABC transporter superfamily. Our expression analysis is based on relative quantification using a calibration curve method. With our assay, expression monitoring of a large number of RNA samples in a 384-well format with only 50 ng of total RNA is possible. Results: In contrast to previous expression analyses of single ABC genes, our method allows the rapid and complete analysis of all ABC transporters in given RNA samples. We used our newly established expression panel to study the gene expression of all human ABC transporters in 20 different human tissues. As a result, we identified tissues with high transcriptional activity for ABC transporters. These organs are mainly involved in secretory function (adrenal gland), metabolic function (liver), barrier function (lung, trachea, small intestine), and tropic function (placenta, uterus). Conclusions: Our RT-PCR assay allows rapid, high-throughput transcriptional profiling of the complete ABC transporter superfamily and thus provides a new enabling tool for research, clinical diagnosis of disease, and drug testing and development.
29
Venter, H., S. Shahi, L. Balakrishnan, S. Velamakanni, A. Bapna, B. Woebking, and H. W. van Veen. "Similarities between ATP-dependent and ion-coupled multidrug transporters." Biochemical Society Transactions 33, no. 5 (October 26, 2005): 1008–11. http://dx.doi.org/10.1042/bst0331008.
Full textAbstract:
The movement of drugs across biological membranes is mediated by two major classes of membrane transporters. Primary-active, ABC (ATP-binding cassette) multidrug transporters are dependent on ATP-binding/hydrolysis, whereas secondary-active multidrug transporters are coupled to the proton (or sodium)-motive force that exists across the plasma membrane. Recent work on LmrA, an ABC multidrug transporter in Lactococcus lactis, suggests that primary- and secondary-active multidrug transporters share functional and structural features. Some of these similarities and their implications for the mechanism of transport by ABC multidrug transporters will be discussed.
30
Oepen, Kristin, Hüseyin Özbek, Anja Schüffler, Johannes C. Liermann, Eckhard Thines, and Dirk Schneider. "Myristic Acid Inhibits the Activity of the Bacterial ABC Transporter BmrA." International Journal of Molecular Sciences 22, no. 24 (December 17, 2021): 13565. http://dx.doi.org/10.3390/ijms222413565.
Full textAbstract:
ATP-binding cassette (ABC) transporters are conserved in all kingdoms of life, where they transport substrates against a concentration gradient across membranes. Some ABC transporters are known to cause multidrug resistances in humans and are able to transport chemotherapeutics across cellular membranes. Similarly, BmrA, the ABC transporter of Bacillus subtilis, is involved in excretion of certain antibiotics out of bacterial cells. Screening of extract libraries isolated from fungi revealed that the C14 fatty acid myristic acid has an inhibitory effect on the BmrA ATPase as well as the transport activity. Thus, a natural membrane constituent inhibits the BmrA activity, a finding with physiological consequences as to the activity and regulation of ABC transporter activities in biological membranes.
31
Kotlyarov, Stanislav, and Anna Kotlyarova. "Analysis of ABC Transporter Gene Expression in Atherosclerosis." Cardiogenetics 11, no. 4 (November 4, 2021): 204–20. http://dx.doi.org/10.3390/cardiogenetics11040021.
Full textAbstract:
ABC transporters are a large family of membrane proteins that transport chemically diverse substrates across the cell membrane. Disruption of transport mechanisms mediated by ABC transporters causes the development of various diseases, including atherosclerosis. Methods: A bioinformatic analysis of a dataset from Gene Expression Omnibus (GEO) was performed. A GEO dataset containing data on gene expression levels in samples of atherosclerotic lesions and control arteries without atherosclerotic lesions from carotid, femoral, and infrapopliteal arteries was used for analysis. To evaluate differentially expressed genes, a bioinformatic analysis was performed in comparison groups using the limma package in R (v. 4.0.2) and the GEO2R and Phantasus tools (v. 1.11.0). Results: The obtained data indicate the differential expression of many ABC transporters belonging to different subfamilies. The differential expressions of ABC transporter genes involved in lipid transport, mechanisms of multidrug resistance, and mechanisms of ion exchange are shown. Differences in the expression of transporters in tissue samples from different arteries are established. Conclusions: The expression of ABC transporter genes demonstrates differences in atherosclerotic samples and normal arteries, which may indicate the involvement of transporters in the pathogenesis of atherosclerosis.
32
Sharma, Monika, Raman Manoharlal, Suneet Shukla, Nidhi Puri, Tulika Prasad, Suresh V. Ambudkar, and Rajendra Prasad. "Curcumin Modulates Efflux Mediated by Yeast ABC Multidrug Transporters and Is Synergistic with Antifungals." Antimicrobial Agents and Chemotherapy 53, no. 8 (May 26, 2009): 3256–65. http://dx.doi.org/10.1128/aac.01497-08.
Full textAbstract:
ABSTRACT Curcumin (CUR), a natural product of turmeric, from rhizomes of Curcuma longa, is a known agent of reversal of drug resistance phenotypes in cancer cells overexpressing ATP-binding cassette (ABC) transporters, viz., ABCB1, ABCG2, and ABCC1. In the present study, we evaluated whether CUR could also modulate multidrug transporters of yeasts that belong either to the ABC family or to the major facilitator superfamily (MFS). The effect of CUR on multidrug transporter proteins was demonstrated by examining rhodamine 6G (R6G) efflux in Saccharomyces cerevisiae cells overexpressing the Candida albicans ABC transporters Cdr1p and Cdr2p (CaCdr1p and CaCdr2p, respectively) and the MFS transporters CaMdr1p and S. cerevisiae Pdr5p. CUR decreased the extracellular concentration of R6G in ABC transporter-expressing cells but had no effect on methotrexate efflux mediated through the MFS transporter CaMdr1p. CUR competitively inhibited R6G efflux and the photolabeling of CaCdr1p by [125I]iodoarylazidoprazosin, a drug analogue of the substrate prazosin (50% inhibitory concentration, 14.2 μM). Notably, the mutant variants of CaCdr1p that displayed abrogated efflux of R6G also showed reduced modulation by CUR. Drug susceptibility testing of ABC protein-expressing cells by spot assays and checkerboard tests revealed that CUR was selectively synergistic with drug substrates such as R6G, ketoconazole, itraconazole, and miconazole but not with fluconazole, voriconazole, anisomycin, cycloheximide, or FK520. Taken together, our results provide the first evidence that CUR modulates only ABC multidrug transporters and could be exploited in combination with certain conventional antifungal drugs to reverse multidrug resistance in Candida cells.
33
Zhao, Yan, Deren Hou, Xialu Feng, Fangbo Lin, and Jing Luo. "Role of ABC transporters in the pathology of Alzheimer’s disease." Reviews in the Neurosciences 28, no. 2 (February 1, 2017): 155–59. http://dx.doi.org/10.1515/revneuro-2016-0060.
Full textAbstract:
AbstractThe ATP-binding cassette (ABC) transporter superfamily is a large family of proteins that transport specific molecules across membranes. These proteins are associated with both cholesterol metabolism and Alzheimer’s disease (AD). Cholesterol homeostasis has a key role in AD, and ABC transporters are important mediators of lipid transportation. Emerging evidence suggests that decreased expression and hypofunction of ABC transporters are crucial to the occurrence and development of AD. In the present article, we review the current knowledge regarding ABC transporters and speculate on their role in the pathogenesis of AD.
34
Stockner, Thomas, Anna Mullen, and Fraser MacMillan. "Investigating the dynamic nature of the ABC transporters: ABCB1 and MsbA as examples for the potential synergies of MD theory and EPR applications." Biochemical Society Transactions 43, no. 5 (October 1, 2015): 1023–32. http://dx.doi.org/10.1042/bst20150138.
Full textAbstract:
ABC transporters are primary active transporters found in all kingdoms of life. Human multidrug resistance transporter ABCB1, or P-glycoprotein, has an extremely broad substrate spectrum and confers resistance against chemotherapy drug treatment in cancer cells. The bacterial ABC transporter MsbA is a lipid A flippase and a homolog to the human ABCB1 transporter, with which it partially shares its substrate spectrum. Crystal structures of MsbA and ABCB1 have been solved in multiple conformations, providing a glimpse into the possible conformational changes the transporter could be going through during the transport cycle. Crystal structures are inherently static, while a dynamic picture of the transporter in motion is needed for a complete understanding of transporter function. Molecular dynamics (MD) simulations and electron paramagnetic resonance (EPR) spectroscopy can provide structural information on ABC transporters, but the strength of these two methods lies in the potential to characterise the dynamic regime of these transporters. Information from the two methods is quite complementary. MD simulations provide an all atom dynamic picture of the time evolution of the molecular system, though with a narrow time window. EPR spectroscopy can probe structural, environmental and dynamic properties of the transporter in several time regimes, but only through the attachment sites of an exogenous spin label. In this review the synergistic effects that can be achieved by combining the two methods are highlighted, and a brief methodological background is also presented.
35
Agboh, Kelvin, Calvin H. F. Lau, Yvonne S. K. Khoo, Himansha Singh, Sagar Raturi, Asha V. Nair, Julie Howard, et al. "Powering the ABC multidrug exporter LmrA: How nucleotides embrace the ion-motive force." Science Advances 4, no. 9 (September 2018): eaas9365. http://dx.doi.org/10.1126/sciadv.aas9365.
Full textAbstract:
LmrA is a bacterial ATP-binding cassette (ABC) multidrug exporter that uses metabolic energy to transport ions, cytotoxic drugs, and lipids. Voltage clamping in a Port-a-Patch was used to monitor electrical currents associated with the transport of monovalent cationic HEPES+by single-LmrA transporters and ensembles of transporters. In these experiments, one proton and one chloride ion are effluxed together with each HEPES+ion out of the inner compartment, whereas two sodium ions are transported into this compartment. Consequently, the sodium-motive force (interior negative and low) can drive this electrogenic ion exchange mechanism in cells under physiological conditions. The same mechanism is also relevant for the efflux of monovalent cationic ethidium, a typical multidrug transporter substrate. Studies in the presence of Mg-ATP (adenosine 5′-triphosphate) show that ion-coupled HEPES+transport is associated with ATP-bound LmrA, whereas ion-coupled ethidium transport requires ATP binding and hydrolysis. HEPES+is highly soluble in a water-based environment, whereas ethidium has a strong preference for residence in the water-repelling plasma membrane. We conclude that the mechanism of the ABC transporter LmrA is fundamentally related to that of an ion antiporter that uses extra steps (ATP binding and hydrolysis) to retrieve and transport membrane-soluble substrates from the phospholipid bilayer.
36
Xiong, Jie, Ding-an Mao, and Li-qun Liu. "Research Progress on the Role of ABC Transporters in the Drug Resistance Mechanism of Intractable Epilepsy." BioMed Research International 2015 (2015): 1–10. http://dx.doi.org/10.1155/2015/194541.
Full textAbstract:
The pathogenesis of intractable epilepsy is not fully clear. In recent years, both animal and clinical trials have shown that the expression of ATP-binding cassette (ABC) transporters is increased in patients with intractable epilepsy; additionally, epileptic seizures can lead to an increase in the number of sites that express ABC transporters. These findings suggest that ABC transporters play an important role in the drug resistance mechanism of epilepsy. ABC transporters can perform the funcions of a drug efflux pump, which can reduce the effective drug concentration at epilepsy lesions by reducing the permeability of the blood brain barrier to antiepileptic drugs, thus causing resistance to antiepileptic drugs. Given the important role of ABC transporters in refractory epilepsy drug resistance, antiepileptic drugs that are not substrates of ABC transporters were used to obtain ABC transporter inhibitors with strong specificity, high safety, and few side effects, making them suitable for long-term use; therefore, these drugs can be used for future clinical treatment of intractable epilepsy.
37
Sims, Gregory E., and In-Geol Choi. "인간 ATP 결합카세트 수퍼페미리 단백질 분류를 위한 서브페미리 특이적인 모티프 프로화일링." Institute of Life Science and Natural Resources 30 (December 31, 2022): 41–51. http://dx.doi.org/10.33147/lsnrr.2022.30.1.41.
Full textAbstract:
The ATP binding cassette (ABC) transporter superfamily is ubiquitous in all three domains of life. The cellular and molecular functions of ABC transporters are diverse and essential to all living organisms. In human, mutations associated with ABC transporters are known to cause many genetic diseases. Although the members of ABC transporter superfamily share common sequential feature, the subfamily recognition is not a trivial task because of its domain complexity. The functional annotation begins with subfamily recognition. Here, we showed that a motif profiling provides simple and intuitive approach to recognize the subfamily level. Along with relation to the structural feature, the motif profiling approach will be a guide to annotate and understand molecular functions of subfamilies with a big superfamily
38
Luckenbach, Till, and David Epel. "ABCB- and ABCC-type transporters confer multixenobiotic resistance and form an environment-tissue barrier in bivalve gills." American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 294, no. 6 (June 2008): R1919—R1929. http://dx.doi.org/10.1152/ajpregu.00563.2007.
Full textAbstract:
Aquatic organisms and, in particular, filter feeders, such as mussels, are continuously exposed to toxicants dissolved in the water and, presumably, require adaptations to avoid the detrimental effects from such chemicals. Previous work indicates that activity of ATP-binding cassette (ABC) transporters protects mussels against toxicants, but the nature of these transporters and the structural basis of protection are not known. Here we meld studies on transporter function, gene expression, and localization of transporter protein in mussel gill tissue and show activity and expression of two xenobiotic transporter types in the gills, where they provide an effective structural barrier against chemicals. Activity of ABCB/MDR/P-glycoprotein and ABCC/MRP-type transporters was indicated by sensitivity of efflux of the test substrate calcein-AM to the ABCB inhibitor PSC-833 and the ABCC inhibitor MK-571. This activity profile is supported by our cloning of the complete sequence of two ABC transporter types from RNA in mussel tissue with a high degree of identity to transporters from the ABCB and ABCC subfamilies. Overall identity of the amino acid sequences with corresponding homologs from other organisms was 38–50% (ABCB) and 27–44% (ABCC). C219 antibody staining specific for ABCB revealed that this transporter was restricted to cells in the gill filaments with direct exposure to water flow. Taken together, our data demonstrate that ABC transporters form an active, physiological barrier at the tissue-environment interface in mussel gills, providing protection against environmental xenotoxicants.
39
Cuan, Rongrong, Shaoting Liu, Chuanyou Zhou, Shengqiang Wang, Yongliang Zheng, and Yongze Yuan. "Transcriptome Analysis of mfs2-Defective Penicillium digitatum Mutant to Reveal Importance of Pdmfs2 in Developing Fungal Prochloraz Resistance." Microorganisms 12, no. 5 (April 28, 2024): 888. http://dx.doi.org/10.3390/microorganisms12050888.
Full textAbstract:
Demethylation inhibitors (DMIs), including prochloraz, are popular fungicides to control citrus postharvest pathogens such as Penicillium digitatum (green mold). However, many P. digitatum strains have developed prochloraz resistance, which decreases drug efficacy. Specific major facilitator superfamily (MFS) transporter gene mfs2, encoding drug-efflux pump protein MFS2, has been identified in P. digitatum strain F6 (PdF6) to confer fungal strain prochloraz resistance. However, except for the drug-efflux pump function of MFS2, other mechanisms relating to the Pdmfs2 are not fully clear. The present study reported a transcriptome investigation on the mfs2-defective P. digitatum strain. Comparing to the wild-type strain, the mfs2-defective strain showed 717 differentially expressed genes (DEGs) without prochloraz induction, and 1221 DEGs with prochloraz induction. The obtained DEGs included multiple isoforms of MFS transporter-encoding genes, ATP-binding cassette (ABC) transporter-encoding genes, and multidrug and toxic compound extrusion (MATE) family protein-encoding genes. Many of these putative drug-efflux pump protein-encoding genes had significantly lower transcript abundances in the mfs2-defective P. digitatum strain at prochloraz induction, as compared to the wild-type strain, including twenty-two MFS transporter-encoding genes (MFS1 to MFS22), two ABC transporter-encoding genes (ABC1 and ABC2), and three MATE protein-encoding genes (MATE1 to MATE3). The prochloraz induction on special drug-efflux pump protein genes in the wild-type strain was not observed in the mfs2-defective strain, including MFS21, MFS22, ABC2, MATE1, MATE2, and MATE3. On the other hand, the up-regulation of other drug-efflux pump protein genes in the mfs2-defective strain cannot recover the fungal prochloraz resistance, including MFS23, MFS26, MFS27, MFS31, MFS33, and ABC3 to ABC8. The functional enrichment of DEGs based on Kyoto Encyclopedia of Genes and Genomes (KEGG), Clusters of Orthologous Groups (COG), and euKaryotic Orthologous Groups (KOG) database resources suggested some essential contributors to the mfs2-relating prochloraz resistance, including ribosome biosynthesis-related genes, oxidative phosphorylation genes, steroid biosynthesis-related genes, fatty acid and lipid metabolism-related genes, and carbon- and nitrogen-metabolism-related genes. The results indicated that the MFS2 transporter might be involved in the regulation of multiple drug-efflux pump protein gene expressions and multiple metabolism-related gene expressions, thus playing an important role in developing P. digitatum prochloraz resistance.
40
Golin, John, and Suresh V. Ambudkar. "The multidrug transporter Pdr5 on the 25th anniversary of its discovery: an important model for the study of asymmetric ABC transporters." Biochemical Journal 467, no. 3 (April 17, 2015): 353–63. http://dx.doi.org/10.1042/bj20150042.
Full textAbstract:
Asymmetric ABC (ATP-binding cassette) transporters make up a significant proportion of this important superfamily of integral membrane proteins. These proteins contain one canonical (catalytic) ATP-binding site and a second atypical site with little enzymatic capability. The baker's yeast (Saccharomyces cerevisiae) Pdr5 multidrug transporter is the founding member of the Pdr subfamily of asymmetric ABC transporters, which exist only in fungi and slime moulds. Because these organisms are of considerable medical and agricultural significance, Pdr5 has been studied extensively, as has its medically important homologue Cdr1 from Candida albicans. Genetic and biochemical analyses of Pdr5 have contributed important observations that are likely to be applicable to mammalian asymmetric ABC multidrug transporter proteins, including the basis of transporter promiscuity, the function of the non-catalytic deviant ATP-binding site, the most complete description of an in vivo transmission interface, and the recent discovery that Pdr5 is a molecular diode (one-way gate). In the present review, we discuss the observations made with Pdr5 and compare them with findings from clinically important asymmetric ABC transporters, such as CFTR (cystic fibrosis transmembrane conductance regulator), Cdr1 and Tap1/Tap2.
41
Shimizu, Takafumi, Yuri Kanno, Hiromi Suzuki, Shunsuke Watanabe, and Mitsunori Seo. "Arabidopsis NPF4.6 and NPF5.1 Control Leaf Stomatal Aperture by Regulating Abscisic Acid Transport." Genes 12, no. 6 (June 8, 2021): 885. http://dx.doi.org/10.3390/genes12060885.
Full textAbstract:
The plant hormone abscisic acid (ABA) is actively synthesized in vascular tissues and transported to guard cells to promote stomatal closure. Although several transmembrane ABA transporters have been identified, how the movement of ABA within plants is regulated is not fully understood. In this study, we determined that Arabidopsis NPF4.6, previously identified as an ABA transporter expressed in vascular tissues, is also present in guard cells and positively regulates stomatal closure in leaves. We also found that mutants defective in NPF5.1 had a higher leaf surface temperature compared to the wild type. Additionally, NPF5.1 mediated cellular ABA uptake when expressed in a heterologous yeast system. Promoter activities of NPF5.1 were detected in several leaf cell types. Taken together, these observations indicate that NPF5.1 negatively regulates stomatal closure by regulating the amount of ABA that can be transported from vascular tissues to guard cells.
42
Rismondo, Jeanine, and Lisa Maria Schulz. "Not Just Transporters: Alternative Functions of ABC Transporters in Bacillus subtilis and Listeria monocytogenes." Microorganisms 9, no. 1 (January 13, 2021): 163. http://dx.doi.org/10.3390/microorganisms9010163.
Full textAbstract:
ATP-binding cassette (ABC) transporters are usually involved in the translocation of their cognate substrates, which is driven by ATP hydrolysis. Typically, these transporters are required for the import or export of a wide range of substrates such as sugars, ions and complex organic molecules. ABC exporters can also be involved in the export of toxic compounds such as antibiotics. However, recent studies revealed alternative detoxification mechanisms of ABC transporters. For instance, the ABC transporter BceAB of Bacillus subtilis seems to confer resistance to bacitracin via target protection. In addition, several transporters with functions other than substrate export or import have been identified in the past. Here, we provide an overview of recent findings on ABC transporters of the Gram-positive organisms B. subtilis and Listeria monocytogenes with transport or regulatory functions affecting antibiotic resistance, cell wall biosynthesis, cell division and sporulation.
43
Saib, Sonia, and Xavier Delavenne. "Inflammation Induces Changes in the Functional Expression of P-gp, BCRP, and MRP2: An Overview of Different Models and Consequences for Drug Disposition." Pharmaceutics 13, no. 10 (September 23, 2021): 1544. http://dx.doi.org/10.3390/pharmaceutics13101544.
Full textAbstract:
The ATP-binding cassette (ABC) transporters play a key role in drug pharmacokinetics. These membrane transporters expressed within physiological barriers can be a source of pharmacokinetic variability. Changes in ABC transporter expression and functionality may consequently affect the disposition of substrate drugs, resulting in different drug exposure. Inflammation, present in several acute and chronic diseases, has been identified as a source of modulation in drug transporter expression leading to variability in drug response. Its regulation may be particularly dangerous for drugs with a narrow therapeutic index. In this context, numerous in vitro and in vivo models have shown up- or downregulation in the expression and functionality of ABC transporters under inflammatory conditions. Nevertheless, the existence of contradictory data and the lack of standardization for the models used have led to a less conclusive interpretation of these data.
44
Apostoli, Anthony J., and Christopher J. B. Nicol. "PPAR Medicines and Human Disease: The ABCs of It All." PPAR Research 2012 (2012): 1–16. http://dx.doi.org/10.1155/2012/504918.
Full textAbstract:
ATP-dependent binding cassette (ABC) transporters are a family of transmembrane proteins that pump a variety of hydrophobic compounds across cellular and subcellular barriers and are implicated in human diseases such as cancer and atherosclerosis. Inhibition of ABC transporter activity showed promise in early preclinical studies; however, the outcomes in clinical trials with these agents have not been as encouraging. Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors that regulate genes involved in fat and glucose metabolism, and inflammation. Activation of PPAR signaling is also reported to regulate ABC gene expression. This suggests the potential of PPAR medicines as a novel means of controlling ABC transporter activity at the transcriptional level. This paper summarizes the advances made in understanding how PPAR medicines affect ABC transporters, and the potential implications for impacting on human diseases, in particular with respect to cancer and atherosclerosis.
45
Paul, Sanjoy, Daniel Diekema, and W. Scott Moye-Rowley. "Contributions of Aspergillus fumigatus ATP-Binding Cassette Transporter Proteins to Drug Resistance and Virulence." Eukaryotic Cell 12, no. 12 (October 11, 2013): 1619–28. http://dx.doi.org/10.1128/ec.00171-13.
Full textAbstract:
ABSTRACTIn yeast cells such as those ofSaccharomyces cerevisiae, expression of ATP-binding cassette (ABC) transporter proteins has been found to be increased and correlates with a concomitant elevation in azole drug resistance. In this study, we investigated the roles of twoAspergillus fumigatusproteins that share high sequence similarity withS. cerevisiaePdr5, an ABC transporter protein that is commonly overproduced in azole-resistant isolates in this yeast. The twoA. fumigatusgenes encoding the ABC transporters sharing the highest sequence similarity toS. cerevisiaePdr5 are calledabcAandabcBhere. We constructed deletion alleles of these two different ABC transporter-encoding genes in three different strains ofA. fumigatus. Loss ofabcBinvariably elicited increased azole susceptibility, whileabcAdisruption alleles had variable phenotypes. Specific antibodies were raised to both AbcA and AbcB proteins. These antisera allowed detection of AbcB in wild-type cells, while AbcA could be visualized only when overproduced from thehspApromoter inA. fumigatus. Overproduction of AbcA also yielded increased azole resistance. Green fluorescent protein fusions were used to provide evidence that both AbcA and AbcB are localized to the plasma membrane inA. fumigatus. Promoter fusions to firefly luciferase suggested that expression of both ABC transporter-encoding genes is inducible by azole challenge. Virulence assays implicated AbcB as a possible factor required for normal pathogenesis. This work provides important new insights into the physiological roles of ABC transporters in this major fungal pathogen.
46
Gong, Xiaoping, and Shanhong Wang. "New Insights into Evolution of the ABC Transporter Family in Mesostigma viride, a Unicellular Charophyte Algae." Current Issues in Molecular Biology 44, no. 4 (April 11, 2022): 1646–60. http://dx.doi.org/10.3390/cimb44040112.
Full textAbstract:
ATP-binding cassette (ABC) transporters play an important role in driving the exchange of multiple molecules across cell membranes. The plant ABC transporter family is among the largest protein families, and recent progress has advanced our understanding of ABC classification. However, the ancestral form and deep origin of plant ABCs remain elusive. In this study, we identified 59 ABC transporters in Mesostigma viride, a unicellular charophyte algae that represents the earliest diverging lineage of streptophytes, and 1034 ABCs in genomes representing a broad taxonomic sampling from distantly related plant evolutionary lineages, including chlorophytes, charophytes, bryophytes, lycophytes, gymnosperms, basal angiosperms, monocots, and eudicots. We classified the plant ABC transporters by comprehensive phylogenetic analysis of each subfamily. Our analysis revealed the ancestral type of ABC proteins as well as duplication and gene loss during plant evolution, contributing to our understanding of the functional conservation and diversity of this family. In summary, this study provides new insight into the origin and evolution of plant ABC transporters.
47
Geisler, Markus. "Regulation von ABC-Transportern durch FKBPs." BIOspektrum 27, no. 2 (March 2021): 131–34. http://dx.doi.org/10.1007/s12268-021-1548-x.
Full textAbstract:
AbstractThe plant hormone auxin is distributed in the plant by a sophisticated network of importers and exporters, including members of the ABCB subclass of ATP-binding cassette (ABC) transporters. ABCB-mediated auxin transport is controlled by Twisted Dwarf1, a member of the FK506-binding protein (FKBP) family. Here, we summarize current knowledge on ABC transporter regulation by FKBPs, which seems to be conserved over kingdoms and ABC subfamilies arguing for conserved mechanism of plant and mammalian post-translational transporter regulation.
48
TRIBBLE, N. D., J. F. BURKA, F. S. B. KIBENGE, and G. M. WRIGHT. "Identification and localization of a putative ATP-binding cassette transporter in sea lice (Lepeophtheirus salmonis) and host Atlantic salmon (Salmo salar)." Parasitology 135, no. 2 (October 26, 2007): 243–55. http://dx.doi.org/10.1017/s0031182007003861.
Full textAbstract:
SUMMARYSome members of the ABC-transporter superfamily, such as P-glycoprotein and the multidrug resistance associated protein, may confer resistance to the avermectin subclass of macrocyclic lactones. The aim of this study was to examine the presence of ABC transporters in both sea lice (Lepeophtheirus salmonis) and its Atlantic salmon host (Salmo salar) using monoclonal antibodies (C219 and JSB-1, with high selectivity for P-gp) and a new polyclonal antibody (SL0525) generated against a putative sea louse ABC transporter. The antibody raised to SL0525 did not react with rat P-gp, suggesting that an ABC transporter, not necessarily P-gp, was isolated. C219 was the only antibody to localize P-gp in all 3 salmon tissues (intestine, kidney and liver). American lobster (Homarus americanus) was used as a reference crustacean for L. salmonis immunostaining reactions and showed positive staining in the hepatopancreatic and intestinal tissues with all 3 antibodies. The L. salmonis showed positive staining in the intestinal epithelial lining with all antibodies. This report represents the first documented evidence for the expression of ABC transporters in L. salmonis, its Atlantic salmon host, and the American lobster.
49
Alrosan, Amjad, Shereen M. Aleidi, Alryel Yang, Andrew J. Brown, and Ingrid C. Gelissen. "The Adaptor Protein Alix is Involved in the Interaction Between the Ubiquitin Ligase NEDD4-1 and its Targets, ABCG1 and ABCG4." International Journal of Molecular Sciences 20, no. 11 (June 2, 2019): 2714. http://dx.doi.org/10.3390/ijms20112714.
Full textAbstract:
Several ATP-Binding Cassette (ABC) transporters, including ABCG1 and the related ABCG4, are essential regulators of cellular lipid homeostasis. ABCG1 is expressed ubiquitously and is functional in the context of atherosclerosis. However, ABCG4 is expressed almost exclusively in brain and has been linked to Alzheimer’s disease (AD). These transporters are highly regulated post-translationally by E3 ubiquitin ligases, with the ligase NEDD4-1 (Neural precursor cell-expressed developmentally downregulated gene 4) implicated in their protein stability. In this study, we investigated interacting partners of ABCG1 using peptide-mass spectrometry and identified the potential adaptor protein, Alix (apoptosis-linked gene 2-interacting protein X). In this paper, we hypothesized and investigated whether Alix could facilitate the interaction between NEDD4-1 and the ABC transporters. We showed that Alix and NEDD4-1 proteins were co-expressed in several commonly used cell lines. Knockdown of Alix in cells overexpressing ABCG1 or ABCG4 increased transporter protein expression while co-immunoprecipitation experiments showed interaction between NEDD4-1, Alix, and ABC transporters. In summary, we provide evidence that Alix serves as a co-factor for the interaction between the E3-ubiquitin ligase NEDD4-1 and the ABC transporter targets, ABCG1 and ABCG4.
50
Sharma, Parul, Navneet Singh, and Siddharth Sharma. "ATP binding cassette transporters and cancer: revisiting their controversial role." Pharmacogenomics 22, no. 18 (December 2021): 1211–35. http://dx.doi.org/10.2217/pgs-2021-0116.
Full textAbstract:
The expression of ATP-binding cassette transporter (ABC transporters) has been reported in various tissues such as the lung, liver, kidney, brain and intestine. These proteins account for the efflux of different compounds and metabolites across the membrane, thus decreasing the concentration of the toxic compounds. ABC transporter genes play a vital role in the development of multidrug resistance, which is the main obstacle that hinders the success of chemotherapy. Preclinical and clinical trials have investigated the probability of overcoming drug-associated resistance and substantial toxicities. The focus has been put on several strategies to overcome multidrug resistance. These strategies include the development of modulators that can modulate ABC transporters. This knowledge can be translated for clinical oncology treatment in the future.