Journal articles: 'Transformation du cacao'

1

Lattre-Gasquet, Marie de, Philippe Petithuguenin, and Isabelle Le Gac. "La mondialisation de la filière cacao et son impact sur l’accord international sur le cacao." Économies et Sociétés. Systèmes agroalimentaires 34, no. 1024 (2000): 241–55. http://dx.doi.org/10.3406/esag.2000.1741.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

L’Accord international sur le cacao qui a initialement visé la régulation des prix a été modifié en 1993 et tend maintenant à l’harmonisation des politiques de production. En effet, le contexte a beaucoup changé : désengagement des Etats et complexification des rapports entre les Etats producteurs et les firmes de transformation, déplacement (relatif) des zones de production d’Amérique latine vers l’Afrique de l’ouest puis l’Asie, transformation accrue des fèves dans les pays producteurs, intégration verticale et concentration des firmes, disparition progressive de l’origine nationale de la qualité, globalisation des marques. Pour l’avenir, il faudrait de nouveaux instruments de couverture des risques et les changements dans les jeux d’acteurs devraient être davantage pris en compte.

2

Syukur, Sumaryati, Zozy Aneloi N, and Femilya Putri. "TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO." Jurnal Riset Kimia 2, no. 2 (February 12, 2015): 156. http://dx.doi.org/10.25077/jrk.v2i2.156.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard. Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin

3

Oussou, Kouame Fulbert, Gamze Guclu, Hasim Kelebek, and Serkan Selli. "Elucidating the contribution of microorganisms to the spontaneous fermentation and the quality of Ivorian cacao (Theobroma cacao) beans." Quality Assurance and Safety of Crops & Foods 14, no. 4 (September 1, 2022): 23–35. http://dx.doi.org/10.15586/qas.v14i4.1078.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Cacao (Theobroma cacao) beans are among the most important ingredients in food and beverage industries. They are mainly produced in tropical and subtropical forests. Africa is the biggest producer of cacao bean providers in the world and the Ivory Coast remains the world leader with an estimated yearly production of 3 million tonnes. Cacao beans are used in many food items such as chocolate products, cocoa butter, confectionary products, iced drinks, cocoa powder, etc. The quality and organoleptic characteristics of these food products are strongly related to those of the cocoa beans obtained from different processing treatments. The pulps surrounding the cacao beans are rich in water, sugars, pectins, proteins, minerals, vitamins, citric acid, and phenolic compounds. Many different processing methods are utilized and fermentation is a crucial postharvest treatment having a great influence on the quality of cacao beans and their related products. Spontaneous fermentation is a common practice carried out by the cacao farmers in Ivory Coast. The microorganisms involved in this process are primarily the yeasts (anaerobic phase), which convert the pulps containing sugars into alcohol with a sporicidal temperature increase and then the lactic and acetic acid bacteria (aerobic phase) that produce lactic and acetic acids, respectively. The degradation of the substrates inside the cacao pulps results in the generation of aroma precursors and compounds. The goal of this review was to elucidate the factors affecting the spontaneous fermentation of Ivorian cacao beans and clarify the transformation of the raw material during fermentation.

4

Tasma, I. Made. "Aplikasi Teknologi DNA untuk Akselerasi Program Pemuliaan Ketahanan Tanaman Kakao terhadap Hama dan Penyakit Utama." Jurnal Penelitian dan Pengembangan Pertanian 35, no. 4 (March 13, 2017): 155. http://dx.doi.org/10.21082/jp3.v35n4.2016.p155-166.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT One of the main constraints on cacao cultivation is disease and insect pest attacks causing significant yield loss. The main insect pests and diseases on cacao plantation are cacao pod borer, cacao fruit rot, vascular streak dieback and cacao mirids (Helopeltis spp.). Conventional breeding method to obtain new cacao clones resistant to insect pests and diseases is a slow process. It may take 1520 years to obtain a new superior clone. Applying DNA technology should expedite cacao breeding program. The article described the application of DNA technology currently available to expedite cacao breeding program for disease and insect resistance. Many genes and quantitative trait loci (QTLs) of important traits have been discovered related to cacao plant productivity and yield quality, disease and insect pest resistance traits. Modern genomic technologies as well as DNA marker have also been applied in cacao breeding program. Genetic transformation technology has been explored its application for cacao improvement. With the development of modern genomic technology, important gene/QTL discoveries would be faster to accelerate insect pest and disease resistant cultivar development. All these new DNA technologies have been assessed their potential applications for coping important pest and disease and for yield improvement. DNA technologies, mainly MAS and genomic-data based breeding technologies are ready to be applied to support breeding programs for main pest and disease resistance to enhance Indonesian cacao productivity and quality. Keywords: Cacao, disease and insect resistance, genomics, DNA markers, genetic transformation, marker-assisted breeding AbstrakSalah satu kendala utama dalam budi daya kakao ialah serangan hama dan penyakit. Hama dan penyakit utama kakao adalah penggerek buah kakao (PBK), busuk buah kakao (BBK), vascular streak dieback (VSD), dan cacao mirids (Helopeltis spp.). Kegiatan pemuliaan tanaman kakao secara konvensional berjalan lambat dan perlu waktu panjang. Untuk menghasilkan satu varietas unggul diperlukan waktu 15-20 tahun. Aplikasi teknologi DNA (genomika melalui pemuliaan berbantuan marka dan rekayasa genetik) dapat mempercepat program pemuliaan tanaman kakao. Tulisan ini mengulas teknologi DNA yang tersedia saat ini dan potensi aplikasinya untuk mempercepat pemuliaan kakao tahan hama dan penyakit. Penemuan marka DNA dan gen/quantitative trait loci (QTL) kakao berkembang cukup pesat. Banyak gen dan QTL karakter penting telah diidentifikasi yang terkait ketahanan hama dan penyakit serta produktivitas tanaman. Teknologi genomika dan pemanfaatan teknik marker-assisted selection (MAS) juga telah diaplikasikan untuk pemuliaan kakao termasuk untuk karakter ketahanan terhadap hama dan penyakit. Teknologi rekayasa genetik telah diteliti untuk menganalisis potensi pemanfaatannya dalam perbaikan bahan tanam kakao. Dengan berkembangnya teknologi genomika modern, penemuan gen/QTL unggul dapat dipercepat, lebih efisien dan komprehensif untuk mempercepat perakitan varietas unggul kakao tahan hama dan penyakit. Teknologi DNA khususnya MAS dan pemuliaan berbasis data genom siap diaplikasikan untuk mendukung program perbaikan ketahanan tanaman kakao terhadap hama dan penyakit utama dalam rangka peningkatan produktivitas dan mutu kakao nasional.

5

Salvador Morales, Pedro, Ruffo Sanchez Hernandez, Delfino Sánchez Gómez, Ulises López Noverola, Gelacio Alejo Santiago, Eduardo Valdés Velarde, and Juan Fernando Gallardo Lancho. "Evolution of soil organic carbon during a chronosequence of transformation from cacao (Theobroma cacao l.) plantation to grassland." Acta Agronómica 66, no. 4 (October 1, 2017): 525–30. http://dx.doi.org/10.15446/acag.v66n4.62543.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Wognin, S. B., A. F. Tchicaya, Y. M. Kouassi, S. Koffi-Oura, J. S. Bonny, and B. Nemery. "Allergie et cacao : tests immunologiques et échantillonnage atmosphérique dans une usine de transformation de fèves de cacao en Côte d’Ivoire." Archives des Maladies Professionnelles et de l'Environnement 75, no. 1 (February 2014): 53–58. http://dx.doi.org/10.1016/j.admp.2013.08.001.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Valussi, Marco, and Clara Minto. "Cacao as a Globalised Functional Food: Review on Cardiovascular Effects of Chocolate Consumption." Open Agriculture Journal 10, no. 1 (August 31, 2016): 36–51. http://dx.doi.org/10.2174/1874331501610010036.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Polyphenols have increasingly been studied for their influence on cardiometabolic health. Since cacao and chocolate can be a rich source of polyphenols, they too have been investigated for their supposed health benefits. In the first part of this paper the history of the food and medicinal uses of the cacao plant was briefly examined. A particular emphasis has been placed on the analysis of the process of transformation of the cacao seed into chocolate, since many of the processing steps involved have important consequences on the final product’s content in polyphenols and flavanols, and hence on the purported beneficial activity of chocolate. This evaluation is also of great importance in interpreting the results of the epidemiological and clinical studies. The relevant literature was surveyed in the second part of the paper, and the results for the consumption of polyphenol-rich chocolate are that it is well correlated to a reduction of the overall cardiovascular risk, and of arterial blood pressure in hypertensive subjects. Less corroborated are the positive effects on vascular endothelial health, on blood lipids and on lipid peroxidation. There are also preliminary but promising results for a positive action on insulin sensitivity, platelet function and inflammation. It remains to be seen whether and how these results can be translated into pragmatic guidelines on the health benefits of the consumption of commercial chocolate bars or products.

8

Mukai, Rie, Itsuko Fukuda, Shin Nishiumi, Midori Natsume, Naomi Osakabe, Ken-ichi Yoshida, and Hitoshi Ashida. "Cacao Polyphenol Extract Suppresses Transformation of an Aryl Hydrocarbon Receptor in C57BL/6 Mice." Journal of Agricultural and Food Chemistry 56, no. 21 (November 12, 2008): 10399–405. http://dx.doi.org/10.1021/jf802453t.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Lopes, Francis Julio Fagundes, Marisa Vieira de Queiroz, Juliana Oliveira Lima, Viviane Aline Oliveira Silva, and Elza Fernandes de Araújo. "Restriction enzyme improves the efficiency of genetic transformations in Moniliophthora perniciosa, the causal agent of witches’ broom disease in Theobroma cacao." Brazilian Archives of Biology and Technology 51, no. 1 (February 2008): 27–34. http://dx.doi.org/10.1590/s1516-89132008000100004.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The presence of restriction enzymes in the transformation mixture improved the efficiency of transformation in Moniliophthora perniciosa. The influence of the vector shape (linear or circular), the patterns of plasmid integration in genomic sites and the influence of the promoter used to express the gene marker were also analyzed. The addition of BamHI or NotI increased the number of transformants by 3-10-fold and 3-fold, respectively, over the control without added enzyme. The use of pre-linearized plasmid did not increase the transformation efficiency in comparison with the circular plasmid. However, the frequency of multi-copy transformants increased significantly. The transformation procedure here reported resulted in better production of protoplasts and transformation efficiency. In addition, the time necessary for the detection of the first transformants and the number of insertions were reduced.

10

Triwahyuni, Iin Eliana. "Increasing of IFNγ Expression in Transformed Cells of Balb/c Mice Due to Ethanol Extract Cocoa Beans (Theobroma cacao)." Dentika Dental Journal 22, no. 2 (October 18, 2019): 26–29. http://dx.doi.org/10.32734/dentika.v22i2.212.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

As current technology cannot cure cancer completely, prevention becomes the main choice. To prevent the development of cell transformation into cancer cells, polyphenols that are widely found in cocoa beans (Theobroma cacao) can be used. IFNγ plays an important role in immunity against cancer. This study aims to see the ability of cocoa beans ethanol extract to increase the number of IFNγ expression in Balb/c mice undergoing cell transformation. This study used three groups Balb/c (n=4), namely K1 (normal control), K2 (negative control: injected with benzopyrene without ethanol extract of cocoa beans), and K3 (treatment: injected with benzopyrene, given 4mg/30gBW/po/day ethanol extract of cocoa beans). The mice were biopsied, and IFNγ expression was examined by immune histochemical method. The results showed that IFNγ expression increased significantly in K3. It can be concluded that ethanol extract of cocoa beans could increase IFNγ expression in Balb/c mice undergoing cell transformation.

11

Bustami, Mirni Ulfa, and Stefaan P. O. Werbrouck. "Cyclic Somatic Embryogenesis in Indonesian Elite Theobroma cacao L. Clones." Horticulturae 10, no. 1 (December 25, 2023): 24. http://dx.doi.org/10.3390/horticulturae10010024.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

To date, in vitro somatic embryogenesis is the only option for the mass vegetative propagation of cocoa. The somatic embryogenesis of Indonesian cocoa clones SUL1 and SUL2 was investigated, focusing on primary and cyclic secondary embryogenesis. The study showed that staminode explants were more effective than petal explants in generating primary somatic embryos (SEs), especially when cultured in liquid medium containing 2 mg/L 2,4-D and 0.25 mg/L kinetin, with the staminodes of SUL2 producing a significant number of globular SEs. In contrast, SUL1 showed limited SE production. The study also demonstrated that fragmenting cotyledons and hypocotyls of the SEs of SUL2 and culturing them on an induction medium supplemented with 2,4,5-T and proline resulted in a high yield of secondary SEs. This cyclic embryogenesis process, in which the SEs remained attached to the maternal tissue, facilitated continuous SE production and development. The addition of proline was found to improve the quality of SEs, leading to higher production of well-organized, milky SEs with a better-defined meristematic structure. These results suggest a promising protocol to produce SEs from cocoa, with implications for plant transformation and gene editing applications.

12

Maximova, S., C. Miller, G. Antúnez de Mayolo, S. Pishak, A. Young, and M. J. Guiltinan. "Stable transformation of Theobroma cacao L. and influence of matrix attachment regions on GFP expression." Plant Cell Reports 21, no. 9 (April 3, 2003): 872–83. http://dx.doi.org/10.1007/s00299-003-0596-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Boutin, Élaine, Jean-François Blais, Guy Mercier, Patrick Drogui, and Myriam Chartier. "Valorisation de coproduits de l’industrie agro-alimentaire par production de compost de haute qualitéArticle envoyé à la Revue du génie et de la science de l'environnement." Canadian Journal of Civil Engineering 37, no. 1 (January 2010): 156–66. http://dx.doi.org/10.1139/l09-112.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Les industries de transformation alimentaire génèrent des quantités imposantes de coproduits organiques, lesquels demeurent, même aujourd’hui, peu valorisés. La présente recherche a permis de réaliser un inventaire détaillé des coproduits générés dans des usines de production de biscuits, chocolat, céréales et barres collations et d’identifier des formulations adéquates de mélanges d’intrants (écailles de cacao, résidus de biscuits et céréales, boues physico-chimiques et biologiques) pour des essais de compostage. Un dispositif expérimental comprenant six tas de compost d’approximativement une tonne métrique, et aérés par retournement manuel, a ensuite été opéré pendant une période de 4 mois. Des températures maximales se situant entre 60 et 68 °C ont été mesurées dans les différents tas au cours de la période de compostage, alors que des températures moyennes supérieures à 50 °C ont été maintenues pendant des périodes se situant entre 6 et 10 semaines. Des composts d’excellente qualité, répondant aux exigences de qualité AA (normes du Bureau de normalisation du Québec) en termes de teneurs en contaminants métalliques et microbiens et de stabilité microbiologique, ont été générés au terme de la période de compostage. Ces essais ont aussi démontré que les écailles de cacao, un coproduit important de la fabrication du chocolat, constituent un excellent agent de foisonnement de compostage.

14

A Mbang, J. Amang, P. Mounjouenpou, E. Nossi, D. Achukwi, S. Bassanaga, and N. Woin. "Adoption of new Technologies of Traditional Transformation of Products Made from Cocoa (Theobroma cacao L.) in Cameroon." International Journal of Engineering Trends and Technology 12, no. 10 (June 25, 2014): 524–37. http://dx.doi.org/10.14445/22315381/ijett-v12p298.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Jean-Marie, Elodie, Weiwen Jiang, Didier Bereau, and Jean-Charles Robinson. "Theobroma cacao and Theobroma grandiflorum: Botany, Composition and Pharmacological Activities of Pods and Seeds." Foods 11, no. 24 (December 8, 2022): 3966. http://dx.doi.org/10.3390/foods11243966.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Cocoa and cupuassu are evergreen Amazonian trees belonging to the genus Theobroma, with morphologically distinct fruits, including pods and beans. These beans are generally used for agri-food and cosmetics and have high fat and carbohydrates contents. The beans also contain interesting bioactive compounds, among which are polyphenols and methylxanthines thought to be responsible for various health benefits such as protective abilities against cardiovascular and neurodegenerative disorders and other metabolic disorders such as obesity and diabetes. Although these pods represent 50–80% of the whole fruit and provide a rich source of proteins, they are regularly eliminated during the cocoa and cupuassu transformation process. The purpose of this work is to provide an overview of recent research on cocoa and cupuassu pods and beans, with emphasis on their chemical composition, bioavailability, and pharmacological properties. According to the literature, pods and beans from cocoa and cupuassu are promising ecological and healthy resources.

16

Kelley, Lisa C. "The politics of uneven smallholder cacao expansion: A critical physical geography of agricultural transformation in Southeast Sulawesi, Indonesia." Geoforum 97 (December 2018): 22–34. http://dx.doi.org/10.1016/j.geoforum.2018.10.006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Antúnez de Mayolo, G. "Moxalactam as a counter-selection antibiotic for Agrobacterium-mediated transformation and its positive effects on Theobroma cacao somatic embryogenesis." Plant Science 164, no. 4 (April 2003): 607–15. http://dx.doi.org/10.1016/s0168-9452(03)00012-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Alburqueque-Vasquez, Nikkolas Javier, Angel David Hernández-Amasifuen, Alexandra Jherina Pineda-Lázaro, Jaime N. Fernández Ponce, Juan Carlos Guerrero-Abad, Ligia García, and Mike Anderson Corazon-Guivin. "Response of the transcription factor BABY BOOM of Arabidopsis thaliana L. in the formation of embryogenic calluses of cocoa leaves (Theobroma cacao L.)." Scientia Agropecuaria 13, no. 3 (September 18, 2023): 359–66. http://dx.doi.org/10.17268/sci.agropecu.2023.031.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Cocoa (Theobroma cacao L.) is one of the most important economic crops worldwide. The propagation of elite varieties of cocoa has been achieved through somatic embryogenesis, but still one of the main limitations is the low rates of embryo formation, which is a genotype-dependent trait. Manipulation of transcription factors (TFs) such as BABY BOOM (BBM) promotes the transition of cocoa somatic cells from the vegetative to the embryonic state. This work validated the use of clonal cocoa leaves cv. IMC-67 to induce somatic embryogenesis, overcoming their recalcitrant limitation with the help of the introduction of TF-BBM from Arabidopsis thaliana (AtBBM). The vectors were constructed by the Gateway system using the donor vector pENTR/D-TOPO and the expression vector pk7WG2. The overexpression vector pk7WG2:AtBBM was obtained, allowing successful transformation into Agrobacterium tumefaciens GV3101. The AtBBM gene was characterized (1755 base pairs), and its expression was observed in the formation of embryogenic calluses in cocoa leaves. Overexpression of AtBBM allowed the obtainment of a 92% response in the formation of embryogenic callus in cocoa leaves with Agrobacterium-mediated vacuum infiltration and overexpression of the pk7WG2:AtBBM vector. This high transformation efficiency reached with the insertion of the overexpression vector provides validation of transient response of the TF AtBBM in the formation of embryogenic calluses in cocoa leaves of the IMC-67 clone. Through this methodology, it is possible to continue with studies of gene overexpression, insertion, silencing, and gene editing in Peruvian cocoa.

19

Korcari, Dea, Alberto Fanton, Giovanni Ricci, Noemi Sofia Rabitti, Monica Laureati, Johannes Hogenboom, Luisa Pellegrino, Davide Emide, Alberto Barbiroli, and Maria Grazia Fortina. "Fine Cocoa Fermentation with Selected Lactic Acid Bacteria: Fermentation Performance and Impact on Chocolate Composition and Sensory Properties." Foods 12, no. 2 (January 11, 2023): 340. http://dx.doi.org/10.3390/foods12020340.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Cocoa fermentation is a central step in chocolate manufacturing. In this research, we performed controlled fermentations of a fine cocoa variety to evaluate the impact of adjunct cultures of selected lactic acid bacteria (LAB) on fermentation parameters, chemical composition, and sensory profile of fine cocoa and chocolate. Improved fermentation processes were carried out at the Centre for the Integral Transformation of Cacao (CETICO) in Dominican Republic. Two strains of LAB, previously isolated from cocoa, and belonging to Lactiplantibacillus fabifermentans and Furfurilactibacillus rossiae species, were employed. Fermentation parameters, protein, peptide and free amino acid profiles of the fermented cocoa and volatile molecules were determined. Sensory analysis of the derived chocolate was also carried out. The obtained results indicated that the addition of the adjunct cultures influences the proteolytic processes and the free amino acid profile. Finally, the adjunct cultures increased the complexity of the flavour profile of the chocolate as they received a higher score for descriptors commonly used for fine chocolate, such as honey and red fruits. The results obtained showed that the selected strains can be an added value to the development of specific flavours that are desirable at industrial level.

20

Pazmino, Carla Patricia. "Evaluation of losses and waste in craft companies that generate added value with cocoa CCN51 (Theobroma cacao L.) of the Ambato-Ecuador canton." Minerva 3, no. 8 (August 9, 2022): 20–31. http://dx.doi.org/10.47460/minerva.v3i8.61.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The craft companies that transform cocoa into value-added products in the Ambato-Ecuador canton generate a large number of losses and waste, causing low production performance, which is not solved by the chocolatiers as they don’t have a clear knowledge of the amount exactly what is lost and how it affects in the productive growth. Therefore, it seeks to quantify the losses and waste generated in the transformation of cocoa into semi-finished products. The work was carried out through the information collected in the craft companies, where was determined the losses and waste of each of the processes that are carried out for the production of semi-finished products will be prolonged. Obtaining in this way key information on waste management within companies and the exact amount and percentages of losses and waste during the production of cocoa paste and its derivates.

21

Silva, Thiago E. R., Luciana C. Cidade, Fátima C. Alvim, Júlio C. M. Cascardo, and Marcio G. C. Costa. "Studies on genetic transformation of Theobroma cacao L.: evaluation of different polyamines and antibiotics on somatic embryogenesis and the efficiency of uidA gene transfer by Agrobacterium tumefaciens." Plant Cell, Tissue and Organ Culture (PCTOC) 99, no. 3 (September 17, 2009): 287–98. http://dx.doi.org/10.1007/s11240-009-9603-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Nikolic, Teodora. "Spatial organization of the settlement network of the municipality of Cacak and tendencies of its development." Glasnik Srpskog geografskog drustva 93, no. 2 (2013): 113–30. http://dx.doi.org/10.2298/gsgd1302113n.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The balanced and sustainable development of the functional area of Cacak is a precondition for greater integration of geospace. Based on the fact that settlements are the most striking elements of the cultural landscape and they are the holders of the functional organization and spatial transformation of geospace, there will be a special emphasis placed on the networking of these settlements and the analysis of its determinants. Both demographic and socioeconomic indicators were analyzed in order to determine the dominant spatial and functional processes occurring in the area that relate to the development of the municipality. Emphasis is placed on the changes in the type of population movement, functional transformation of the settlements, and changes in the level of social geographic transformation of settlements. Analysis of the demographic and socio-economic indicators showed that the settlement network of Cacak is, to a large extent, incoherent. Socio-geographic and functional transformation of settlements is articulated and directed entirely from the municipal center, and consequently the most affected settlements of periurban zone of Cacak and settlements along major roads. Adjusting to the modern development processes requires new spatial-functional relations at the municipality level in order to strengthen territorial cohesion and equal conditions of life.

23

Stamenkovic, Srboljub, and Dragica Gataric. "Cacak and its daily urban system: Second part." Glasnik Srpskog geografskog drustva 87, no. 1 (2007): 107–12. http://dx.doi.org/10.2298/gsgd0701107s.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In this article, which is an integral part of our announcement published in the previous number of this publication, we examined commuting of school children and youth toward Cacak as well as from Cacak toward surrounding settlements in which, according to the census results in 2002, 2,330 pupils and students took part. The volume of pupils? and students? daily migrations of Cacak is approximately 4.3 times lower compared to the convergent and divergent daily migrations of its labor. That is why this type of continual daily migration has less importance in integration and transformation of the settlement network of Cacak and neighboring functional centers.

24

Muhtadan, Muhtadan. "EKSTRAKSI CIRI CACAT PENGELASAN PADA CITRA DIGITAL FILM RADIOGRAFI MENGGUNAKAN GEOMETRIC INVARIANT MOMENT DAN STATISTICAL TEXTURE." Jurnal Forum Nuklir 3, no. 2 (November 1, 2009): 83. http://dx.doi.org/10.17146/jfn.2009.3.2.3296.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

EKSTRAKSI CIRI CACAT PENGELASAN PADA CITRA DIGITAL FILM RADIOGRAFI MENGGUNAKAN GEOMETRIC INVARIANT MOMENT DAN STATISTICAL TEXTURE. Penelitian ini dilakukan untuk mendapatkan ekstraksi ciri cacat pengelasan pada citra digital film radiografi dengan menggunakan metode geometric invariant moment dan statistical texture. Nilai ekstraksi ciri ini dapat dimanfaatkan sebagai nilai yang digunakan dalam melakukan klasifikasi dan pengenalan pola cacat pada interpretasi cacat pengelasan citra digital film radiografi secara otomatis oleh komputer. Jenis cacat yang digunakan dalam penelitian ini adalah longitudinal crack, transversal crack, distributed porosity, clustered porosity, wormhole dan tanpa cacat (no defect). Sebagai bahan penelitian digunakan citra digital film radiografi dengan keenam jenis defektologi tersebut. Langkah yang dilakukan yaitu dengan membuat program untuk membaca citra digital, kemudian melakukan pemotongan citra (cropping) untuk melokalisasi letak cacat kemudian menghitung nilai momen dengan persamaan metode geometric invariant moment dan statistical texture. Hasil penelitian berupa nilai-nilai ekstraksi ciri yang telah diuji dengan perlakuan RST(rotation, scale, transformation) dan diperoleh nilai momen yang paling invariant terhadap RST yaitu momen f3, f4, f5 dari metode geometric invariant moment . Sedangkan dari metode statistical texture digunakan seluruh nilaisebagai hasil ekstraksi ciri yaitu intensitas rerata , kontras rerata, smoothness, 3rdmoment, uniformity, dan entropy

25

Aleixo, S., A. C. Gama-Rodrigues, M. G. Costa, M. V. S. Sales, E. F. Gama-Rodrigues, and J. R. B. Marques. "P transformations in cacao agroforests soils in the Atlantic forest region of Bahia, Brazil." Agroforestry Systems 91, no. 3 (April 16, 2016): 423–37. http://dx.doi.org/10.1007/s10457-016-9939-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Heinlein, A., M. Metzger, H. Walles, and A. Buettner. "Transport of hop aroma compounds across Caco-2 monolayers." Food Funct. 5, no. 11 (2014): 2719–30. http://dx.doi.org/10.1039/c3fo60675a.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Yu, Xiaoqin, Mengfan Lang, Daofen Huang, Chengfang Yang, Zhuozhi Ouyang, and Xuetao Guo. "Photo-transformation of microplastics and its toxicity to Caco-2 cells." Science of The Total Environment 806 (February 2022): 150954. http://dx.doi.org/10.1016/j.scitotenv.2021.150954.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Sturny, Arno. "Raising the bar: a story of bean-to-bar chocolate production in New Zealand." Hospitality Insights 3, no. 2 (December 3, 2019): 11–12. http://dx.doi.org/10.24135/hi.v3i2.62.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Chocolate is considered one of the most gratifying confections there is, and this holds as true in New Zealand as elsewhere in the world. Evidence of this high interest in chocolate in New Zealand is demonstrated in the arrival of small artisanal bean-to-bar chocolate makers in the early 2000s; the voting of Whittaker’s as New Zealand’s single most trusted brand for eight years running (Reader’s Digest New Zealand’s Most Trusted Brand) [1]; the reporting on the economic, social and cultural impacts of the closure of the Cadbury chocolate factory in Dunedin [2]; and the opening of the first fair trade chocolate factory, Sweet Justice Chocolate Factory, in Christchurch by Trade Aid New Zealand [3]. These examples also demonstrate a clear transformation within New Zealand’s commercial chocolate production, reflecting worldwide changes in multinational confectionery companies but also the emergence of artisanal production that directly addresses issues of sustainability and transparency [4, 5]. While broader culinary traditions in New Zealand have been well-documented, the food history of chocolate production has not yet been explored. Consequently, this study explored the history of chocolate production in New Zealand, with a specific focus on bean-to-bar products [6]. The study, based on a narrative history and interviews with current bean-to-bar chocolate makers in New Zealand, traced the history of bean-to-bar chocolate production in New Zealand. This process allowed for a multi-faceted reconstruction and interpretation of historical data to help understand various transformations within New Zealand’s chocolate industry, an industry long dominated by multinational companies such as Cadbury and Nestlé. This domination by overseas companies has recently been challenged by the emergence of small artisanal bean-to-bar chocolate makers and the rise of local chocolate company, Whittaker’s. Among the key findings was evidence of the maturing of the local chocolate industry to the point where it is clear that New Zealand-made chocolate is now widely viewed and trusted by local consumers as a high-quality product. This trust extends to both the current strong player in the market, Whittaker’s, and equally to smaller artisanal bean-to-bar chocolate makers, a confidence in product comparable to the New Zealand craft beer industry and the more well-established wine industry. The research also finds that the emergence of more artisanal bean-to-bar chocolate makers, and their focus on more transparency around the production of chocolate, reflects similar trends overseas. The findings highlight the fragile structure surrounding growth and sustainability in the chocolate production industry, with the view that closer ties should be formed with New Zealand’s Pacific cacao-growing neighbours. The findings point to the need for additional research around the history of food in New Zealand, an area of study often undervalued in academia [7]. The findings of the research are timely as they highlight opportunities for the industry to place current worldwide sustainability concerns in perspective with a view to the future – a future that New Zealand chocolate manufacturers cannot avoid. The historical archival data captured together with the contemporary voices of New Zealand’s new generation of chocolate makers combine to tell a story of creativity and competition. The original research this article is based on can be accessed here: https://openrepository.aut.ac.nz/bitstream/handle/10292/12970/SturnyA.pdf?sequence=3&isAllowed=y Corresponding author Arno Sturny can be contacted at: arno.sturny@aut.ac.nz References (1) Trusted Brands New Zealand 2019. Most Trusted. http://www.trustedbrands.co.nz/default.asp#mostTrusted (accessed Jun 1, 2019). (2) Cadbury’s Dunedin Factory Faces Closure, 350 Jobs on the Line. The New Zealand Herald, Feb 16, 2017. https://www.nzherald.co.nz/business/news/article.cfm?c_id=3&objectid=11801779 (accessed Jun 2, 2019). (3) Trade Aid. The Sweet Justice Chocolate Factory. https://www.tradeaid.org.nz/trade/the-sweet-justice-chocolate-factory/ (accessed Mar 24, 2019). (4) Fountain, A.; Huetz-Adams, F. 2018 Cocoa Barometer; 2018. http://www.cocoabarometer.org/cocoa_barometer/Download_files/2018%20Cocoa%20Barometer%20180420.pdf (accessed Oct 13, 2018). (5) Squicciarini, M. P.; Swinnen, J. F. M. The Economics of Chocolate; Oxford University Press: Oxford, U.K., 2016. (6) Sturny, A. Raising the Bar: A Story of Bean-to-Bar Chocolate Production in New Zealand; Master’s Thesis, Auckland University of Technology, New Zealand, 2018. https://openrepository.aut.ac.nz/bitstream/handle/10292/12970/SturnyA.pdf?sequence=3&isAllowed=y (accessed Nov 25, 2019). (7) Belasco, W. G. Food Matters: Perspectives on an Emerging Field. In Food Nations: Selling Taste in Consumer Societies; Belasco, W., Scranton, P., Eds.; Taylor & Francis: London, 2002, pp 1–22. https://www.researchgate.net/publication/239586863 (accessed Jun 15, 2019).

29

Borja Abad, Katheryn Lissette, Harry Vite Cevallos, Víctor Javier Garzón Montealegre, and Héctor Carvajal Romero. "Análisis de las exportaciones del cacao ecuatoriano en grano en el periodo 2008 al 2018." Revista Metropolitana de Ciencias Aplicadas 4, Suplemento 1 (June 1, 2021): 147–55. http://dx.doi.org/10.62452/kqjprc07.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The objective of this research is to analyze cocoa bean exports from Ecuador from 2008 to 2018, as well as its importance in the national economy. In recent years, cocoa exports have become a source of foreign currency income, generating employment, contributing to the trade balance and the Gross Domestic Product (GDP). The scope of the research is descriptive, non-experimental documentary type with the use of secondary sources and the collection of historical statistical data of Ecuador. The results obtained are that the changes experienced by the economy of Ecuador in the last 10 years have significantly affected exports due to the fall mainly of commodities worldwide, which implies adapting to these transformations. Under this scenario, it is concluded that the export of cocoa beans has had variations in export levels, which decrease because other countries compete in the world market with the same product at lower prices. Ecuadorian cocoa stands out for the quality of the bean, for its aroma and flavor which is an important factor to remain in the international market, which has allowed it to have a comparative advantage over other competitors, obtaining exports in 2018 of 315 tons which meant an income in FOB 710 million dollars.

30

Sampeck, Kathryn E. "LATE POSTCLASSIC TO COLONIAL TRANSFORMATIONS OF THE LANDSCAPE IN THE IZALCOS REGION OF WESTERN EL SALVADOR." Ancient Mesoamerica 21, no. 2 (2010): 261–82. http://dx.doi.org/10.1017/s0956536111000174.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

AbstractThe Izalcos Pipil were pre-Hispanic residents of the Río Ceniza Valley of western El Salvador and had clear linguistic ties to the Aztecs and other Nahuas of central Mexico. Both archaeological and documentary data are presented that show strong evidence that the Izalcos Pipil also maintained Nahua social and political institutions. The Izalcos Pipil emphasized characteristics of Nahua social practices that depend on dynamic mobility on the landscape to articulate discrete cultural elements, and these characteristics are observable in Izalcos inter- and intrasite settlement organization and the distribution of Nahua settlement in southern Mesoamerica. The degree of mobility on the landscape was shown in the internal organization of sites, architectural arrangements, and the relationships among sites and is indicated in historical documents. Pipil concepts, institutions, and boundaries provided the foundation for the Spanish colonial political economy. This region became a jewel in the Spanish Crown in part because of prodigious cacao production that the Izalcos Pipil established long before Spanish contact. The degree of nucleation before and after conquest did not change dramatically, but the analysis of mobility showed that even though some elements of patterning appeared superficially the same, underlying causes were fundamentally different. The most important conquest-induced change was the transition to capitalism, which created a static, disarticulated landscape of nucleated settlements, enclosures, and private property that discouraged human movement. The tensions between these two contrasting systems of landscape use heightened with the passage of time.

31

Jahn, Kristina A., Joanna M. Biazik, and Filip Braet. "GM1 Expression in Caco-2 Cells: Characterisation of a Fundamental Passage-dependent Transformation of a Cell Line." Journal of Pharmaceutical Sciences 100, no. 9 (September 2011): 3751–62. http://dx.doi.org/10.1002/jps.22418.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Chen, Guangchun, Xiaofeng Jiang, Chenggang Gu, Cheng Sun, and Mei Li. "Bioaccessibility of BDE 47 in a simulated gastrointestinal system and its metabolic transformation mechanisms in Caco-2 cells." Chemosphere 214 (January 2019): 408–17. http://dx.doi.org/10.1016/j.chemosphere.2018.09.008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Azarian, Mohammad Hossein, Supinya Nijpanich, Narong Chanlek, and Wimonlak Sutapun. "Probing capping mechanisms and polymer matrix loading of biogenic vaterite CaCO₃–Ag hybrid through X-ray photoelectron spectroscopy (XPS)." RSC Advances 14, no. 21 (2024): 14624–39. http://dx.doi.org/10.1039/d4ra01710b.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

XPS revealed Ag+ and Ag0 in biogenic vaterite CaCO3–Ag microspheres. CMC and PSS capping agents influenced Ag species distribution. Polymorph transformations and vaterite's stability were highlighted.

34

Pedersen, Kristian Jensen, Sven-Bastiaan Haange, Kateřina Žížalová, Alina Viehof, Thomas Clavel, Martin Leniček, Beatrice Engelmann, et al. "Eggerthella lenta DSM 2243 Alleviates Bile Acid Stress Response in Clostridium ramosum and Anaerostipes caccae by Transformation of Bile Acids." Microorganisms 10, no. 10 (October 13, 2022): 2025. http://dx.doi.org/10.3390/microorganisms10102025.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Bile acids are crucial for the uptake of dietary lipids and can shape the gut-microbiome composition. This latter function is associated with the toxicity of bile acids and can be modulated by bile acid modifying bacteria such as Eggerthella lenta, but the molecular details of the interaction of bacteria depending on bile acid modifications are not well understood. In order to unravel the molecular response to bile acids and their metabolites, we cultivated eight strains from a human intestinal microbiome model alone and in co-culture with Eggerthella lenta in the presence of cholic acid (CA) and deoxycholic acid (DCA). We observed growth inhibition of particularly gram-positive strains such as Clostridium ramosum and the gram-variable Anaerostipes cacae by CA and DCA stress. C. ramosum was alleviated through co-culturing with Eggerthella lenta. We approached effects on the membrane by zeta potential and genotoxic and metabolic effects by (meta)proteomic and metabolomic analyses. Co-culturing with Eggerthella lenta decreased both CA and DCA by the formation of oxidized and epimerized bile acids. Eggerthella lenta also produces microbial bile salt conjugates in a co-cultured species-specific manner. This study highlights how the interaction with other bacteria can influence the functionality of bacteria.

35

Mohamed Tolba Said, Mohamed, Daud Ismail, Fazlena Abd Rahim, Asyraf Abdul Rahman, and Wan Mohd Khairul Firdaus Wan Khairuldin. "[Transformation and Contribution of Al-Razi (854-932m) in The Field of Medicine] Transformasi dan Sumbangan Al-Razi (854-932m) dalam Bidang Perubatan." Jurnal Islam dan Masyarakat Kontemporari 17, no. 1 (May 31, 2018): 36–44. http://dx.doi.org/10.37231/jimk.2018.17.1.270.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract Al-Razi was a leading figure amongst Muslim scientists in the Middle Ages. The result of his work, besides considered as a reference point, have inspired many ideas and theories in the field of pharmacology and contemporary medicine. This article aims to highlight the transformation and his contribution in the field of medicine. This study uses content analysis approach which involves review of secondary data from library research conducted. Qualitative data were then analyzed descriptively. The results showed that al-Razi was a doctor and medical practitioners who did a lot of experiments throughout his career. Through experiments carried out, he was able to identify a variety of diseases such as smallpox and measles, and how to treat it. In addition to working as a doctor, he spend his time in writing and successfully produced many works that became common reference in various fields of medicine up to the present today. Keywords: Al-Razi, Transformation, Treatment Method , Modern Medical. Al-Razi ialah seorang tokoh saintis Islam terkemuka pada abad pertengahan. Hasil karya beliau selain merupakan rujukan utama, menjadi sumber inspirasi kelahiran pelbagai idea dan teori dalam bidang farmakologi dan perubatan kontemporari. Artikel ini bertujuan mengetengahkan transformasi dan sumbangan beliau dalam bidang kedoktoran. Kajian ini menggunakan pendekatan analisis kandungan melibatkan data-data sekunder dari kajian kepustakaan yang dijalankan. Data-data kualitatif yang dikumpul dianalisis secara deskriptif. Hasil kajian menunjukkan al-Razi adalah seorang doktor dan pengamal perubatan yang banyak melakukan uji kaji. Melalui uji kaji yang dijalankan, beliau dapat mengenal pasti pelbagai jenis penyakit seperti cacar dan campak serta cara merawatnya. Di samping bertugas sebagai seorang doktor, beliau meluangkan masa untuk menulis sehingga berjaya menghasilkan banyak karya yang menjadi rujukan umum dalam pelbagai bidang perubatan. Kata kunci: Al- Razi, Transformasi, Kaedah Rawatan, Perubatan moden.

36

Villalva, Marisol, Laura Jaime, María de las Nieves Siles-Sánchez, and Susana Santoyo. "Bioavailability Assessment of Yarrow Phenolic Compounds Using an In Vitro Digestion/Caco-2 Cell Model: Anti-Inflammatory Activity of Basolateral Fraction." Molecules 27, no. 23 (November 26, 2022): 8254. http://dx.doi.org/10.3390/molecules27238254.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

In this study, a combined in vitro digestion/Caco-2 model was performed with the aim to determine the phenolic compounds bioavailability of two yarrow extracts. HPLC-PAD characterisation indicated that the main components in both extracts were 3,5-dicaffeoylquinic acid (DCQA) and luteolin-7-O-glucoside. Analyses after the simulated digestion process revealed that phenolic composition was not affected during the oral phase, whereas gastric and intestinal phases represented critical steps for some individual phenolics, especially intestinal step. The transition from gastric medium to intestinal environment caused an important degradation of 3,5-DCQA (63–67% loss), whereas 3,4-DCQA and 4,5-DCQA increased significantly, suggesting an isomeric transformation within these caffeic acid derivatives. However, an approx. 90% of luteolin-7-O-glucoside was recovered after intestinal step. At the end of Caco-2 absorption experiments, casticin, diosmetin and centaureidin represented the most abundant compounds in the basolateral fraction. Moreover, this fraction presented anti-inflammatory activity since was able to inhibit the secretion of IL-1β and IL-6 pro-inflammatory cytokines. Thus, the presence in the basolateral fraction of flavonoid-aglycones from yarrow, could be related with the observed anti-inflammatory activity from yarrow extract.

37

González-Arias, C. A., A. Crespo-Sempere, S. Marín, V. Sanchis, and A. J. Ramos. "Modulation of the xenobiotic transformation system and inflammatory response by ochratoxin A exposure using a co-culture system of Caco-2 and HepG2 cells." Food and Chemical Toxicology 86 (December 2015): 245–52. http://dx.doi.org/10.1016/j.fct.2015.10.007.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Bhuvaneswari, S., K. Palanisamy, K. Subramani, and V. K. Subramanian. "Polymorphic and Morphological Transformations of CaCO₃ under CO₂ Atmosphere and under the Influence of EDTA at 60 °C." International Letters of Chemistry, Physics and Astronomy 53 (July 2015): 173–79. http://dx.doi.org/10.18052/www.scipress.com/ilcpa.53.173.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Calcium carbonate scale samples were synthesized from calcium chloride solution in the presence of ethylenediamminetetraacetic acid (EDTA) by bubbling CO2 gas. Samples were prepared with different concentrations of EDTA at 60 °C and characterized using XRD, FTIR and SEM techniques. The details revealed that EDTA stabilizes aragonite more efficiently at higher concentrations of EDTA. It was also observed that increasing the concentration of EDTA has no significant impact on the polymorphic specificity where as influence the morphology and the size of the particles.

39

Lanzón, Marcos, Juan Antonio Madrid, Ana Martínez-Arredondo, and Soledad Mónaco. "Use of diluted Ca(OH) 2 suspensions and their transformation into nanostructured CaCO 3 coatings: A case study in strengthening heritage materials (stucco, adobe and stone)." Applied Surface Science 424 (December 2017): 20–27. http://dx.doi.org/10.1016/j.apsusc.2017.02.248.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

HALVORSEN, Bente, Anne Cathrine STAFF, Solveig LIGAARDEN, Kristian PRYDZ, and Svein Olav KOLSET. "Lithocholic acid and sulphated lithocholic acid differ in the ability to promote matrix metalloproteinase secretion in the human colon cancer cell line CaCo-2." Biochemical Journal 349, no. 1 (June 26, 2000): 189–93. http://dx.doi.org/10.1042/bj3490189.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

The human colon carcinoma cell line CaCo-2 has the ability to sulphate the secondary bile acid lithocholic acid (LA), whereas other primary or secondary bile acids were not sulphated [Halvorsen, Kase, Prydz, Gharagozlian, Andresen and Kolset (1999) Biochem. J. 343, 533-539]. To study the biological implications of this modification, CaCo-2 cells were incubated with either LA or sulphated lithocholic acid (3-sulpholithocholic acid, SLA), and in some experiments with taurine-conjugated lithocholic acid. Increased secretion of matrix metalloproteinases (MMPs) correlates with transformation of colon epithelial cells. When CaCo-2 cells were incubated with LA, the secretion of MMP-2 was found to increase approx. 60% when analysed by gelatin zymography, and 80% when analysed by Western blotting. SLA, in contrast, did not affect the level of MMP-2 secretion, and after zymography the level of enzyme activity was 78% of control values after 18 h incubation. The secretion of MMPs is linked to increased cellular invasion and, in tumours, to increased capacity for metastasis. The ability of CaCo-2 cells to invade in a chamber assay was stimulated after exposure to LA, whereas SLA-treated cells did not differ from control cells. LA therefore seems to induce a more invasive CaCo-2 cell phenotype, as judged by the two parameters tested, whereas the sulphated counterpart, SLA, did not have these effects. Sulphation of LA in the colon may be an important mechanism to decrease the potential LA has to promote a malignant epithelial phenotype.

41

Muslem, Muslem, Sri Purnama Sari, and Agus Arip Munawar. "Transformasi Attenuated Total Reflectance Untuk Prediksi Vitamin C Pada Buah Mangga Arumanis (Mangifera indica)." Jurnal Ilmiah Mahasiswa Pertanian 4, no. 3 (August 1, 2019): 75–84. http://dx.doi.org/10.17969/jimfp.v4i3.11532.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstrak, Parameter yang digunakan dalam penilaian mutu buah mangga antara lain ukuran atau berat, kekerasan, tingkat ketuaan serta bebas dari cacat. Kekerasan pada buah mangga merupakan fungsi dari tingkat kematangan, sedangkan kematangan berhubungan dengan tingkat ketuaan yang dapat diduga melalui penampilan visual. Vitamin C merupakan vitamin yang larut dalam air dan esensial untuk biosintesis kolagen.pengukuran vitamin C pada buah mangga menggunkan metode tetrasi, dan penggunaan gelombang elektromaknetik seperti Near Infrared. Penelitian ini bertujuan untuk memprediksi kadar vitamin C dalam buah mangga menggunakan metode Spektrofotometri UV-Vis dan Iodimetri, serta membandingkan hasil dari kedua metode tersebut. Sampel yang diidentifikasi yaitu buah mangga yang sudah matang dengan menggunakan model transformasi Attenuated Total Reflectance dan menggunakan metode Principal Component Analysis (PCA) dan menggunakan metode Principal Component Regression (PCR). Penelitian ini menggunakan buah mangga jenis Arumanis, yang berjumlah 30 sampel. Prediksi vitamin C dengan NIRS menggunakan alat FT-IR IPTEK T-1516. Pengolahan data menggunakan Unscramble software® X versi 10.5. Hasil penelitian menunjukkan prediksi vitamin C mangga dengan metode Principal Component Regression (PCR) menghasilkan sufficient performance dengan nilai RPD yang didapat yaitu 2,0083 (r) sebesar 0,8638 , (R2 ) sebesar 0,7463 dan (RMSEC) sebesar 5,1854 Transformation Of Attenuated Total Reflectance (ATR) Near Infrared for prediction of Vitamin C In Arumanis Mangoes (Mangifera Indica)Abstract. Parameters used in assessing the quality of mangoes are size or weight, hardness, age level and free from defects. Hardness in mangoes is a function of maturity level, while the maturity is related to the level of aging that can be predicted through visual appearance. Vitamin C is a water-soluble vitamin which is essential for collagen biosynthesis. The measurement of vitamin C in mangoes use tetration methods, and the using of electromagnetic waves such as Near Infrared. This study aims to predict vitamin C contains in mango fruit using the UV-Vis and Iodymetry Spectrophotometry method, and comparing the results of the two methods. The samples identified were mature mangoes using the attenuated total reflectance transformation model and using the Principal Component Analysis (PCA) method also using the Principal Component Regression (PCR) method. This study used Arumanis mangoes, which amounted to 30 samples. Prediction of vitamin C with NIRS using the FT-IR IPTEK T-1516. Data processing use the Unscramble software® X 10.5 version. The results showed that the prediction of vitamin C mango using the Principal Component Regression (PCR) method resulted in sufficient performance with the obtained RPD value of 2,0083, (r) of 0,8638, (R2) of 0,7463 and (RMSEC) of 5,1854.

42

González -Laxe, Fernando. "REFLEXIONES SOBRE LAS CONDUCTAS Y LAS FASES DEL CONSUMO PESQUERO." CICIMAR Oceánides 32, no. 2 (November 24, 2017): 25. http://dx.doi.org/10.37543/oceanides.v32i2.205.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

La actividad pesquera desempeña un papel transcendental tanto en lo que concierne a la generación de rentas y de empleo, como en lo tocante a su contribución en garantizar el derecho a la alimentación y a la seguridad alimentaria. Se contabilizan en el mundo alrededor de 56 millones de personas en dicha actividad y tres veces más si se consideran las actividades en aval y en amont. Casi el 40% de la producción pesquera es vendida en los mercados mundiales por un valor de 146000 millones de dólares, cifras más elevadas que las contabilizadas por las ventas procedentes del café, del banano, del cacao, del té, del tabaco o del azúcar. Las actividades pesqueras contribuyen a la seguridad alimentaria suministrando un aporte nutricional esencial a la población; representan el 17% de las proteínas animales y el 6.7% del total de las proteínas consumidas anualmente. En este trabajo se analizan las distintas conductas alimentarias registradas en los últimos años y se describen las diferentes fases del consumo de productos pesqueros a la luz de los cambios experimentados en el sector. Las tres grandes transformaciones mayores llevadas a cabo proceden de la consolidación de un amplio mercado globalizado; de las innovaciones técnicas aportadas en las embarcaciones; y, por la mejora de los procedimientos de conservación y calidad de los productos pesqueros. Considerations on the behavior and phases of the fisheries consumptionABSTRACT. The fishing activity has a key role in terms of income and employment, and it also guarantees access to food and food security. 56 million people are estimated to work in this field, three fold if we include aval and amont activities. Almost 40% of the fishing production is sold in world markets and its value represents 146000 million dollars. These figures are higher than those coming from coffee, banana, cocoa, tea, tobacco or sugar. Fishing activities contribute to food security by providing the population with an essential nutritional content –they account for 17% of animal protein and 6.7% of the yearly protein intake. In this paper, recent food patterns are analyzed and the different stages in the consumption of fishing products are described by taking into account recent changes in this field. The three mayor transformations stem from the consolidation of a vast global market, from technical innovations in vessels and from improvements in preservation procedures and in the quality of fishing products.

43

González -Laxe, Fernando. "REFLEXIONES SOBRE LAS CONDUCTAS Y LAS FASES DEL CONSUMO PESQUERO." CICIMAR Oceánides 32, no. 2 (November 24, 2017): 25. http://dx.doi.org/10.37543/oceanides.v32i2.205.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

La actividad pesquera desempeña un papel transcendental tanto en lo que concierne a la generación de rentas y de empleo, como en lo tocante a su contribución en garantizar el derecho a la alimentación y a la seguridad alimentaria. Se contabilizan en el mundo alrededor de 56 millones de personas en dicha actividad y tres veces más si se consideran las actividades en aval y en amont. Casi el 40% de la producción pesquera es vendida en los mercados mundiales por un valor de 146000 millones de dólares, cifras más elevadas que las contabilizadas por las ventas procedentes del café, del banano, del cacao, del té, del tabaco o del azúcar. Las actividades pesqueras contribuyen a la seguridad alimentaria suministrando un aporte nutricional esencial a la población; representan el 17% de las proteínas animales y el 6.7% del total de las proteínas consumidas anualmente. En este trabajo se analizan las distintas conductas alimentarias registradas en los últimos años y se describen las diferentes fases del consumo de productos pesqueros a la luz de los cambios experimentados en el sector. Las tres grandes transformaciones mayores llevadas a cabo proceden de la consolidación de un amplio mercado globalizado; de las innovaciones técnicas aportadas en las embarcaciones; y, por la mejora de los procedimientos de conservación y calidad de los productos pesqueros. Considerations on the behavior and phases of the fisheries consumptionABSTRACT. The fishing activity has a key role in terms of income and employment, and it also guarantees access to food and food security. 56 million people are estimated to work in this field, three fold if we include aval and amont activities. Almost 40% of the fishing production is sold in world markets and its value represents 146000 million dollars. These figures are higher than those coming from coffee, banana, cocoa, tea, tobacco or sugar. Fishing activities contribute to food security by providing the population with an essential nutritional content –they account for 17% of animal protein and 6.7% of the yearly protein intake. In this paper, recent food patterns are analyzed and the different stages in the consumption of fishing products are described by taking into account recent changes in this field. The three mayor transformations stem from the consolidation of a vast global market, from technical innovations in vessels and from improvements in preservation procedures and in the quality of fishing products.

44

Bhuvaneswari, S., K. Palanisamy, K. Subramani, and V. K. Subramanian. "Polymorphic and Morphological Transformations of CaCO3 under CO2 Atmosphere and under the Influence of EDTA at 60 °C." International Letters of Chemistry, Physics and Astronomy 53 (July 1, 2015): 173–79. http://dx.doi.org/10.56431/p-81w900.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Calcium carbonate scale samples were synthesized from calcium chloride solution in the presence of ethylenediamminetetraacetic acid (EDTA) by bubbling CO2 gas. Samples were prepared with different concentrations of EDTA at 60 °C and characterized using XRD, FTIR and SEM techniques. The details revealed that EDTA stabilizes aragonite more efficiently at higher concentrations of EDTA. It was also observed that increasing the concentration of EDTA has no significant impact on the polymorphic specificity where as influence the morphology and the size of the particles.

45

Raehana, Hafiza Raehana. "360° PHOTO TECHNIQUES AND VIRTUAL REALITY IN CINEMATOGRAPHY." Arty: Jurnal Seni Rupa 11, no. 2 (July 11, 2022): 56–63. http://dx.doi.org/10.15294/arty.v11i2.56111.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Era transformasi digital 4.0 ini marak penggunaan citraan berbasis digital untuk berbagai kebutuhan, dari jualan hingga hiburan. Metaverse memiliki peluang besar di Indonesia karena dapat digunakan di berbagai bidang seperti pariwisata, pendidikan, kesejahteraan sosial dan perdagangan di Indonesia. Namun demikian, belum banyak berkembang pembahasan mengenai kualitas citra yang standar untuk kebutuhan sinematografi. Citra yang dimaksud adalah suatu representasi (gambaran), kemiripan atau imitasi dari suatu objek. Citra sebagai keluaran suatu sistem perekaman data dapat bersifat optik berupa foto, bersifat analog berupa sinyal-sinyal video seperti gambaran pada monitor televisi, atau bersifat digital yang dapat langsung disimpan pada suatu media penyimpanan. Meskipun sebuah citra kaya akan informasi, namun sering kali citra yang dimiliki mengalami penurunan mutu, misalnya mengandung cacat atau denois. Metode yang digunakan dalam sinematografi meliputi camera angle, continuity, cutting, dan composition. Hasil penelitian ini adalah Penggunaan aspek sinematografi terutama dalam karya animasi ataupun syuting mempunyai mood dan teknik pencahayaan yang sama dengan pengarahan pada media yang lain. Dalam pencahayaan film VR yang menggunakan metode pembuatannya menggunakan animasi tiga dimensi mempunyai treatment yang lebih menonjolkan kesan tekstur yang gelap dan low-key lighting In this era of digital transformation 4.0, there is widespread use of digital-based imagery for various needs, from sales to entertainment. Metaverse has great opportunities in Indonesia because it can be used in various fields such as tourism, education, social welfare and trade in Indonesia. However, there has not been much discussion about standard image quality for cinematography needs. The image in question is a representation (picture), resemblance or imitation of an object. The image as the output of a data recording system can be optical in the form of photos, analog in the form of video signals such as images on a television monitor, or digital which can be directly stored on a storage medium. Even though an image is rich in information, the image that is owned often suffers a loss of quality, for example, contains defects or defects. The methods used in cinematography include camera angle, continuity, cutting, and composition. The result of this research is that the use of cinematographic aspects, especially in animation or filming works, has the same mood and lighting techniques as directed at other media. In VR film lighting, which uses a three-dimensional animation method, it has a treatment that emphasizes the impression of a dark texture and low-key lighting.

46

Serovaiskii, A. Yu, and V. G. Kutcherov. "Hydrocarbon formation in CaCO3–FeO–H2O–SiO2 and Fe3C–H2O–SiO2 systems under thermobaric conditions of the upper mantle." LITHOSPHERE (Russia) 22, no. 6 (January 7, 2023): 840–46. http://dx.doi.org/10.24930/1681-9004-2022-22-6-840-846.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Research subject. The possible influence of the SiO2 environment as the most common component of the mantle on the deep abiogenic synthesis of hydrocarbons in the CaCO3–FeO–H2O and Fe3C–H2O systems under thermobaric conditions corresponding to those in the upper mantle is investigated.Materials and methods. Experiments were carried out using a high-pressure unit in Toroid-type chambers across the thermobaric range of 2.0–4.0 GPa and 220–750°C. CaCO3 and Fe3C were used as carbon donors, H2O was used as a hydrogen donor, and SiO2 was used as an environment. The synthesized products were analyzed by gas chromatography and X-ray diffraction.Results. Across the entire temperature and pressure range used, mixtures of light alkanes with the predominance of methane were obtained. The composition of the hydrocarbon systems synthesized in the presence of SiO2 was similar to that obtained at the same thermobaric parameters without SiO2, depending exclusively on the temperature and pressure of synthesis. The conducted X-ray diffraction analysis of solid products demonstrated transformation of quartz into coesite at 400°C and 750°C.Conclusions. According to the conducted investigation, the qualitative and quantitative composition of hydrocarbon systems formed during the abiogenic synthesis of hydrocarbons in the presence of SiO2 corresponds to the results of similar experiments without SiO2. However, the total yield of the hydrocarbon systems in the SiO2 environment decreases. The dependence of the composition of the synthesized hydrocarbon systems on the thermobaric conditions of synthesis remains in the SiO2 environment.

47

Amin, Mirawanty, Herlina N. Salamba, and Asnawi Asnawi. "PENGELOLAAN HARA MIKRO ZN DALAM TANAH UNTUK MENINGKATKAN KUALITAS DAN PRODUKTIVITAS TANAMAN/Management of Micro Zink Nutrition in Soil to Improve Plant Quality and Productivity." Jurnal Penelitian dan Pengembangan Pertanian 41, no. 1 (May 10, 2022): 32. http://dx.doi.org/10.21082/jp3.v41n1.2022.p32-43.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Zinc (Zn) is a micronutrient that has an important role in various physiological and photosynthetic processes of plants. However the important role of Zn has not yet been concidered. This paper discussed the source of Zn and its availability in the soil, the important role of Zn in plants and strategies to overcome Zn deficiency in the soil. Zn has an important role in increasing crop production and yield quality. Zn nutrients in soil derived from parent material with an average content of 78 mg/kg. The low Zn level in the soil causes stunted plant and low crop yields. Zinc deficiency in plants resulted leaf chlorosis, necrotic spots on leaves, stunted plants, deformed and stunted leaves. Zn deficiency in soil can cause yield loss up to 40% without the appearance of leaf symptoms. Plants absorb Zn in the form of Zn2+. Soils in Indonesia have low Zn content so that production and quality of crops are low. Zn plays an important role in plant growth, gene expression, enzyme structure, photosynthesis, pollen development, sugar transformation, protein synthesis, membrane permeability, signal transduction and auxin metabolism, and increasing maturation of seeds and stems. The critical limit of soil Zn for most plants ranges from 0.5-2.0 mg Zn/kg for DTPA extractant, while the critical limit in plant tissue is 20 mg Zn/kg. The management of Zn nutrients needs to be considered, although it is needed only in small amounts. Without Zn nutrient management, its concentration in soil will continuously decreased. Management strategies in overcoming low Zn availability in plants are application of fertilizer containing Zn and the use of varieties that have high Zn content. The application of ZnSO4 of 60 kg/ha can increased the yield of grain, straw, number of tillers, plant height and weight of 1000 grains in rice plants. The treatment of soaking rice seeds in a solution of 0.05% ZnSO4 for ± 5 minutes + 100 kg TSP/ha was the best treatment giving the highest grain weight in Grumusol and Alluvial.Keywords: Micronutrients Zn, deficiency, management AbtrakHara mikro Zn memiliki peranan penting dalam berbagai proses fisiologis dan fotosintesis untuk meningkatkan pertumbuhan dan hasil tanaman, namun belum mendapatkan perhatian. Naskah ini membahas sumber Zn dan ketersediannnya pada tanah, peranan penting hara Zn pada tanaman, dan strategi mengatasi kekurangan Zn dalam tanah. Hara Zn dalam tanah berasal dari batuan bahan induk tanah dengan kandungan rata-rata 78 mg/kg. Kadar Zn yang rendah di tanah menyebabkan pertumbuhan tanaman terhambat dan hasil rendah. Kekurangan Zn pada tanaman menyebabkan klorosis dan bintik-bintik nekrotik pada daun, pertumbuhan kerdil, dan daun cacat. Pada tanah yang kekurangan Zn, tanaman dapat mengalami kehilangan hasil hingga 40% tanpa gejala pada daun. Tanaman menyerap Zn dalam bentuk Zn2+. Tanah di Indonesia memiliki kandungan Zn yang rendah sehingga produksi dan kualitas tanaman rendah. Zn berperan penting dalam pertumbuhan tanaman, ekspresi gen, struktur enzim, fotosintesis, perkembangan polen, transformasi gula, sintesis protein, permeabilitas membran, transduksi sinyal, metabolisme auksin, pematangan biji dan batang. Batas kritis Zn dalam tanah untuk sebagian besar tanaman berkisar antara 0,5-2,0 mg Zn/kg untuk pengekstrak DTPA, sedangkan batas kritis pada jaringan tanaman 20 mg Zn/kg. Meskipun diperlukan tanaman dalam jumlah yang kecil, hara Zn perlu dikelola dengan baik. Strategi pengelolaan hara Zn agar selalu tersedia di tanah adalah melalui pemupukan dan penggunaan varietas yang mengandung Zn tinggi. Pemberian ZnSO4 60 kg/ha dapat meningkatkan hasil gabah, jerami, jumlah anakan, tinggi tanaman, dan bobot 1.000 butir tanaman padi. Perlakuan perendaman bibit padi dalam larutan 0,05% ZnSO4 selama ± 5 menit + 100 kg TSP/ ha memberikan bobot gabah tertinggi pada Grumusol dan Aluvial.Kata kunci: Hara mikro Zn, defisiensi, pengelolaan

48

Villacis, Alexis, Jeffrey Alwang, and Victor Barrera. "Cacao value chains and credence attributes: lessons from Ecuador." Journal of Agribusiness in Developing and Emerging Economies, April 19, 2022. http://dx.doi.org/10.1108/jadee-10-2021-0267.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

PurposeMotivated by transformations in global food systems and increasing demand for multidimensional credence attributes, the authors analyze cacao value chains in Ecuador – the main producer of fine and flavor cacao worldwide. The authors identify opportunities and discuss how private and public sector initiatives can help meet emerging challenges.Design/methodology/approachPrimary information was collected through interviews of actors in the Ecuadorian industry during spring/summer 2020, including cacao producer associations, exporter associations, chocolate processing firms, public institutions and local universities. Two focus groups were also conducted with producers from associations in the Ecuadorian Amazon.FindingsFindings suggest new opportunities for cacao producers and chocolate processors have emerged from the global market transformation. To exploit these, firms need to personalize and differentiate their products, for example, by using quality certifications such as organic and fair trade. Market developments, such as European cadmium regulations and the necessity of worldwide traceability systems, are driving exporters to enhance Ecuador’s cacao value chains. The sector still requires coordination to reap the benefits associated with demands for credence attributes.Originality/valueFindings are supported by two case studies. The first focuses on how associativity can help those producing high-quality beans to differentiate themselves in modern agri-food markets. The second describes the success of a local chocolate firm and its links with local farmers.

49

Jaramillo-Mazo, Claudia, Daniel Bravo, Beatriz E. Guerra Sierra, and Javier C. Alvarez. "Association between bacterial community and cadmium distribution across Colombian cacao crops." Microbiology Spectrum, May 30, 2024. http://dx.doi.org/10.1128/spectrum.03363-23.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

ABSTRACT Assessing the bacterial community composition across cacao crops is important to understand its potential role as a modulator of cadmium (Cd) translocation to plant tissues under field conditions; Cd mobility between soil and plants is a complex and multifactorial problem that cannot be captured only by experimentation. Although microbes have been shown to metabolize and drive the speciation of Cd under controlled conditions, regardless of the link between soil bacterial community (SBC) dynamics and Cd mobilization in the rhizosphere, only a few studies have addressed the relationship between soil bacterial community composition (SBCC) and Cd content in cacao seeds (Cd seed ). Therefore, this study aimed to explore the association between SBCC and different factors influencing the distribution of Cd across cacao crop systems. This study comprised 225 samples collected across five farms, where we used an amplicon sequencing approach to characterize the bacterial community composition. The soil Cd concentration alone (Cd soil ) was a poor predictor of Cd seed . Still, we found that this relationship was more apparent when the variation within farms was controlled, suggesting a role of heterogeneity within farms in modulating Cd translocation and, thus, seed Cd content. Our results provide evidence of the link between soil bacterial communities and the distribution of Cd across Colombian cacao crops, and highlight the importance of incorporating fine-spatial-scale studies to advance the understanding of factors driving Cd uptake and accumulation in cacao plants. IMPORTANCE Cadmium (Cd) content in cacao crops is an issue that generates interest due to the commercialization of chocolate for human consumption. Several studies provided evidence about the non-biological factors involved in its translocation into the cacao plant. However, factors related to this process, including soil bacterial community composition (SBCC), still need to be addressed. It is well known that soil microbiome could impact compounds’ chemical transformation, including Cd, on the field. Here, we found the first evidence of the link between soil bacterial community composition and Cd concentration in cacao soils and seeds. It highlights the importance of including the variation of bacterial communities to assess the factors driving the Cd translocation into cacao seeds. Moreover, the results highlight the relevance of the spatial heterogeneity within and across cacao farms, influencing the variability of Cd concentrations.

50

Balée, William, Tod Swanson, María Gabriela Zurita-Benavides, and Juan C. Ruiz Macedo. "Evidence for Landscape Transformation of Ridgetop Forests in Amazonian Ecuador." Latin American Antiquity, February 2, 2023, 1–15. http://dx.doi.org/10.1017/laq.2022.94.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Abstract:

Abstract The Napo River basin, which is situated within the Upper Amazon archaeological region, is one of the most speciose forests in Greater Amazonia. Standard thinking in scholarship and science holds that these forests are essentially pristine because any Indigenous impacts in the past would have been minimal, seedbanks would have been nearby, and natural forests would have reappeared after the humans left, died out, or dispersed. Inventory research in 2019 on three ridgetop forests in Waorani territory inside the Curaray basin (which drains to the right margin of the Napo River) and a comparable inventory on one control site forest along the Nushiño River (also in the Curaray basin) show human impacts from about the late nineteenth century to about 1960; they occurred during the period of wartime among Waorani themselves and between Wao people and outsiders. The human impacts resulted in the high basal-area presence of two long-lived species with important Waorani cultural uses: cacao (Theobroma cacao L.) and ungurahua palm (Oenocarpus bataua Mart.). These species have high frequency and dominance values and do not occur in the control site, which is comparable in terms of elevation above the flood zone of the rivers in the sample. These findings mean that alpha diversity in the right margin sector (or south) of the Napo River basin cannot a priori be explained by reference to traditionally, biologically accepted patterns of ecological succession but may require knowledge of historical patterns of Indigenous land use and secondary landscape transformation over time due to human (specifically Waorani) impacts of the past.

Journal articles on the topic 'Transformation du cacao'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles