Journal articles on the topic 'Structural breakpoint'
To see the other types of publications on this topic, follow the link: Structural breakpoint.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Structural breakpoint.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Wang, Dandan, Daixi Li, Guangrong Qin, Wen Zhang, Jian Ouyang, Menghuan Zhang, and Lu Xie. "The Structural Characterization of Tumor Fusion Genes and Proteins." Computational and Mathematical Methods in Medicine 2015 (2015): 1–9. http://dx.doi.org/10.1155/2015/912742.
Full textAbstract:
Chromosomal translocation, which generates fusion proteins in blood tumor or solid tumor, is considered as one of the major causes leading to cancer. Recent studies suggested that the disordered fragments in a fusion protein might contribute to its carcinogenicity. Here, we investigated the sequence feature near the breakpoints in the fusion partner genes, the structure features of breakpoints in fusion proteins, and the posttranslational modification preference in the fusion proteins. Results show that the breakpoints in the fusion partner genes have both sequence preference and structural preference. At the sequence level, nucleotide combination AG is preferred before the breakpoint and GG is preferred at the breakpoint. At the structural level, the breakpoints in the fusion proteins prefer to be located in the disordered regions. Further analysis suggests the phosphorylation sites at serine, threonine, and the methylation sites at arginine are enriched in disordered regions of the fusion proteins. Using EML4-ALK as an example, we further explained how the fusion protein leads to the protein disorder and contributes to its carcinogenicity. The sequence and structural features of the fusion proteins may help the scientific community to predict novel breakpoints in fusion genes and better understand the structure and function of fusion proteins.
2
Still, Ivan H., Olga Chernova, David Hurd, Richard M. Stone, and John K. Cowell. "Molecular Characterization of the t(8; 13)(p11;q12) Translocation Associated With an Atypical Myeloproliferative Disorder: Evidence for Three Discrete Loci Involved in Myeloid Leukemias on 8p11." Blood 90, no. 8 (October 15, 1997): 3136–41. http://dx.doi.org/10.1182/blood.v90.8.3136.
Full textAbstract:
Abstract A reciprocal chromosome translocation between 13q12 and 8p11 is the consistent cytogenetic abnormality seen in a nonspecific myeloproliferative disorder that is associated with T-cell leukemia/lymphoma and peripheral blood eosinophilia. Detailed molecular analyses of the translocation breakpoints associated with this rearrangement have not been reported to date. We have now generated somatic cell hybrids from a newly described patient with this specific structural rearrangement and analyzed the breakpoints on the derivative chromosomes. We have shown that the breakpoint on chromosome 13 lies within a 300- to 500-kb region defined by the KIAA177 gene and D13S1123 marker. In addition, we have identified a 1.2-Mb YAC, 959A4, that crosses the translocation breakpoint on the short arm of chromosome 8 in this patient. The location of this breakpoint in 8p11 is distinct from the t(8; 16) and t(8; 22) translocations associated with M4/M5 myeloid leukemias, and suggests that three distinct loci located within 8p11 are involved in the pathogenesis of myeloid neoplasias.
3
Vaandrager, Jan-Willem, Ed Schuuring, Katja Philippo, and Philip M. Kluin. "V(D)J recombinase-mediated transposition of the BCL2gene to the IGH locus in follicular lymphoma." Blood 96, no. 5 (September 1, 2000): 1947–52. http://dx.doi.org/10.1182/blood.v96.5.1947.
Full textAbstract:
Abstract Using DNA fiber fluorescence in-situ hybridization (FISH) and 3-color interphase FISH, 2 cases of follicular lymphoma were identified in which the BCL2 gene was excised from 18q21 and inserted into the immunoglobulin heavy chain (IGH) locus at 14q32. Both the insertion breakpoint at 14q32 and the deletion breakpoint at 18q21 were cloned using inverse polymerase chain reaction. Sequence analysis showed that the JH sequences were juxtaposed to the 5′-side of BCL2, and the DH sequences were juxtaposed to the 3′-side of BCL2. There were breakpoints at both the JH and DH recombination signal sequences, and N-nucleotides were present at all breakpoint junctions. At theBCL2 locus, the 3′-breakpoints in both cases were localized at exactly the same nucleotide position, 6.2 kilobase downstream of the major breakpoint region, directly adjacent to a complete cryptic recombination signal sequence (RSS) consisting of a heptamer, a nonamer, and a 23–base pair (bp) spacer. The BCL25′-breakpoints were approximately 600 bp upstream of the gene, within the CA repeats. Although less evident than for the BCL23′-breakpoints, cryptic RSSs were also identified at these breakpoints, with a 12-bp spacer. On the basis of structural characteristics of these rearrangements, a model is proposed in which the BCL2 gene is deleted from its locus by recombination activation gene-1/-2 (RAG-1/-2)–mediated excision. The gene is subsequently inserted into the recombiningIGH locus, a process involving the formation of hybrid joints between the IGH coding ends and theBCL2 signal ends.
4
Vaandrager, Jan-Willem, Ed Schuuring, Katja Philippo, and Philip M. Kluin. "V(D)J recombinase-mediated transposition of the BCL2gene to the IGH locus in follicular lymphoma." Blood 96, no. 5 (September 1, 2000): 1947–52. http://dx.doi.org/10.1182/blood.v96.5.1947.h8001947_1947_1952.
Full textAbstract:
Using DNA fiber fluorescence in-situ hybridization (FISH) and 3-color interphase FISH, 2 cases of follicular lymphoma were identified in which the BCL2 gene was excised from 18q21 and inserted into the immunoglobulin heavy chain (IGH) locus at 14q32. Both the insertion breakpoint at 14q32 and the deletion breakpoint at 18q21 were cloned using inverse polymerase chain reaction. Sequence analysis showed that the JH sequences were juxtaposed to the 5′-side of BCL2, and the DH sequences were juxtaposed to the 3′-side of BCL2. There were breakpoints at both the JH and DH recombination signal sequences, and N-nucleotides were present at all breakpoint junctions. At theBCL2 locus, the 3′-breakpoints in both cases were localized at exactly the same nucleotide position, 6.2 kilobase downstream of the major breakpoint region, directly adjacent to a complete cryptic recombination signal sequence (RSS) consisting of a heptamer, a nonamer, and a 23–base pair (bp) spacer. The BCL25′-breakpoints were approximately 600 bp upstream of the gene, within the CA repeats. Although less evident than for the BCL23′-breakpoints, cryptic RSSs were also identified at these breakpoints, with a 12-bp spacer. On the basis of structural characteristics of these rearrangements, a model is proposed in which the BCL2 gene is deleted from its locus by recombination activation gene-1/-2 (RAG-1/-2)–mediated excision. The gene is subsequently inserted into the recombiningIGH locus, a process involving the formation of hybrid joints between the IGH coding ends and theBCL2 signal ends.
5
Schnause, Anna Clara, Katalin Komlosi, Barbara Herr, Jürgen Neesen, Paul Dremsek, Thomas Schwarz, Andreas Tzschach, et al. "Marfan Syndrome Caused by Disruption of the FBN1 Gene due to A Reciprocal Chromosome Translocation." Genes 12, no. 11 (November 21, 2021): 1836. http://dx.doi.org/10.3390/genes12111836.
Full textAbstract:
Marfan syndrome (MFS) is a hereditary connective tissue disease caused by heterozygous mutations in the fibrillin-1 gene (FBN1) located on chromosome 15q21.1. A complex chromosomal rearrangement leading to MFS has only been reported in one case so far. We report on a mother and daughter with marfanoid habitus and no pathogenic variant in the FBN1 gene after next generation sequencing (NGS) analysis, both showing a cytogenetically reciprocal balanced translocation between chromosomes 2 and 15. By means of fluorescence in situ hybridization of Bacterial artificial chromosome (BAC) clones from the breakpoint area on chromosome 15 the breakpoint was narrowed down to a region of approximately 110 kb in FBN1. With the help of optical genome mapping (OGM), the translocation breakpoints were further refined on chromosomes 2 and 15. Sequencing of the regions affected by the translocation identified the breakpoint of chromosome 2 as well as the breakpoint of chromosome 15 in the FBN1 gene leading to its disruption. To our knowledge, this is the first report of patients with typical clinical features of MFS showing a cytogenetically reciprocal translocation involving the FBN1 gene. Our case highlights the importance of structural genome variants as an underlying cause of monogenic diseases and the useful clinical application of OGM in the elucidation of structural variants.
6
Wareham, D. G., K. J. Hall, and D. S. Mavinic. "An ORP screening protocol for biological phosphorus removal in sequencing batch reactors." Canadian Journal of Civil Engineering 22, no. 2 (April 1, 1995): 260–69. http://dx.doi.org/10.1139/l95-035.
Full textAbstract:
This research discusses two strategies for adding acetate to sequencing batch reactors operating as biological removal (Bio-P) systems. The control (fixed-time) reactor adds the acetate at a set time of 1 h 25 min, which is an assumed time for complete denitrification. The experimental (real-time) reactor adds the acetate when a computer detects the disappearance of nitrates, as indicated by a distinctive "breakpoint" or "kink" in the oxidation-reduction potential versus time profile. This control strategy is therefore based upon a known time for complete denitrification. The time-of-occurrence of the nitrate breakpoint is utilized in the development of a screening protocol for interpreting the behaviour (in terms of nitrate reactions) for reactors operating in biological phosphorus removal mode. The protocol involves categorizing the timing of the nitrate breakpoint into two groupings. A "failure" category corresponds to acetate being added prior to the breakpoint, because, in these cases, the acetate is used partially for denitrification and partially for Bio-P carbon storage. A "success" category corresponds to breakpoints occurring prior to the addition of acetate. In such cases, acetate is used solely for carbon storage by Bio-P organisms. Key words: oxidation-reduction potential, biological phosphorus removal, sequencing batch reactor, real-time computer control.
7
Lefeuvre, P., J. M. Lett, A. Varsani, and D. P. Martin. "Widely Conserved Recombination Patterns among Single-Stranded DNA Viruses." Journal of Virology 83, no. 6 (December 30, 2008): 2697–707. http://dx.doi.org/10.1128/jvi.02152-08.
Full textAbstract:
ABSTRACT The combinatorial nature of genetic recombination can potentially provide organisms with immediate access to many more positions in sequence space than can be reached by mutation alone. Recombination features particularly prominently in the evolution of a diverse range of viruses. Despite rapid progress having been made in the characterization of discrete recombination events for many species, little is currently known about either gross patterns of recombination across related virus families or the underlying processes that determine genome-wide recombination breakpoint distributions observable in nature. It has been hypothesized that the networks of coevolved molecular interactions that define the epistatic architectures of virus genomes might be damaged by recombination and therefore that selection strongly influences observable recombination patterns. For recombinants to thrive in nature, it is probably important that the portions of their genomes that they have inherited from different parents work well together. Here we describe a comparative analysis of recombination breakpoint distributions within the genomes of diverse single-stranded DNA (ssDNA) virus families. We show that whereas nonrandom breakpoint distributions in ssDNA virus genomes are partially attributable to mechanistic aspects of the recombination process, there is also a significant tendency for recombination breakpoints to fall either outside or on the peripheries of genes. In particular, we found significantly fewer recombination breakpoints within structural protein genes than within other gene types. Collectively, these results imply that natural selection acting against viruses expressing recombinant proteins is a major determinant of nonrandom recombination breakpoint distributions observable in most ssDNA virus families.
8
Beauchamp, N. J., M. Makris, F. E. Preston, I. R. Peake, and M. E. Daly. "Major Structural Defects in the Antithrombin Gene in Four Families with Type I Antithrombin Deficiency." Thrombosis and Haemostasis 83, no. 05 (2000): 715–21. http://dx.doi.org/10.1055/s-0037-1613898.
Full textAbstract:
SummaryThe molecular basis of quantitative antithrombin deficiency was investigated in four families predicted to have major antithrombin gene rearrangements. A 1,442 bp deletion and insertion of the sequence 5’T(n = 38-40)GAGACG was characterised in one case. Sequence surrounding the breakpoints contained two perfect, and one imperfect, inverted repeats which may have mediated formation of a stem loop structure on one strand during DNA replication potentiating the deletion. A 9,219 bp deletion spanning introns 2 to 5 was identified in a second family. The identical 6 bp sequence was upstream of each breakpoint and the 5’ breakpoint was located in a sequence of the Alu 3 repeat predicted to be susceptible to strand breakage during transcription. This may have promoted misalignment, and deletion, of one of the repeats and the intervening DNA. A novel 1.8 kb antithrombin gene fragment was present in DNA digests from affected members of the third family suggesting a partial antithrombin gene duplication event while in the remaining family, evidence supporting a complete gene deletion was obtained.
9
van den Broek, Evert, Stef van Lieshout, Christian Rausch, Bauke Ylstra, Mark A. van de Wiel, Gerrit A. Meijer, Remond J. A. Fijneman, and Sanne Abeln. "GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes." F1000Research 5 (September 19, 2016): 2340. http://dx.doi.org/10.12688/f1000research.9259.1.
Full textAbstract:
Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs) of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large) series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH) or by (low-pass) whole genome sequencing (WGS). First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org) and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html).
10
van den Broek, Evert, Stef van Lieshout, Christian Rausch, Bauke Ylstra, Mark A. van de Wiel, Gerrit A. Meijer, Remond J. A. Fijneman, and Sanne Abeln. "GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes." F1000Research 5 (July 6, 2017): 2340. http://dx.doi.org/10.12688/f1000research.9259.2.
Full textAbstract:
Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs) of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large) series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH) or by (low-pass) whole genome sequencing (WGS). First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org) and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html).
11
Heath, Livio, Eric van der Walt, Arvind Varsani, and Darren P. Martin. "Recombination Patterns in Aphthoviruses Mirror Those Found in Other Picornaviruses." Journal of Virology 80, no. 23 (September 13, 2006): 11827–32. http://dx.doi.org/10.1128/jvi.01100-06.
Full textAbstract:
ABSTRACT Foot-and-mouth disease virus (FMDV) is thought to evolve largely through genetic drift driven by the inherently error-prone nature of its RNA polymerase. There is, however, increasing evidence that recombination is an important mechanism in the evolution of these and other related picornoviruses. Here, we use an extensive set of recombination detection methods to identify 86 unique potential recombination events among 125 publicly available FMDV complete genome sequences. The large number of events detected between members of different serotypes suggests that horizontal flow of sequences among the serotypes is relatively common and does not incur severe fitness costs. Interestingly, the distribution of recombination breakpoints was found to be largely nonrandom. Whereas there are clear breakpoint cold spots within the structural genes, two statistically significant hot spots precisely separate these from the nonstructural genes. Very similar breakpoint distributions were found for other picornovirus species in the genera Enterovirus and Teschovirus. Our results suggest that genome regions encoding the structural proteins of both FMDV and other picornaviruses are functionally interchangeable modules, supporting recent proposals that the structural and nonstructural coding regions of the picornaviruses are evolving largely independently of one another.
12
Cameron, Daniel L., Ruining Dong, and Anthony T. Papenfuss. "StructuralVariantAnnotation: a R/Bioconductor foundation for a caller-agnostic structural variant software ecosystem." Bioinformatics 38, no. 7 (February 4, 2022): 2046–48. http://dx.doi.org/10.1093/bioinformatics/btac042.
Full textAbstract:
Abstract Summary StructuralVariantAnnotation is an R/Bioconductor package that provides a framework for decoupling downstream analysis of structural variant breakpoints from upstream variant calling methods. It standardizes the representational format from BEDPE, or any of the three different notations supported by VCF into a breakpoint GRanges data structure suitable for use by the wider Bioconductor ecosystem. It handles both transitive breakpoints and duplication/insertion notational differences of identical variants—both common scenarios when comparing short/long read-based call sets that confound downstream analysis. StructuralVariantAnnotation provides the caller-agnostic foundation needed for a R/Bioconductor ecosystem of structural variant annotation, classification and interpretation tools able to handle both simple and complex genomic rearrangements. Availability and implementation StructuralVariantAnnotation is implemented in R and available for download as the Bioconductor StructuralVariantAnnotation package. Details can be found at https://www.bioconductor.org/packages/release/bioc/html/StructuralVariantAnnotation.html. It has been released under a GPL license.
13
Ghysels, Eric, Alain Guay, and Alastair Hall. "Predictive tests for structural change with unknown breakpoint." Journal of Econometrics 82, no. 2 (February 1998): 209–33. http://dx.doi.org/10.1016/s0304-4076(97)00057-2.
Full text
14
Wyczalkowski, Matthew A., Kristine M. Wylie, Song Cao, Michael D. McLellan, Jennifer Flynn, Mo Huang, Kai Ye, et al. "BreakPoint Surveyor: a pipeline for structural variant visualization." Bioinformatics 33, no. 19 (June 5, 2017): 3121–22. http://dx.doi.org/10.1093/bioinformatics/btx362.
Full text
15
Damián, Alejandra, Raluca Oancea Ionescu, Marta Rodríguez de Alba, Alejandra Tamayo, María José Trujillo-Tiebas, María Carmen Cotarelo-Pérez, Olga Pérez Rodríguez, et al. "Fine Breakpoint Mapping by Genome Sequencing Reveals the First Large X Inversion Disrupting the NHS Gene in a Patient with Syndromic Cataracts." International Journal of Molecular Sciences 22, no. 23 (November 24, 2021): 12713. http://dx.doi.org/10.3390/ijms222312713.
Full textAbstract:
Inversions are structural variants that are generally balanced. However, they could lead to gene disruptions or have positional effects leading to diseases. Mutations in the NHS gene cause Nance-Horan syndrome, an X-linked disorder characterised by congenital cataracts and dental anomalies. Here, we aimed to characterise a balanced pericentric inversion X(p22q27), maternally inherited, in a child with syndromic bilateral cataracts by breakpoint mapping using whole-genome sequencing (WGS). 30× Illumina paired-end WGS was performed in the proband, and breakpoints were confirmed by Sanger sequencing. EdU assays and FISH analysis were used to assess skewed X-inactivation patterns. RNA expression of involved genes in the breakpoint boundaries was evaluated by droplet-digital PCR. We defined the breakpoint position of the inversion at Xp22.13, with a 15 bp deletion, disrupting the unusually large intron 1 of the canonical NHS isoform, and also perturbing topologically-associated domains (TADs). Moreover, a microhomology region of 5 bp was found on both sides. RNA analysis confirmed null and reduced NHS expression in the proband and his unaffected mother, respectively. In conclusion, we report the first chromosomal inversion disrupting NHS, fine-mapped by WGS. Our data expand the clinical spectrum and the pathogenic mechanisms underlying the NHS defects.
16
Jaeger, U., B. Purtscher, GD Karth, S. Knapp, C. Mannhalter, and K. Lechner. "Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein." Blood 81, no. 7 (April 1, 1993): 1833–40. http://dx.doi.org/10.1182/blood.v81.7.1833.1833.
Full textAbstract:
Abstract The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
17
Jaeger, U., B. Purtscher, GD Karth, S. Knapp, C. Mannhalter, and K. Lechner. "Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein." Blood 81, no. 7 (April 1, 1993): 1833–40. http://dx.doi.org/10.1182/blood.v81.7.1833.bloodjournal8171833.
Full textAbstract:
The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
18
Mackay, Alan, Yura Grabovska, Matthew Clarke, Diana Carvalho, Sara Temelso, and Chris Jones. "PATH-17. INTRAGENIC COPY NUMBER BREAKPOINT ANALYSIS OF METHYLATION DATA FROM CNS TUMOURS IDENTIFIES NOVEL SUBGROUP-SPECIFIC CANDIDATE FUSION GENE ENRICHMENTS." Neuro-Oncology 22, Supplement_3 (December 1, 2020): iii427—iii428. http://dx.doi.org/10.1093/neuonc/noaa222.652.
Full textAbstract:
Abstract Methylation array-based molecular profiling has redefined the classification of brain tumours and now forms an important part of their integrated diagnosis, providing both subgroup assignment and genome wide DNA copy number profiles. These latter data can be used to identify intragenic breakpoints which are frequently associated with structural variations resulting in therapeutically targetable oncogenic fusion genes. To systematically assess the landscape of these alterations, we combined publicly available methylation datasets resulting in a total of 5660 CNS tumours, around half paediatric, and including >1000 high grade glioma and DIPG. These were analysed by standard methodology (MNP, conumee), and intragenic breakpoint enrichment was compared within methylation subgroups, superfamilies, and tumours with no high-scoring classification. Benchmarking included sequence-verified cases such as infant hemispheric gliomas (IHG) with ALK(15%) and ROS1(7%) fusions, and pathognomic alterations associated with specific entities such as RELA-EPN, MYB-LGG and HGNET-MN1. We identified previously unreported enrichments of well-recognised fusion targets such as NTRK2in GBM_MID and NTRK3in DMG_K27 (both 5%), METin A_IDH / A_IDH_HG (3–5%), and FGFR1/3in GBM_G34 (8–9%). Novel recurrent kinase gene candidates to be verified and explored further include IGF1Rin 2–12% cases spanning glioma subgroups, and TIE1in poorly classified tumours. This latter ‘NOS’ group were also enriched in various transcription factor targets of breakpoints, including TCF4and PLAGL2. Despite limitations due to sample quality, resolution or balanced translocations, breakpoint analysis of methylation copy number profiles provides simple screening for structural rearrangements which may directly influence targeted therapy in paediatric CNS tumours.
19
Carbó-Meix, Anna, Francesca Guijarro, Luojun Wang, Romina Royo, Isabel Granada, José Tomás Navarro, Blanca Espinet, et al. "Whole Genome Sequencing of B-Cell Neoplasms with t(14;19)(q32;q13) Reveals Different Entities." Blood 138, Supplement 1 (November 5, 2021): 3709. http://dx.doi.org/10.1182/blood-2021-150891.
Full textAbstract:
Abstract Introduction: The t(14;19)(q32;q13) is a rare cytogenetic abnormality found in <0.1% of all B-cell neoplasms. The molecular features of this translocation are not well characterized. IGH-BCL3 rearrangement has been found in some tumors identified as "atypical" chronic lymphocytic leukemia (CLL) with aggressive clinical evolution. This translocation has also been observed in other B-cell neoplasms without clear evidence of the target gene. The mechanisms generating this translocation, the genomic profile of alterations of these cases, and whether different molecular features may be associated with specific entities are not known. Aim: To elucidate the genomic features of B-cell neoplasms carrying the t(14;19) and their relationship to pathological characteristics of the tumors. Materials and methods: We sequenced the whole-genome (WGS) of 13 cases in which the t(14;19) had been identified by conventional cytogenetics and/or FISH using a BCL3 break-apart probe. In six of these cases we performed RNA-seq. Pathological and clinical revision was conducted in all cases, 8 of them with tissue biopsies. Results: The breakpoints of the t(14;19) were characterized at base-pair resolution using WGS. All breakpoints in chr14 were found within any of the class switch recombination (CSR) regions suggesting an aberrant CSR as the mechanism causing this alteration. The breakpoints on chr19 were found upstream (13 kb) the 5' untranslated region (UTR) of BCL3 in 8/13 (61.5%) cases. One additional case had the breakpoint further upstream (49 kb) of BCL3 truncating CEACAM16. The four remaining cases had breakpoints downstream of BCL3; two cases within CBLC, one in BCAM, and one after NECTIN2. Of note, the further upstream BCL3 case and the downstream BCL3 cases had mutated IGHV, while all upstream BCL3 cases had unmutated IGHV. Based on RNA-seq data, all upstream BCL3 cases (n=5) showed an upregulation of BCL3, while one downstream case with RNA-seq available showed upregulation of NECTIN2 and low levels of BCL3. The pathology review identified the four downstream BCL3 cases as marginal zone lymphomas whereas the cases with breakpoints upstream BCL3 (n=3 with tissue available) and the case further upstream BCL3 were classified as "atypical" CLL. We next characterized the genomic landscape of these tumors based on the breakpoint on chr19 (upstream and downstream BCL3). The analysis of the WGS showed a lower number of mutations, copy number alterations (CNA), and structural variants (SV) in the upstream BCL3 group compared to the downstream BCL3 cases (mean of 2429.5 vs 6271.7 somatic mutations, 3.1 vs 11.7 CNA, and 4.4 vs 18 SV, respectively). In terms of specific driver mutations, the downstream BCL3 group carried mutations in genes previously described in MZL, such as KMT2D, NOTCH2, or KLF2 found in two cases. All but one case with the breakpoint upstream BCL3 carried trisomy 12 (tri12), which was absent in all cases with a downstream breakpoint. Finally, we performed a differential expression analysis between 5 atypical CLL cases with BCL3 rearrangements vs 4 CLL without t(14;19) [all unmutated IGHV]. This analysis showed 578 genes upregulated and 720 genes downregulated in the BCL3-rearranged cases (q <0.05), including remarkable differences in the expression of previously described CLL hallmark genes, such as upregulation of EBF1 and downregulation of LEF1, FMOD, ADTRP, CLNK, IGSF3, TCF4. An analysis of the RNA-seq data of 294 CLL cases lacking the t(14;19) (Puente et al., Nature 2015) indicated that this transcriptional program was not related to IGHV mutational status nor to the presence of tri12. Nonetheless, we identified a small set of tri12 mutated IGHV CLL lacking the t(14;19) with a similar modulation of the expression of the above hallmark genes. Conclusions: We have characterized the breakpoints of the t(14;19) at base-pair resolution and evidenced marked molecular and pathological differences of the tumors according to the location of the breakpoint. Tumors carrying the breakpoint downstream BCL3 exhibit a higher genomic complexity, driver alterations, and pathological features corresponding to MZL. Contrarily, tumors with the breakpoint upstream of BCL3 upregulate BCL3 and display lower genomic complexity as well as CLL-like features. Nonetheless, these cases have a different gene expression profile compared to conventional CLL characterized by LEF1 downregulation and EBF1 overexpression. Disclosures Navarro: Nocartis: Honoraria; Roche: Honoraria; EUSA: Consultancy, Research Funding; Pharma: Consultancy; GILEAD: Research Funding; Pharma: Research Funding.
20
Phoong, Seuk Wai, Seuk Yen Phoong, Sedigheh Moghavvemi, and Kok Hau Phoong. "Multiple Breakpoint Test on Crude Oil Price." Foundations of Management 11, no. 1 (January 1, 2019): 187–96. http://dx.doi.org/10.2478/fman-2019-0016.
Full textAbstract:
Abstract The impact of structural changes as well as breaks on oil price fluctuations is studied in this article. There are a few channels, such as domestic prices and inflation, that cause the effect of oil price to pass through the economy. The higher crude oil price is immediately followed by the increase in oil products such as gasoline and heating oil. The direct effects continue as people choose alternative energy sources, leading to the increase in price. Besides, the indirect effect on inflation as a result of the behavioral responses of the firms and workers which is known as the “second round” effects in which higher wages is being demanded. This article uses exploratory data analysis to discover the patterns of the variables’ series and then examines the relationship between oil price and consumer price index. Multiple breakpoint test is thereafter used to identify the structural changes in time-varying variables.
21
Kim, Pora, Ke Yiya, and Xiaobo Zhou. "FGviewer: an online visualization tool for functional features of human fusion genes." Nucleic Acids Research 48, W1 (May 18, 2020): W313—W320. http://dx.doi.org/10.1093/nar/gkaa364.
Full textAbstract:
Abstract Among the diverse location of the breakpoints (BPs) of structural variants (SVs), the breakpoints of fusion genes (FGs) are located in the gene bodies. This broken gene context provided the aberrant functional clues to study disease genesis. Many tumorigenic fusion genes have retained or lost functional or regulatory domains and these features impacted tumorigenesis. Full annotation of fusion genes aided by the visualization tool based on two gene bodies will be helpful to study the functional aspect of fusion genes. To date, a specialized tool with effective visualization of the functional features of fusion genes is not available. In this study, we built FGviewer, a tool for visualizing functional features of human fusion genes, which is available at https://ccsmweb.uth.edu/FGviewer. FGviewer gets the input of fusion gene symbols, breakpoint information, or structural variants from whole-genome sequence (WGS) data. For any combination of gene pairs/breakpoints to be involved in fusion genes, the users can search the functional/regulatory aspect of the fusion gene in the three bio-molecular levels (DNA-, RNA-, and protein-levels) and one clinical level (pathogenic-level). FGviewer will be a unique online tool in disease research communities.
22
Zhang, Jinping, Hongbin Li, Bin Sun, and Hongyuan Fang. "Annual runoff prediction in the source area of the Yellow River based on structure change co-integration theory." Water Supply 20, no. 5 (May 4, 2020): 1664–77. http://dx.doi.org/10.2166/ws.2020.075.
Full textAbstract:
Abstract Aiming at revealing the co-integration under structural change in the long-run relationship between rainfall and runoff time series at Tangnaihai Hydrological Station in the source area of the Yellow River, and improving the accuracy of annual runoff prediction, co-integration theory and structure change co-integration theory are introduced respectively. The error correction models of rainfall and runoff in these two cases are constructed. The results show that reservoir construction and climate change can cause structure change in the long-run relationship between rainfall and runoff in the source area of the Yellow River. The breakpoints appeared in 1989 and 2002, in which the breakpoint in 1989 is mainly effected by reservoir construction while in 2002 it is effected by rainfall changes. Meanwhile, the error correction model with structural change shows that the impact of rainfall on runoff decreases from 1989 but increases from 2002. Finally, for the prediction of runoff in the next five years, the mean absolute percentage errors of the prediction models without and with breakpoints are 11.04% and 7.08% respectively, and this shows that the error correction model with structural change has the higher runoff prediction accuracy.
23
Greer, S. U., and H. P. Ji. "Structural variant analysis for linked-read sequencing data with gemtools." Bioinformatics 35, no. 21 (April 2, 2019): 4397–99. http://dx.doi.org/10.1093/bioinformatics/btz239.
Full textAbstract:
Abstract Summary Linked-read sequencing generates synthetic long reads which are useful for the detection and analysis of structural variants (SVs). The software associated with 10× Genomics linked-read sequencing, Long Ranger, generates the essential output files (BAM, VCF, SV BEDPE) necessary for downstream analyses. However, to perform downstream analyses requires the user to customize their own tools to handle the unique features of linked-read sequencing data. Here, we describe gemtools, a collection of tools for the downstream and in-depth analysis of SVs from linked-read data. Gemtools uses the barcoded aligned reads and the Megabase-scale phase blocks to determine haplotypes of SV breakpoints and delineate complex breakpoint configurations at the resolution of single DNA molecules. The gemtools package is a suite of tools that provides the user with the flexibility to perform basic functions on their linked-read sequencing output in order to address even more questions. Availability and implementation The gemtools package is freely available for download at: https://github.com/sgreer77/gemtools. Supplementary information Supplementary data are available at Bioinformatics online.
24
Machiela, Mitchell J., Lea Jessop, Weiyin Zhou, Meredith Yeager, and Stephen J. Chanock. "Characterization of breakpoint regions of large structural autosomal mosaic events." Human Molecular Genetics 26, no. 22 (August 16, 2017): 4388–94. http://dx.doi.org/10.1093/hmg/ddx324.
Full text
25
Carlson, John B., Ben Craig, and Jeffrey C. Schwarz. "Structural uncertainty and breakpoint tests: an application to equilibrium velocity." Journal of Economics and Business 52, no. 1-2 (January 2000): 101–15. http://dx.doi.org/10.1016/s0148-6195(99)00027-2.
Full text
26
Wang, Shaoqiang, Jie Li, A. K. Alvi Haque, Haiyong Zhao, Liying Yang, and Xiguo Yuan. "svBreak: A New Approach for the Detection of Structural Variant Breakpoints Based on Convolutional Neural Network." BioMed Research International 2022 (March 19, 2022): 1–8. http://dx.doi.org/10.1155/2022/7196040.
Full textAbstract:
Structural variation (SV) is an important type of genome variation and confers susceptibility to human cancer diseases. Systematic analysis of SVs has become a crucial step for the exploration of mechanisms and precision diagnosis of cancers. The central point is how to accurately detect SV breakpoints by using next-generation sequencing (NGS) data. Due to the cooccurrence of multiple types of SVs in the human genome and the intrinsic complexity of SVs, the discrimination of SV breakpoint types is a challenging task. In this paper, we propose a convolutional neural network- (CNN-) based approach, called svBreak, for the detection and discrimination of common types of SV breakpoints. The principle of svBreak is that it extracts a set of SV-related features for each genome site from the sequencing reads aligned to the reference genome and establishes a data matrix where each row represents one site and each column represents one feature and then adopts a CNN model to analyze such data matrix for the prediction of SV breakpoints. The performance of the proposed approach is tested via simulation studies and application to a real sequencing sample. The experimental results demonstrate the merits of the proposed approach when compared with existing methods. Thus, svBreak can be expected to be a supplementary approach in the field of SV analysis in human tumor genomes.
27
Mungall, Andrew J., Andy Chu, Readman Chiu, Richard Corbett, Matthew A. Field, Shaun D. Jackman, Karen L. Mungall, et al. "Base-Pair Resolution of Somatic and Germline-Derived Genome Rearrangement Breakpoints in Follicular Lymphoma." Blood 114, no. 22 (November 20, 2009): 439. http://dx.doi.org/10.1182/blood.v114.22.439.439.
Full textAbstract:
Abstract Abstract 439 Introduction: Follicular lymphoma (FL) is the most common indolent lymphoid malignancy in North America with approximately 20,000 new cases of this incurable cancer diagnosed each year. In approximately 85% of patients, FL is associated with the reciprocal translocation t(14;18)(q32;q21), which results in a fusion between IGH and BCL2 genes and consequent over-expression of the anti-apoptotic protein BCL2. This translocation likely represents an initiating event for FL, requiring additional mutational events for the onset of clinical disease. To investigate the relationship between genome rearrangements and FL we identified rearrangement locations in the genome followed by detailed, fine-structure analysis of the rearrangements to ascertain their effects on genes and other features of biological interest. Patients and Methods: We used a whole-genome bacterial artificial chromosome (BAC) fingerprint-based approach, termed Fingerprint Profiling (FPP, Krzywinski, M. et al. 2007), to detect genome rearrangements relative to the reference human genome in neoplastic B cells purified from 24 FL patient biopsies. Analysis of 2,640,707 BAC fingerprints revealed 721 candidate genomic rearrangements. To validate these observations and provide base-pair resolution of the rearrangement breakpoints we performed paired-end massively parallel sequencing, on the Illumina Genome Analyzer II platform, of the breakpoint-containing regions captured in the BAC clones. Sequence reads were assembled into contigs using our in-house de novo assembly algorithm ABySS (Assembly By Short Sequences, Simpson, J. et al. 2009) then aligned to the reference human genome. Following manual annotation of the breakpoint junctions PCR primers were designed to assay patient tumour and matched constitutional DNA and thus determine whether the observed genome rearrangements were somatic (acquired) or germline in origin. Results: 727 BACs with apparent large-scale genome rearrangements, representing 354 distinct genome rearrangements across 20 patients, were sequenced in 95 pools, generating 72 Gbp of sequence. The 354 distinct events include 163 deletions, 71 inversions, 27 insertions, 83 translocations and 10 duplications, ranging in size from 3 kb to 67 Mb. PCR assays for 194 of the distinct events have been performed thus far identifying 80 distinct somatic and 114 germline-derived structural variations at base-pair resolution. Of the somatic events 5 are present in two or more of the 20 patients analyzed including a 720 kb inversion of 3q27.3 that results in expression of a BCL6-ST6GAL1 fusion transcript. Identification at base-pair resolution of breakpoint sequences enabled a detailed study of breakpoint and fusion mechanisms. We classified breakpoint junctions into 4 groups; those with microhomology (48%), those with sequence additions (28%), those with blunt fusions (20%) and those with flanking low copy repeats (4%). We were particularly interested in establishing the origin of the observed nucleotide sequence additions in 97 breakpoint junctions. The sequence additions ranged in size from a single nucleotide to 454 bp. In one case we have unambiguously mapped a 53 bp sequence, lying within one of the 3q27.3 inversion breakpoints, to chromosome 5q12.3. This finding is consistent with the recently proposed fork stalling and template switching (FoSTeS) DNA replication-based mechanism and thus represents a novel mechanism in FL lymphomagenesis. Conclusions: We have successfully employed high-throughput clone fingerprinting and sequencing to identify numerous novel somatic and germline genome rearrangements from FL primary tumour samples. Furthermore, base-pair resolution of rearrangement breakpoints provides mechanistic insights. With the complete inventory of somatic and germline events in hand we will be able to propose recurrent structurally altered genes in FL patients for validation in independent datasets and improve our understanding of FL biology. Pathway analyses to identify emerging themes from somatic mutations are also being performed. The PCR assays we have developed will also be of utility in identifying germline predisposition alleles in larger FL patient cohorts. Disclosures: No relevant conflicts of interest to declare.
28
Thibodeau, My Linh, Michelle Steinraths, Lindsay Brown, Zheyuan Zong, Naomi Shomer, Stefan Taubert, Karen L. Mungall, et al. "Genomic and Cytogenetic Characterization of a Balanced Translocation Disrupting NUP98." Cytogenetic and Genome Research 152, no. 3 (2017): 117–21. http://dx.doi.org/10.1159/000479463.
Full textAbstract:
A 41-year-old Asian woman with bilateral renal angiomyolipomas (AML) was incidentally identified to have a balanced translocation, 46,XX,t(11;12)(p15.4;q15). She had no other features or family history to suggest a diagnosis of tuberous sclerosis. Her healthy daughter had the same translocation and no renal AML at the age of 3 years. Whole-genome sequencing was performed on genomic maternal DNA isolated from blood. A targeted de novo assembly was then conducted with ABySS for chromosomes 11 and 12. Sanger sequencing was used to validate the translocation breakpoints. As a result, genomic characterization of chromosomes 11 and 12 revealed that the 11p breakpoint disrupted the NUP98 gene in intron 1, causing a separation of the promoter and transcription start site from the rest of the gene. The translocation breakpoint on chromosome 12q was located in a gene desert. NUP98 has not yet been associated with renal AML pathogenesis, but somatic NUP98 alterations are recurrently implicated in hematological malignancies, most often following a gene fusion event. We also found evidence for complex structural events involving chromosome 12, which appear to disrupt the TDG gene. We identified a TDGP1 partially processed pseudogene at 12p12.1, which adds complexity to the de novo assembly. In conclusion, this is the first report of a germline constitutional structural chromosome rearrangement disrupting NUP98 that occurred in a generally healthy woman with bilateral renal AML.
29
Wang, Rui, Xiaofeng Hui, and Xuechao Zhang. "Analysis of Multiple Structural Changes in Financial Contagion Based on the Largest Lyapunov Exponents." Mathematical Problems in Engineering 2014 (2014): 1–7. http://dx.doi.org/10.1155/2014/209470.
Full textAbstract:
A modified multiple structural changes model is built to test structural breaks of the financial system based on calculating the largest Lyapunov exponents of the financial time series. Afterwards, the Lorenz system is used as a simulation example to inspect the new model. As the Lorenz system has strong nonlinearity, the verification results show that the new model has good capability in both finding the breakpoint and revealing the changes in nonlinear characteristics of the time series. The empirical study based on the model used daily data from the S&P 500 stock index during the global financial crisis from 2005 to 2012. The results provide four breakpoints of the period, which divide the contagion into four stages: stationary, local outbreak, global outbreak, and recovery period. An additional significant result is the obvious chaos characteristic difference in the largest Lyapunov exponents and the standard deviation at various stages, particularly at the local outbreak stage.
30
Suzuki, Erina, Ryosuke Bo, Kaori Sue, Hiroyuki Awano, Tsutomu Ogata, Satoshi Narumi, Masayo Kagami, Shinichiro Sano, and Maki Fukami. "A de novo 50-bp GNAS Intragenic Duplication in a Patient with Pseudohypoparathyroidism Type 1a." Cytogenetic and Genome Research 153, no. 3 (2017): 125–30. http://dx.doi.org/10.1159/000485644.
Full textAbstract:
Germline intragenic mutations in the GNAS locus result in pseudohypoparathyroidism type 1a (PHP1a) and related conditions. Nearly half of the previously reported GNAS intragenic mutations were structural variants, including 3 tandem duplications of 12-25 bp. However, the precise mutation spectrum and the genomic basis of GNAS structural variants remain to be clarified. Here, we report a de novo 50-bp tandem duplication in GNAS (c.723_772dup50, p.Glu259Leufs*29) identified in a patient with typical clinical features of PHP1a. The mutant transcript was predicted to undergo mRNA decay or encode a nonfunctional protein. The 2 breakpoints of the duplication shared a 1-bp microhomology but were not associated with long homology or nucleotide stretches. We also examined the breakpoint structures of 3 previously reported GNAS duplications and found that 1 had a structure similar to that of our case, while the remaining 2 had blunt-ended breakpoints without microhomologies. In silico analyses revealed that the GNAS-flanking region was not enriched with repeats, palindromes, noncanonical DNA motifs, or GC content. This study expands the mutation spectrum of GNAS and provides the first indication that GNAS intragenic structural variants are induced by multiple processes, including nonhomologous end-joining and/or microhomology-mediated break-induced replication, independently of known rearrangement-inducing DNA features.
31
Chong, Lauren C., David D. W. Twa, Anja Mottok, Susana Ben-Neriah, Bruce W. Woolcock, Yongjun Zhao, Kerry J. Savage, et al. "Comprehensive characterization of programmed death ligand structural rearrangements in B-cell non-Hodgkin lymphomas." Blood 128, no. 9 (September 1, 2016): 1206–13. http://dx.doi.org/10.1182/blood-2015-11-683003.
Full text
32
Orlando, Valeria, Silvia Di Tommaso, Viola Alesi, Sara Loddo, Silvia Genovese, Giorgia Catino, Licia Martucci, et al. "A Complex Genomic Rearrangement Resulting in Loss of Function of SCN1A and SCN2A in a Patient with Severe Developmental and Epileptic Encephalopathy." International Journal of Molecular Sciences 23, no. 21 (October 26, 2022): 12900. http://dx.doi.org/10.3390/ijms232112900.
Full textAbstract:
Complex genomic rearrangements (CGRs) are structural variants arising from two or more chromosomal breaks, which are challenging to characterize by conventional or molecular cytogenetic analysis (karyotype and FISH). The integrated approach of standard and genomic techniques, including optical genome mapping (OGM) and genome sequencing, is crucial for disclosing and characterizing cryptic chromosomal rearrangements at high resolutions. We report on a patient with a complex developmental and epileptic encephalopathy in which karyotype analysis showed a de novo balanced translocation involving the long arms of chromosomes 2 and 18. Microarray analysis detected a 194 Kb microdeletion at 2q24.3 involving the SCN2A gene, which was considered the likely translocation breakpoint on chromosome 2. However, OGM redefined the translocation breakpoints by disclosing a paracentric inversion at 2q24.3 disrupting SCN1A. This combined genomic high-resolution approach allowed a fine characterization of the CGR, which involves two different chromosomes with four breakpoints. The patient’s phenotype resulted from the concomitant loss of function of SCN1A and SCN2A.
33
Chen, Q., C. Y. Yang, J. T. Tsan, Y. Xia, A. H. Ragab, S. C. Peiper, A. Carroll, and R. Baer. "Coding sequences of the tal-1 gene are disrupted by chromosome translocation in human T cell leukemia." Journal of Experimental Medicine 172, no. 5 (November 1, 1990): 1403–8. http://dx.doi.org/10.1084/jem.172.5.1403.
Full textAbstract:
The tal-1 proto-oncogene encodes a helix-loop-helix DNA-binding protein that has been implicated in the formation of T cell acute lymphoblastic leukemia (T-ALL). Patients with T-ALL harbor structural rearrangements of tal-1 that result from either local DNA deletion or t(1;14)(p34;q11) chromosome translocation. By analyzing t(1;14)(p34;q11) chromosomes from a series of patients, we have now identified a discrete region of tal-1 wherein most of the translocation breakpoints occur. Moreover, mapping of tal-1 genomic DNA revealed that coding exons are situated on both sides of the t(1;14)(p34;q11) major breakpoint region. Hence, the translocated allele of tal-1 is truncated in a manner that reduces its amino acid coding potential.
34
Umanskaya, O. N., A. A. Bystritskiy, and S. V. Razin. "Chromosome Rearrangement Breakpoint Clustering: The Role of Clonal Selection." Molecular Biology 39, no. 3 (May 2005): 313–20. http://dx.doi.org/10.1007/s11008-005-0044-6.
Full text
35
Suzukawa, K., E. Parganas, A. Gajjar, T. Abe, S. Takahashi, K. Tani, S. Asano, H. Asou, N. Kamada, and J. Yokota. "Identification of a breakpoint cluster region 3' of the ribophorin I gene at 3q21 associated with the transcriptional activation of the EVI1 gene in acute myelogenous leukemias with inv(3)(q21q26)." Blood 84, no. 8 (October 15, 1994): 2681–88. http://dx.doi.org/10.1182/blood.v84.8.2681.2681.
Full textAbstract:
Abstract Structural alterations occur in the long arm of chromosome 3 in approximately 2% of patients with acute myelogenous leukemia (AML) or myelodysplastic syndrome (MDS). The major alterations are inv(3)(q21q26) and t(3:3)(q21;q26) and are often classified as the 3q21q26 syndrome. We previously reported that the EVI1 gene is transcriptionally activated in AMLs with t(3;3)(q21;q26) and inv(3)(q21q26) and that the chromosomal breakpoints at 3q26 in the translocations were 5′ of the EVI1 gene, whereas the breakpoints in the inversion cases were 3′ of the gene. In these studies, four additional cases of AML with inv(3)(q21q26) are shown to express the EVI1 gene and to have breakpoints 3′ of the gene. To characterize the 3q21 breakpoint region, cosmid and phage clones were isolated that cover approximately 100 kb. At 3q21, the breakpoints for both AMLs with t(3;3)(q21;q26) and inv(3)(q21q26) were found to cluster over a region of approximately 50 kb downstream of the Ribophorin I gene. The results indicate a common mechanism for the translocations and inversions and support the hypothesis that the transcriptional activation of the EVI1 gene is mediated by enhancer elements associated with the Ribophorin I gene.
36
Suzukawa, K., E. Parganas, A. Gajjar, T. Abe, S. Takahashi, K. Tani, S. Asano, H. Asou, N. Kamada, and J. Yokota. "Identification of a breakpoint cluster region 3' of the ribophorin I gene at 3q21 associated with the transcriptional activation of the EVI1 gene in acute myelogenous leukemias with inv(3)(q21q26)." Blood 84, no. 8 (October 15, 1994): 2681–88. http://dx.doi.org/10.1182/blood.v84.8.2681.bloodjournal8482681.
Full textAbstract:
Structural alterations occur in the long arm of chromosome 3 in approximately 2% of patients with acute myelogenous leukemia (AML) or myelodysplastic syndrome (MDS). The major alterations are inv(3)(q21q26) and t(3:3)(q21;q26) and are often classified as the 3q21q26 syndrome. We previously reported that the EVI1 gene is transcriptionally activated in AMLs with t(3;3)(q21;q26) and inv(3)(q21q26) and that the chromosomal breakpoints at 3q26 in the translocations were 5′ of the EVI1 gene, whereas the breakpoints in the inversion cases were 3′ of the gene. In these studies, four additional cases of AML with inv(3)(q21q26) are shown to express the EVI1 gene and to have breakpoints 3′ of the gene. To characterize the 3q21 breakpoint region, cosmid and phage clones were isolated that cover approximately 100 kb. At 3q21, the breakpoints for both AMLs with t(3;3)(q21;q26) and inv(3)(q21q26) were found to cluster over a region of approximately 50 kb downstream of the Ribophorin I gene. The results indicate a common mechanism for the translocations and inversions and support the hypothesis that the transcriptional activation of the EVI1 gene is mediated by enhancer elements associated with the Ribophorin I gene.
37
Fan, Haitao, Zhe Liu, Peng Zhan, and Guoliang Jia. "Pericentric inversion of chromosome 6 and male fertility problems." Open Medicine 17, no. 1 (January 1, 2022): 191–96. http://dx.doi.org/10.1515/med-2022-0411.
Full textAbstract:
Abstract As a significant chromosomal structural abnormality, chromosomal inversion is closely related to male infertility. For inversion carriers, the interchromosomal effect explains male infertility, but its specific mechanism remains unclear. Additionally, inversion carriers with different chromosomes have different clinical manifestations. Therefore, genetic counseling is difficult in clinical practice. Herein, four male carriers of pericentric inversion in chromosome 6 have been described. Two patients showed asthenospermia, one showed azoospermia, and the wife of the remaining patient had recurrent miscarriages. Through a literature search, the association between the breakpoint of pericentric inversion in chromosome 6 and male fertility problems are also discussed in this study. Overall, important genes related to asthenospermia in chromosome 6p21 were found, which may be related to the clinical phenotype. These results suggest that physicians should focus on the breakpoints of inversion in genetic counseling.
38
Harasztosi, L., Lajos Daróczi, I. A. Szabó, Z. Balogh, and Dezső L. Beke. "Temperature Dependence of Barkhausen Noise Parameters in Carbon Steel." Materials Science Forum 537-538 (February 2007): 371–80. http://dx.doi.org/10.4028/www.scientific.net/msf.537-538.371.
Full textAbstract:
Temperature dependence of different parameters (the position of the inflexion point and the saturation value on the root main square, RMS, values versus exciting field curves) of the Barkhausen noise is measured in structural steel (S 235 JRG1). It is shown that while the position of the inflexion point remained constant, the RMS value at the inflexion point and saturation value increased with the increasing temperature, T. Most interestingly the field required for saturation decreased with decreasing temperature and had a breakpoint at about 200K. Breakpoints at the same temperature on the critical exponents versus temperature functions (i.e. on the β(T) and α(T) curves, where β and α are the exponents of the probability distributions of peak heights and durations, respectively) were also observed. This temperature can be identified as the ductile-brittle transition temperature.
39
Cinar, Gokhan, and Adnan Hushmat. "The analysis of wheat prices using multiple structural breakpoint co-integration test." Panoeconomicus, no. 00 (2021): 4. http://dx.doi.org/10.2298/pan150428004c.
Full textAbstract:
From 2005 to 2008, high volatility in the markets affected grain prices significantly. This high volatility in grain prices made many researchers curious, and many discussions aroused from this topic. This study analyzes wheat price behavior during this period of high volatility. We estimate a return index for wheat using spot and futures wheat prices with the help of a present value model. To analyze the cointegration between the wheat prices and return index, a new co-integration test with multiple structural breaks, developed by Daiki Maki (2012), is used. The long-run cointegration coefficients are estimated using the Dynamic Ordinary Least Squares methodology. The empirical results show that there is cointegration between the spot and futures wheat prices, which tends to change at breakpoints. In other words, there is an equilibrium relation between spot prices and futures prices; however, it becomes unstable during the crisis in 2008. The results may help in understanding the dynamics of wheat prices, especially during high-volatility periods.
40
Lam, Hugo Y. K., Xinmeng Jasmine Mu, Adrian M. Stütz, Andrea Tanzer, Philip D. Cayting, Michael Snyder, Philip M. Kim, Jan O. Korbel, and Mark B. Gerstein. "Nucleotide-resolution analysis of structural variants using BreakSeq and a breakpoint library." Nature Biotechnology 28, no. 1 (January 2010): 47–55. http://dx.doi.org/10.1038/nbt.1600.
Full text
41
Jomaa, Danny, Prasidda Khadka, Dana Novikov, Alexandra L. Condurat, Jessica W. Tsai, Frank Dubois, Shu Zhang, et al. "RARE-22 Characterizing the landscape of structural variants in adamantinomatous craniopharyngioma." Neuro-Oncology 24, Supplement_1 (June 1, 2022): i14. http://dx.doi.org/10.1093/neuonc/noac079.047.
Full textAbstract:
Abstract INTRODUCTION: Adamantinomatous craniopharyngiomas (ACPs) are rare brain tumors that primarily occur in children and impact long-term morbidity and mortality. The canonical driver mutation for ACP growth occurs in CTNNB1 and leads to constitutive activation of the Wnt/β-catenin signaling pathway. In this study, we outline the genomic, transcriptomic, and structural variant (SV) landscape in a cohort of 41 ACP samples. METHODS: We performed whole-genome sequencing (WGS) and RNA-sequencing of 41 ACP samples. Matched normal samples were also characterized by WGS. Mutect2 was used to detect single nucleotide variants (SNVs) and indels, and copy number data was generated using the GATK pipeline. SvABA was used to perform SV analysis and to identify significantly recurrent breakpoints and juxtapositions. DESeq2 was used to perform differential gene expression analysis based on clinical and molecular annotation data. RESULTS: 29/41 (70%) of the ACP samples harbored missense mutations in exon 3 of CTNNB1, all of which have previously been reported in ACP tumors. SV analysis identified a median of 11.5 events per tumor. Overall, 9.7% of events were interchromosomal. Of the remainder, the majority (78.6%) were deletions. No SVs occurred within CTNNB1. A positive correlation (r = 0.533) was observed between the frequency of SVs and SNVs within samples. Analysis of significantly recurring breakpoints (SRBs) did not identify recurrent breakpoint events. Differential gene expression analysis comparing samples with and without CTNNB1 variants identified 2,143 differentially expressed genes with q-value < 0.05. CONCLUSION: This study identifies activating mutations in exon 3 of CTNNB1 in a large cohort of ACP samples. We also integrate SV and transcriptomic data to comprehensively investigate ACP tumor genomes and identify putative novel tumorigenic mechanisms that advance our understanding of ACP biology.
42
HOSSAIN, AKHAND AKHTAR. "IN SEARCH OF A STABLE NARROW MONEY-DEMAND FUNCTION FOR INDONESIA, 1970–2007." Singapore Economic Review 56, no. 01 (March 2011): 61–77. http://dx.doi.org/10.1142/s0217590811004109.
Full textAbstract:
This paper adopts the Johansen approach to cointegration to estimate a narrow money-demand function for Indonesia with annual data for the period 1970–2007. Empirical results suggest that there exists a cointegral relationship between real narrow balances, real permanent income and the deposit rate of interest. The recursive and rolling regression results suggest that the narrow money-demand function has remained largely stable irrespective of ongoing financial reforms in Indonesia since the late 1980s and/or financial crises in the late 1990s. The Quandt-Andrews breakpoint and the Hansen-Johansen stability tests results however suggest that the narrow money-demand relationship had a structural break in the early 1990s. This corresponds to a period of time when the banking and financial reforms in Indonesia took effect. The Chow breakpoint test results suggest that there was also a structural break in the money-demand relationship during the financial crises of the late 1990s.
43
Gerung, Altiano R., Liza Wikarsa, and Rinaldi Munir. "PENGIMPLEMENTASIAN APLIKASI GENERATOR KODE HTML DAN CSS UNTUK PERANCANGAN WEB RESPONSIF." Jurnal Ilmiah Realtech 16, no. 1 (April 30, 2020): 13–18. http://dx.doi.org/10.52159/realtech.v16i1.128.
Full textAbstract:
Desain web responsif adalah praktik untuk membuat situs web disajikan dengan baik di setiap perangkat. Sebelum pengenalan desain web responsif, pengembang web harusmembuat halaman web terpisah atau bahkan situs web terpisah untuk setiap perangkat keras yang berbeda. Kekurangan dari aplikasi desain web responsif serupa antara lain ketidakmampuan untuk mengelompokkan halaman web, tidak dapat membuat breakpoints lokal, dan mengatur elemen HTML khusus untuk komponen tata letak. Oleh karena keterbatasan ini, Aplikasi Moli (My Original Layout, Immediately) dibangun untuk memungkinkan pengembang web pemula dalam merancang dan menerapkan tata letak web responsif dengan mudah dan cepat. Aplikasi ini menyediakan manajemen proyek website, halaman web, komponen tata letak global dan lokal, breakpoints global dan lokal, desain tata letak responsif serta menghasilkan dokumen kode HTML dan CSS dari tata letak web yang dirancang. Hasil pengujian mengungkapkan bahwa Aplikasi Moli berhasil mengelompokkan halaman web, membuat breakpoint lokal dan global, memilih dan menyesuaikan elemen HTML untuk komponen tata letak, dan menghasilkan tata letak responsif dalam bentuk dokumen kode HTML dan CSS. Juga, Aplikasi Moli dapat mengoptimalkan proses desain dengan mengurangi kode HTML yang berlebihan dengan tag presentasi, skrip, dan obyek/atribut yang dicampur dengan structural markup.
44
Bagchi, Bhaskar, and Biswajit Paul. "Effects of Crude Oil Price Shocks on Stock Markets and Currency Exchange Rates in the Context of Russia-Ukraine Conflict: Evidence from G7 Countries." Journal of Risk and Financial Management 16, no. 2 (January 23, 2023): 64. http://dx.doi.org/10.3390/jrfm16020064.
Full textAbstract:
The present study examines the effects of the steep surge in crude oil prices which has also been considered as an oil price shock on the stock price returns and currency exchange rates of G7 countries, namely Canada, France, Germany, Italy, Japan, the United Kingdom (UK) and the United States (US), in the context of the Russia–Ukraine conflict. Due to the outbreak of the war, the steep surge in Brent crude oil price returns is seen as an exogenous shock to stock price returns and exchange rates during the period from 2 January 2017 to 29 June 2022. The paper applies the Fractionally Integrated GARCH (FIGARCH) model to capture the effect of the crude oil price shock and the Breakpoint unit root test to examine the structural breaks in the dataset. Structural breakpoints in the dataset for the entire stock price returns and exchange rates are observed during the period commencing from the last week of February, 2022, to the last week of March, 2022. Except for TSX, NASDAQand USD, noteworthy long memory effects running from Brent crude oil priceto all the stock price returns along with the currency exchange rates for all G7 countries were also found.
45
van den Akker, Jeroen, Lawrence Hon, Anjana Ondov, Ziga Mahkovec, Robert O'Connor, Raymond C. Chan, Justin Lock, et al. "Intronic Breakpoint Signatures Enhance Detection and Characterization of Clinically Relevant Germline Structural Variants." Journal of Molecular Diagnostics 23, no. 5 (May 2021): 612–29. http://dx.doi.org/10.1016/j.jmoldx.2021.01.015.
Full text
46
Mukhopadhyay, Debabrata. "Structural Change in Rice-Wheat Crop Yield in India: A Multiple Breakpoint Analysis." Journal of Developing Areas 56, no. 1 (2022): 369–78. http://dx.doi.org/10.1353/jda.2022.0006.
Full text
47
Heerema, NA, DC Arthur, H. Sather, V. Albo, J. Feusner, BJ Lange, PG Steinherz, P. Zeltzer, D. Hammond, and GH Reaman. "Cytogenetic features of infants less than 12 months of age at diagnosis of acute lymphoblastic leukemia: impact of the 11q23 breakpoint on outcome: a report of the Childrens Cancer Group." Blood 83, no. 8 (April 15, 1994): 2274–84. http://dx.doi.org/10.1182/blood.v83.8.2274.2274.
Full textAbstract:
Abstract Cytogenetic analyses of pretreatment bone marrows were performed at local institutions as part of Childrens Cancer Group (CCG) protocol CCG- 107 for infants less than 1 year of age with previously untreated acute lymphoblastic leukemia (ALL). Cytogenetic analyses from 39 patients (17 males and 22 females) were accepted after review. Several unique cytogenetic features were observed. Twelve patients (31%) had a t(4;11)(q21;q23) and had a significantly shorter event-free survival (EFS) than did the other patients with adequate cytogenetic analyses (P = .009). Five additional patients had an 11q23 breakpoint, not associated with 4q21. When EFS for these 5 patients was compared with that of the t(4;11) patients, even with these small numbers there was a strong, although not significant, suggestion that the t(4;11) patients have a reduced EFS (P = .09), indicating that the specific translocation, t(4;11)(q21;q23), and not an 11q23 breakpoint per se, may be associated with the poor prognosis of these infants. Structural abnormalities were present in 27 of 28 patients with abnormal karyotypes. A new recurring abnormality, t(5;15)(p15:1;q11) or t(5;15)(p15.3;q13), was identified in 3 patients (Arthur et al, Blood 70:274a, 1987 [abstr, suppl 1]). Two females had structural abnormalities involving Xp11, a breakpoint rarely seen in ALL. Fourteen (36%) patients had a single structural abnormality, and 13 (33%) had complex karyotypes. No patients had hyperdiploidy with more than 50 chromosomes. Only normal chromosomes were observed in 11 patients (28%), and their outcome did not differ from patients with abnormal karyotypes. These cytogenetic abnormalities found in the leukemic cells of infants are clearly different from those in older children and adults, and may explain, in part, the unique biologic characteristics of infant ALL.
48
Heerema, NA, DC Arthur, H. Sather, V. Albo, J. Feusner, BJ Lange, PG Steinherz, P. Zeltzer, D. Hammond, and GH Reaman. "Cytogenetic features of infants less than 12 months of age at diagnosis of acute lymphoblastic leukemia: impact of the 11q23 breakpoint on outcome: a report of the Childrens Cancer Group." Blood 83, no. 8 (April 15, 1994): 2274–84. http://dx.doi.org/10.1182/blood.v83.8.2274.bloodjournal8382274.
Full textAbstract:
Cytogenetic analyses of pretreatment bone marrows were performed at local institutions as part of Childrens Cancer Group (CCG) protocol CCG- 107 for infants less than 1 year of age with previously untreated acute lymphoblastic leukemia (ALL). Cytogenetic analyses from 39 patients (17 males and 22 females) were accepted after review. Several unique cytogenetic features were observed. Twelve patients (31%) had a t(4;11)(q21;q23) and had a significantly shorter event-free survival (EFS) than did the other patients with adequate cytogenetic analyses (P = .009). Five additional patients had an 11q23 breakpoint, not associated with 4q21. When EFS for these 5 patients was compared with that of the t(4;11) patients, even with these small numbers there was a strong, although not significant, suggestion that the t(4;11) patients have a reduced EFS (P = .09), indicating that the specific translocation, t(4;11)(q21;q23), and not an 11q23 breakpoint per se, may be associated with the poor prognosis of these infants. Structural abnormalities were present in 27 of 28 patients with abnormal karyotypes. A new recurring abnormality, t(5;15)(p15:1;q11) or t(5;15)(p15.3;q13), was identified in 3 patients (Arthur et al, Blood 70:274a, 1987 [abstr, suppl 1]). Two females had structural abnormalities involving Xp11, a breakpoint rarely seen in ALL. Fourteen (36%) patients had a single structural abnormality, and 13 (33%) had complex karyotypes. No patients had hyperdiploidy with more than 50 chromosomes. Only normal chromosomes were observed in 11 patients (28%), and their outcome did not differ from patients with abnormal karyotypes. These cytogenetic abnormalities found in the leukemic cells of infants are clearly different from those in older children and adults, and may explain, in part, the unique biologic characteristics of infant ALL.
49
Czech, Katarzyna. "Structural Changes in Wheat Market." Zeszyty Naukowe SGGW w Warszawie - Problemy Rolnictwa Światowego 16, no. 4 (December 31, 2016): 92–98. http://dx.doi.org/10.22630/prs.2016.16.4.102.
Full textAbstract:
Time series analysis is based on the assumption of stationarity. Stationarity implies the parameters are constant over time. Structural break occurs when at least one of the parameters changes at some date. Structural breaks can lead to huge forecasting errors and unreliability of the model. Modelling structure breaks is very popular in the literature of macroeconomics and finance. However, there are still too few publications about structural breaks in agricultural market. The goal of research is to identify structural breaks in wheat prices time series. A few structural break tests are applied. It has been shown that there is at least one significant structural break in the analysed time series. Both Quandt-Andrews and Bai-Perron tests show that there is a significant breakpoint in 12.09.2007. The estimated break date is associated with the beginning of global financial crisis. It may imply that wheat prices have become more prone to changes in global financial market.
50
Mottok, Anja, Lauren Chong, Susana Ben-Neriah, Bruce Woolcock, Yongjun Zhao, Marco A. Marra, David W. Scott, Randy D. Gascoyne, Andrew J. Mungall, and Christian Steidl. "Characterization of Genomic Rearrangements Involving CIITA and SOCS1 Using Targeted Capture Sequencing of Archival Tissue Specimens." Blood 128, no. 22 (December 2, 2016): 2925. http://dx.doi.org/10.1182/blood.v128.22.2925.2925.
Full textAbstract:
Abstract Introduction: Malignant lymphomas account for 5% of all newly diagnosed cancer cases per year and affect patients of all ages. Genomic rearrangements represent a pathogenic hallmark of most B-cell lymphoma entities and some are associated with an unfavorable clinical outcome. Recurrent structural genomic aberrations involving the MHC class II transactivator CIITA (located on chromosome 16p13) have been identified in multiple lymphoma subtypes in which they contribute to an immune escape phenotype. Moreover, inactivating mutations of the tumor suppressor gene SOCS1, located in close proximity to CIITA on chromosome 16, result in constitutively active JAK-STAT-signaling across a spectrum of lymphomas. Preliminary data from our group indicate that SOCS1 is also involved in recurrent rearrangements. However, more detailed study of these rearrangements was hampered due to the lack of analytic methods and platforms applicable to archival formalin-fixed and paraffin-embedded tissue (FFPET) specimens. Here, using FFPET biopsies, we sought to characterize the comprehensive landscape of CIITA and SOCS1rearrangement partner genes, determine the exact breakpoint anatomy, and study the functional impact of individual alterations. Methods: In order to select cases for DNA extraction and subsequent sequencing analysis we revisited the results of previously conducted fluorescence in-situ hybridization (FISH) experiments performed on lymphoma cases arranged on tissue microarrays. Cases were included based on the presence of rearrangements in CIITA, SOCS1 and the 9p24.1 locus. 92 specimens met these criteria and DNA was extracted using the Qiagen AllPrep DNA/RNA FFPE kit. An optimized 96-well-plate protocol was used for whole genome library construction (FFPET small gap protocol) and 16 to 18 libraries were multiplexed and pooled prior to capture using a custom Agilent SureSelect design targeting the aforementioned loci. Sequencing was performed on an Illumina HiSeq 2500. Predicted structural variants (SV) were generated with the computational tools DELLY and deStruct, and subsequently filtered based on read support. High confidence predictions were validated by either PCR-amplification of the genomic DNA spanning the breakpoint sequence followed by Sanger Sequencing, or customized FISH assays. Results: Library construction was successful in 68 cases (74%) and the mean coverage across the target regions for these libraries was above 600x with 97.7% of bases having an average depth of > 100x. After filtering, a list of 82 rearrangement events was generated consisting of 16 translocations (12 affecting CIITA and 4 affecting SOCS1), 44 deletions, 19 inversions and 3 duplications. Mapping of the translocation breakpoints revealed two distinct breakpoint cluster regions within intron 1 of CIITA and exon 2 of the SOCS1 gene. None of the exact breakpoints were recurrent and identification of rearrangement partner genes confirmed that CIITA and SOCS1 rearrange promiscuously. Furthermore, we demonstrate that some translocation events result in the generation of novel in-frame fusion transcripts (e.g. CIITA-PRDM16), warranting further functional characterization. Consistent with previous studies, intra-chromosomal alterations were detected in intron 1 of CIITA in48% of the cases while SOCS1 was shown to be frequently deleted (20% of cases).Overall, the concordance between FISH and targeted capture sequencing was 63%, reflecting the differences in sensitivity to detect large- and small-scale genomic events. Conclusions: Targeted capture sequencing, in conjunction with FISH, represents a valuable tool to explore the spectrum of genomic structural variants and rearrangement partner genes in archival lymphoma FFPET specimens. Future studies are required to address the functional impact of specific alterations and the utility of capture-sequencing-based assays for clinical decision-making. Disclosures Scott: NanoString Technologies: Patents & Royalties: named inventor on a patent for molecular subtyping of DLBCL that has been licensed to NanoString Technologies.