Journal articles on the topic 'Sorokiniana'
To see the other types of publications on this topic, follow the link: Sorokiniana.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Sorokiniana.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Zulkarnain, Muhammad Iskandar, Hermin Pancasakti Kusumaningrum, Nurhayati Nurhayati, Agung Suprihadi, and Muhammad Zainuri. "Identifikasi Molekuler Chlorella sorokiniana menggunakan Marka ITS dan 18S rDNA serta Produksi Karotenoid dengan Perlakuan Cahaya." Buletin Oseanografi Marina 12, no. 2 (March 16, 2023): 153–63. http://dx.doi.org/10.14710/buloma.v12i2.46705.
Full textAbstract:
Chlorella sorokiniana merupakan salah satu mikroalga penghasil astaxantin. Produksi astaxantin C. sorokiniana dapat meningkat pada kondisi kultur yang optimal. Penelitian ini bertujuan untuk memastikan identitas C. sorokiniana secara molekuler menggunakan ITS, dan 18S rDNA, serta untuk mengetahui pertumbuhan dan produksi astaxantin C. sorokiniana berdasarkan perlakuan cahaya. Metode yang digunakan pada penelitian ini meliputi kultivasi mikroalga C. sorokiniana, isolasi DNA, uji kuantitatif DNA, identifikasi molekuler melalui proses amplifikasi DNA dengan PCR (Polymerase Chain Reaction) menggunakan marka molekuler ITS dan 18S rDNA, visualisasi hasil PCR dengan elektroforesis menggunakan GelDoc diikuti sekuensing DNA. Produksi astaxantin mikroalga C. sorokiniana dihitung selama 10 hari dibawah perlakuan cahaya matahari dan sinar UV. Identifikasi molekuler C. sorokiniana menggunakan ITS memperoleh dengan ukuran fragmen sebesar 500 pb, sedangkan fragmen 18S rDNA sebesar 600 pb. Pertumbuhan mikroalga C. sorokiniana kontrol pada hari ke-10 dengan kerapatan 15×106 sel/ml, sedangkan pada perlakuan cahaya matahari dan sinar UV pada hari ke-10 dengan kerapatan 38,45×106 sel/ml. Konsentrasi astaxantin yang dihasilkan mikroalga C. sorokiniana pada perlakuan kontrol mencapai tertinggi 0.3306 mg/mL dan pada perlakuan cahaya matahari dan sinar UV meningkat mencapai 0,3874 mg/mL. Chlorella sorokiniana is one of the astaxanthin-producing microalgae. Astaxanthin production of C. sorokiniana can be increased under optimal culture conditions. This study aims to determine the molecular identity of C. sorokiniana using ITS and 18S rDNA, as well as to determine the growth and production of astaxanthin C. sorokiniana based light treatment. The methods used in this study included C. sorokiniana microalgae cultivation, DNA isolation, DNA quantitative testing, molecular identification through the process of DNA amplification with PCR (Polymerase Chain Reaction) using ITS and 18S rDNA molecular markers, visualization of PCR results by electrophoresis using GelDoc followed by sequencing DNA. The astaxanthin production of C. sorokiniana microalgae was calculated for 10 days under sunlight and UV light treatment. Molecular identification of C. sorokiniana using ITS obtained a fragment size of 500 bp, while the 18S rDNA fragment was 600 bp. The growth of C. sorokiniana microalgae was controlled on day 10 with a density of 15×106 cells/ml, whereas in the treatment of sunlight and UV light on day 10 with a density of 38,45×106 cells/ml. The concentration of astaxanthin produced by C. sorokiniana microalgae in the control treatment reached 0,3306 mg/mL and in the sunlight and UV light treatments it increased to 0,3874 mg/mL.
2
Ye, Wei, Taomei Liu, Weimin Zhang, Saini Li, Muzi Zhu, Haohua Li, Yali Kong, and Liqiong Xu. "Disclosure of the Molecular Mechanism of Wheat Leaf Spot Disease Caused by Bipolaris sorokiniana through Comparative Transcriptome and Metabolomics Analysis." International Journal of Molecular Sciences 20, no. 23 (December 3, 2019): 6090. http://dx.doi.org/10.3390/ijms20236090.
Full textAbstract:
Wheat yield is greatly reduced because of the occurrence of leaf spot diseases. Bipolaris sorokiniana is the main pathogenic fungus in leaf spot disease. In this study, B. sorokiniana from wheat leaf (W-B. sorokiniana) showed much stronger pathogenicity toward wheat than endophytic B. sorokiniana from Pogostemon cablin (P-B. sorokiniana). The transcriptomes and metabolomics of the two B. sorokiniana strains and transcriptomes of B. sorokiniana-infected wheat leaves were comparatively analyzed. In addition, the expression levels of unigenes related to pathogenicity, toxicity, and cell wall degradation were predicted and validated by quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. Results indicated that pathogenicity-related genes, especially the gene encoding loss-of-pathogenicity B (LopB) protein, cell wall-degrading enzymes (particularly glycosyl hydrolase-related genes), and killer and Ptr necrosis toxin-producing related unigenes in the W-B. sorokiniana played important roles in the pathogenicity of W-B. sorokiniana toward wheat. The down-regulation of cell wall protein, photosystem peptide, and rubisco protein suggested impairment of the phytosynthetic system and cell wall of B. sorokiniana-infected wheat. The up-regulation of hydrolase inhibitor, NAC (including NAM, ATAF1 and CUC2) transcriptional factor, and peroxidase in infected wheat tissues suggests their important roles in the defensive response of wheat to W-B. sorokiniana. This is the first report providing a comparison of the transcriptome and metabolome between the pathogenic and endophytic B. sorokiniana strains, thus providing a molecular clue for the pathogenic mechanism of W-B. sorokiniana toward wheat and wheat’s defensive response mechanism to W-B. sorokiniana. Our study could offer molecular clues for controlling the hazard of leaf spot and root rot diseases in wheat, thus improving wheat yield in the future.
3
Li, Linxuan, Tingting Zhu, Lele Huang, and Maozhi Ren. "Target of Rapamycin Signaling Involved in the Regulation of Photosynthesis and Cellular Metabolism in Chlorella sorokiniana." International Journal of Molecular Sciences 23, no. 13 (July 4, 2022): 7451. http://dx.doi.org/10.3390/ijms23137451.
Full textAbstract:
Target of rapamycin (TOR) is a serine/threonine protein kinase that plays a central regulating role in cell proliferation, growth, and metabolism, but little is known about the TOR signaling pathway in Chlorella sorokiniana. In this study, a Chlorella sorokiniana DP-1 strain was isolated and identified, and its nutritional compositions were analyzed. Based on homologous sequence analysis, the conserved CsTOR protein was found in the genome of Chlorella sorokiniana. In addition, the key components of TOR complex 1 (TORC1) were present, but the components of TORC2 (RICTOR and SIN1) were absent in Chlorella sorokiniana. Pharmacological assays showed that Chlorella sorokiniana DP-1 was insensitive to rapamycin, Torin1 and KU0063794, whereas AZD8055 could significantly inhibit the growth of Chlorella sorokiniana. RNA-seq analysis showed that CsTOR regulated various metabolic processes and signal transduction pathways in AZD8055-treated Chlorella sorokiniana DP-1. Most genes involved in photosynthesis and carbon fixation in Chlorella sorokiniana DP-1 were significantly downregulated under CsTOR inhibition, indicating that CsTOR positively regulated the photosynthesis in Chlorella sorokiniana. Furthermore, CsTOR controlled protein synthesis and degradation by positively regulating ribosome synthesis and negatively regulating autophagy. These observations suggested that CsTOR plays an important role in photosynthesis and cellular metabolism, and provide new insights into the function of CsTOR in Chlorella sorokiniana.
4
Ammar, Muhammad, Maria Omer, Sitwat Aman, Abdul Hameed Abdul Hameed, Safdar Abbas, Shabnam Shaheen, Aiman Abbas, and Samina N. Shakeel. "Fatty Acid Profiling and Physiochemical Characterization of Chlorella sorokiniana Potentially Used for Biofuel Production." Sains Malaysiana 51, no. 8 (August 31, 2021): 2547–57. http://dx.doi.org/10.17576/jsm-2022-5108-15.
Full textAbstract:
Rising oil prices and climate change have resulted in more emphasis on research into renewable biofuels. In this study, different water samples were collected from local vicinities for the isolation of local isolates of microalgae to check their potential towards the production of biofuel by the addition of different chemical substrates. Five different concentrations of ascorbic acid and iron (III) chloride (0, 1, 2.5, 5 & 10 µM) are used as substrates. Microscopic analysis evaluated that samples belong to genus Chlorella and further molecular identification showed that the samples are C. sorokiniana. Among all the concentrations of ascorbic acid 2.5 µM is most effective against the C. sorokiniana strain 1 (Safari Wildlife Park, Lahore) and C. sorokiniana strain 2 (Bahria Town, Lahore) while C. sorokiniana Strain 3 (SukhChane Society, Lahore) responded at 2.5 & 5 µM in term of biomass production. FeCl3 (2.5 µM) is effective against C. sorokiniana strain 1 while the growth of C. sorokiniana strain 2 and C. sorokiniana Strain 3 is inhibited. Lipid content analysis showed that only the C. sorokiniana strain 1 shows effective results at 1 & 2.5 µM of ascorbic acid and FeCl3, respectively. Those concentrations which give the significant results of lipid production were preceded for fatty acid profiling. Results indicate that the C. sorokiniana strain 1 can be considered as a source of alpha-linolenic acid; the basic constituent of biofuel production. In this study, it is concluded that C. sorokiniana strain 1 is useful for the production of environment friendly biofuel.
5
Nakajima, Hiromitsu, Keiko Isomi, Takashi Hamasaki, and Masakatsu Ichinoe. "Sorokinianin: A novel phytotoxin produced by the phytopathogenic fungus Bipolaris sorokiniana." Tetrahedron Letters 35, no. 51 (December 1994): 9597–600. http://dx.doi.org/10.1016/0040-4039(94)88520-6.
Full text
6
Aggarwal, R., S. Gupta, S. Banerjee, and V. B. Singh. "Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat." Canadian Journal of Microbiology 57, no. 11 (November 2011): 934–42. http://dx.doi.org/10.1139/w11-089.
Full textAbstract:
Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS600 could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.
7
Guo, Feilong, Zilong Shan, Jinfeng Yu, Gangbiao Xu, and Zengyan Zhang. "The Cysteine-Rich Repeat Protein TaCRR1 Participates in Defense against Both Rhizoctonia cerealis and Bipolaris sorokiniana in Wheat." International Journal of Molecular Sciences 21, no. 16 (August 9, 2020): 5698. http://dx.doi.org/10.3390/ijms21165698.
Full textAbstract:
The domain of unknown function 26 (DUF26), harboring a conserved cysteine-rich motif (C-X8-C-X2-C), is unique to land plants. Several cysteine-rich repeat proteins (CRRs), belonging to DUF26-containing proteins, have been implicated in the defense against fungal pathogens in ginkgo, cotton, and maize. However, little is known about the functional roles of CRRs in the important staple crop wheat (Triticum aestivum). In this study, we identified a wheat CRR-encoding gene TaCRR1 through transcriptomic analysis, and dissected the defense role of TaCRR1 against the soil-borne fungi Rhizoctonia cerealis and Bipolaris sorokiniana, causal pathogens of destructive wheat diseases. TaCRR1 transcription was up-regulated in wheat towards B. Sorokiniana or R. cerealis infection. The deduced TaCRR1 protein contained a signal peptide and two DUF26 domains. Heterologously-expressed TaCRR1 protein markedly inhibited the mycelia growth of B. sorokiniana and R. cerealis. Furthermore, the silencing of TaCRR1 both impaired host resistance to B. sorokiniana and R. cerealis and repressed the expression of several pathogenesis-related genes in wheat. These results suggest that the TaCRR1 positively participated in wheat defense against both B. sorokiniana and R. cerealis through its antifungal activity and modulating expression of pathogenesis-related genes. Thus, TaCRR1 is a candidate gene for improving wheat resistance to B. sorokiniana and R. cerealis.
8
Moya-Elizondo, Ernesto A., Barry J. Jacobsen, Andrew C. Hogg, and Alan T. Dyer. "Population Dynamics Between Fusarium pseudograminearum and Bipolaris sorokiniana in Wheat Stems Using Real-Time qPCR." Plant Disease 95, no. 9 (September 2011): 1089–98. http://dx.doi.org/10.1094/pdis-11-10-0794.
Full textAbstract:
Fusarium pseudograminearum and Bipolaris sorokiniana are causal agents of Fusarium crown rot and common root rot, respectively, of wheat and cause significant losses worldwide. Understanding the population dynamics between these two pathogens at late stages of wheat development is needed. The effect of F. pseudograminearum and B. sorokiniana inocula applied singly or in mixtures at seeding to spring wheat ‘Hank’ was measured using seedling stand, grain yield, and pathogen populations in the first internode at heading, milk, and harvest stage of wheat development using real-time quantitative polymerase chain reaction. High and low rates of F. pseudograminearum inoculum reduced B. sorokiniana populations in field trials but B. sorokiniana inoculations did not affect F. pseudograminearum populations. Populations of both pathogens increased from heading until harvest, with F. pseudograminearum colonizing lower internodes earlier than B. sorokiniana. Neither pathogen prevented infection by the other in the first internode of wheat stems. Inoculations increased incidence of infection and co-infection relative to natural settings observed for both pathogens. At the seedling stage, both fungi, individually or combined, reduced the seedling stands when compared with a noninoculated control for the three location–years. Grain yield and F. pseudograminearum populations were inversely correlated, while B. sorokiniana populations were not correlated with yield.
9
Ghazvini, H., and A. Tekauz. "Virulence Diversity in the Population of Bipolaris sorokiniana." Plant Disease 91, no. 7 (July 2007): 814–21. http://dx.doi.org/10.1094/pdis-91-7-0814.
Full textAbstract:
Spot blotch, caused by Bipolaris sorokiniana, is a damaging disease of barley in Canada, especially in the prairie region (Manitoba, Saskatchewan, and Alberta) where most of Canadian crops are produced. Considerable interaction between isolates of the pathogen and barley genotypes necessitates the evaluation of the virulence diversity in the B. sorokiniana population in order to deploy effective resistance against the pathogen. The virulence diversity of 127 B. sorokiniana isolates from Canada and other countries was evaluated on 12 barley genotypes. Different virulence patterns were detected across B. sorokiniana isolates and eight virulence groups were identified using qualitative analysis of the virulence data. Results indicate broader virulence diversity in the pathogen population in the eastern prairie region of Canada, especially in Manitoba, compared with that previously reported. One group of isolates collected from Manitoba displayed a virulence pattern which had not been reported previously. This group was moderately virulent on most differential lines, including American six-rowed barley genotypes considered to possess durable resistance against B. sorokiniana. Although the classical method of pathotype identification can be exploited to analyze interactions in the barley-B. sorokiniana pathosystem, the continuous range of infection phenotypes found suggests that a quantitative analysis of the complex interactions occurring may be warranted.
10
Kang, Kun, Zhipeng Niu, Wei Zhang, Shan Wei, Yangyong Lv, and Yuansen Hu. "Antagonistic Strain Bacillus halotolerans Jk-25 Mediates the Biocontrol of Wheat Common Root Rot Caused by Bipolaris sorokiniana." Plants 12, no. 4 (February 13, 2023): 828. http://dx.doi.org/10.3390/plants12040828.
Full textAbstract:
Common root rot caused by Bipolaris sorokiniana infestation in wheat is one of the main reasons for yield reduction in wheat crops worldwide. The bacterium strain JK-25 used in the current investigation was isolated from wheat rhizosphere soil and was later identified as Bacillus halotolerans based on its morphological, physiological, biochemical, and molecular properties. The strain showed significant antagonism to B. sorokiniana, Fusarium oxysporum, Fusarium graminearum, and Rhizoctonia zeae. Inhibition of B. sorokiniana mycelial dry weight and spore germination rate by JK-25 fermentation supernatant reached 60% and 88%, respectively. The crude extract of JK-25 was found, by Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS), to contain the surfactin that exerted an inhibitory effect on B. sorokiniana. The disruption of mycelial cell membranes was observed under laser scanning confocal microscope (LSCM) after treatment of B. sorokiniana mycelium with the crude extract. The antioxidant enzyme activity of B. sorokiniana was significantly reduced and the oxidation product malondialdehyde (MDA) content increased after treatment with the crude extract. The incidence of root rot was significantly reduced in pot experiments with the addition of JK-25 culture fermentation supernatant, which had a significant biological control effect of 72.06%. Its ability to produce siderophores may help to promote wheat growth and the production of proteases and pectinases may also be part of the strain’s role in suppressing pathogens. These results demonstrate the excellent antagonistic effect of JK-25 against B. sorokiniana and suggest that this strain has great potential as a resource for biological control of wheat root rot strains.
11
Tunalı, Berna, Büşra Müge Maldar, Bayram Kansu, and Fatih Ölmez. "Buğday Bitkilerinde Kök Çürüklüğüne Neden Olan Bıpolarıs Spp. İzolatlarının Patojenitesi." Turkish Journal of Agriculture - Food Science and Technology 11, no. 3 (March 26, 2023): 424–30. http://dx.doi.org/10.24925/turjaf.v11i3.424-431.4840.
Full textAbstract:
Bipolaris sorokiniana buğday ve arpada kök çürüklüğü yapan en önemli etmenlerden biridir. Buğday ve arpada tohum, başak, yaprak ve köklerde hastalık oluşturarak bitkilerde önemli ürün kayıplarına yol açmaktadır. Farklı agro-ekolojik bölgelerden toplanan kök ve kök boğazında çürüklük belirtisi gösteren buğday bitkilerinden izole edilen Bipolaris spp. izolatları morfolojik teşhis edilmiştir. Bu çalışmada B. sorokiniana, B. spicifera, ve B. australiensis olarak teşhis edilmiş olan 49 izolat kullanılmıştır. Yapılan patojenite çalışması sonucunda B. sorokiniana izolatlarının ikisi hariç hepsinin patojen olduğu ve hastalık şiddetlerinin %50 ila %90 arasında olduğu belirlenmiştir. Yalnızca bir B. spicifera izolatı bitkilerde zayıf patojen olarak belirlenmiş, B. australiensis izolatları hiçbir hastalık belirtisi oluşturmamıştır. B. sorokiniana bitkilerin yaş ağırlıklarında kontrollere oranla önemli düşüşlere yol açarken, B. spicifera'nın dört izolatının bitki ağırlığında artış sağladığı belirlenmiştir. Sonuç olarak, tüm agro-ekolojik bölgelerdeki B. sorokiniana izolatlarının şiddetli kök çürüklük hastalığı yaptığı ve bitki ağırlığında önemli miktarda azalmalara neden olduğu belirlenmiştir. Diğer taraftan, B. spicifera izolatlarının buğday bitkilerinin köklerinde zayıf hastalık belirtileri oluşturduğu, B. australiensis'in ise bitkilerin köklerinde hastalığa yol açmadığı ve bitki ağırlığını olumsuz olarak etkilemediği görülmüştür.
12
Safitri, Lusi Nurul, Devy Susanty, Nurlela Nurlela, and Ade Ayu Oksari. "METABOLIT SEKUNDER EKSTRAK CHLORELLA SOROKINIANA HASIL KULTUR PADA MEDIA LIMBAH TAHU DENGAN VARIASI WAKTU PANEN." Prosiding Seminar Nasional Sinergi Riset dan Inovasi 1, no. 1 (March 6, 2023): 44–55. http://dx.doi.org/10.31938/psnsri.v1i1.509.
Full textAbstract:
Mikroalga Chlorella sorokiniana telah diketahui mampu tumbuh pada media limbah cair tahu. Ekstrak etanol C. sorokiniana yang dikultur pada media limbah tahu dan dipanen pada hari ketujuh menunjukkan adanya kandungan flavonoid dan fenolik. Perbedaan waktu panen dapat mempengaruhi kandungan metabolit sekunder pada C. sorokiniana. Penelitian ini bertujuan untuk menentukan metabolit sekunder, total flavonoid, total fenolik dan aktivitas antioksidan dari ekstrak C. sorokiniana yang dikultur pada media limbah cair tahu 30% pada waktu panen 7, 14, dan 21 hari. Biomassa C. sorokiniana yang dipanen pada tiga waktu berbeda diekstraksi dengan metode maserasi menggunakan pelarut etanol. Metabolit sekunder pada ekstrak diketahui dengan uji fitokimia secara kualitatif. Total flavonoid diuji menggunakan AlCl3, total fenolik diuji menggunakan Follin Ciocalteu, dan antioksidan pada ekstrak diuji dengan menggunakan 2,2-diphenyl-1-picrylhydrazyl (DPPH). Hasil uji fitokimia menunjukkan ketiga ekstrak mengandung alkaloid, flavonoid, steroid, saponin dan tannin. Total flavonoid dan total fenolik pada ekstrak dengan waktu panen biomassa hari ke-21 lebih tinggi berturut-turut 36,70 mgQE/g dan 5,27 mgGAE/g. Uji aktivitas antioksidan menunjukkan bahwa ketiga ekstrak tidak memiliki aktivitas antioksidan.
13
Kulachinskaya, A. Yu, N. A. Politaeva, Yu A. Smyatskaya, K. R. Tarantseva, and T. Yu Kudryavtseva. "Development of Cost-Effective Biotechnology for Extracting the Total Lipids from the Biomass of the Microalgae Chlorella Sorokiniana." Ecology and Industry of Russia 24, no. 10 (October 14, 2020): 38–42. http://dx.doi.org/10.18412/1816-0395-2020-10-38-42.
Full textAbstract:
The flow chart of the processes of lipid extraction from the biomass of the microalgae Chlorella sorokiniana is presented. The main equipment for the production of products from the biomass of the microalgae Chlorella sorokiniana was selected, and economic calculations were carried out, which made it possible to draw a conclusion about the amount of costs for the production of lipids from the dry biomass of the microalgae Chlorella sorokiniana. The obtained indicators allow us to consider the proposed biotechnology as cost effective.
14
BASAK, POULAMI, MALKHAN SINGH GURJAR, NATASHA KASHYAP, TEJ PRATAP JITENDRA KUMAR, MUKESH KUMAR YADAV, DINESH SINGH, SHAILENDRA JHA, and MAHENDER SINGH SAHARAN. "Assessment of fungal and bacterial bioagents against Bipolaris sorokiniana inciting spot blotch on barley (Hordeum vulgare)." Indian Journal of Agricultural Sciences 94, no. 4 (April 24, 2024): 375–81. http://dx.doi.org/10.56093/ijas.v94i4.142924.
Full textAbstract:
In India, spot blotch disease caused by Bipolaris sorokiniana is one of the major constraints in barley (Hordeum vulgare L.) production. The present study was carried out during 2022–23 at ICAR-Indian Agriculture Research Institute, New Delhi to identify promising biocontrol agents, which can act as eco-friendly alternatives to chemicals against Bipolaris sorokiniana inciting spot blotch on barley (Hordeum vulgare L.). In this study, 18 isolates of Trichoderma asperellum, 15 isolates of Trichoderma harzianum and 5 bacterial species were tested against B. sorokiniana under in vitro and in planta conditions. In the dual culture assays, Trichoderma asperellum 8686 and Trichoderma asperellum 8687 showed significantly highest per cent disease inhibition of 71.73% and 71.37% respectively. Among bacterial strains, Pseudomonas fluorescens and Bacillus amyloliquefaciens showed significantly good per cent disease inhibition of 64.09% and 57.09% respectively. B. subtilis and Pantoea spp. did not show any pathogen inhibition. In addition, the superior bioagents were also screened out. In the studies on in planta assays, Bacillus amyloliquefaciens (per cent disease control-55.19%) was found most effective for seed treatment against B. sorokiniana. Post-inoculation with biocontrol agents revealed that Bacillus amyloliquefaciens was at par with Trichoderma asperellum and Pseudomonas fluorescens against B. sorokiniana. Additionally, a combination of seed treatment, pre and post-inoculation treatment of biocontrol agents revealed that Bacillus amyloliquefaciens and Trichoderma asperellum 8686 were at par with Trichoderma harzianum (Pusa Th3) against B. sorokiniana. Overall, Bacillus amyloliquefaciens was more effective and consistent to manage spot blotch disease.
15
Zhang, Xiao, Huifen Cao, Juan Wang, Feng Li, and Jianguo Zhao. "Graphene Oxide Exhibits Antifungal Activity against Bipolaris sorokiniana In Vitro and In Vivo." Microorganisms 10, no. 10 (October 9, 2022): 1994. http://dx.doi.org/10.3390/microorganisms10101994.
Full textAbstract:
The antimicrobial properties of graphene in vitro have been widely reported. However, compared to research performed on graphene’s antibacterial properties, there have been relatively few studies assessing graphene’s antifungal properties. In particular, evaluating graphene’s pathogenic effects on host plants in vivo, which is critical to using graphene in disease control, has rarely been performed. In this study, the fungal pathogen of wheat, barley, and other plants, Bipolaris sorokiniana (B. sorokiniana) and graphene oxide (GO) were selected for materials. A combination of physiological, cytological, and biochemical approaches was used to explore how GO affects the growth and pathogenicity of B. sorokiniana. The mycelial growth and spore germination of B. sorokiniana were both inhibited in a dose-dependent manner by GO treatment. The addition of GO significantly alleviated the infection of pathogenic fungi in host plants. The results of scanning electron microscopy demonstrated that the inhibitory effect of GO on B. sorokiniana was primarily related to the destruction of the cell membrane. Our study confirmed the antifungal effect of graphene in vitro and in vivo, providing an experimental basis for applying graphene in disease resistance, which is of great significance for agricultural and forestry production.
16
Moya, Paulina, Debora Pedemonte, Susana Amengual, Mario E. E. Franco, and Marina N. Sisterna. "Antagonism and modes of action of Chaetomium globosum species group, potential biocontrol agent of barley foliar diseases." Boletín de la Sociedad Argentina de Botánica 51, no. 4 (December 30, 2016): 569–78. http://dx.doi.org/10.31055/1851.2372.v51.n4.16334.
Full textAbstract:
“Net blotch” (Drechslera teres) and “Bipolaris spot blotch” (Bipolaris sorokiniana) are foliar diseases of barley. Biological control is currently considered as an efficient alternative to chemical management of these plant diseases. The aim of the present study was to identify 2 isolates of Chaetomium (C2 and C5), endophytics on barley seedlings and to study the in vitro interactions with D. teres and B. sorokiniana, isolated from seeds of the same host. Cultural and morphologicalcharacterization of all microorganisms was done. In addition, molecular characterization of Chaetomiumspp. was conducted and dual culture tests were carried out to find, by microscopic observations, the effects of the antagonist on the morphology of the pathogens. The results confirm the identity of the pathogens and the isolates of Chaetomium spp. as Chaetomium globosum species group. Inhibition of B. sorokiniana and D. teres by C2 and C5 accounted for 30% and 31.2 %, and 40% and 36% respectively, compared with the control. The mechanisms of action against B. sorokiniana and D. teres were antibiosis and competition and mycoparasitism, respectively. Microscopic observation revealed deformed conidia in B. sorokiniana and plasmolisis, coiling and orange pigmentation in D. teres.
17
Smyatskaya, Yu A., A. A. Fazullina, N. A. Politaeva, A. N. Chusov, and A. A. Bezborodov. "Wastewater Treatment of Iron(III) Ions with Residual Biomass of Microalgae Сhlorella Sorokiniana." Ecology and Industry of Russia 23, no. 6 (June 11, 2019): 22–27. http://dx.doi.org/10.18412/1816-0395-2019-6-22-27.
Full textAbstract:
The sorption properties of the residual biomass of microalgae Chlorella sorokiniana, which is formed after the extraction of lipids, were investigated. Residual biomass is waste and is used for wastewater treatment from iron(III) ions. Microstructural studies of Chlorella sorokiniana microalgae and residual biomass after lipid extraction were carried out. The purification of model wastewater from iron(III) ions under static conditions has been studied, the purification efficiency and adsorption capacity of the residual biomass of Chlorella sorokiniana have been calculated. A model filter was created, where residual biomass of Chlorella sorokiniana was used as a filtering load and sorption processes were studied under dynamic conditions. The efficiency of purification of model wastewater from iron(III) ions has been calculated and a comparative analysis of the effectiveness of purification under static and dynamic conditions has been carried out. A method for the disposal of spent sorbents as an additional fuel is proposed. The specific heat of combustion (q = 20,674 kJ/kg) of the spent sorbents from the residual biomass of microalgae Chlorella sorokiniana, the value of which is not inferior to traditional energy sources, was determined experimentally.
18
Wiewióra, Barbara. "Podatność jęczmienia jarego na porażenie przez Bipolaris sorokiniana (Sacc.) Shoem. sprawcę plamistości liści." Biuletyn Instytutu Hodowli i Aklimatyzacji Roślin, no. 252 (June 30, 2009): 187–99. http://dx.doi.org/10.37317/biul-2009-0067.
Full textAbstract:
Badania dotyczyły podatności jęczmienia jarego w różnych fazach rozwojowych na plamistość liści powodowaną przez Bipolaris sorokiniana. Obejmowały ocenę wschodów polowych po inokulacji ziarna, określenie wpływu fazy rozwojowej, w której ma miejsce infekcja na wystąpienie plamistości liści w doświadczeniu polowym oraz wpływu porażenia roślin przez B. sorokiniana na plon i zdrowotność materiału nasiennego. Ponadto przeprowadzono laboratoryjną ocenę odporności wybranych odmian na plamistość liści. Wykonane analizy wykazały, że inokulacja ziarniaków grzybem B. sorokiniana spowodowała obniżenie wschodów polowych u wszystkich badanych odmian. Największe nasilenie plamistości liści w porównaniu do poletek kontrolnych obserwowano na roślinach inokulowanych w czasie kłoszenia i kwitnienia. Ponadto stwierdzono, że plon ziarna, a zwłaszcza jego porażenie przez B. sorokiniana zależały od fazy rozwojowej jęczmienia, w której nastąpiła infekcja. Spośród badanych odmian najbardziej odporne na plamistość liści w warunkach laboratoryjnych były odmiany Lailla i Prosa, a najbardziej podatne okazały się odmiany Rastik i Widawa.
19
Ghazvini, H., and A. Tekauz. "Host–Pathogen Interactions Among Barley Genotypes and Bipolaris sorokiniana Isolates." Plant Disease 92, no. 2 (February 2008): 225–33. http://dx.doi.org/10.1094/pdis-92-2-0225.
Full textAbstract:
Spot blotch, caused by Bipolaris sorokiniana, is a damaging foliar disease of barley (Hordeum vulgare) and other cereal grains in Canada. In order to deploy resistance as an effective management tool, information on the virulence diversity present in the local population of the pathogen is necessary. Speculation regarding the presence of differential virulence versus continuous aggressiveness in B. sorokiniana isolates was begun when isolates with differential virulence on the barley cv. Bowman and its derivatives were reported in North Dakota. To further evaluate the H. vulgare–B. sorokiniana interaction model, the infection responses induced by 127 isolates of the pathogen collected from Canada and other parts of the world were analyzed on 12 differential barley lines using quantitative approaches. Analysis of the data based on infection response elicited on the barley differentials resulted in an enhanced understanding of the host–pathogen interactions and in the relationships among isolates, compared with the classical method of pathotype identification. The population of B. sorokiniana was determined to consist of three distinct pathogenic groups (having low virulence, differential virulence, and virulence with varying levels of aggressiveness). The results of the various quantitative approaches indicated that complex interactions exist among barley genotypes and B. sorokiniana isolates of the third pathogenic group which cannot be analyzed easily using the classical method of pathotype identification. It also was inferred that the gene-for-gene model is not the principal system operating in the H. vulgare–B. sorokiniana pathosystem, although this plays a role in some interactions.
20
Badamasi, M., S. Rabiu, B. A. Abdullahi, B. Abdulkarim, A. B. Taofik, H. Aliyu, and Y. Dahiru. "Assessment of Phycoremediation Potential of Chlorella sorokiniana Wastewater Treatment: Analysis of Biochemical Component Changes." Sahel Journal of Life Sciences FUDMA 2, no. 1 (March 31, 2024): 43–50. http://dx.doi.org/10.33003/sajols-2024-0201-006.
Full textAbstract:
Using algae for wastewater treatment offers significant advantages, including providing oxygen for bacteria through photosynthesis, reducing energy demand by eliminating the need for aeration, minimizing the formation of hazardous toxic slush producing useful algal biomass, and recycling nutrients present in the wastewater. In the study, Chlorella sorokiniana was isolated from domestic wastewater samples collected from municipal wastewater of the Katsina metropolis (River Ginzo). The isolated Chlorella sorokiniana was cultured in BG-11 media for ten weeks, and cell density was monitored using a haemacytometer. Twelve flasks containing 100mL wastewater samples each were inoculated with 10mL of cultured Chlorella sorokiniana and incubated at 25°C under 12/12h light/dark photoperiods for four weeks. Physicochemical parameters were analysed weekly. Results showed an increase in Chlorella sorokiniana cell density from (6.33±2.31) x104 at week one to (53.33±26.60) x104 at week ten. Remediation efforts resulted in reduction percentages for various parameters: total dissolved solids (57.7%), nitrate (99.96%), phosphorus (100%), ammonium (99.98%), potassium (91.65%), zinc (87.03%), manganese (90.63%), iron (79.44%), copper (50.62%), and nickel (30.10%). pH remained neutral, and dissolved oxygen increased over the weeks. Significant differences in biochemical components were observed before and after treatment. The remediation of diverse wastewater samples using Chlorella sorokiniana was effective, leading to the accumulation of biomass rich in biochemical components such as lipids, carbohydrates, and proteins. The accumulated biomass can be utilized for further research purposes. This study highlights the potential of Chlorella sorokiniana for phycoremediation and underscores its ability to improve water quality while generating valuable biomass for additional applications.
21
Romero-Arguelles, Ricardo, Patricia Tamez-Guerra, Guadalupe González-Ochoa, César I. Romo-Sáenz, Ricardo Gomez-Flores, Lilian Flores-Mendoza, and Elizama Aros-Uzarraga. "Bifidobacterium longum and Chlorella sorokiniana Improve the IFN Type I-Mediated Antiviral Response in Rotavirus-Infected Cells." Microorganisms 11, no. 5 (May 8, 2023): 1237. http://dx.doi.org/10.3390/microorganisms11051237.
Full textAbstract:
Probiotics are effective to treat or prevent gastrointestinal infections, and microalgae have demonstrated important health-promoting effects and in some cases function as prebiotics. In this regard, the anti-rotavirus effect of Bifidobacterium longum and Chlorella sorokiniana by reducing viral infectivity is well known. However, their effect on immune response against rotavirus has not yet been investigated. Therefore, the aim of this study was to determine the role of Bifidobacterium longum and/or Chlorella sorokiniana in influencing an IFN type I-mediated antiviral response in rotavirus-infected cells. In pre-infection experiments, HT-29 cells were treated with B. longum and C. sorokiniana alone or in combination, followed by rotavirus infection, whereas in post-infection assays, HT-29 cells were treated after infection. The cells’ mRNA was then purified to determine the relative expression level of IFN-α, IFN-β, and precursors of interferons such as RIG-I, IRF-3, and IRF-5 by qPCR. We showed that combination of B. longum and C. sorokiniana significantly increased IFN-α levels in pre-infection and IFN-β in post-infection assays, as compared with individual effects. Results indicate that B. longum, C. sorokiniana, or their combination improve cellular antiviral immune response.
22
Kurnushko, A. S., T. A. Skuratovich, Yu N. Bekish, S. G. Azizbekyan, and O. V. Molchan. "Influence of selenium and silicon salts and nanoparticles on the growth of <i>Fusarium avenaceum</i> (Fr.) Sacc. and <i>Bipolaris sorokiniana</i> (Sacc.) Shoem. mycelium and grain seeds germination." Proceedings of the National Academy of Sciences of Belarus, Biological Series 68, no. 4 (October 29, 2023): 332–44. http://dx.doi.org/10.29235/1029-8940-2023-68-4-332-344.
Full textAbstract:
The effect of selenium and silicon in nanoform in comparison with sodium selenite and sodium silicofluoride on the growth of pathogenic fungi Fusarium avenaceum and Bipolaris sorokiniana was evaluated. The influence of nanoparticles on wheat and corn seed germination and seedling growth was also studied. The inhibitory effect of selenium and silicon nanoparticles on the growth of Fusarium avenaceum and Bipolaris sorokiniana was revealed. Nanosilicon at a concentration of 5–50 mg/l inhibited the growth of pathogenic fungi Fusarium avenaceum and Bipolaris sorokiniana to a greater extent than selenium nanoparticles and was more effective than sodium silicofluoride. Fusarium avenaceum was shown to be more resistant to nanoselenium and sodium selenite compared to Bipolaris sorokiniana. Nanoparticles had practically no effect on seed germination and the growth of wheat and corn seedlings, while sodium selenite and sodium silicofluoride at the same concentrations caused a decrease in seed germination energy and dry weight of the shoots and roots of seedlings.
23
Ballesteros-Torres, Juan M., Luis Samaniego-Moreno, Ricardo Gomez-Flores, Reyes S. Tamez-Guerra, Cristina Rodríguez-Padilla, and Patricia Tamez-Guerra. "Amino acids and acylcarnitine production by Chlorella vulgaris and Chlorella sorokiniana microalgae from wastewater culture." PeerJ 7 (December 3, 2019): e7977. http://dx.doi.org/10.7717/peerj.7977.
Full textAbstract:
Background Microalgae are a widely distributed group of prokaryotic and eukaryotic photosynthetic microorganisms that use a number of substances present in wastewater to produce a variety of biotechnological and nutritional biomolecules. Methods Production ofamino acids and acylcarnitine by Chlorella vulgaris and Chlorella sorokiniana was determined after 13 d of culture in wastewater, under various culture conditions. Wastewater was collected from “La Encantada” stream, located in Saltillo, Coahuila, Mexico. Microalgae was cultured at 23°C and natural day light, including the use of the following conditions: (1) extra light (12:12 light:dark cycles, 1,380 lumens), (2) agitation (130 rpm), and (3) both conditions, until exponential phase. Supernatant products were then analyzed by liquid chromatograph coupled to mass spectrometry. In addition, metabolomic profiles related to growing conditions were evaluated. Results Amino acids and acylcarnitine production by C. sorokiniana and C. vulgaris resulted in higher Ala and Leu concentrations by C. vulgaris compared with control, where control produced Gly and Pro in higher amounts compared with C. sorokiniana. Tyr, Phe, Val, and Cit were detected in lower amounts under light and shaking culture conditions. High concentrations of C0 acylcarnitines were produced by both microalgae compared with control, where C. sorokiniana production was independent of culture conditions, whereas C. vulgaris one was stimulated by shaking. C4 production was higher by C. sorokiniana compared with control. Furthermore, C4, C6DC, C14:1, C14:2, and C18:1OH production by microalga was low in all culture conditions. Conclusion Microalgae produced essential amino acids and nutritionally important carnitines from wastewater. In addition, C. sorokiniana biomass has higher potential as animal nutrient supplement, as compared with that of C. vulgaris.
24
Pratt, R. G. "First Report of Infection of Bermudagrass by Bipolaris sorokiniana in the Southeastern United States." Plant Disease 87, no. 10 (October 2003): 1265. http://dx.doi.org/10.1094/pdis.2003.87.10.1265a.
Full textAbstract:
Bipolaris sorokiniana (Sacc.) Shoemaker is a major foliar and root-infecting pathogen of cool-season forage and turf grasses and small grains in the southeastern United States (2). In North America, B. sorokiniana has been reported from bermudagrass (Cynodon dactylon [L.] Pers.) once in California in 1961 (1), and rarely from other warm-season grasses in the southeastern United States. In May, July, September, and October 2002, B. sorokiniana sporulation was observed on leaves of common bermudagrass exhibiting necrotic lesions and dieback in waste application fields on three commercial swine farms in Chickasaw, Lowndes, and Webster counties, MS. Leaves were collected (50 per farm per month), surface-disinfested, plated on water agar, and observed for fungal sporulation on leaf surfaces after 7 to 10 days (3,4). The pathogen was detected on 1 to 3 farms each month in leaves that were infected with numerous other dematiaceous hyphomycetes (3,4). Three randomly selected single-spore isolates of B. sorokiniana from each of bermudagrass and annual ryegrass (Lolium multiflorum Lam.), collected at the Webster County farm, were compared for select features of morphology and pathogenicity on bermudagrass. Isolates differed significantly in growth rates, amount of sporulation, and spore sizes on cornmeal agar, but differences were not consistently related to hosts of origin. In plants inoculated by atomizing equal quantities of spores (2.8 × 104/ml) onto foliage, isolates of B. sorokiniana from bermudagrass and ryegrass both caused significantly (P = 0.05) more severe foliar necrosis after 10 days than B. cynodontis (5 pots of seeded plants per treatment in each of two experiments). B. sorokiniana was reisolated from disinfested, symptomatic bermudagrass leaf tissue following inoculations. To our knowledge, this is the first report of B. sorokiniana on bermudagrass in North America outside of California (1) and indicates that this pathogen is highly virulent on bermudagrass in the southeastern United States (3,4). Of potentially greater importance is the fact that one of the most common and widespread forage and turf grass species in the southeastern United States can serve as an alternate host for maintenance and increase of inoculum of B. sorokiniana during summer months. References: (1) R. M. Endo. Plant Dis. Rep. 45:869, 1961. (2) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory, On-line publication. ARS, USDA, 2003. (3) R. G. Pratt. Agron. J. 92:512, 2000. (4) R. G. Pratt. Plant Dis. 85:1206, 2001.
25
NAKAJIMA, H., K. ISOMI, T. HAMASAKI, and M. ICHINOE. "ChemInform Abstract: Sorokinianin: A Novel Phytotoxin Produced by the Phytopathogenic Fungus Bipolaris sorokiniana." ChemInform 26, no. 19 (August 18, 2010): no. http://dx.doi.org/10.1002/chin.199519189.
Full text
26
Montanhim, Graziela Cristina, Renata Natsumi Haneda, Ana Teresa Lombardi, and Maria Inês Salgueiro Lima. "Uso de biomassa de algas para a peletização de sementes de Bowdichia virgilioides Kunth." Revista Árvore 38, no. 5 (October 2014): 867–77. http://dx.doi.org/10.1590/s0100-67622014000500011.
Full textAbstract:
Microalgas são consideradas organismos promissores com aplicações em diversas áreas, entre elas para a fixação de CO2, indústria alimentícia, cosmética e farmacêutica. A industrialização na produção desses organismos levará à geração de resíduos, cuja utilização é vista como contribuinte na redução de custos de produção. Nesta pesquisa, propôs-se o uso de microalgas como material cimentante para peletização de sementes de Bowdichia virgilioides Kunth, espécie nativa do Cerrado brasileiro. Biomassa das microalgas Selenastrum capricornutum e Chlorella sorokiniana foram obtidas a partir de cultivos semicontrolados em casa de vegetação. Nas microalgas, foi determinada a concentração de clorofila a, proteínas, carboidratos e lipídios totais, e a biomassa para peletização foi obtida com as células em fase estacionária de crescimento. Com relação às sementes, os tratamentos consistiram de semente nua, semente com gesso agrícola, semente com gesso agrícola e S. capricornutum ou com C. sorokiniana. Nessas, analisaram-se a emergência e desenvolvimento das plântulas e ocorrência de nódulos fixadores de nitrogênio. Os resultados indicaram que sementes com gesso e C. sorokiniana apresentaram porcentagem de emergência (76%) estatisticamente similar à obtida para sementes nuas (86%) e que foi mais elevada do que sementes peletizadas com gesso (60%) e com gesso e S. capricornutum (62%). A melhor porcentagem de emergência para C. sorokiniana em comparação com S. capricornutum pode estar relacionada ao maior conteúdo de lipídios (11,4 mgL-1) e carboidratos (25,0 mg L-1) em C. sorokiniana, em comparação com S. capricornutum (2,2 mg L-1 lipídios e 0,31 mg L-1 carboidratos). Parâmetros como tempo médio de emergência, comprimento e peso da parte aérea fresca e seca e radicular das plântulas de B. virgilioides foram similares para todos os tratamentos. Conclui-se que a biomassa de C. sorokiniana pode ter aplicação promissora como constituinte de material cimentante em peletização de sementes, apresentando resultados posistivos e similares à emergência de sementes nuas.
27
Adhikari, Pratishtha, Gopal Bahadur Khatri-Chhetri, Sundar Man Shrestha, and Santosh Marahatta. "Study on Prevalence of Mycoflora in Wheat Seeds." Turkish Journal of Agriculture - Food Science and Technology 4, no. 1 (January 20, 2016): 31. http://dx.doi.org/10.24925/turjaf.v4i1.31-35.509.
Full textAbstract:
Forty seed sample of wheat (Triticum aestivum) were collected from four locations viz. Chitwan, Kaski, Banke and Lalitpur and tested by blotter method at laboratory during 2013 for determining fungal pathogens associated with wheat seeds in Nepal. Eighteen species representing thirteen genera of fungi were recovered from the seed. Alternaria alternata and Bipolaris sorokiniana were predominant in all the varieties/genotypes from all the locations, where B. sorokiniana was strongly pathogenic in wheat crop. Percentage frequency and type of fungi detected varied with variety and locations. Bipolaris sorokiniana was highest (64.40%) in Banke than remaining three locations. Seeds of Chitwan had lowest percentage (5.50%) of seed infection as compared to other locations. Relative abundance of Alternaria alternata (55.10%) was highest as it was the most prevalent component of seed borne mycoflora, followed by Bipolaris sorokiniana (34.69%) and Cladosporium herbarum (7.19%). Differences in quantity of precipitation and relative humidity might be the possible reason for variation in frequency and type of fungi detected in wheat seeds of four locations.
28
Dutbayev, Yerlan, Nurlan Kuldybayev, Saule Daugaliyeva, Elvira Ismailova, Nadira Sultanova, Göksel Özer, Ayana Slyamova, Kadyrzhan Mukin, Abdelfattah Dababat, and Minura Yessimbekova. "Occurrence of Spot Blotch in Spring Barley Caused by Bipolaris sorokiniana Shoem. in South-Eastern Kazakhstan." Scientific World Journal 2022 (August 26, 2022): 1–8. http://dx.doi.org/10.1155/2022/3602996.
Full textAbstract:
In Kazakhstan, barley (Hordeum vulgare L.) is the second most important cereal crop after wheat, with an annual production of approximately 1.9 million tons. The study aimed to characterize Bipolaris sorokiniana isolates obtained from barley fields surveyed. A total of 21 diseased leaves showing spot blotch symptoms were collected from experimental plots located close to the Kazakh Research Institute of Agriculture and Crop Production, where the spring barley Arna cultivar was planted in June 2020. The overall strategy for control of spring barley blotch in the Almaty region of Kazakhstan should include the determination of the aggressiveness of the pathogen isolates to better understand the biology of the diseases and ultimately proper control strategy. Pathogenicity of B. sorokiniana isolates was made on barley seedlings in vitro. Inoculated seedlings showed clear symptoms of B. sorokiniana, and therefore, Koch’s postulates were fulfilled by reisolating the pathogen from artificially inoculated seedlings and identifying it based on standard morphology criteria. Further investigation is needed to understand the impact of B. sorokiniana on barley production in Kazakhstan.
29
Amorim, Ana Carolina Lourenço, Maria das Graças Cardoso, José Eduardo Brasil Pereira Pinto, Paulo Estevão de Souza, and Nelson Delú Filho. "Fungitoxic activity avaliation of the hexane and methanol extracts of copaiba plant leavesCopaifera langsdorffi Desfon." Ciência e Agrotecnologia 28, no. 2 (April 2004): 314–22. http://dx.doi.org/10.1590/s1413-70542004000200010.
Full textAbstract:
The fungitoxicity of hexane and methanol extracts of copaiba plants were evaluated by biological tests against the phytopathogens Colletotrichum gloeosporioides and Bipolaris sorokiniana. These extracts were chosen because they presented the highest yields in the extraction at room temperature. The biological material was obtained from the Department of Phytopathology of the UFLA, transplanted in BDA (C. gloeosporioides) and PCA (B. sorokiniana) culture media and incubated in a germination chamber with control of light and temperature. Five treatments (0/100/200/400/800 ppm) were used with three repetitions of each, and four mutually perpendicular radii, were measured in centimeters from the mycelial center. The formula for the Mycelial Growth Index (MGI) was applied to the values obtained for statistical analyses. A 32% reduction in the growth of B. sorokiniana was observed in the presence of the methanol extract, while the hexane extract was effective against both of the phytopathogens, resulting in a 49% reduction in the growth of B. sorokiniana and an 18% reduction in the growth of C. gloeosporioides.
30
TEMBO, B., J. SIBIYA, P. TONGOONA, and L. TEMBO. "Validation of microsatellite molecular markers linked with resistance to Bipolaris sorokiniana in wheat (Triticum aestivum L.)." Journal of Agricultural Science 155, no. 7 (March 21, 2017): 1061–68. http://dx.doi.org/10.1017/s0021859617000144.
Full textAbstract:
SUMMARYSpot blotch disease caused by Bipolaris sorokiniana (Sacc.) Shoem causes yield losses and reduces grain quality in wheat. Molecular markers reported to be linked with resistance to B. sorokiniana could accelerate the identification of resistant genotypes as they are independent of the environmental effect. However, before they can be utilized for marker assisted selection (MAS), validation in an independent population is required. The objective of the present study was therefore to validate three simple sequence repeat (SSR) molecular markers (Xwgm570, Xgwm544 and Xgwm437) linked with resistance to B. sorokiniana. The markers were validated using 66 wheat genotypes comprising 11 parental genotypes and 55 F2 progenies. Single marker analysis was performed using simple linear regression to ascertain the relationship between the marker and the trait. All the markers were confirmed to be associated with resistance. They all gave significant association with resistance to B. sorokiniana. The markers amplified DNA fragments in the resistant parental genotypes that were similar to those observed in resistant F2 progenies, but absent in the susceptible ones. Hence, these markers could be useful in increasing the efficiency of selection for resistance to B. sorokiniana in wheat breeding. Since the R2 values are low, a combination of two or three SSR markers can be employed during MAS. This was evident by the multiple linear equation which gave a combined R2 value of 18·0%, obtained from the inclusion of all three markers.
31
Sharma, Pradeep, Shefali Mishra, Garima Singroha, Rajan Selva Selva Kumar, Sanjay Kumar Singh, and Gyanendra Pratap Singh. "Phylogeographic Diversity Analysis of Bipolaris wesorokiniana (Sacc.) Shoemaker Causing Spot Blotch Disease in Wheat and Barley." Genes 13, no. 12 (November 24, 2022): 2206. http://dx.doi.org/10.3390/genes13122206.
Full textAbstract:
Bipolaris sorokiniana is a fungal pathogen that infects wheat, barley, and other crops, causing spot blotch disease. The disease is most common in humid, warm, wheat-growing regions, with South Asia’s Eastern Gangetic Plains serving as a hotspot. There is very little information known about its genetic variability, demography, and divergence period. The current work is the first to study the phylogeographic patterns of B. sorokiniana isolates obtained from various wheat and barley-growing regions throughout the world, with the goal of elucidating the demographic history and estimating divergence times. In this study, 162 ITS sequences, 18 GAPDH sequences, and 74 TEF-1αsequences from B. sorokiniana obtained from the GenBank, including 21 ITS sequences produced in this study, were used to analyse the phylogeographic pattern of distribution and evolution of B. sorokiniana infecting wheat and barley. The degrees of differentiation among B. sorokiniana sequences from eighteen countries imply the presence of a broad and geographically undifferentiated global population. The study provided forty haplotypes. The H_1 haplotype was identified to be the ancestral haplotype, followed by H_29 and H_27, with H_1 occupying a central position in the median-joining network and being shared by several populations from different continents. The phylogeographic patterns of species based on multi-gene analysis, as well as the predominance of a single haplotype, suggested that human-mediated dispersal may have played a significant role in shaping this pathogen’s population. According to divergence time analysis, haplogroups began at the Plio/Pleistocene boundary.
32
BARBA, JAVIER TOLEDO, ERLEI M. REIS, and CARLOS A. FORCELINI. "Comparação de métodos para detecção de Bipolaris sorokiniana em sementes de cevada." Fitopatologia Brasileira 27, no. 4 (July 2002): 389–94. http://dx.doi.org/10.1590/s0100-41582002000400009.
Full textAbstract:
O fungo Bipolaris sorokiniana, agente causal da helmintosporiose da cevada (Hordeum vulgare), sobrevive como micélio em sementes infetadas e saprofiticamente nos restos culturais de seus hospedeiros. Em experimentos conduzidos em laboratório, diferentes métodos [papel-filtro, papel-filtro + componentes líquidos do meio seletivo de Reis (MSR), batata-dextrose-ágar (BDA), extrato de tomate-ágar, V-8-ágar, meio seletivo de Reis (MSR) e meio seletivo de Dodman & Reinke] foram comparados visando selecionar o mais sensível para detecção de B. sorokiniana em sementes de cevada. Os meios foram testados com e sem congelamento das sementes. Sem congelamento, os meios seletivos foram mais sensíveis na detecção de B. sorokiniana, seguidos pelo meio de BDA. O método papel-filtro padrão ocupou uma posição intermediária, estatisticamente inferior aos demais. Sob congelamento a -20 ºC (durante 16 h), o tratamento térmico anulou o efeito dos substratos na detecção do fungo, de tal modo que todos apresentaram comportamento estatisticamente semelhante. Esse procedimento não afetou positivamente a detecção do fungo-alvo deste estudo. O meio seletivo de Reis foi mais sensível que o de papel-filtro + congelamento na detecção de B. sorokiniana em sementes com diferentes níveis de incidência.
33
Li, Fang, Tingyu Duan, and Yanzhong Li. "Effects of the Fungal Endophyte Epichloë festucae var. lolii on Growth and Physiological Responses of Perennial Ryegrass cv. Fairway to Combined Drought and Pathogen Stresses." Microorganisms 8, no. 12 (December 2, 2020): 1917. http://dx.doi.org/10.3390/microorganisms8121917.
Full textAbstract:
Perennial ryegrass (Lolium perenne) is widely cultivated around the world for turf and forage. However, the plant is highly susceptible to disease and is sensitive to drought. The present study aims to determine the effect of the fungal endophyte Epichloë festucae var. lolii of perennial ryegrass on the combined stresses of drought and disease caused by Bipolaris sorokiniana in the greenhouse. In the experiment, plants infected (E+) or not infected (E−) with the fungal endophyte were inoculated with Bipolaris sorokiniana and put under different soil water regimes (30%, 50%, and 70%). The control treatment consisted of E+ and E− plants not inoculated with B. sorokiniana. Plant growth, phosphorus (P) uptake, photosynthetic parameters, and other physiological indices were evaluated two weeks after pathogen infection. The fungal endophyte in E+ plants increased P uptake, plant growth, and photosynthetic parameters but decreased the malondialdehyde concentration, proline content, and disease incidence of perennial ryegrass (p < 0.05). E+ plants had the lowest disease incidence at 70% soil water (p < 0.05). The study demonstrates that the fungal endophyte E. festucae var. lolii is beneficial for plant growth and stress tolerance in perennial ryegrass exposed to the combined stresses of drought and B. sorokiniana.
34
Харіпжанова, Айдана, Эльвира Исмаилова, Ерлан Дутбаев, Макира Cыбанбаева, and Надира Султанова. "АЛМАТЫ ОБЛЫСЫНЫҢ КҮЗДІК БИДАЙ ТҰҚЫМЫ САҢЫРАУҚҰЛАҒЫНЫҢ МОРФОЛОГИЯЛЫҚ-КУЛЬТУРАЛДЫ БЕЛГІЛЕРІ." Izdenister natigeler, no. 3 (99) (September 29, 2023): 81–91. http://dx.doi.org/10.37884/3-2023/08.
Full textAbstract:
Мақалада Алматы облысы жағдайында күздік бидайдың тамыр шірігі қоздырғыштарының морфологиялық-культуралды белгілерін анықтау және сәйкестендіру бойынша зерттеу нәтижелері келтірілген. Зерттеулер 2021-2022 жылдары «Микробиология және вирусология ғылыми-өндірістік орталығы» базасында микробиология және фитопатологияда жалпы қабылданған әдістер бойынша зертхана жағдайында жүргізілді. Статистикалық талдау Стьюденттің Т критерийін дисперсиялық талдау арқылы R- studio бағдарламасы арқылы жүргізілді. Маңыздылықтың критикалық деңгейі Р мәнімен анықталды. Зерттеу барысында сүзгі қағазының орамдардағы талдау әдісі, құмда өнген тұқымдардағы тұқым инфекциясын анықтау әдісі арқылы күздік бидайдың фузариоз және тамыр шірік белгілері бар екендігі анықталды. Тамыр шірігінің негізгі қоздырғыштары Bipolaris sorokiniana және Fusarium spp. тұқымдас саңырауқұлақтардың екі түрі кездескені анықталды. Ауруға бейімділік бойынша фитосанитариялық талдау нәтижелері орташа алғанда 91-94% тұқымдық инфекциямен берілген. Тұқымдық инфекция Алмалы сортында Bipolaris sorokiniana таралуы 46%, Fusarium spp 45% құрады. Канада сортында таралу деңгейі сәйкесінше 56% және 38% құрайды. Бидай тұқымынан бөлініп алыңған Bipolaris sorokiniana тұқымдас саңырауқұлақтардың P15, P15I изоляттарының қоректік орталарда өсу динамикасы қоректік орта мен изолят факторы колониялардың аумағына әсер ететінін көрсетті. Алайда, Fusarium F2 және F3 саңырауқұлақтарының өсу динамикасы колониялардың ауданы тәуліктің p <0,05 факторына байланысты екенін көрсетті. Fusarium spp және Bipolaris sorokiniana cаңырауқұлақ конидияларының биологиялық ерекшеліктері, оның ішінде қалқаншалардың ұзындығы, ені және саны cипатталған.
35
Kliphuis, Anna M. J., Marcel Janssen, Evert J. van den End, Dirk E. Martens, and René H. Wijffels. "Light respiration in Chlorella sorokiniana." Journal of Applied Phycology 23, no. 6 (November 3, 2010): 935–47. http://dx.doi.org/10.1007/s10811-010-9614-7.
Full text
36
Leite, Luan de Souza, Danilo Vitorino dos Santos, Cristina Filomena Pereira Rosa Paschoalato, Tom Bond, and Luiz Antonio Daniel. "Disinfection By-Products Formation from Chlor(am)ination of Algal Organic Matter of Chlorella sorokiniana." Toxics 11, no. 8 (August 10, 2023): 690. http://dx.doi.org/10.3390/toxics11080690.
Full textAbstract:
Eutrophication in water reservoirs releases algal organic matter (AOM), which is an important precursor of disinfection by-products (DBPs) formed during water treatment. Chlorella sorokiniana is a microalgae which flourishes under conditions of high light intensity and temperature, thus its prevalence in algal blooms is expected to increase with climate change. However, Chlorella sorokiniana AOM has not been previously investigated as a DBP precursor. In this context, this study evaluated the effect of AOM concentration, humic acid (HA), and pH on DBP formation from chlor(am)ination of AOM Chlorella sorokiniana. DBP yields determined by linear regression for trichloromethane (TCM) and chloral hydrate (CH) were 57.9 and 46.0 µg·mg DOC−1 in chlorination, while the TCM, CH, dichloroacetonitrile (DCAN), 1,1,1-trichloropropanone (1,1,1-TCP), and chloropicrin (CPN) concentrations were 33.6, 29.8, 16.7, 2.1, and 1.2 µg·mg DOC−1 in chloramination. Chloramination reduced the formation of TCM and CH but increased CPN, DCAN, and 1,1,1-TCP yields. AOM Chlorella sorokiniana showed a higher DBP formation than 9 of 11 algae species previously investigated in the literature. At basic pH, the concentration of TCM increased while the concentration of other DBP classes decreased. Bromide was effectively incorporated into the AOM structure and high values of bromine incorporation factor were found for THM (1.81–1.89) and HAN (1.32) at 1.5 mg Br·L−1. Empirical models predicted successfully the formation of THM and HAN (R2 > 0.86). The bromide concentration had more impact in the model on the DBP formation than AOM and HA. These results provide the first insights into the DBP formation from AOM chlor(am)ination of Chlorella sorokiniana.
37
Baturo, Anna. "Health status of five spring barley cultivars cultivated under organic system." Acta Agrobotanica 58, no. 2 (2012): 347–58. http://dx.doi.org/10.5586/aa.2005.061.
Full textAbstract:
The objective of the study was to compare health status of harvested grain of spring barley cv. Rudzik, Rodos, Start and Maresi cultivated in organic system and cv. Damazy grown in an organic farm. Analyses showed that prevalent pathogen on grain was <i>Bipolaris sorokiniana</i> isolated from 48% of grains. Fungi from genus of <i>Fusarium</i> were obtained less numerously, from 27% of grains and were represented mainly by <i>F. poae</i> and <i>F. avenaceum</i>. Microscopic analysis of <i>F. poae</i> was confirmed by PCR analysis. All cultivars were intensively diseased by <i>B. sorokiniana</i>, thus it is impossible to show a cultivar especially recommended for this system, where <i>B. sorokiniana</i> can be serious problem. However cv. Damazy showed relatively the lowest infestation by <i>B. sorokiniana</i> and it also was not more intensively diseased by <i>Fusarium</i> spp. It is very important in nutrition aspect because these fungi can be dangerous for both human and animal health due to their abilities to produce mycotoxins.
38
Wiewióra, Barbara. "Long-time storage effect on the seed health of spring barley grains." Plant Breeding and Seed Science 59, no. 1 (January 1, 2009): 3–12. http://dx.doi.org/10.2478/v10129-009-0001-y.
Full textAbstract:
Long-time storage effect on the seed health of spring barley grains Seeds of 5 cultivars of spring barley, originated from field experiments conducted in 2000 at Radzików, were tested immediately after harvest and after three, four and five years of storage in uncontrolled conditions, for incidence of seed-borne fungi with special regard to "field fungi" (Bipolaris sorokiniana and Fusarium spp.) and "storage fungi" (species of Penicillium and Aspergillus). The studies showed that barley seeds were infected before storage by numerous fungi as well as the saprophytes: Alternaria alternata, Acremonium spp,Acremoniella atra and the pathogens: Bipolaris sorokiniana and ten Fusarium species. The analysis after storage showed that the frequency of fungal infection had changed. The occurrence of some fungi was significantly affected by the period of storage. An increase of infection by species of Penicillium and Aspergillus known as "storage fungi" was detected on seeds after storage, especially after four years. At the same time, isolation of species of Fusarium and Bipolaris sorokiniana from these seeds decreased. Differences in number of ‘field’ and ‘storage’ fungi were found in dependence on period of storage, also. The smallest infection by Bipolaris sorokiniana and Fusarium was observed on seed after five years of storage.
39
Gómez-Espinoza, Olman, Giovanni Garro-Monge, Johnny Peraza, Kattia Núńez-Montero, Karla Meneses-Montero, and Maritza Guerrero-Barrantes. "Transformación genética de Chlorella sorokiniana mediada por Agrobacterium tumefaciens." Revista Tecnología en Marcha 31, no. 1 (March 22, 2018): 162. http://dx.doi.org/10.18845/tm.v31i1.3505.
Full textAbstract:
Las microalgas se han convertido en una plataforma viable para numerosas aplicaciones biotecnológicas como la producción de biocombustibles, vitaminas, carotenoides, enzimas, farmacéuticos y proteínas recombinantes. Dentro de este grupo, <em>Chlorella sorokiniana</em> tiene los requerimientos para convertirse en un microorganismo industrial, gracias a su habilidad de soportar considerables fluctuaciones de temperatura, pH y salinidad. En el presente estudio, <em>C. sorokiniana</em> fue utilizada para determinar las condiciones óptimas de transformación a mediante Agrobacterium tumefaciens. Se determinó que una densidad bacteriana de OD<sub>600 </sub>= 1.5, 3 días de co-cultivo a 24°C en un pH de 5.6, 150 mM de acetosiringona y dos días de recuperación post co-cultivo son las condiciones óptimas para la transformación de <em>C. sorokiniana</em>.
40
Toropova, E. Yu, M. P. Selyuk, G. Ya Stetsov, and R. I. Trunov. "Colonisation of spring wheat spikelets by soil phytopathogens in the Western Siberian forest-steppe." Bulletin of NSAU (Novosibirsk State Agrarian University), no. 3 (October 9, 2023): 120–28. http://dx.doi.org/10.31677/2072-6724-2023-68-3-120-128.
Full textAbstract:
The research aimed to assess the influence of varieties and yearly conditions on phytopathogens' colonisation of spring wheat spikes. The study tasks included specifying the mechanisms and timing of colonisation by phytopathogens, determining the taxonomy of microfungi groups and species related to various generative organs, and identifying the impact of varieties and yearly conditions on microfungi colonisation of generative organs. The research was conducted in 2021-2022 in the northern forest steppe of the Ob region on ten spring wheat varieties from various areas of Russia and the world, using standard methodologies. Of the two experimental years, 2021 was relatively humid (GTU August 1.2), while 2022 was dry (GTU August 0.45). In the research years, the mycobiota of generative organs of spring wheat varieties consisted of Bipolaris sorokiniana Sacc. Shoem, fungi of the Fusarium Link genus, and Alternaria Nees. However, the taxon representation significantly differed between years, varieties, and spike organs. The dynamics of colonisation of generative organs of spring wheat varieties by microfungi suggest early infestation of spikelet peduncles by Fusarium fungi (tubular stage) and B. sorokiniana (stem elongation stage). It indicates the ability of these microfungi to infect spikes through vessels and by airborne-droplet transmission. The study of the collection did not reveal varieties resistant to the infestation of generative organs by B. sorokiniana and Fusarium and Alternaria fungi. B. sorokiniana preferred infesting spikelet peduncles over grains and increased spike colonisation in wetter conditions. B. sorokiniana dominated on spike peduncles in both years of the study and on grains in the wetter 2021. Fusarium fungi demonstrated lower colonisation activity of generative organs in dry and wet conditions, with a higher affinity for spikelet peduncles, which was less dependent on the yearly conditions. In contrast, the colonisation of grains depended on yearly conditions and was 1.9 times lower on average across varieties in dry conditions. Alternaria fungi preferred colonising grains over spikelet peduncles in spring wheat varieties. They were more successful in dry conditions, unfavourable for moisture-loving phytopathogens from the Fusarium and B. sorokiniana genera. They dominated on grains of all collection varieties in the dry 2022.
41
Bazarnova, Y. "ILLUMINATION INFLUENCE ON Chlorella sorokiniana BIOMASS SYNTHESIS." Biotechnologia Acta 12, no. 3 (June 2019): 50–56. http://dx.doi.org/10.15407/biotech12.03.050.
Full text
42
Т. М., Horhan, Beznosko І. V., Bilenka О. М., and Blahinina А. А. "INFLUENCE OF EXOMETABOLITES OF DIFFERENT VARIETIES OF CULTURAL PLANTS ON THE GROWTH AND DEVELOPMENT OF PATHOGENIC MICROMYCETES BIPOLARIS SOROKINIANA AND ALTERNARIA ALTERNATA." Agriciltural microbiology 33 (June 18, 2021): 96–105. http://dx.doi.org/10.35868/1997-3004.33.96-105.
Full textAbstract:
Objective. To establish the influence of exometabolites of winter wheat plants of Podolianka, Natalka, Skagen, Mulan varieties and oats of Skarb Ukrainy, Svitanok, Tembr varieties on the growth and development of Bipolaris sorokiniana micromycete, as well as the influence of onion of Tkachenkivska, Mavka, Veselka, Liubchyk, Variah, Harmonia varieties on the growth and development of the micromycete Alternaria alternata. Methods. Mycological, phytopathological, phytoimmunological. Results. Two hundred isolates of pathogenic micromycetes were isolated from the seeds of the studied crops of different varieties. The most common microbiota were: Bipolaris sorokiniana, Alternaria alternata, Alternaria tenuissima, Alternaria infectoria, Stemphylium vesicarium, Curvularia inaequalis. The highest incidence on wheat and oat seeds (over 80 %) was reported for B. sorokiniana, on onion seeds — for A. alternata. It was found that exometabolites of plants of different varieties can both inhibit and stimulate the rate of radial growth of mycelium of B. sorokiniana and A. alternata. It was proved that exometabolites of plants of wheat, oats, onion can significantly affect the reproductive capacity of the studied micromycetes, which reduced the number of spores per 1 cm2 of colony area almost 1.2–2.5 times compared to the control. This indicates that exometabolites of plants are characterized by fungicidal properties, which are due to a complex of biologically active substances that can inhibit the intensity of sporulation of B. sorokiniana and A. alternate. Conclusion. The antifungal property of root exometabolites of plants of the studied varieties significantly depends on the genotype of the variety. Therefore, an important timely task is to identify environmentally stable and flexible varieties that are characterized by group resistance to pathogens of fungal origin, as well as the search for mechanisms of action of fungicidal natural origin.
43
Manandhar, H. K., H. J. Lyngs Jørgensen, S. B. Mathur, and V. Smedegaard-Petersen. "Suppression of Rice Blast by Preinoculation with Avirulent Pyricularia oryzae and the Nonrice Pathogen Bipolaris sorokiniana." Phytopathology® 88, no. 7 (July 1998): 735–39. http://dx.doi.org/10.1094/phyto.1998.88.7.735.
Full textAbstract:
Avirulent isolates of Pyricularia oryzae and isolates of Bipolaris sorokiniana, a nonrice pathogen, were used to suppress rice blast caused by P. oryzae. In greenhouse experiments, both fungi substantially reduced leaf blast when applied 24 h or more before the pathogen. B. sorokiniana, but not avirulent isolates of P. oryzae, systemically reduced disease in leaf 5 when applied to whole plants at the four-leaf stage. In field experiments, both fungi were able to reduce neck blast significantly. No increase in grain yield was obtained by using avirulent isolates of P. oryzae, whereas five sprays with B. sorokiniana from seedling to heading stages increased the grain yield in two of three experiments conducted at two locations in Nepal. The significant increase in yield was observed under high inoculum pressure of P. oryzae. Induced resistance is suggested to be involved in the suppression of disease.
44
Khanahmadi, K., S. Ghasemi, S. Bharaminejad, M. Sheikholesami, and M. Abdolmaleki. "Antifungal activity of Artemisia haussknechtii against Fusarium oxysporum and Bipolaris sorokiniana." Indian Journal of Agricultural Sciences 82, no. 8 (August 14, 2012): 727–30. http://dx.doi.org/10.56093/ijas.v82i8.23064.
Full textAbstract:
Since long time ago, Artemisia species have been used as the flavone sources and as insects and snakes repellants. In this research, antifungal activity of ethanolic extract and essential oil of Artemisia hussknechtii was investigated based on two methods: Agar diffusion method and paper disc method. Inhibitory effects of these samples on mycelial growth of two fungi Fusarium oxysporum, Bipolaris sorokiniana were determined. Results showed that in paper disc method the essential oil of A. haussknechtii had remarkable inhibitory effect against F. oxysporum with 19.33 mm inhibitory radius zone in 50 µl /paper disc. The most inhibition on B. sorokiniana was belonging to A. hauskenechti extract with 19.08 mm inhibitory radius zone in 5 mg/paper disc. Via agar diffusion method both A. haussknechtii extract and essential oil inhibit mycelial growth of F. oxysporum and sorokiniana with 100% inhibition in 4 000, 5 000 ppm.
45
Carmo, Ivani Ramos do, Andréia A. O. Silva, Eliana Rodrigues, Noemir Antomiazzi, and Erna E. Bach. "Patogenicidade de isolados do fungo Bipolaris sorokiniana em cultivares de cevada e trigo." ConScientiae Saúde 2 (January 3, 2008): 11–17. http://dx.doi.org/10.5585/conssaude.v2i0.189.
Full textAbstract:
As doenças do trigo e da cevada causadas por Bipolaris sorokiniana vêm acarretando consideráveis perdas no rendimento e produção. O objetivo do presente trabalho foi identificar os isolados, observando os sintomas. Testes de patogenicidade em casa-de-vegetação demonstraram que as cultivares de cevada e trigo foram suscetíveis a todos os patógenos, na concentração de 105 conídios/ml. Assim, isolados de trigo e cevada de Bipolaris sorokiniana apresentaram reação cruzada, demonstrando o nível de especialização nos cultivares.
46
Bhattacharjee, Priyanka, Arnab Sen, Usha Chakraborty, and Biswanath Chakraborty. "RAPD analysis and rDNA gene sequence based phylogeny of Bipolaris sorokiniana, a spot blotch pathogen of sorghum." NBU Journal of Plant Sciences 11, no. 1 (2019): 101–14. http://dx.doi.org/10.55734/nbujps.2019.v11i01.006.
Full textAbstract:
Sorghum [Sorghum bicolor (L) Moench] is the one of the most important cereal crops in the world. It is the staple food grain for over 750 million people who live in the semi-arid tropics of Africa, Asia, and Latin America. Global pro-duction of sorghum is currently estimated to be 57.6 million tonnes, with Asian countries contributing 20% of the total production. Within Asia, India is the largest producer of sorghum grain. Recently there have been severe signs of sorghum decline caused by Bipolaris sorokiniana resulting in decreased production of sorghum in villages of Kalimpong and Darjeeling. In the present study, initially, several strains of the fungus were isolated from diseased leaves of Sorghum bicolor and Triticum aestivum which were morphologically identified as Bipolaris sorokiniana. Genomic DNA of B. sorokiniana isolated from infected leaves was purified and PCR amplification of 18s rDNA was done using specific primers. Amplified product (1190 bp) was sequenced and aligned against ex-type strain sequences of B. sorokiniana from NCBI GenBank using BLAST and phylogenetic analysis was done using MEGA4 software. RAPD PCR analysis and DGGE analysis of amplified genomic DNA were done. The evolutionary history was inferred using the UPGMA method. Amplification of ITS region of the rDNA can be considered as a rapid technique for identifying pathogens successfully in all cases.
47
Nur-E-Nasreen, Nur-E.-Nasreen, M. Bahadur Meah, Farzana Haque Tumpa, and Muhammed Ali Hossain. "Effect of Media Composition on Vegetative and Reproductive Growth of Alternaria Brassicicola and Bipolaris Sorokiniana." Current Agriculture Research Journal 5, no. 3 (December 11, 2017): 266–78. http://dx.doi.org/10.12944/carj.5.3.02.
Full textAbstract:
Experiments were conducted to evaluate the effect of some culture media on the vegetative and reproductive growth of Alternaria brassicicola and Bipolaris sorokiniana. Twenty one (21) treatment combinations each with three replications were employed. Potato Dextrose Agar (PDA) was used as the basic growth medium in this study. Supplementation with different plant extracts with this medium produced differential growth and sporulation of the tested fungi. PDA media supplemented with mustard leaf extract showed significantly highest vegetative growth (7.8 cm) and PDA with the combination of mustard leaf, tomato fruit, carrot fruit and cabbage leaf extracts showed the highest sporulation (11×105 spores/ml) of A. brassicicola. In case of B. sorokiniana, the highest vegetative growth (7.4 cm) and highest sporulation (45×104 spores/ml) were obtained by the supplementation of mustard and wheat leaf extracts respectively. Plant extract supplementation proved better than PDA as growth medium of A. brassicicola and B. sorokiniana.
48
Krupinsky, J. M., and J. D. Berdahl. "Selecting Resistance to Bipolaris sorokiniana and Fusarium graminearum in Intermediate Wheatgrass." Plant Disease 84, no. 12 (December 2000): 1299–302. http://dx.doi.org/10.1094/pdis.2000.84.12.1299.
Full textAbstract:
Forage yield and persistence of intermediate wheatgrass and pubescent intermediate wheatgrass can be adversely affected by foot rot caused by Fusarium graminearum, Bipolaris sorokiniana, or both. Putative B. sorokiniana- and F. graminearum-resistant plants were selected from both Reliant and Manska cultivars of intermediate wheatgrass to produce four populations. When plants from half-sib families that were selected for resistance were intercrossed and progeny subjected to subsequent selection cycles for B. sorokiniana and F. graminearum resistance, progressively higher percentages of putative resistant seedlings were found for three of the four selected populations compared to the original base populations. In cycle 3 of three populations, 7 to 91% of half-sib families with statistically higher seedling survival rates than the base populations were considered more resistant than the base populations. Thus, progressive improvement in seedling survival was realized for three populations selected for resistance using three cycles of recurrent phenotypic selection among and within half-sib families.
49
Gurova, Tamara, and Natalia Chesnochenko. "Chlorophyll fluorescence of wheat leaves when infected with Bipolaris sorokiniana." E3S Web of Conferences 390 (2023): 01011. http://dx.doi.org/10.1051/e3sconf/202339001011.
Full textAbstract:
For three spring wheat cultivars, characteristics of adaptive reaction to cereal root rot pathogen Bipolaris sorokiniana Shoem. infection are found by laboratory experiments using chlorophyll fluorecence parameter (ChlF) dynamics of 10-16 day old seedlings. Such ChlF parameters as Y(II), ETR, qP, Fv / Fm, Fv / Fо, Y(NPQ), qN and Y(NQ) are verified as informative, being reliable biomarkers for photosynthetic apparatus level pre-symptom estimate of cultivar resistance to the pathogen. For more resistant cultivars Novosibirskaya 29 and Sibirskaya 21, the reaction to the pathogen invasion appeared to be less expressed compared to less resistant cultivar Novosibiskaya 41. More resistant cultivars have the smallest ChlF parameter changes compared to the control ones. Sixteen day old seedlings infected with B. sorokiniana showed the largest intercultivar differences. The photosynthetic activity level during adaptive reaction to B. sorokiniana pathogenesis can be used as stress resistance criterion for selection material to accelerate its sampling and to increase its effectiveness by early non-perspective sample rejection.
50
М. К. Инсебаева and Ұ. Н. Тілеубек. "О ВОПРОСАХ НАСЕЛЕННОСТИ ПОЧВ КОНИДИЯМИ BIPOLARIS SOROKINIANA SACC. SHOEM НА СЕВЕРО-ВОСТОКЕ КАЗАХСТАНА." Bulletin of Toraighyrov University. Chemistry & Biology series, no. 3,2023 (September 29, 2023): 111–19. http://dx.doi.org/10.48081/psvp8721.
Full textAbstract:
В данной статье указаны результаты исследования населенности почв конидиями некоторых семейств грибов. Одна из распространённых – Bipolaris sorokiniana Sacc. Shoem является родом грибов, включающих около 70 видов, которые являются причиной различных заболеваний растений. Эти грибы могут заселять почву и оставаться в ней в течение длительного времени, что может негативно сказаться на посевах и урожайности растений. На Северо-Востоке Казахстана, как и во многих других регионах мира проблемы с заселенностью почв конидиями Bipolaris sorokiniana Sacc. Shoem возникают, в связи с использованием некоторых сельско-хозяйственных практик, а также в результате повсеместных изменений климатических условий. Для оценки заселенности почв конидиями данного гриба на Северо-Востоке Казахстана проводились исследования на протяжении нескольких лет, в разных климатических зонах. В результате было выявлено, что заселенность почв ими значительно отличается в зависимости от географического расположения и типа почвы. Изучение заселенности почв конидиями Bipolaris sorokiniana Sacc. Shoem на Северо-Востоке Казахстана важно для определения мер по предотвращению и контролю заболеваний растений, вызываемых этими грибами. Ключевые слова: почва, грибы, Северо-Восток Казахстана, фитопатогены, пшеница.