Journal articles: 'Selassie'

1

Alasow, Jonis Ghedi. "Emperor Haile Selassie." Journal of Contemporary African Studies 35, no. 1 (September 16, 2016): 129–30. http://dx.doi.org/10.1080/02589001.2016.1232884.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Ludi, Regula. "Haile Selassie auf Jamaika." Historische Anthropologie 19, no. 1 (January 2011): 82–111. http://dx.doi.org/10.7788/ha.2011.19.1.82.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Levin, Ayala. "Haile Selassie's Imperial Modernity: Expatriate Architects and the Shaping of Addis Ababa." Journal of the Society of Architectural Historians 75, no. 4 (December 1, 2016): 447–68. http://dx.doi.org/10.1525/jsah.2016.75.4.447.

Full text

Abstract:

In the 1960s, Addis Ababa experienced a construction boom, spurred by its new international stature as the seat of both the United Nations Economic Commission for Africa and the Organization of African Unity. Working closely with Emperor Haile Selassie, expatriate architects played a major role in shaping the Ethiopian capital as a symbol of an African modernity in continuity with tradition. Haile Selassie's Imperial Modernity: Expatriate Architects and the Shaping of Addis Ababa examines how a distinct Ethiopian modernity was negotiated through various borrowings from the past, including Italian colonial planning, both at the scale of the individual building and at the scale of the city. Focusing on public buildings designed by Italian Eritrean Arturo Mezzedimi, French Henri Chomette, and the partnership of Israeli Zalman Enav and Ethiopian Michael Tedros, Ayala Levin critically explores how international architects confronted the challenges of mediating Haile Selassie's vision of an imperial modernity.

APA, Harvard, Vancouver, ISO, and other styles

4

McClellan, Charles W. "Emperor Haile Selassie. By Bereket Habte Selassie. (Athens, OH: Ohio University Press, 2014. Pp. 147. $14.95.)." Historian 78, no. 4 (December 1, 2016): 738–39. http://dx.doi.org/10.1111/hisn.12342.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Sorenson, John. "Discourses on Eritrean Nationalism and Identity." Journal of Modern African Studies 29, no. 2 (June 1991): 301–17. http://dx.doi.org/10.1017/s0022278x00002767.

Full text

Abstract:

Since Italy's defeat in World Ward II, Ethiopia has pressed its claim to Eritrea. Following an abortive federation imposed by the United Nations in 1950, Haile Selassie annexed the former Italian colony in 1962, and for the last three decades Eritreans have fought for their independence.

APA, Harvard, Vancouver, ISO, and other styles

6

Tafla, Bairu. "In memoriam Sergew Hable Selassie (Sǝrgǝw Hablä Śellase) (1929–2003)." Aethiopica 6 (January 20, 2013): 211–15. http://dx.doi.org/10.15460/aethiopica.6.1.384.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Woubshet, Dagmawi, and Kifle Selassie Beseat. "A Life of Solidarity: An Interview with Kifle Selassie Beseat." Callaloo 39, no. 1 (2016): 55–75. http://dx.doi.org/10.1353/cal.2016.0014.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Mba, Chika. "African leaders of the twentieth century: Biko, Selassie, Lumumba, Sankara." Journal of Contemporary African Studies 35, no. 4 (September 7, 2017): 573–77. http://dx.doi.org/10.1080/02589001.2017.1375087.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Werts, J. K. "The Clothes Make the Man: Portraits of Emperor Haile Selassie." Nka Journal of Contemporary African Art 2010, no. 27 (September 1, 2010): 108–17. http://dx.doi.org/10.1215/10757163-2010-27-108.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Negm, Namira. "Diverse Perspectives on the Impact of Colonialism in International Law: The Case of the Chagos Archipelago." Proceedings of the ASIL Annual Meeting 113 (2019): 68–71. http://dx.doi.org/10.1017/amp.2019.145.

Full text

Abstract:

FREEDOM … AFRICA FREE OF DECOLONIZATION … that was the dream of our founding fathers from Nyerere, Nasser, Nkrumah, Haile Selassie, to Lumumba, and many others. The call for freedom laid the basis for the African unity, so it came as no surprise that we, at the African Union, had the support of an entire continent, with its fifty-five member states, to defend the Mauritian Cause to free Chagos.

APA, Harvard, Vancouver, ISO, and other styles

11

Haile, Getatchew. "The Unity and Territorial Integrity of Ethiopia." Journal of Modern African Studies 24, no. 3 (September 1986): 465–87. http://dx.doi.org/10.1017/s0022278x00007126.

Full text

Abstract:

Under the title ‘The American Dilemma on the Horn’, Bereket Habte Selassie published in this Journal, Vol. 22, No. 2, June 1984, pp. 249–72, a lawyer's presentation of a client's case: that of the Eritrean separatists. Although my views do not necessarily represent those held by the régime in Addis Ababa, they do indicate why Ethiopians resolutely continue to defend the territorial integrity of their motherland with a degree of unity only admitted by a few writers.

APA, Harvard, Vancouver, ISO, and other styles

12

Getachew, Yohannes Tesfaye. "A History of Koshe Town in South-Central Ethiopia from 1941 to 1991." Ethnologia Actualis 20, no. 1 (February 1, 2020): 119–37. http://dx.doi.org/10.2478/eas-2021-0006.

Full text

Abstract:

Abstract Koshe town is the administrative and commercial center of Mareko woreda.1 It is found in Gurage Zone Southern Nation Nationalities and Peoples Regional State. According to the tradition the origin of the name “Koshe” is originated from the plant which called by the name Koshe which abundantly grow in the area. The establishment of Koshe town is directly associated with the five years Italian occupation. Due to the expansion of patriotic movement in the area Italian officials of the area forced to establish additional camp in the area in a particular place Koshe. This paper explores the role of Fascist Italy for the establishment of Koshe town. The former weekly market shifted its location and established around the Italian camp. Following the evacuation of Fascist Italy the Ethiopian governments control the area. During the government of Emperor Haile Selassie Koshe town got some important developmental programs. The most important development was the opening of the first school by the effort of the Swedes.2 The Military regime (Derg)3 also provided important inputs for the urbanization of Koshe town. This research paper observes the development works that flourish in Koshe during the reign of Emperor Haile Selassie and the Military regime, and also asses the role of different organizations for the urbanization of Koshe town.

APA, Harvard, Vancouver, ISO, and other styles

13

Van der Beken, Christophe. "Ethiopia: From a Centralised Monarchy to a Federal Republic." Afrika Focus 20, no. 1-2 (February 15, 2007): 13–48. http://dx.doi.org/10.1163/2031356x-0200102003.

Full text

Abstract:

Ethiopia: From a Centralised Monarchy to a Federal Republic Although the Ethiopian state traces its roots back to the empire of Axum in the first centuries AD, the modern Ethiopian state took shape in the second half of the 19th century. During that period the territory of the Ethiopian empire expanded considerably. Several ethnic groups were incorporated into the empire and the foundations for a strong, centralised state were laid Centralisation of authority in the hands of the emperor and a strategy of nation building that denied the ethnic diversity of Ethiopian society characterised the rule of Emperor Haile Selassie. At the same time, these elements contributed to its decline. Haile Selassie was ultimately deposed by a military committee in 1974. This announced the end of the Ethiopian monarchy and the transformation of the Ethiopian state, following the Marxist model. In spite of Marxist-Leninist attention to the 'nationalities issue', Ethiopia remained a centralised state, dominated by one ethnic identity. This gave rise to increasing resistance from various regional and ethnic liberation movements. The combined effort of these movements caused the fall of military rule in May 1991. The new regime, which was dominated by ethnically organised parties, initiated a radical transformation of the Ethiopian state structure that leads to the establishment of a federation in 1995.

APA, Harvard, Vancouver, ISO, and other styles

14

Tesfaye, Dagnew. "From disillusionment to protest: Poems by Haile Selassie I University students." African Journal of History and Culture 7, no. 8 (August 31, 2015): 164–70. http://dx.doi.org/10.5897/ajhc2014.0224.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

LEVI, CAROLEIN. "The Mission. The Life, Reign and Character of Haile Selassie I." African Affairs 89, no. 357 (October 1990): 604–5. http://dx.doi.org/10.1093/oxfordjournals.afraf.a098350.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Taylor, J. R. "MICKAEL BETHE-SELASSIE: THE SACRED FOREST PAPIER-MACHE SCULPTURES AND RELIEFS." Nka Journal of Contemporary African Art 1994, no. 1 (September 1, 1994): 62. http://dx.doi.org/10.1215/10757163-1-1-62.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Khan, Geoffrey. "From Haile Selassie to H. J. Polotsky: An Ethiopian and Semitic Miscellany." Journal of Jewish Studies 48, no. 2 (October 1, 1997): 423. http://dx.doi.org/10.18647/2050/jjs-1997.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Guluma Gemeda. "Haile Selassie, Western Education, and Political Revolution in Ethiopia (review)." Northeast African Studies 10, no. 1 (2008): 191–95. http://dx.doi.org/10.1353/nas.0.0008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Thomas, Charles G. "Ethiopian Warriorhood: Defence, Land, & Society 1800–1941, by Tsehai Berhane-Selassie." Journal of African Military History 3, no. 2 (December 19, 2019): 155–57. http://dx.doi.org/10.1163/24680966-00302003.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

Nelson, Sioban. "Nursing Experts, Hygienic Modernity, and Nation Building: The Case of Nursing in Ethiopia in the Post-Colonial Era." Canadian Bulletin of Medical History 38, no. 1 (April 2021): 63–92. http://dx.doi.org/10.3138/cbmh.455-062020.

Full text

Abstract:

This is a tale in three parts. It begins with an exploration of the story of Princess Tsahai, daughter of Haile Selassie, and the highly successful British campaign led by suffragette E. Sylvia Pankhurst to bring British-style nursing and medicine to Ethiopia in the 1940s and 1950s. Second, it examines the role of foreign women, most notably Swedish missionary nurses, in building health services and nursing capacity in the country. Finally, it examines the way in which nursing brought together gendered notions of expertise and geopolitical pressures to redefine expectations for Ethiopian women as citizens of the new nation-state.

APA, Harvard, Vancouver, ISO, and other styles

21

Osborne, Myles. "“Mau Mau are Angels … Sent by Haile Selassie”: A Kenyan War in Jamaica." Comparative Studies in Society and History 62, no. 4 (September 29, 2020): 714–44. http://dx.doi.org/10.1017/s0010417520000262.

Full text

Abstract:

AbstractThis article traces the impact of Kenya's Mau Mau uprising in Jamaica during the 1950s. Jamaican responses to Mau Mau varied dramatically by class: for members of the middle and upper classes, Mau Mau represented the worst of potential visions for a route to black liberation. But for marginalized Jamaicans in poorer areas, and especially Rastafari, Mau Mau was inspirational and represented an alternative method for procuring genuine freedom and independence. For these people, Mau Mau epitomized a different strand of pan-Africanism that had most in common with the ideas of Marcus Garvey. It was most closely aligned with, and was the forerunner of, Walter Rodney, Stokely Carmichael, and Black Power in the Caribbean. Theirs was a more radical, violent, and black-focused vision that ran alongside and sometimes over more traditional views. Placing Mau Mau in the Jamaican context reveals these additional levels of intellectual thought that are invisible without its presence. It also forces us to rethink the ways we periodize pan-Africanism and consider how pan-African linkages operated in the absence of direct contact between different regions.

APA, Harvard, Vancouver, ISO, and other styles

22

Valero, Arnaldo E. "Reggae y ethos rastafari." ÍSTMICA. Revista de la Facultad de Filosofía y Letras 1, no. 28 (July 21, 2021): 125–40. http://dx.doi.org/10.15359/istmica.28.7.

Full text

Abstract:

El presente artículo busca señalar que cantantes como Bob Marley, Bunny Wailer y Peter Tosh han ejercido una especie de educación tribal que le ha permitido a la comunidad rastafari informarse de las pautas de comportamiento social y moral que han llegado a considerarse como emblemáticas de su sistema de valores. Para lograr nuestro propósito se citarán y glosarán un conjunto de canciones de ese género musical que a lo largo de décadas ha pregonado la naturaleza divina de Haile Selassie, la idea del regreso al África, la importancia histórica y política de Marcus Garvey, el carácter sacramental del consumo de la marihuana y el valor simbólico de los dreadlocks.

APA, Harvard, Vancouver, ISO, and other styles

23

Stepman, François. "King of Kings – The Thriumph and Tragedy of Emperor Haile Selassie I of Ethiopia." Afrika Focus 29, no. 2 (February 26, 2016): 122–23. http://dx.doi.org/10.1163/2031356x-02902011.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Marsai, Viktor. "Az utolsó császár Magyarországon – Hailé Szelasszié 1964-es látogatása." Afrika Tanulmányok / Hungarian Journal of African Studies 14, no. 3-4. (January 30, 2021): 29–46. http://dx.doi.org/10.15170/at.2020.14.3-4.2.

Full text

Abstract:

The visit of the Ethiopian emperor Haile Selassie on 20-23 September 1964 was one of the most important events of the Hungarian foreign relations that time. This article aims to examine the circumstances of the meeting and its effects on the Ethio-Hungarian relations. The main statement of the paper is that although the visit did not bring a breakthrough in the collaboration, it helped to strengthen and fill with content the fresh connection between the parties, and it also determined the main frameworks of cooperation for the next two and half decades. Furthermore, the negotiations bred important practical experiences for the Hungarian administration, which knowledge helped not only in the relations with the developing world, but also in the wider international arena.

APA, Harvard, Vancouver, ISO, and other styles

25

Kropp, Manfred. "Edward Ullendorff: From Emperor Haile Selassie to H. J. Polotsky. An Ethiopian and Semitic Miscellany." Aethiopica 1 (September 13, 2013): 234–35. http://dx.doi.org/10.15460/aethiopica.1.1.624.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Endale, Fiseha, and Degefa Tolossa. "Food Security Status of People with Disabilities in Selassie Kebele, Hawassa Town, Southern Ethiopia." Ethiopian Journal of the Social Sciences and Humanities 13, no. 1 (January 9, 2018): 105. http://dx.doi.org/10.4314/ejossah.v13i1.5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Marcus, Harold G. "The Politics of Famine." Worldview 28, no. 3 (March 1985): 20–21. http://dx.doi.org/10.1017/s0084255900046842.

Full text

Abstract:

In Addis Ababa's vast Revolution Square there are large pictures of Marx, Lenin, and Engels, and of Mengistu Haile Mariam, the head of the Provisional Military Government of Socialist Ethiopia and leader of the newly organized Workers Party of Ethiopia. In the decade since a military committee, the dirgue, dethroned Haile Selassie and abolished the monarchy, these four have been proclaimed the saviors of Ethiopia. Today, however, many Ethiopians believe the dirgue's policies are responsible for inciting the nationalities to insurrection, reducing agricultural yields in the south, helping to cause the famine in the northeast, tying Ethiopia to the capital-poor Soviet Union and its allies, and unnecessarily alienating the capital-rich West. In their opinion, the government has failed the. revolution by being repressive and rigid. Mengistu and the ideology he represent should give way to new and more flexible leaders and politics.

APA, Harvard, Vancouver, ISO, and other styles

28

Scott, Catherine V. "Socialism and the ‘Soft State’ in Africa: an Analysis of Angola and Mozambique." Journal of Modern African Studies 26, no. 1 (March 1988): 23–36. http://dx.doi.org/10.1017/s0022278x00010302.

Full text

Abstract:

The overthrow of Haile Selassie in Ethiopia in 1974, and the independence of Angola and Mozambique in 1975, as well as Zimbabwe in 1980, seem to have strengthened the case for classifying African régimes on the basis of their ideology.In a collection of mainly country-studies of socialism in sub-Saharan Africa edited by Carl Rosberg and Thomas Callaghy in 1978, various explanations were advanced about why the so-called ‘first wave’ of radicals failed to transform African societies successfully, and a common theme was the major rô played by ideology in differentiating ‘African’ from ‘scientific’ socialist régimes.1 In 1981 David and Marina Ottaway contrasted the ‘African socialism’ of Guinea, Zambia, and Tanzania with the ‘Afrocommunism’ of Angola, Mozambique, and Ethiopia, and contended that ideology was the best indicator of the clear differences that existed in both their institutions and policy choices.2 In 1982 Crawford Young placed African régimes in three ideological categories: ‘Populist socialist’, and ‘African capitalist’.3

APA, Harvard, Vancouver, ISO, and other styles

29

Alvaré, Bretton. "Haile Selassie and the Gospel of Development: Hegemony and Faith-Based Development in Trinidad and Tobago, West Indies." Journal of Latin American and Caribbean Anthropology 19, no. 1 (March 2014): 126–47. http://dx.doi.org/10.1111/jlca.12063.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Weis, Julianne. "Medicalization and Maternal Health: The Use of Female Health Auxiliaries to Modernize Ethiopia under Haile Selassie, 1930–1974." Journal of Women's History 29, no. 4 (2017): 61–84. http://dx.doi.org/10.1353/jowh.2017.0051.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Macklin, Graham. "‘No Power on Earth can Remove his Liability’: Emperor Haile Selassie and the Foreign Office, a Documentary Essay." Immigrants & Minorities 25, no. 1 (March 2007): 73–93. http://dx.doi.org/10.1080/02619280701630995.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Bustorf, Dirk. "Wolder-Selassie Abbute: Gumuz and Highland Resettlers. Differing Strategies of Livelihood and Ethnic Reaction in Metekel, Northwestern Ethiopia." Aethiopica 10 (June 22, 2012): 281–84. http://dx.doi.org/10.15460/aethiopica.10.1.223.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Coleman, Sterling Joseph. "Gradual Abolition or Immediate Abolition of Slavery? The Political, Social and Economic Quandary of Emperor Haile Selassie I." Slavery & Abolition 29, no. 1 (March 2008): 65–82. http://dx.doi.org/10.1080/01440390701841067.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Volpe, M. L. "Book Review: Nigusie Kassae V.M. (2016). Haile Selassie I - Emperor of Ethiopia. Moscow: RUDN University publ., 424 p. (in Russian)." Vestnik RUDN. International Relations 18, no. 4 (2018): 992–95. http://dx.doi.org/10.22363/2313-0660-2018-18-4-992-995.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Feyera Senbeta. "The Paradox of Ethiopia’s Underdevelopment: Endogenous Factors in Retrospect." PanAfrican Journal of Governance and Development (PJGD) 2, no. 1 (February 28, 2021): 3–30. http://dx.doi.org/10.46404/panjogov.v2i1.2907.

Full text

Abstract:

Ethiopia is a country of diverse historical, cultural, geographical, archeological, and ecological resources and is well known as the cradle of humanity. It is also the tenth-largest country in Africa and endowed with vast land and water resources. This country was unable to translate these potential resources into positive development outcomes. This paper examines the historical perspective of Ethiopia’s underdevelopment mystery under the last three regimes (i.e., Haile Selassie (Imperial), Derg, and the Ethiopian People’s Revolutionary Democratic Front (EPRDF)). Qualitative approaches mainly interview, discussion, document analysis, and personal experiences were employed in generating relevant data that were analyzed and presented thematically. The results show that Ethiopia ranked the least in many global human development indexes such as Human Development Index, Corruption Index, and Global Hunger Index in the last decade. The underlying historical development challenges include political instability, despotic leadership, corruption, dependence on foreign aid and assistance, controlled freedom of expression, lack of diversity within unity, and inconsistent development policies. Over the last three successive regimes, the state-society relationship has been characterized by conflict, disagreement, and supremacy of state which messed up available national development opportunities. If Ethiopia has to come out of poverty and underdevelopment, it needs to improve its political stability and governance. It must be governed by ‘popularly elected’ not by ‘self-elected leader’ and put in place a system of accountability for a better future and wellbeing of its population. Consistent and pro-poor policy, good working culture, and unity in diversity must be other areas of concern for future development.

APA, Harvard, Vancouver, ISO, and other styles

36

Zitelmann, Thomas. "Berhane‐Selassie, Tsehai. Ethiopian warriorhood: defence, land and society 1800‐1941. xxvi, 309 pp., maps, figs, illus., bibliogr. Rochester, N.Y.: James Currey, 2018. £60.00 (cloth)." Journal of the Royal Anthropological Institute 27, no. 2 (May 15, 2021): 424–25. http://dx.doi.org/10.1111/1467-9655.13517.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Dunkley, D. A. "The Suppression of Leonard Howell in Late Colonial Jamaica, 1932-1954." New West Indian Guide 87, no. 1-2 (2013): 62–93. http://dx.doi.org/10.1163/22134360-12340004.

Full text

Abstract:

Abstract This article is about Leonard Percival Howell, the man who is widely regarded as the founder of the Rastafari movement, which started in Jamaica in 1932. The article focuses on the attempts to suppress Howell during the foundational phase of the Rastafari movement from 1932 to 1954. This was the period in which Howell began preaching the divinity of Haile Selassie I, who was crowned the emperor of Ethiopia in 1930. In 1937, Howell established the friendly organization known as the Ethiopian Salvation Society, and in 1940 started the first Rastafari community in the hills of the parish of St. Catherine, Jamaica. These and his other religio-political activities made Howell the target of one of the longest and most aggressive campaigns to suppress an anticolonial activist during the late colonial period in Jamaica. However, one of the main points of this article is that the attempts to suppress Howell, who was seen by the colonial government as seditious, implicated not just the colonial regime, but also a number of other opponents within the society. This article is an attempt to show that Howell’s suppression was not exclusively a colonial endeavor, but a society-wide campaign to undermine his leadership in order to disband the Rastafari movement. Howell advocated an anticolonialism that was seen as too revolutionary by every participant in the campaign to suppress him and his movement, and particularly aggravating was the notion that a black monarch was the fulfillment of biblical prophecy, and whose ascension signaled the start of black nationalism as a global liberation movement to end white rule over Africans and people of African descent.

APA, Harvard, Vancouver, ISO, and other styles

38

Haruna, Abdallah Imam, and A. Abdul Salam. "Rethinking Russian Foreign Policy towards Africa: Prospects and Opportunities for Cooperation in New Geopolitical Realities." European Journal of Humanities and Social Sciences 1, no. 2 (April 30, 2021): 10–20. http://dx.doi.org/10.24018/ejsocial.2021.1.2.24.

Full text

Abstract:

Diplomatic ties between Africa and the Russian Federation dates back to Africa’s dark decades of collective struggle for continental decolonization and severance in relations with its European colonizers. There is a vestige of historical evidence to support the claim that Russia had contributed immensely to this struggle in the early 1950s. Historically, the Russian Revolution of 1917 set the stage for the strenuous global struggle against colonialism and imperialism. This revolution, subsequently, inspired leaders of the nationalist movements on the African continent like Kwame Nkrumah of Ghana, Nnamdi Azikiwe of Nigeria, Haile Selassie of Ethiopia, Nelson Mandela of South Africa and Kenneth Kaunda of Zambia, among others to champion the fight for the liberation of Africa. Between 1945 and 1991, international politics was in a hegemonic geopolitical tension between the Soviet Union and the United States and their respective global allies. This power struggle polarized the world into the contrasting ideologies of Capitalism and Socialism. Some African nationalists situated the crusade for self-rule within the Eastern Bloc led by the Soviet Union. The collapse of the USSR on 26 December 1991 and the fall of the Berlin wall on 9 November 1989 heralded a new era in global politics. This paper is on the assumption that three decades into the demise of the Soviet Union, it is now time to reflect on the influence of Russia in international politics, with particular focus on Moscow’s foreign policy towards Sub-Saharan Africa. This rethinking is crucial because of the criticism that Russia’s renewed interest in Africa is a grand strategy to dominate affairs of the continent, rather than a search for new opportunities for economic cooperation and geopolitical alliances.

APA, Harvard, Vancouver, ISO, and other styles

39

Cusack, Carole M. "The Romance of Hereditary Monarchs and Theocratic States: Ethiopia and Emperor Haile Selassie I in Rastafarianism and Tibet and the Fourteenth Dalai Lama, Tenzin Gyatso, in Western Buddhism." Alternative Spirituality and Religion Review 4, no. 1 (2013): 122–46. http://dx.doi.org/10.5840/asrr20134121.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Haile, Getatchew. "From Emperor Haile Selassie to H.J. Polotsky. An Ethiopian and Semitic miscellany. By Edward Ullendorff. (Äthiopistische Forschungen, Band 42.) pp. xix, 192, illus. Wiesbaden, Harrassowitz Verlag, 1995. DM 158." Journal of the Royal Asiatic Society 6, no. 3 (November 1996): 411–13. http://dx.doi.org/10.1017/s1356186300007811.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Negash, Girma. "The rise and rise of agricultural wage labour: evidence from Ethiopia's south, c.1950–2000." Africa 87, no. 1 (January 27, 2017): 36–52. http://dx.doi.org/10.1017/s0001972016000681.

Full text

Abstract:

AbstractThis article seeks to examine the dynamic transformation in the system of labour mobilization and the consequent intermingling of peoples of diverse cultural background in northern Sidama, Ethiopia. It investigates the different labour recruitment strategies deployed in the study area at different times, ranging from traditional to hired labour. In the former case, the household plays a major role in the recruitment and supply of agricultural labour, whereas in the latter case, ‘trans-locality’ reinforced by migration becomes central to the labour history of the region. In the 1940s and 1950s, Emperor Haile Selassie I granted large estates of land in the study area to absentee landowners who started schemes of commercial coffee farming. The subsequent expansion of commercialized coffee farming in a locality called Wondo Gänät (northern Sidama) from the 1950s onwards was responsible for the introduction of agricultural wage labour into the wider region. There was no local surplus labour to satisfy the labour needs of the new coffee farms. This void was later filled by Kembata, Hadiya and Wolayita migrant labourers who flocked into the study area from regions widely noted for their scarcity of arable land. This translocal movement of workers paved the way for the beginning of wage employment and eventually the commodification of farm labour in line with capitalist agriculture. Although commercial coffee plantations provided the initial stimulus for labour commodification in the study area, sugar cane-based cash cropping has helped it flourish even further. I argue in this article that the imperial land grants of the late 1940s and 1950s were an important milestone both for the agricultural history of the study area and for the organization of farm labour. Most importantly, I also argue that some of the social tensions and conflicts that often haunt contemporary northern Sidama are legacies inherited from the labour migrations of the 1950s and 1960s and the demographic heterogeneity that ensued.

APA, Harvard, Vancouver, ISO, and other styles

42

Bekele, Getnet. "ETHIOPIAN WARRIORHOOD - Ethiopian Warriorhood: Defence, Land & Society 1800–1941. By Tsehai Berhane-Selassie. Woodbridge, UK: James Currey, 2018. Pp. xxvi + 309. $99.00, hardcover (ISBN: 978-1-84701-191-6)." Journal of African History 61, no. 2 (July 2020): 303–4. http://dx.doi.org/10.1017/s0021853720000377.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Adem, Seifudein. "Bereket Habte Selassie. The Crown and the Pen: The Memoirs of a Lawyer Turned Rebel. Trenton, N.J., and Asmara, Eritrea: The Red Sea Press, 2007. 350 pp. Index. $29.95. Paper." African Studies Review 54, no. 1 (April 2011): 213–14. http://dx.doi.org/10.1353/arw.2011.0018.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

Vestal, Theodore M. "King of Kings: The Triumph and Tragedy of Emperor Haile Selassie of Ethiopia. By Asfa-Wossen Asserate. Translated by Peter Lewis. (London, United Kingdom: Haus Publishing, 2015. Pp. xiii, 374. $29.95.)." Historian 79, no. 2 (June 1, 2017): 325–27. http://dx.doi.org/10.1111/hisn.12507.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Dorman, Sara Rich. "Bereket Habte Selassie, The Making of the Eritrean Constitution: the dialectic of process and substance. Lawrenceville NJ: Red Sea Press (paperback US$24.95, ISBN 1 56902 161 9). 2003, 325 pp." Africa 74, no. 4 (November 2004): 703–4. http://dx.doi.org/10.3366/afr.2004.74.4.703.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

ADEM, SEIFUDEIN. "The Lion of Judah in the New World: Emperor Haile Selassie of Ethiopia and the shaping of Americans’ attitude toward Africa by T. Vestal Santa Barbara, CA: Praeger, 2011. Pp. 231, $44.95 (hbk)." Journal of Modern African Studies 50, no. 3 (September 2012): 541–42. http://dx.doi.org/10.1017/s0022278x12000286.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Semon, Hewan. "Berhane-Selassie, Tsehai: Ethiopian Warriorhood. Defence, Land and Society 1800–1941. Rochester: Boydell & Brewer 2018. XXVI, 309 S., 13 Abb. 8° = Eastern Africa Series. Hartbd. £ 60,00. ISBN 978-1-84701-191-6." Orientalistische Literaturzeitung 115, no. 6 (April 29, 2021): 494–96. http://dx.doi.org/10.1515/olzg-2020-0165.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Liu, H. Y., and J. L. Sears. "First Report of Pelargonium zonate spot virus from Tomato in the United States." Plant Disease 91, no. 5 (May 2007): 633. http://dx.doi.org/10.1094/pdis-91-5-0633b.

Full text

Abstract:

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

APA, Harvard, Vancouver, ISO, and other styles

49

KUNDRATA, ROBIN. "New species of Selasia Laporte, 1838 (Elateridae: Agrypninae: Drilini) from Nepal and Pakistan." Zootaxa 4344, no. 2 (November 7, 2017): 380. http://dx.doi.org/10.11646/zootaxa.4344.2.12.

Full text

Abstract:

The neotenic click-beetle genus Selasia Laporte, 1838 is distributed mainly in the tropical Africa, and only a few species are known from the Palaearctic and Oriental regions. Herein, I describe and figure two new Palaearctic species: Selasia nigrobrunnea sp. nov. from the western Nepal, and Selasia sabatinellii sp. nov. from Pakistan. Both species are compared with their Palaearctic congeners, and an updated identification key to Selasia species from the Palaearctic region is provided.

APA, Harvard, Vancouver, ISO, and other styles

50

Kundrata, Robin, and Eliska Sormova. "Selasia dembickyi sp. nov., the first member of Drilini (Coleoptera: Elateridae) from South East Asia, with the description of S. jenisi sp. nov. from Nepal." Acta Entomologica Musei Nationalis Pragae 58, no. 2 (October 1, 2018): 513–18. http://dx.doi.org/10.2478/aemnp-2018-0039.

Full text

Abstract:

Abstract We describe and figure two new Asian Selasia Laporte, 1838 species: S. dembickyi sp. nov. from northern Thailand, and S. jenisi sp. nov. from Nepal. Selasia dembickyi sp. nov. is the easternmost record for the tribe Drilini and the first species of this tribe known from South East Asia. An updated identification key to Selasia species from the Palaearctic Region is given, and a distribution map of Selasia from the southern part of Asia is provided.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Selassie'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles