Journal articles: 'Rottlerin'

1

Chen, Xu‐Ling, Yu Dong, and Ji‐Yu Wang. "The Practical Total Synthesis of Rottlerin and Rottlerone." ChemistrySelect 5, no. 29 (August 4, 2020): 9206–9. http://dx.doi.org/10.1002/slct.202002245.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Kim, Hyun Kyung, Eun Young Kang, and Gwang-woong Go. "Rottlerin, a Polyphenolic Compound, Alleviate Body Adiposity by Enhancing Lipolysis and Thermogenesis in Diet-Induced Obesity Mice." Current Developments in Nutrition 5, Supplement_2 (June 2021): 1222. http://dx.doi.org/10.1093/cdn/nzab055_032.

Full text

Abstract:

Abstract Objectives Rottlerin (mallotoxin) is a polyphenolic compound in Mallotus philippensis. The anti-tumor, anti-inflammation, and mitochondrial uncoupling regulation effects of rottlerin have been known. However, the anti-obesity effect was not reported yet. Thus, we hypothesized that rottlerin would suppress body fat accumulation in obesity-induced mice. Methods Five-week-old male C57BL/6 mice were fed a high-fat diet (HFD) (60% kcal from fat) ad libitum for 8 weeks. Mice were randomly assigned to five groups as follows: 1) normal diet (18% kcal from fat), 2) negative control (60% kcal from fat), 3) rottlerin 10 (HFD + rottlerin 10 mg/kg bw), 4) rottlerin 20 (HFD + 20 mg/kg bw), 5) positive control (HFD + metformin 150 mg/kg bw). Rottlerin was daily supplemented by oral gavage. Body weight and feed intake were measured each week. Results Body weight and weight gain were reduced in rottlerin 20 compared to the control (P < 0.001). Body fat mass was also significantly decreased by rottlerin (P < 0.05). Total feed intake and lean mass were similar among HFD groups. Furthermore, energy expenditure was dose-dependently facilitated by rottlerin. RNA-sequencing results supported these findings that rottlerin 20 up-regulated fatty acid beta-oxidation, heat generation, and brown cell differentiation in white-adipose tissues. Rottlerin promoted a catabolic pathway such as lipolysis, thermogenesis, and oxidation in white adipose tissues. Moreover, non-esterified fatty acid levels were decreased by rottlerin (P < 0.05), and hepatic triglyceride contents tended to decline in rottlerin 20 without hepatotoxicity. Non-shivering thermogenesis enzymes, PRDM16 (P = 0.06) and UCP1 (P < 0.01), were stimulated by rottlerin. Conclusions Rottlerin supplementation altered body adiposity accumulation via enhancing fat utilization, lipolysis, and thermogenesis in obese mice. We suggest that rottlerin is a potent nutraceutical for anti-obesity. Funding Sources This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Science and ICT; MSIT).

APA, Harvard, Vancouver, ISO, and other styles

3

Shivshankar, Pooja, Lei Lei, Jie Wang, and Guangming Zhong. "Rottlerin Inhibits Chlamydial Intracellular Growth and Blocks Chlamydial Acquisition of Sphingolipids from Host Cells." Applied and Environmental Microbiology 74, no. 4 (December 14, 2007): 1243–49. http://dx.doi.org/10.1128/aem.02151-07.

Full text

Abstract:

ABSTRACT We report that rottlerin, a plant-derived compound known to inhibit various mammalian kinases, profoundly inhibited chlamydial growth in cell culture with a minimal inhibition concentration of 1 μM. The inhibition was effective even when rottlerin was added as late as the middle stage of chlamydial infection cycle, against multiple Chlamydia species, and in different host cell lines. Pretreatment of host cells with rottlerin prior to infection also blocked chlamydial growth, suggesting that rottlerin targets host factors. Moreover, rottlerin did not alter the chlamydial infection rate and did not directly target chlamydial protein synthesis and secretion. The rottlerin-mediated inhibition of chlamydial replication and inclusion expansion correlated well with the rottlerin-induced blockade of host cell sphingolipid trafficking from the Golgi apparatus into chlamydial inclusions. These studies not only allowed us to identify a novel antimicrobial activity for rottlerin but also allowed us to uncover a potential mechanism for rottlerin inhibition of chlamydial growth.

APA, Harvard, Vancouver, ISO, and other styles

4

Kim, Ye Jin, and Gwang-woong !Go. "Rottlerin Suppresses Fat Accumulation by Inhibiting Adipogenesis and De Novo Lipogenesis in 3T3-L1 Adipocytes." Current Developments in Nutrition 5, Supplement_2 (June 2021): 1224. http://dx.doi.org/10.1093/cdn/nzab055_034.

Full text

Abstract:

Abstract Objectives Rottlerin is isolated from Mallotus japonicus, a rich-in polyphenol. Rottlerin is a PKC delta inhibitor known for an uncoupler of oxidative phosphorylation and anti-neoplastic agent. However, the effect of anti-obesity is not conclusive. This study hypothesized that rottlerin inhibits lipid accumulation in adipocytes. Methods 3T3-L1 cells were maintained with DMEM containing 10% BCS and 1% penicillin. The cells were seeded in a 6-well plate with a density of 8 × 104 followed by cultured for 4 days until reaching 120% confluency and incubated in a differentiation medium for 6 days. Rottlerin was incubated with differentiation media (0, 1, 2, and 4 µM). Cells were harvested after treatment for measurement of Oil Red O stating, immunoblotting, and RT-PCR. Results Differentiated 3T3-L1 adipocytes were stained using the Oil Red O, which stains triglycerides into the red. Lipid accumulation was significantly inhibited in 4 µM of rottlerin (P < 0.001). In protein levels, PPARγ, an adipogenesis marker, was reduced dose-dependently decreased (P < 0.001), indicating lipid droplet formation reduced. FAS and SCD1 were diminished by rottlerin treated groups (all P < 0.001). ACC-pS79/ACC was increased by rottlerin (P = 0.02). In mRNA gene expressions, C/EBPα was reduced by rottlerin in a dose-dependent manner (P < 0.001), and PPARγ tend to be decreased by rottlerin (P = 0.06). FAS and SREBP1 were inhibited by rottlerin (P < 0.01). SCD1 was dramatically reduced by rottlerin (P < 0.001). Conclusions We found that rottlerin reduces lipid accumulation by inhibiting adipogenesis in differentiated 3T3-L1 adipocytes. This suggests that rottlerin is a potential nutraceutical for treating dyslipidemia, non-alcoholic fatty liver disease, and obesity. Funding Sources This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Science and ICT; MSIT).

APA, Harvard, Vancouver, ISO, and other styles

5

Ohno, Izumi, Guido Eibl, Irina Odinokova, Mouad Edderkaoui, Robert D. Damoiseaux, Moussa Yazbec, Ravinder Abrol, et al. "Rottlerin stimulates apoptosis in pancreatic cancer cells through interactions with proteins of the Bcl-2 family." American Journal of Physiology-Gastrointestinal and Liver Physiology 298, no. 1 (January 2010): G63—G73. http://dx.doi.org/10.1152/ajpgi.00257.2009.

Full text

Abstract:

Rottlerin is a polyphenolic compound derived from Mallotus philipinensis . In the present study, we show that rottlerin decreased tumor size and stimulated apoptosis in an orthotopic model of pancreatic cancer with no effect on normal tissues in vivo. Rottlerin also induced apoptosis in pancreatic cancer (PaCa) cell lines by interacting with mitochondria and stimulating cytochrome c release. Immunoprecipitation results indicated that rottlerin disrupts complexes of prosurvival Bcl-xL with Bim and Puma. Furthermore, siRNA knockdown showed that Bim and Puma are necessary for rottlerin to stimulate apoptosis. We also showed that rottlerin and Bcl-2 and Bcl-xL inhibitor BH3I-2′ stimulate apoptosis through a common mechanism. They both directly interact with mitochondria, causing increased cytochrome c release and mitochondrial depolarization, and both decrease sequestration of BH3-only proteins by Bcl-xL. However, the effects of rottlerin and BH3I-2′ on the complex formation between Bcl-xL and BH3-only proteins are different. BH3I-2′ disrupts complexes of Bcl-xL with Bad but not with Bim or Puma, whereas rottlerin had no effect on the Bcl-xL interaction with Bad. Also BH3I-2′, but not rottlerin, required Bad to stimulate apoptosis. In conclusion, our results demonstrate that rottlerin has a potent proapoptotic and antitumor activity in pancreatic cancer, which is mediated by disrupting the interaction between prosurvival Bcl-2 proteins and proapoptotic BH3-only proteins. Thus rottlerin represents a promising novel agent for pancreatic cancer treatment.

APA, Harvard, Vancouver, ISO, and other styles

6

Maioli, Emanuela, Lucedio Greci, Karel Soucek, Martina Hyzdalova, Alessandra Pecorelli, Vittoria Fortino, and Giuseppe Valacchi. "Rottlerin Inhibits ROS Formation and Prevents NFκB Activation in MCF-7 and HT-29 Cells." Journal of Biomedicine and Biotechnology 2009 (2009): 1–7. http://dx.doi.org/10.1155/2009/742936.

Full text

Abstract:

Rottlerin, a polyphenol isolated from Mallotus Philippinensis, has been recently used as a selective inhibitor of PKCδ, although it can inhibit many kinases and has several biological effects. Among them, we recently found that Rottlerin inhibits the Nuclear FactorκB (NFκB), activated by either phorbol esters orH2O2. Because of the redox sensitivity of NFκB and on the basis of Rottlerin antioxidant property, we hypothesized that Rottlerin could prevent NFκB activation acting as a free radicals scavenger, as other natural polyphenols. The current study confirms the antioxidant property of Rottlerin against the 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) in vitro and against oxidative stress induced byH2O2and by menadione in culture cells. We also demonstrate that Rottlerin prevents TNFα-dependent NFκB activation in MCF-7 cells and in HT-29 cells transfected with the NFκB-driven plasmid pBIIX-LUC, suggesting that Rottlerin can inhibit NFκB via several pathways and in several cell types.

APA, Harvard, Vancouver, ISO, and other styles

7

Molina, Yessenia L., David García-Seisdedos, Bohdan Babiy, Milagros Lerma, Javier Martínez-Botas, María J. Casarejos, María T. Vallejo, et al. "Rottlerin Stimulates Exosome/Microvesicle Release Via the Increase of Ceramide Levels Mediated by Ampk in an In Vitro Model of Intracellular Lipid Accumulation." Biomedicines 10, no. 6 (June 3, 2022): 1316. http://dx.doi.org/10.3390/biomedicines10061316.

Full text

Abstract:

Exosomes/microvesicles originate from multivesicular bodies that allow the secretion of endolysosome components out of the cell. In the present work, we investigated the effects of rottlerin, a polyphenol, on exosome/microvesicle secretion in a model of intracellular lipid trafficking impairment, and elucidated the mechanism of action. In a model of lipid trafficking impairment in C6 glia cells, rottlerin increased ceramide levels, while decreasing hexosylceramide content. This was accompanied by increased exosome/microvesicle secretion, thereby reducing the concentration of lipids in the endolysosomal compartment. The reduction of hexosylceramide levels by rottlerin was attributed to the increase of β-glucosidase (glucosylceramidase) activity, and the effects of rottlerin were abrogated by β-glucosidase inhibitors such as isofagomine D-tartrate and AMP-deoxynojirimycin. Moreover, treatment with ML-266, a potent activator of the β-glucosidase enzyme, recapitulated the effects of rottlerin on the sphingolipid profile and exosome/microvesicle secretion. Finally, inhibition of AMPK (AMP-activated protein kinase) using compound C prevented both exosome/microvesicle secretion and the elimination of endolysosome lipids, which were promoted by rottlerin. The results showed that the decrease in intracellular lipid deposition induced by rottlerin was mediated by β-glucosidase activation and exosome/microvesicle release via the AMPK pathway. Rottlerin consumption could represent an additional health benefit in lysosomal deposition diseases.

APA, Harvard, Vancouver, ISO, and other styles

8

Mischitelli, Morena, Mohamed Jemaà, Mustafa Almasry, Caterina Faggio, and Florian Lang. "Stimulation of Suicidal Erythrocyte Death by Rottlerin." Cellular Physiology and Biochemistry 40, no. 3-4 (2016): 558–66. http://dx.doi.org/10.1159/000452569.

Full text

Abstract:

Background/Aims: The phytochemical polyphenol rottlerin is a potent activator of diverse Ca2+ -sensitive K+ channels. Those channels play a decisive role in the execution of eryptosis, the suicidal death of erythrocytes, which is characterized by cell shrinkage and cell membrane scrambling with phosphatidylserine translocation to the erythrocyte surface. Signaling involved in the stimulation of eryptosis includes increase of cytosolic Ca2+ activity ([Ca2+]i) and ceramide. The present study explored, whether rottlerin induces eryptosis and, if so, to test for the involvement of Ca2+ entry and ceramide. Methods: Flow cytometry was employed to estimate phosphatidylserine exposure at the cell surface from annexin-V-binding, cell volume from forward scatter, [Ca2+]i from Fluo3-fluorescence, and ceramide abundance utilizing specific antibodies. Hemolysis was quantified by determination of haemoglobin concentration in the supernatant. Results: A 48 hours exposure of human erythrocytes to rottlerin (1 - 5 µM) significantly increased the percentage of annexin-V-binding cells, an effect paralleled by significant decrease of forward scatter. Up to 5 µM rottlerin failed to significantly increase average Fluo3-fluorescence. Rottlerin (5 µM) did, however, significantly increase the ceramide abundance. Rottlerin (5 µM) further significantly increased hemolysis. The effect of rottlerin (5 µM) on annexin-V-binding was virtually abolished by removal of extracellular Ca2+. Conclusions: Rottlerin stimulates eryptosis with erythrocyte shrinkage and phospholipid scrambling of the erythrocyte cell membrane, an effect paralleled by and at least in part due to Ca2+ entry and ceramide.

APA, Harvard, Vancouver, ISO, and other styles

9

Matschke, Veronika, Ilaria Piccini, Janina Schubert, Eva Wrobel, Florian Lang, Johann Matschke, Elsie Amedonu, et al. "The Natural Plant Product Rottlerin Activates Kv7.1/KCNE1 Channels." Cellular Physiology and Biochemistry 40, no. 6 (2016): 1549–58. http://dx.doi.org/10.1159/000453205.

Full text

Abstract:

Background/Aims: Acquired as well as inherited channelopathies are disorders that are caused by altered ion channel function. A family of channels whose malfunction is associated with different channelopathies is the Kv7 K+ channel family; and restoration of normal Kv7 channel function by small molecule modulators is a promising approach for treatment of these often fatal diseases. Methods: Here, we show the modulation of Kv7 channels by the natural compound Rottlerin heterologously expressed in Xenopus laevis oocytes and on iPSC cardiomyocytes overexpressing Kv7.1 channels. Results: We show that currents carried by Kv7.1 (EC50 = 1.48 μM), Kv7.1/KCNE1 (EC50 = 4.9 μM), and Kv7.4 (EC50 = 0.148 μM) are strongly enhanced by the compound, whereas Kv7.2, Kv7.2/Kv7.3, and Kv7.5 are not sensitive to Rottlerin. Studies on Kv7.1/KCNE1 mutants and in silico modelling indicate that Rottlerin binds to the R-L3-activator site. Rottlerin mediated activation of Kv7.1/KCNE1 channels might be a promising approach in long QT syndrome. As a proof of concept, we show that Rottlerin shortens cardiac repolarisation in iPSC-derived cardiomyocytes expressing Kv7.1.Conclusion: Rottlerin or an optimized derivative holds a potential as QT interval correcting drug.

APA, Harvard, Vancouver, ISO, and other styles

10

Klinger, James R., Josh D. Murray, Brian Casserly, Diego F. Alvarez, Judy A. King, Steven S. An, Gaurav Choudhary, Akua N. Owusu-Sarfo, Rod Warburton, and Elizabeth O. Harrington. "Rottlerin causes pulmonary edema in vivo: a possible role for PKCδ." Journal of Applied Physiology 103, no. 6 (December 2007): 2084–94. http://dx.doi.org/10.1152/japplphysiol.00695.2007.

Full text

Abstract:

In the present study, we assessed the effects of chemical inhibitors shown to be selective for protein kinase C (PKC) isoforms on lung barrier function both in vitro and in vivo. Rottlerin, a purported inhibitor of PKCδ, but not other chemical inhibitors, dose dependently promoted barrier dysfunction in lung endothelial cells in vitro. This barrier dysfunction correlated with structural changes in focal adhesions and stress fibers, which were consistent with functional changes in cell stiffness. To determine whether the effects noted in vitro correlated with changes in intact lungs, we tested the effects of rottlerin in the formation of pulmonary edema in rats using both ex vivo and in vivo models. Isolated, perfused lungs demonstrated a significant increase in filtration coefficients on exposure to rottlerin, compared with vehicle-treated lungs, an effect that correlated with increased extravasation of Evan's blue dye (EBD)-conjugated albumin. Additionally, compared with vehicle, the ratio of the wet lung weights to dry lung weights was significantly greater on exposure of animals to rottlerin; rottlerin also produced a dose-dependent increase in EBD extravasation into the lungs. These effects on lung edema occurred without any increase in right ventricular pressures. Microscopic assessment of edema in the ex vivo lungs demonstrated perivascular cuffing, with no evidence of septal capillary leak, in rottlerin-exposed lungs. Taken together, rottlerin increases barrier dysfunction in pulmonary endothelial cell monolayers and causes pulmonary edema in rats; results suggestive of an important role for PKCδ in maintaining lung endothelial barrier function.

APA, Harvard, Vancouver, ISO, and other styles

11

Hong, Kenneth K. C., Graham E. Ball, David StC Black, and Naresh Kumar. "The Mosaic of Rottlerin." Journal of Organic Chemistry 80, no. 21 (October 14, 2015): 10668–74. http://dx.doi.org/10.1021/acs.joc.5b01827.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

Brown, Jared M., Corbin M. Schwanke, Mark A. Pershouse, Jean C. Pfau, and Andrij Holian. "Effects of rottlerin on silica-exacerbated systemic autoimmune disease in New Zealand mixed mice." American Journal of Physiology-Lung Cellular and Molecular Physiology 289, no. 6 (December 2005): L990—L998. http://dx.doi.org/10.1152/ajplung.00078.2005.

Full text

Abstract:

Environmental crystalline silica exposure has been associated with formation of autoantibodies and development of systemic autoimmune disease, but the mechanisms leading to these events are unknown. Silica exposure in autoimmune-prone New Zealand mixed (NZM) mice results in a significant exacerbation of systemic autoimmunity as measured by increases in autoantibodies and glomerulonephritis. Previous studies have suggested that silica-induced apoptosis of alveolar macrophages (AM) contributes to the generation of the autoantibodies and disease. Rottlerin has been reported to inhibit apoptosis in many cell types, possibly through direct or indirect effects on PKCδ. In this study, rottlerin reduced silica-induced apoptosis in bone marrow-derived macrophages as measured by DNA fragmentation. In NZM mice, RNA and protein levels of PKCδ were significantly elevated in AM 14 wk after silica exposure. Therefore, rottlerin was used to reduce apoptosis of AM and evaluate the progress of silica-exacerbated systemic autoimmune disease. Fourteen weeks after silica exposure, NZM mice had increased levels of anti-histone autoantibodies, high proteinuria, and glomerulonephritis. However, silica-instilled mice that also received weekly instillations of rottlerin had significantly lower levels of proteinuria, anti-histone autoantibodies, complement C3, and IgG deposition within the kidney. Weekly instillations of rottlerin in silica-instilled NZM mice also inhibited the upregulation of PKCδ in AM. Together, these data demonstrate that in vivo treatment with rottlerin significantly decreased the exacerbation of autoimmunity by silica exposure.

APA, Harvard, Vancouver, ISO, and other styles

13

Cordeiro, Brenda, Dmitry Terentyev, and Richard T. Clements. "BKCa channel activation increases cardiac contractile recovery following hypothermic ischemia/reperfusion." American Journal of Physiology-Heart and Circulatory Physiology 309, no. 4 (August 15, 2015): H625—H633. http://dx.doi.org/10.1152/ajpheart.00818.2014.

Full text

Abstract:

Mitochondrial Ca2+-activated large-conductance K+ (BKCa) channels are thought to provide protection during ischemic insults in the heart. Rottlerin (mallotoxin) has been implicated as a potent BKCa activator. The purpose of this study was twofold: 1) to investigate the efficacy of BKCa channel activation as a cardioprotective strategy during ischemic cardioplegic arrest and reperfusion (CP/R) and 2) to assess the specificity of rottlerin for BKCa channels. Wild-type (WT) and BKCa knockout (KO) mice were subjected to an isolated heart model of ischemic CP/R. A mechanism of rottlerin-induced cardioprotection was also investigated using H9c2 cells subjected to in vitro CP/reoxygenation and assessed for mitochondrial membrane potential and reactive oxygen species (ROS) production. CP/R decreased left ventricular developed pressure, positive and negative first derivatives of left ventricular pressure, and coronary flow (CF) in WT mice. Rottlerin dose dependently increased the recovery of left ventricular function and CF to near baseline levels. BKCa KO hearts treated with or without 500 nM rottlerin were similar to WT CP hearts. H9c2 cells subjected to in vitro CP/R displayed reduced mitochondrial membrane potential and increased ROS generation, both of which were significantly normalized by rottlerin. We conclude that activation of BKCa channels rescues ischemic damage associated with CP/R, likely via effects on improved mitochondrial membrane potential and reduced ROS generation.

APA, Harvard, Vancouver, ISO, and other styles

14

Zhao, Hongyu, Wei Tian, and David M. Cohen. "Rottlerin inhibits tonicity-dependent expression and action of TonEBP in a PKCδ-independent fashion." American Journal of Physiology-Renal Physiology 282, no. 4 (April 1, 2002): F710—F717. http://dx.doi.org/10.1152/ajprenal.00303.2001.

Full text

Abstract:

Novel protein kinase C (PKC) isoforms PKCδ and PKCε have recently been implicated in signaling by hypertonic stress. We investigated the role of the putative PKCδ inhibitor rottlerin on tonicity-dependent gene regulation. In the renal medullary mIMCD3 cell line, rottlerin blocked tonicity-dependent transcription of a tonicity enhancer (TonE)-driven luciferase reporter gene, as well as tonicity-dependent transcription of the physiological tonicity effector gene aldose reductase, but not urea-dependent transcription. Consistent with these data, rottlerin inhibited tonicity-dependent expression of TonE binding protein (TonEBP) at the mRNA and protein levels. Another inhibitor of both novel and conventional PKC isoforms, GF-109203X, suppressed TonEBP-dependent transcription but failed to influence tonicity-inducible TonEBP expression. Global PKC downregulation with protracted phorbol ester treatment, however, failed to influence tonicity-dependent signaling, arguing against a PKCδ-dependent mechanism of rottlerin action in this model. In addition, hypertonic stress failed to induce phosphorylation of PKCδ. Furthermore, in a PC-12 cell model with a comparable degree of tonicity-dependent transcription, constitutive overexpression of dominant negative-acting PKCδ or PKCε effectively decreased tonicity signaling to extracellular signal-regulated kinase activation, as expected, but failed to influence TonE-dependent transcription. TonE-dependent transcription, however, remained rottlerin sensitive in this PC-12 cell model. In the aggregate, these data indicate that rottlerin dramatically inhibits tonicity-dependent TonEBP expression and TonE-dependent transcription but, despite its reputed mode of action, does so through a PKCδ-independent pathway.

APA, Harvard, Vancouver, ISO, and other styles

15

Mody, Vandana D., Sivadasan Mangalan, Kalpesh K. Pandya, Ramanbhai B. Patel, and Balakrishna K. Chakravarthy. "Absorption of Herbinol—A Polyherbal Topical Cream." Journal of Pharmacy Technology 10, no. 2 (March 1994): 71–74. http://dx.doi.org/10.1177/875512259401000207.

Full text

Abstract:

Objective: To determine serum absorption concentrations of two bioactive chemical markers (munjistin and rottlerin) of Herbinol, a topical polyherbal antiseptic cream. Design: Topical application of Herbinol cream on the back of albino rats on hair-free skin. Study: Serum concentrations of munjistin and rottlerin were estimated after application of Herbinol on the backs of the rats at 0,1, 2,3,4, and 24 hours and concentrations were quantified by high-performance-thin-layer chromatography. The validity of the procedure was verified by recovery studies by adding a known concentration of standards to drug-free serum. Results: Peak serum concentrations of both munjistin and rottlerin were observed two hours after topical application of Herbinol and the concentrations measured were 122 ± 5.8 ng/mL of rottlerin and 38 ± 3.2 ng/mL of munjistin. At these concentrations both compounds showed antimicrobial effects. Conclusions: The absorption studies performed with the topical antiseptic polyherbal cream Herbinol showed quantifiable serum concentrations of rottlerin and munjistin two hours after application. Both the markers showed antimicrobial efficacy at the measured concentrations and thus have clinical significance. This is a preliminary report on absorption studies of a polyherbal drug.

APA, Harvard, Vancouver, ISO, and other styles

16

Ringshausen, Ingo, Kathrin Weick, Madlene Oelsner, Christian Peschel, and Thomas Decker. "Inhibition of Protein Kinase C (PKC) delta with Rottlerin Induces Apoptosis in B-CLL Cells, Augments Chemotherapeutic Cytotoxicity and Inhibits Antiapoptotic Survival Signals." Blood 104, no. 11 (November 16, 2004): 2800. http://dx.doi.org/10.1182/blood.v104.11.2800.2800.

Full text

Abstract:

Abstract Purpose: We have previously shown that PKC delta is constitutively activated in B-CLL cells. In the present study, we have analyzed the mechanism of apotosis induction as well as the effets of PKC delta in the presence of survival signal and chemotherapeutic agents. Methods: The mitochondrial membrane potential, presence of active caspase 3, conformational status of Bax and apoptosis assays (Annexin V stain, Tunel assay) were performed using flow cytometric analysis. Expression of BCL-2 family proteins and XIAP as well as processing of caspase 8 and 9 was revealed in western blot experiments. Results: Rottlerin at 5μM (which is not toxic for normal lymphocytes) induced apoptosis in a large amount of B-CLL samples. Rottlerin was equally effective in zap70 positive- and negative samples. Rottlerin induced apoptosis was in part caspase dependent and involved processing of caspase 3, 8 and 9. Expression of antiapoptotic proteins MCL-1 and XIAP was reduced in Rottlerin treated cells and BAX expression increased and Bax conformation changed to its proapoptotic form.IN contrast, expression of bcl-2 was not changed. B-CL cells are likely to receive survival signals from the microenvironment and might be rescued from cell death induced by chemotherapeutic agents. Rottlerin was very effective in inhibiting survival signals like IL-4 or stromal cell contact. In addition, treatment with Rottlerin enhanced the cytotoxicity of the chemotherapeutic agents Fludarabine, Vncristine and Daunorubicine. Conclusion: Inhibition of PKC delta might be a powerful treatment option for B-CLL given its potential to induce apoptosis, inhibit antiapoptotic survival signals and augment the cytotoxicity of chemotherapeutic agents.

APA, Harvard, Vancouver, ISO, and other styles

17

Daveri, Elena, Giuseppe Valacchi, Roberta Romagnoli, Emilia Maellaro, and Emanuela Maioli. "Antiproliferative Effect of Rottlerin on Sk-Mel-28 Melanoma Cells." Evidence-Based Complementary and Alternative Medicine 2015 (2015): 1–9. http://dx.doi.org/10.1155/2015/545838.

Full text

Abstract:

Melanoma is the most aggressive and chemoresistant form of skin cancer. Mutated, constitutively active B-RAF is believed to play a crucial role, although the selective B-RAF inhibition has shown poor clinical success, since phenomena of resistance usually occur, likely arising from additional genetic aberrations, such as loss of function of p53 and PTEN, overexpression of cyclin D1, hyperactivation of NF-κB, and downregulation of p21/Cip1. Since all of them are present in the Sk-Mel-28 melanoma cells, this cell line could be an ideal, albeit hard to study, model to develop new therapeutic strategies. In the current study, we tested the cytostatic action of Rottlerin on Sk-Mel-28 melanoma cells, on the basis of the known Rottlerin effects on the main proliferative signaling pathways. We presented evidence that the drug inhibits cell growth by an Akt- and p21/Cip1-independent mechanism, involving the dual inhibition of ERK and NF-κB and downregulation of cyclin D1. In addition, we found that Rottlerin increases ERK phosphorylation, but, surprisingly, this resulted in decreased ERK activity. Pull-down experiments, using Rottlerin-CNBr-conjugated Sepharose beads, revealed that Rottlerin binds to ERK, independently from its phosphorylation status. This direct interaction could in part explain the paradoxical blockage of ERK downstream signaling and growth arrest.

APA, Harvard, Vancouver, ISO, and other styles

18

Suresh, Dittu, Shekh Sabir, Tsz Tin Yu, Daniel Wenholz, Theerthankar Das, David StC Black, and Naresh Kumar. "Natural Product Rottlerin Derivatives Targeting Quorum Sensing." Molecules 26, no. 12 (June 19, 2021): 3745. http://dx.doi.org/10.3390/molecules26123745.

Full text

Abstract:

Rottlerin is a natural product consisting of chalcone and flavonoid scaffolds, both of which have previously shown quorum sensing (QS) inhibition in various bacteria. Therefore, the unique rottlerin scaffold highlights great potential in inhibiting the QS system of Pseudomonas aeruginosa. Rottlerin analogues were synthesised by modifications at its chalcone- and methylene-bridged acetophenone moieties. The synthesis of analogues was achieved using an established five-step synthetic strategy for chalcone derivatives and utilising the Mannich reaction at C6 of the chromene to construct morpholine analogues. Several pyranochromene chalcone derivatives were also generated using aldol conditions. All the synthetic rottlerin derivatives were screened for QS inhibition and growth inhibition against the related LasR QS system. The pyranochromene chalcone structures displayed high QS inhibitory activity with the most potent compounds, 8b and 8d, achieving QS inhibition of 49.4% and 40.6% and no effect on bacterial growth inhibition at 31 µM, respectively. Both compounds also displayed moderate biofilm inhibitory activity and reduced the production of pyocyanin.

APA, Harvard, Vancouver, ISO, and other styles

19

You, Bang-Jau, Yang-Chang Wu, Bo-Ying Bao, Chi-Yu Wu, Ya-Win Yang, Yu-Hao Chang, and Hong-Zin Lee. "Rottlerin InhibitsLonicera japonica-Induced Photokilling in Human Lung Cancer Cells through Cytoskeleton-Related Signaling Cascade." Evidence-Based Complementary and Alternative Medicine 2011 (2011): 1–9. http://dx.doi.org/10.1155/2011/193842.

Full text

Abstract:

This study demonstrated that many apoptotic signaling pathways, such as Rho family, PKC family, MAP kinase family, and mitochondria-mediated apoptotic pathway, were triggered byLonicera japonicaextracts and irradiation in CH27 cells. Rottlerin, a PKCδ-selective inhibitor, reversed the photoactivatedLonicera japonicaextract-induced decrease in PKCδprotein expression and change in cell morphology in this study. In addition, rottlerin inhibited the photoactivatedLonicera japonica-induced decrease in protein expression of Ras, ERK, p38, PKCα, and PKCε, which are the kinases of prosurvival signaling pathway. We also demonstrated that pretreatment with rottlerin prevented actin microfilaments and microtubules from damage during the photoactivatedLonicera japonica-induced CH27 cell death. Furthermore, the promotion of the cytoskeleton-related signaling cascade following rottlerin by upregulation of cytoskeleton-related mediators (p38, HSP27, FAK, paxillin, and tubulin) and molecules of downstream of F-actin (mitochondria-mediated apoptosis pathway) reduces CH27 cell death, indicating that cytoskeleton is the potential target in the photoactivatedLonicera japonicaextract-induced photokilling of CH27 cells.

APA, Harvard, Vancouver, ISO, and other styles

20

Maioli, E., E. Daveri, E. Maellaro, F. Ietta, L. Cresti, and G. Valacchi. "Non-conventional rottlerin anticancer properties." Archives of Biochemistry and Biophysics 645 (May 2018): 50–53. http://dx.doi.org/10.1016/j.abb.2018.03.009.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Maioli, E., C. Torricelli, and G. Valacchi. "Rottlerin and Cancer: Novel Evidence and Mechanisms." Scientific World Journal 2012 (2012): 1–11. http://dx.doi.org/10.1100/2012/350826.

Full text

Abstract:

Because cancers are caused by deregulation of hundreds of genes, an ideal anticancer agent should target multiple gene products or signaling pathways simultaneously. Recently, extensive research has addressed the chemotherapeutic potential of plant-derived compounds. Among the ever-increasing list of naturally occurring anticancer agents, Rottlerin appears to have great potentiality for being used in chemotherapy because it affects several cell machineries involved in survival, apoptosis, autophagy, and invasion. The underlying mechanisms that have been described are diverse, and the final, cell-specific, Rottlerin outcome appears to result from a combination of signaling pathways at multiple levels. This paper seeks to summarize the multifocal signal modulatory properties of Rottlerin, which merit to be further exploited for successful prevention and treatment of cancer.

APA, Harvard, Vancouver, ISO, and other styles

22

Uecker, Marina, Rafaela da Silva, Thomas Grampp, Thomas Pasch, Marcus C. Schaub, and Michael Zaugg. "Translocation of Protein Kinase C Isoforms to Subcellular Targets in Ischemic and Anesthetic Preconditioning." Anesthesiology 99, no. 1 (July 1, 2003): 138–47. http://dx.doi.org/10.1097/00000542-200307000-00023.

Full text

Abstract:

Background Translocation of protein kinase C (PKC) to subcellular targets is a pivotal signaling step in ischemic preconditioning (IPC). However, to date, it is unknown whether PKC isoforms translocate in anesthetic preconditioning (APC). Methods The PKC blockers chelerythrine and rottlerin and the adenosine triphosphate-dependent potassium (K(ATP)) channel blockers HMR-1098 and 5-hydroxydecanoate were used to assess the role of PKC and K(ATP) channels in isolated perfused rat hearts subjected to IPC or APC (1.5 minimum alveolar concentration isoflurane) followed by 40 min of ischemia and 30 min of reperfusion. Immunohistochemical techniques were used to visualize PKC translocation after preconditioning. In addition, the phosphorylation status of PKC isoforms was assessed. Results Chelerythrine, rottlerin, and 5-hydroxydecanoate blocked IPC and APC with respect to functional recovery, albeit IPC at higher concentrations. HMR-1098 did not affect IPC or APC. PKCdelta and PKCepsilon translocated to nuclei in both IPC and APC, which was inhibited by chelerythrine and rottlerin. PKCdelta translocated to mitochondria but not to the sarcolemma, and PKCepsilon translocated to the sarcolemma and intercalated disks but not to mitochondria. Interestingly, PKCepsilon was accumulated at the intercalated disks in control and preconditioned hearts. Phosphorylation of PKCdelta on serine643 was increased in IPC and APC and blocked by chelerythrine and rottlerin, whereas phosphorylation of PKCdelta on threonine505 was increased only in IPC and not blocked by chelerythrine or rottlerin. PKCepsilon on serine729 did not change its phosphorylation status. Conclusions This study indicates that translocation of PKCdelta plays a pivotal role in IPC and APC and suggests that phosphorylation of PKCdelta on serine643 may be of particular relevance in transferring the APC stimulus to mitochondrial K(ATP) channels.

APA, Harvard, Vancouver, ISO, and other styles

23

Torricelli, Claudia, Sara Salvadori, Giuseppe Valacchi, Karel Souček, Eva Slabáková, Michela Muscettola, Nila Volpi, and Emanuela Maioli. "Alternative Pathways of Cancer Cell Death by Rottlerin: Apoptosis versus Autophagy." Evidence-Based Complementary and Alternative Medicine 2012 (2012): 1–11. http://dx.doi.org/10.1155/2012/980658.

Full text

Abstract:

Since the ability of cancer cells to evade apoptosis often limits the efficacy of radiotherapy and chemotherapy, autophagy is emerging as an alternative target to promote cell death. Therefore, we wondered whether Rottlerin, a natural polyphenolic compound with antiproliferative effects in several cell types, can induce cell death in MCF-7 breast cancer cells. The MCF-7 cell line is a good model of chemo/radio resistance, being both apoptosis and autophagy resistant, due to deletion of caspase 3 gene, high expression of the antiapoptotic protein Bcl-2, and low expression of the autophagic Beclin-1 protein. The contribution of autophagy and apoptosis to the cytotoxic effects of Rottlerin was examined by light, fluorescence, and electron microscopic examination and by western blotting analysis of apoptotic and autophagic markers. By comparing caspases-3-deficient (MCF-73def) and caspases-3-transfected MCF-7 cells (MCF-73trans), we found that Rottlerin induced a noncanonical, Bcl-2-, Beclin 1-, Akt-, and ERK-independent autophagic death in the former- and the caspases-mediated apoptosis in the latter, in not starved conditions and in the absence of any other treatment. These findings suggest that Rottlerin could be cytotoxic for different cancer cell types, both apoptosis competent and apoptosis resistant.

APA, Harvard, Vancouver, ISO, and other styles

24

Bahlis, Nizar J., Maya Starovic, Koen Raedschelders, Kathy Gratton, Oliver Bathe, and Andrew Belch. "PKC δ Inhibition Restores PTEN Activity in Myeloma Cells and Prolongs Survival of GFP+ Myeloma SCID/NOD Mice In Vivo." Blood 106, no. 11 (November 16, 2005): 113. http://dx.doi.org/10.1182/blood.v106.11.113.113.

Full text

Abstract:

Abstract PTEN, a cellular phosphatase involved in the regulation of phosphatidylinositol phosphates (PIPs), is often inactivated in myeloma cells either through gene mutation or via phosphorylation of serine and threonine residues in the PTEN C-terminal domain that also results in loss of its activity and stability. The loss of PTEN function results in a failure to de-phosphorylate PIPs with a corresponding increase in Akt kinase activity. We have recently reported that PKCδ inhibition with Rottlerin (3 μM) induces cell death in sensitive and resistant myeloma cell lines (MM1S, MM1R, 8226S and U266) (Blood2002,100,11,393a). In addition Rottlerin blocked constitutive as well as IGF-1 induced phosphorylation of Akt abrogating its kinase activity and suppresses the phosphorylation of FKHR, GSK 3α/β and Bad, downstream substrates of Akt, triggerring activation of the intrinsic apoptotic pathway with loss of the mitochondrial membrane potential (Δψ) and cleavage of caspases 9, 3 and PARP. PKCδ inhibition also suppressed, upstream of Akt, ser 241-PDK1 phosphorylation by PIPs. These findings led us to investigate the PTEN status in human myeloma cell lines (MM1S, 8226S and U266). While normal PTEN expression was detected in these cell lines, PTEN was universally phosphorylated on ser 380 in its C-terminal domain, resulting in loss of its activity. Rottlerin completely suppressed the phosphorylation of this serine residue, restoring PTEN function and dephosphorylating PIPs. In order to verify that Rottlerin exhibited its effects by inhibiting PKCδ, we first stably overexpressed PKCδ in the 8226S cells. PKCδ overexpression partially protected these cells against rotttlerin cytotoxicity and abrogated rottlerin induced AKT inhibition and PTEN activation. Furthermore transfection of 8226S cells with a mammalian PKCδ siRNA expression plasmid (sense strand of shRNA: 5′_AAGAACGCTTCAACATCGACATTCAAGATGCGATGTTGAAGCGTTCTTTTTTTG_3′expression plasmid) reduced PKCδ expression by nearly 90% and more importantly it reduced PTEN, Akt and GSK 3α/β phosphorylation. Finally, we examined the effect of Rottlerin on the viability of GFP+ myeloma SCID/NOD mice in vivo. 4 to 6 weeks old SCID/NOD mice were irradiated (300 rads) and 24 h later received tail vein injections of 5 x 106 RPMI-8226/S-GFP+ cells. Treatment with Rottlerin (3mg/kg ip) every other day was effective in slowing tumor growth as monitored by whole-body real-time fluorescence imaging and prolonged median survival of GFP+ myeloma SCID/NOD mice compared to a non-treated control cohort. In summary, our work provides evidence that PKCδ inhibition restores PTEN function in wild type PTEN expressing myeloma cells and is a valid biological target for the treatment of multiple myeloma.

APA, Harvard, Vancouver, ISO, and other styles

25

Qomaladewi, Nurinanda Prisky, Mi-Yeon Kim, and Jae Youl Cho. "Rottlerin Reduces cAMP/CREB-Mediated Melanogenesis via Regulation of Autophagy." International Journal of Molecular Sciences 20, no. 9 (April 27, 2019): 2081. http://dx.doi.org/10.3390/ijms20092081.

Full text

Abstract:

Melanogenesis is the sequential process of melanin production by melanocytes in order to protect the skin from harmful stimuli. Melanogenesis is disrupted by radiation exposure, which results in the differentiation of melanocytes into melanoma. Recently, some methods have been developed to maintain the instability of melanogenesis in melanoma by activating cellular autophagy. However, there is still a lack of knowledge about how autophagy is involved in the regulation of melanogenesis in melanoma cells. Here, we used rottlerin as an autophagy inducer to investigate the role of the cyclic adenosine monophosphate (cAMP)/cAMP response element binding (CREB) signaling pathway in melanogenesis. We found that rottlerin can inhibit melanin production by targeting cAMP, which is initially activated by alpha-melanocyte stimulating hormone (α-MSH). Our findings suggest that rottlerin has a pivotal role as an autophagy inducer in the regulation of melanogenesis by targeting the cAMP/CREB signaling pathway.

APA, Harvard, Vancouver, ISO, and other styles

26

Hong, Kenneth K. C., Kitty K. K. Ho, Mohan Bhadbhade, Graham E. Ball, David StC Black, and Naresh Kumar. "The Mosaic of Rottlerin: The Sequel." Journal of Natural Products 82, no. 5 (April 24, 2019): 1190–99. http://dx.doi.org/10.1021/acs.jnatprod.8b00917.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Valacchi, Giuseppe, Alessandra Pecorelli, Claudia Sticozzi, Claudia Torricelli, Michela Muscettola, Carlo Aldinucci, and Emanuela Maioli. "Rottlerin Exhibits Antiangiogenic Effects In vitro." Chemical Biology & Drug Design 77, no. 6 (May 4, 2011): 460–70. http://dx.doi.org/10.1111/j.1747-0285.2011.01121.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Maioli, Emanuela, Claudia Torricelli, and Giuseppe Valacchi. "Rottlerin and curcumin: a comparative analysis." Annals of the New York Academy of Sciences 1259, no. 1 (July 2012): 65–76. http://dx.doi.org/10.1111/j.1749-6632.2012.06514.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

29

Springael, Cécile, Séverine Thomas, Souad Rahmouni, Arnaud Vandamme, Michel Goldman, Fabienne Willems, and Olivier Vosters. "Rottlerin inhibits human T cell responses." Biochemical Pharmacology 73, no. 4 (February 2007): 515–25. http://dx.doi.org/10.1016/j.bcp.2006.10.034.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Gschwendt, M., H. J. Muller, K. Kielbassa, R. Zang, W. Kittstein, G. Rincke, and F. Marks. "Rottlerin, a Novel Protein Kinase Inhibitor." Biochemical and Biophysical Research Communications 199, no. 1 (February 1994): 93–98. http://dx.doi.org/10.1006/bbrc.1994.1199.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Guo, Benchang, Derek Blair, Thomas Chiles, Clifford Lowell, and Thomas Rothstein. "B Cell Receptor Crosstalk: The IL-4-induced Alternate Pathway for BCR Signaling Operates in Parallel with the Classical Pathway, Is Sensitive to Rottlerin, and Depends on Lyn (86.14)." Journal of Immunology 178, no. 1_Supplement (April 1, 2007): S126. http://dx.doi.org/10.4049/jimmunol.178.supp.86.14.

Full text

Abstract:

Abstract B cell exposure to IL-4 alters subsequent B cell receptor signaling such that ERK phosphorylation becomes signalosome-independent; however, the nature of this new, alternate signaling pathway and its relationship to the classical, signalosome-dependent signaling pathway, are not known. Here we report that the alternate and classical pathways for BCR signaling are differentially affected by rottlerin, and by Go6976 or LY294002, respectively. Further, in B cells lacking PKCâ, the classical pathway for BCR signaling is blocked, whereas the alternate pathway is little affected. Conversely, in B cells lacking Lyn, the alternate pathway for BCR signaling is blocked, whereas the classical pathway is little affected. The rottlerin-sensitive element is not PKCä, inasmuch as the alternate pathway as not blocked in PKCä-deficient B cells. These results indicate that the rottlerin-sensitive, Lyn-dependent alternate pathway, and the classical pathway, for BCR signaling operate in parallel when BCR engagement follows IL-4 exposure.

APA, Harvard, Vancouver, ISO, and other styles

32

De Witt, Bracken J., Alan D. Kaye, Ikhlass N. Ibrahim, Trinity J. Bivalacqua, Fiona M. D'Souza, Ronald E. Banister, A. Salam Arif, and Bobby D. Nossaman. "Effects of PKC isozyme inhibitors on constrictor responses in the feline pulmonary vascular bed." American Journal of Physiology-Lung Cellular and Molecular Physiology 280, no. 1 (January 1, 2001): L50—L57. http://dx.doi.org/10.1152/ajplung.2001.280.1.l50.

Full text

Abstract:

The effects of Gö-6976, a Ca2+-dependent protein kinase C (PKC) isozyme inhibitor, and rottlerin, a PKC-δ isozyme/calmodulin (CaM)-dependent kinase III inhibitor, on responses to vasopressor agents were investigated in the feline pulmonary vascular bed. Injections of angiotensin II, norepinephrine (NE), serotonin, BAY K 8644, and U-46619 into the lobar arterial constant blood flow perfusion circuit caused increases in pressure. Gö-6976 reduced responses to angiotensin II; however, it did not alter responses to serotonin, NE, or U-46619, whereas Gö-6976 enhanced BAY K 8644 responses. Rottlerin reduced responses to angiotensin II and NE, did not alter responses to serotonin or U-46619, and enhanced responses to BAY K 8644. Immunohistochemistry of feline pulmonary arterial smooth muscle cells demonstrated localization of PKC-α and -δ isozymes in response to phorbol 12-myristate 13-acetate and angiotensin II. Localization of PKC-α and -δ isozymes decreased with administration of Gö-6976 and rottlerin, respectively. These data suggest that activation of Ca2+-dependent PKC isozymes and Ca2+-independent PKC-δ isozyme/CaM-dependent kinase III mediate angiotensin II responses. These data further suggest that Ca2+-independent PKC-δ isozyme/CaM-dependent kinase III mediate responses to NE. A rottlerin- or Gö-6976-sensitive mechanism is not involved in mediating responses to serotonin and U-46619, but these PKC isozyme inhibitors enhanced BAY K 8644 responses in the feline pulmonary vascular bed.

APA, Harvard, Vancouver, ISO, and other styles

33

Welters, HJ, SA Smith, M. Tadayyon, JH Scarpello, and NG Morgan. "Evidence that protein kinase Cdelta is not required for palmitate-induced cytotoxicity in BRIN-BD11 beta-cells." Journal of Molecular Endocrinology 32, no. 1 (February 1, 2004): 227–35. http://dx.doi.org/10.1677/jme.0.0320227.

Full text

Abstract:

Chronic exposure of pancreatic beta-cells to saturated fatty acids leads to loss of viability, an effect that has been implicated in the process of beta-cell 'lipotoxicity' associated with the progression of type 2 diabetes. The mechanisms involved are unknown but recent evidence has implicated the delta isoform of protein kinase C (PKCdelta) in mediating fatty acid toxicity. We have investigated this proposition in the clonal insulin-secreting cell line, BRIN-BD11. BRIN-BD11 cells were found to undergo apoptosis when exposed to palmitate and this response was attenuated by the purportedly selective inhibitor of PKCdelta, rottlerin. However, activation of PKCdelta with the phorbol ester, phorbol-12-myristate-13-acetate (PMA), failed to promote cell death and down-regulation of PKCdelta did not prevent the cytotoxic effects of palmitate. Moreover, rottlerin remained effective as a blocker of the palmitate response in cells depleted of PKCdelta. Since rottlerin can inhibit various other kinases in addition to PKCdelta, a range of additional kinase inhibitors was also tested. Of these, only the putative Ca2+/calmodulin-dependent protein kinase II (CaM kinase II) inhibitor, KN-62, was found to inhibit palmitate-induced cell death. However, this effect was not reproduced by a more selective pseudo-substrate inhibitor of CaM kinase II. Therefore, the present results reveal that palmitate induces cell death in BRIN-BD11 cells and suggest that this may involve the activation of a rottlerin (and KN-62)-sensitive kinase. However, it is clear that PKCdelta is not required for this response.

APA, Harvard, Vancouver, ISO, and other styles

34

Wang, Fang, Hui-min Liu, Michael G. Irwin, Zhong-yuan Xia, Zhiyong Huang, Jingping Ouyang, and Zhengyuan Xia. "Role of protein kinase C β2 activation in TNF-α-induced human vascular endothelial cell apoptosis." Canadian Journal of Physiology and Pharmacology 87, no. 3 (March 2009): 221–29. http://dx.doi.org/10.1139/y09-004.

Full text

Abstract:

The circulatory inflammatory cytokine tumor necrosis factor alpha (TNF-α) is increased in pathologic conditions that initiate or exacerbate vascular endothelial injury, such as diabetes. Protein kinase C (PKC) has been shown to play a critical role in TNF-α-induced human endothelial cell apoptosis. However, the relative roles played by specific isoforms of PKC in TNF-α-induced human endothelial cell apoptosis have not been addressed. We investigated the effects of a selective PKCβ2 inhibitor (CGP53353) on TNF-α-induced apoptosis in human vascular endothelial cells (cell line ECV304) and on the production of reactive oxygen species and nitric oxide, and compared its effects with rottlerin, a reagent that has been shown to reduce PKCδ protein levels. Cultured human vascular endothelial cells (ECV304) were treated for 24 h with one of 4 regimes: 40 ng/mL TNF-α alone (TNF-α), TNF-α with 10 µmol/L rottlerin (T+rottlerin), TNF-α with 1 µmol/L CGP53353 (T+CGP), or untreated (control). Cell viability was measured by MTT assay, and cell apoptosis was assessed by flow cytometry. TNF-α-induced endothelial cell apoptosis was associated with dramatic increases in production of intracellular hydrogen peroxide (approximately 20 times greater than control) and superoxide (approximately 16 times greater than control), as measured by dichlorofluorescein and dihydroethidium fluorescent staining, respectively. This increase was accompanied by reduced activity of superoxide dismutase and glutathione peroxidase and, subsequently, an increase in the lipid peroxidation product malondialdehyde. CGP53353, but not rottlerin, abolished or attenuated all these changes. We conclude that PKCβ2 plays a major role in TNF-α-induced human vascular endothelial cell apoptosis.

APA, Harvard, Vancouver, ISO, and other styles

35

Wang, Zhong, Gen-hai Shen, Jia-ming Xie, Bin Li, and Quan-gen Gao. "Rottlerin upregulates DDX3 expression in hepatocellular carcinoma." Biochemical and Biophysical Research Communications 495, no. 1 (January 2018): 1503–9. http://dx.doi.org/10.1016/j.bbrc.2017.11.198.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Barbaric, Ivana, Mark Jones, David J. Harley, Paul J. Gokhale, and Peter W. Andrews. "High-Content Screening for Chemical Modulators of Embryonal Carcinoma Cell Differentiation and Survival." Journal of Biomolecular Screening 16, no. 6 (May 18, 2011): 603–17. http://dx.doi.org/10.1177/1087057111406547.

Full text

Abstract:

Disentangling the complex interactions that govern stem cell fate choices of self-renewal, differentiation, or death presents a formidable challenge. Image-based phenotype-driven screening meets this challenge by providing means for rapid testing of many small molecules simultaneously. Pluripotent embryonal carcinoma (EC) cells offer a convenient substitute for embryonic stem (ES) cells in such screens because they are simpler to maintain and control. The authors developed an image-based screening assay to identify compounds that affect survival or differentiation of the human EC stem cell line NTERA2 by measuring the effect on cell number and the proportion of cells expressing a pluripotency-associated marker SSEA3. A pilot screen of 80 kinase inhibitors identified several compounds that improved cell survival or induced differentiation. The survival compounds Y-27632, HA-1077, and H-8 all strongly inhibit the kinases ROCK and PRK2, highlighting the important role of these kinases in EC cell survival. Two molecules, GF109203x and rottlerin, induced EC differentiation. The effects of rottlerin were also investigated in human ES cells. Rottlerin inhibited the self-renewal ability of ES cells, caused the cell cycle arrest, and repressed the expression of pluripotency-associated genes.

APA, Harvard, Vancouver, ISO, and other styles

37

Petr, J., E. Chmelíková, A. Dörflerová, M. Ješeta, and Z. Kuthanová. "Effects of protein kinase C on parthenogenetic activation of pig oocytes using calcium ionophore or nitric oxide-donor." Czech Journal of Animal Science 52, No. 12 (January 7, 2008): 415–22. http://dx.doi.org/10.17221/2336-cjas.

Full text

Abstract:

Porcine oocytes matured in vitro were activated for parthenogenetic development using either calcium ionophore (50μM for 10 min) or nitric oxide donor SNAP (2mM for 23.5 hours). Protein kinase C (PKC) inhibitors, bisindolylmaleimide I or rottlerin, are able to inhibit parthenogenetic activation induced by calcium ionophore. The rate of activated oocytes decreased from 69% to 2% (P < 0.05) under the effect of bisindolylmaleimide I at a concentration of 0 or 20nM, respectively. The activation rate decreased from 68% to 0% (P < 0.05) under the influence of 0 or 20μM rottlerin, respectively. PKC inhibitors Go6976 or hispidin had no effect on the oocyte activation using calcium ionophore or on oocytes activated by a nitric oxide donor. The activation of oocytes by a nitric oxide donor is not significantly influenced even under the effects of bisindolylmaleimide I or rottlerin. Based on these data we can conclude that the oocyte activation induced by calcium ionophore depends on PKC, especially on PKC-δ. On the other hand, the oocyte activation induced by nitric oxide is independent of the tested isotypes of PKC.

APA, Harvard, Vancouver, ISO, and other styles

38

Liedtke, Carole M., and Thomas Cole. "Antisense oligodeoxynucleotide to PKC-δ blocks α1-adrenergic activation of Na-K-2Cl cotransport." American Journal of Physiology-Cell Physiology 273, no. 5 (November 1, 1997): C1632—C1640. http://dx.doi.org/10.1152/ajpcell.1997.273.5.c1632.

Full text

Abstract:

A role for protein kinase C (PKC)-δ and -ζ isotypes in α1-adrenergic regulation of human tracheal epithelial Na-K-2Cl cotransport was studied with the use of isotype-specific PKC inhibitors and antisense oligodeoxynucleotides to PKC-δ or -ζ mRNA. Rottlerin, a PKC-δ inhibitor, blocked 72% of basolateral-to-apical, bumetanide-sensitive36Cl flux in nystatin-permeabilized cell monolayers stimulated with methoxamine, an α1-adrenergic agonist, with a 50% inhibitory concentration of 2.3 μM. Methoxamine increased PKC activity in cytosol and a particulate fraction; the response was insensitive to PKC-α and -βIIisotype-specific inhibitors, but was blocked by general PKC inhibitors and rottlerin. Rottlerin also inhibited methoxamine-induced PKC activity in immune complexes of PKC-δ, but not PKC-ζ. At the subcellular level, methoxamine selectively elevated cytosolic PKC-δ activity and particulate PKC-ζ activity. Pretreatment of cell monolayers with antisense oligodeoxynucleotide to PKC-δ for 48 h reduced the amount of whole cell and cytosolic PKC-δ, diminished whole cell and cytosolic PKC-δ activity, and blocked methoxamine-stimulated Na-K-2Cl cotransport. Sense oligodeoxynucleotide to PKC-δ and antisense oligodeoxynucleotide to PKC-ζ did not alter methoxamine-induced cotransport activity. These results demonstrate the selective activation of Na-K-2Cl cotransport by cytosolic PKC-δ.

APA, Harvard, Vancouver, ISO, and other styles

39

Maioli, Emanuela, and Giuseppe Valacchi. "Rottlerin: Bases for a Possible Usage in Psoriasis." Current Drug Metabolism 11, no. 5 (June 1, 2010): 425–30. http://dx.doi.org/10.2174/138920010791526097.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Valacchi, Giuseppe, Alessandra Pecorelli, Marzia Mencarelli, Paola Carbotti, Vittoria Fortino, Michela Muscettola, and Emanuela Maioli. "Rottlerin: a multifaced regulator of keratinocyte cell cycle." Experimental Dermatology 18, no. 6 (June 2009): 516–21. http://dx.doi.org/10.1111/j.1600-0625.2008.00816.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

SOLTOFF, S. "Rottlerin: an inappropriate and ineffective inhibitor of PKCδ." Trends in Pharmacological Sciences 28, no. 9 (September 2007): 453–58. http://dx.doi.org/10.1016/j.tips.2007.07.003.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Li, Yangfeng, Biao Yu, and Renxiao Wang. "Efficient synthesis of rottlerin and its two subunits." Tetrahedron Letters 57, no. 17 (April 2016): 1856–59. http://dx.doi.org/10.1016/j.tetlet.2016.03.049.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Dietrich, Cornelia, Nicolas Gumpert, Isabelle Heit, Monika Borchert-Stuhlträger, Franz Oesch, and Raimund Wieser. "Rottlerin Induces a Transformed Phenotype in Human Keratinocytes." Biochemical and Biophysical Research Communications 282, no. 2 (March 2001): 575–79. http://dx.doi.org/10.1006/bbrc.2001.4530.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

Liedtke, Carole M., Robert Papay, and Thomas S. Cole. "Modulation of Na-K-2Cl cotransport by intracellular Cl− and protein kinase C-δ in Calu-3 cells." American Journal of Physiology-Lung Cellular and Molecular Physiology 282, no. 5 (May 1, 2002): L1151—L1159. http://dx.doi.org/10.1152/ajplung.00143.2001.

Full text

Abstract:

In this study, we tested the hypothesis that intracellular Cl−(Cl[Formula: see text]) regulates the activity of protein kinase C (PKC)-δ and thus the activation of Na-K-Cl cotransport (NKCC1) in a Calu-3 cell line. The α1-adrenergic agonist methoxamine (MOX) and hypertonic sucrose increased Cl[Formula: see text] and increased or decreased intracellular volume, respectively, without changing Cl[Formula: see text] concentration ([Cl−]i). Titration of [Cl−]i from 20–140 mM in nystatin-permeabilized cell monolayers did not affect the baseline activity of PKC-δ, PKC-ζ, or rottlerin-sensitive NKCC1. At 200 mM Cl−, rottlerin-sensitive NKCC1 was activated, and PKC isotypes were localized predominantly to a particulate fraction. MOX induced a biphasic increase in NKCC1 activity and PKC-δ in activity and particulate localization of PKC-δ and -ζ. Activity of NKCC1 and PKC-δ decreased with increasing Cl[Formula: see text] from 20 to 80 mM Cl[Formula: see text] then increased at 140–200 mM Cl[Formula: see text] apparently as an additive effect to high [Cl−]i levels. Rottlerin inhibited the effects of MOX, which indicates that PKC-δ was required for activation of NKCC1. The results indicate that, in airway epithelial cells, a Cl[Formula: see text] electrochemical gradient alone is not sufficient to stimulate NKCC1 activity; rather, elevated activity of PKC-δ is necessary. Further, high Cl[Formula: see text] levels induce a subcellular redistribution of PKC-δ, which results in increased enzyme activity.

APA, Harvard, Vancouver, ISO, and other styles

45

He, Peng, Nan Shen, Gongming Gao, Xuefeng Jiang, Huiqing Sun, Dong Zhou, Nanwei Xu, Luming Nong, and Kewei Ren. "Periodic Mechanical Stress Activates PKCδ-Dependent EGFR Mitogenic Signals in Rat Chondrocytes via PI3K-Akt and ERK1/2." Cellular Physiology and Biochemistry 39, no. 4 (2016): 1281–94. http://dx.doi.org/10.1159/000447833.

Full text

Abstract:

Background/Aims: The present study aimed to analyze the mechanisms by which periodic mechanical stress is translated into biochemical signals, and to verify the important role of signaling molecules including phosphatidylinositol-3-kinase (PI3K)-Akt, protein kinase C (PKC), and epidermal growth factor receptor (EGFR) in chondrocyte proliferation. The effects of periodic mechanical stress on the mitogenesis of chondrocytes have been studied extensively in recent years. However, the mechanisms underlying the ability of chondrocytes to sense and respond to periodic mechanical stress need further investigation. Methods: Two steps were undertaken in the experiment. In the first step, the cells were pretreated with shRNA targeted to Akt or EGFR or PKCδ or control scrambled shRNA. Moreover, they were pretreated with LY294002, GF109203X, Gö6976, rottlerin, and AG1478. They were maintained under static conditions or periodic mechanical stress for 3 days, 8 h per day, prior to direct cell counting and CCK-8 assay, respectively. In the second step, the cells were pretreated with shRNA targeted to Akt or EGFR or PKCδ or control scrambled shRNA. Moreover, they were pretreated with LY294002, AG1478, and rottlerin. They were maintained under static conditions or periodic mechanical stress for 1 h prior to Western blot analysis. Results: Proliferation was inhibited by pretreatment with PKC or PKCδ inhibitor GF109203X or rottlerin and by short hairpin RNA (shRNA) targeted to PKCδ, but not by PKCα inhibitor Gö6976 in chondrocytes in response to periodic mechanical stress. Meantime, rottlerin and shRNA targeted to PKCδ also attenuated EGFR, Akt, and ERK1/2 activation. Furthermore, inhibiting EGFR activity by AG1478 and shRNA targeted to EGFR abrogated chondrocyte proliferation and phosphorylation levels of Akt and extracellular signal-regulated kinase (ERK)1/2 subjected to periodic mechanical stress, while the phosphorylation site of PKCδ was not affected. In addition, pretreatment with the PI3K-Akt-selective inhibitor LY294002 and shRNA targeted to Akt reduced periodic mechanical stress-induced chondrocyte proliferation and phosphorylation of ERK1/2, while the phosphorylation levels of EGFR and PKCδ were not inhibited. Conclusion: These findings suggested that periodic mechanical stress promoted chondrocyte proliferation through PKCδ-EGFR-PI3K-Akt-ERK1/2. They provide a stronger viewpoint for further investigations into chondrocyte mechanobiology under periodic mechanical stress and the ways to improve the quality of tissue-engineered cartilage.

APA, Harvard, Vancouver, ISO, and other styles

46

Su, Chun-Min, Yueh-Shan Weng, Lin-Yen Kuan, Jiann-Hwa Chen, and Fei-Ting Hsu. "Suppression of PKCδ/NF-κB Signaling and Apoptosis Induction through Extrinsic/Intrinsic Pathways Are Associated with Magnolol-Inhibited Tumor Progression in Colorectal Cancer In Vitro and In Vivo." International Journal of Molecular Sciences 21, no. 10 (May 16, 2020): 3527. http://dx.doi.org/10.3390/ijms21103527.

Full text

Abstract:

Magnolol is one of the hydroxylated biphenyl compounds from the root and stem bark of Magnolia officinalis, which shown to possess anti-colorectal cancer (CRC) effects. However, the regulatory mechanism of magnolol on apoptosis and NF-κB signaling in human CRC has not been elucidated. Thus, we investigated the inhibitory mechanism of magnolol on human and mouse CRC (HT-29 and CT-26) in vitro and in vivo. Results from reporter gene assay indicated that both magnolol and rottlerin (PKCδ inhibitor) reduced the endogenous NF-κB activity. In addition, indolactam V (PKCδ activator)-induced NF-κB signaling was significantly suppressed with both magnolol and rottlerin treatment. Results from Western blotting also indicated that phosphorylation of PKCδ and NF-κB -related proteins involved in tumor progression were effectively decreased by magnolol treatment. The invasion capacity of CRC cells was also attenuated by both magnolol and rottlerin. Furthermore, magnolol triggered Fas/Fas-L mediated extrinsic apoptosis and mitochondria mediated intrinsic apoptosis were validated by flow cytometry. Most importantly, tumor growth in both HT-29 and CT-26 bearing mice were suppressed by magnolol, but no pathologic change was detected in mice kidney, spleen, and liver. As confirmed by immunohistochemistry (IHC) staining from tumor tissue, PKCδ/NF-κB signaling and downstream proteins expression were decreased, while apoptotic proteins expression was increased in the magnolol treated group. According to these results, we suggest that the induction of apoptosis through extrinsic/intrinsic pathways and the blockage of PKCδ/NF-κB signaling are associated with the magnolol-inhibited progression of CRC.

APA, Harvard, Vancouver, ISO, and other styles

47

Zhu, Yi, Minjie Wang, Xu Zhao, Lei Zhang, Yigao Wu, Bangqi Wang, and Weilie Hu. "Rottlerin as a novel chemotherapy agent for adrenocortical carcinoma." Oncotarget 8, no. 14 (February 9, 2017): 22825–34. http://dx.doi.org/10.18632/oncotarget.15221.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Torricelli, C., E. Daveri, S. Salvadori, G. Valacchi, F. Ietta, M. Muscettola, F. Carlucci, and E. Maioli. "Phosphorylation-independent mTORC1 inhibition by the autophagy inducer Rottlerin." Cancer Letters 360, no. 1 (April 2015): 17–27. http://dx.doi.org/10.1016/j.canlet.2015.01.040.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Ietta, Francesca, Giuseppe Valacchi, Linda Benincasa, Alessandra Pecorelli, Laura Cresti, and Emanuela Maioli. "Multiple mechanisms of Rottlerin toxicity in A375 melanoma cells." BioFactors 45, no. 6 (August 13, 2019): 920–29. http://dx.doi.org/10.1002/biof.1551.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Lübke, Marco, Julian A. Schreiber, Thang Le Quoc, Florian Körber, Jasmin Müller, Sivatharushan Sivanathan, Veronika Matschke, et al. "Rottlerin: Structure Modifications and KCNQ1/KCNE1 Ion Channel Activity." ChemMedChem 15, no. 12 (May 5, 2020): 1078–88. http://dx.doi.org/10.1002/cmdc.202000083.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Rottlerin'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles