Journal articles on the topic 'Red kangaroo Australia Reproduction'

Immunocontraception involves eliciting an immune response against eggs, sperm or hormones so that successful reproduction is prevented. Work in Australasia is aimed at European rabbits (Oryctolagus cuniculus), red foxes (Vulpes vulpes), house mice (Mus musculus), common brushtail possums (Trichosurus vulpecula), koalas (Phascolartcos cinereus) and kangaroos (Macropus spp.), with the vaccines involved all containing self antigens or their relatives. Two fundamental problems have been inadequately addressed in this research. The first problem is that it is difficult to obtain strong immune responses against self antigens and so the vaccines may be ineffective. Most published data on the effect of immunocontraceptives on reproduction involve the use of an adjuvant of which there are many kinds. The materials enhance the immune response greatly. The most frequently used is Freund?s adjuvant which can cause chronic suffering. Its use on wildlife will lead to very negative public perceptions. There has been no convincing demonstration that successful immunocontraception is possible with any method of vaccination likely to be used in the field, if success is defined as contraception of a proportion of the population high enough for management requirements. If it is assumed that success can be achieved, the second fundamental problem arises with two potential consequences. Even with adjuvant, a substantial minority of the vaccinated animals remains fertile. The first consequence is that since failure to be contracepted is likely to be in part genetic, there is likely to be rapid selection for these non-responders. The method will become ineffective in a few generations. The second problem is that the offspring of the animals which breed will have altered immune responses. Their capacities to respond to their own pathogens or to harbor pathogens of other species in the same ecosystem are likely to be changed. The presence of chlamydia in P. cinereus and bovine tuberculosis in New Zealand T. vulpecula means that responses to these pathogens would have to be studied in offspring of immunocontracepted parents to ensure that the offspring were not more susceptible to them. New Zealand intentions to put an immunocontraceptive into a T. vulpecula gut worm must be viewed with caution by Australia. The eggs of transgenic worms will be easily transplanted either accidentally or deliberately back into Australia, and so infect T. vulpecula in Australia.

The cDNA encoding the follicle stimulating hormone beta subunit (FSH-β) was isolated from a red kangaroo pituitary cDNA library by using a porcine probe and the nucleotide sequence for the coding region was determined. The highest degree of deduced amino acid sequence identity (91%) was observed between the red kangaroo and another marsupial, the brushtail possum (Trichosurus vulpecula), followed by eutherian species (76%, 75% and 74%, respectively, for pig, mouse and sheep). Based on the deduced red kangaroo FSH-β amino acid sequence, putative antigenic sites have been identified that may prove useful for studying the hormonal control of reproduction in marsupials.

Pastoralists frequently claim that attempts at range regeneration in arid and semi-arid areas are thwarted by kangaroos. This paper examines the possibility that the impact of kangaroo grazing is exacerbated by an influx of kangaroos onto regeneration sites. The amount of kangaroo dung in a 7500 ha paddock in arid Western Australia increased six-fold over a 15-month period following the removal of sheep. A similar influx was apparent in another destocked paddock that provided unusually high offtake of kangaroos by a commercial shooter. The amount of kangaroo dung remained relatively stable in a control paddock that was stocked. Some areas subject to cultivation and reseeding with native shrubs also showed increased amounts of kangaroo dung, indicating relatively intense kangaroo grazing. Radio-tracking of 46 kangaroos showed them to be mostly sedentary, suggesting that 'invading' kangaroos emerge from the local area. This conclusion is contrary to the widespread view that kangaroos migrate from distant locations. Thus, kangaroo control programs on sensitive areas are likely to be long-lasting because incursions are predominantly from local populations.

The red kangaroo (Macropus rufus) and the dingo (Canis dingo) are two of Australia's iconic mammals. Both are ingrained in the national psyche and well known internationally. For the red kangaroo, recognition has come despite the fact that the highest densities of the species occur well away from most of the human population. The dingo has achieved its status despite being present on the continent for perhaps as little as 3,000 years. This article considers the question of how, and why, these two animals became so elevated in the popular imagination and the scientific literature. It is a story of both the integers and consequences of scientific research, a story best told with a particular focus on the contribution made by one individual. Alan Newsome changed our understanding of the interactions between agriculture, introduced species and native wildlife, and was one of the first to understand the possibilities of enriching western science with Indigenous knowledge. He was a pioneer in explaining—particularly by reference to the red kangaroo in central Australia—the remarkable story of how Australian wildlife has adapted to survive some of the harshest conditions on the planet. His work across the landscape of the arid zone has had profound implications for management and conservation in Australia. This, then, is the story of three icons: the red kangaroo, the dingo and Alan Newsome.

The number of individuals in a wildlife population is often estimated and the estimates used for wildlife management. The scientific basis of published continental-scale estimates of individuals in Australia of feral cats and feral pigs is reviewed and contrasted with estimation of red kangaroo abundance and the usage of the estimates. We reviewed all papers on feral cats, feral pigs and red kangaroos found in a Web of Science search and in Australian Wildlife Research and Wildlife Research, and related Australian and overseas scientific and ‘grey’ literature. The estimated number of feral cats in Australia has often been repeated without rigorous evaluation of the origin of the estimate. We propose an origin. The number of feral pigs in Australia was estimated and since then has sometimes been quoted correctly and sometimes misquoted. In contrast, red kangaroo numbers in Australia have been estimated by more rigorous methods and the relevant literature demonstrates active refining and reviewing of estimation procedures and management usage. We propose four criteria for acceptable use of wildlife abundance estimates in wildlife management. The criteria are: use of appropriate statistical or mathematical analysis; precision estimated; original source cited; and age (current or out-of-date) of an estimate evaluated. The criteria are then used here to assess the strength of evidence of the abundance estimates and each has at least one deficiency (being out-of-date). We do know feral cats, feral pigs and red kangaroos occur in Australia but we do not know currently how many feral cats or feral pigs are in Australia. Our knowledge of red kangaroo abundance is stronger at the state than the continental scale, and is also out-of-date at the continental scale. We recommend greater consideration be given to whether abundance estimates at the continental scale are needed and to their use, and not misuse, in wildlife management.

We studied the impact of grazing by red kangaroos (Macropus rufus) on pasture biomass and species diversity over a 32-month period in destocked open shrubland in the Gascoyne region of Western Australia. Grazing significantly impeded the accumulation of annual and perennial grass biomass in a degraded perennial shrub community (Pc0.001 and P<0.05) and on denuded sites that were cultivated and reseeded with native shrubs (P<0.01 and Pc0.01). The accumulation of annual and perennial forb biomass was unaffected by kangaroo grazing. After 12 months, pasture species diversity was significantly greater on degraded perennial sites protected from kangaroo grazing (P<0.05). Commercial kangaroo shooting did not alleviate the impact of kangaroo grazing on grass accumulation (P<0.01). Unless more effective methods of kangaroo control are integrated with stock reductions, the recovery of degraded rangeland pastures is likely to be severely limited.

In this study we examined the utility of manipulating artificial waters as a means of managing total grazing pressure in semi-arid rangelands of eastern Australia. We tested the efficacy of 'Finlayson trough' exclosure technology at three locations, over two summers, in paddocks with red kangaroos (Macropus rufirs) and two species of grey kangaroo (M. giganteus and M. fuliginosus). We also examined the effect of closing off five waters on the distribution of feral goat grazing intensity at one study site. Generally, there were no apparent reductions in kangaroo and goat grazing intensity following 6-10 weeks of water exclosure, the exception being a minor reduction in red kangaroo grazing intensity at one location. We concluded that kangaroo and goat grazing pressure cannot be substantially reduced by simply closing off waters in and near paddocks for several months. Key words: kangaroos, water exclosure. feral goats, grazing pressure, paddock spelling

Historical records, and the names of animals within Aboriginal languages, were analysed to compare the distribution and density of kangaroos at European contact with those of today. We gave up this attempt for the Eastern Grey Kangaroo, Macropus giganteus, presently restricted to the extreme south-east of the state, because it was never differentiated historically from the Southern Grey Kangaroo, M. fuliginosus, which occurs right across the southern portion of the state. The historical distribution of the latter species, and of the Red Kangaroo, M. rufus, seems to have been similar to their distribution today. Past densities are difficult to extract from historical records and are not sufficiently reliable to justify comparison with present densities. We note however an apparent increase in density of &apos;kangaroos&apos; in the mid-1800s.

The short-beaked echidna is the most widely distributed endemic Australian mammal, and echidnas from different geographic areas differ so much in appearance that they have been assigned to several subspecies. In this paper, we present data obtained from free-ranging echidnas in southern Tasmania, and compare this with studies from other parts of Australia. In Tasmania mating occurs between early June and mid-September, and throughout Australia the normal breeding season lies within these limits. In echidnas from the more easterly parts of Australia reproduction closely follows hibernation, with Tasmanian echidnas showing a significant overlap between hibernation and reproduction. There is intense competition between males, and female echidnas from Tasmania show multiple matings. There are significant differences between echidnas from different areas of Australia in the use of nursery burrows and maternal care. One of the most dramatic differences is in duration of lactation: echidnas from Kangaroo Island wean the young at 204–210 days, but in Tasmania weaning occurs at 139–152 days, even though the masses of the young at weaning are comparable.

We examined Toona ciliata M.Roemer (Australian red cedar) for its potential to deliver annually resolved tree-ring proxy data. Such proxies are valuable and sought-after sources for reconstructing climate beyond instrumental records, especially in Australia. T. ciliata was chosen because it is one of the few deciduous tree species in Australia experiencing a seasonally dormant period of the cambium. This was confirmed by a preliminary tree-ring analysis which revealed distinct growth rings. Because of initial uncertainties regarding reliable annual growth rings in the wood of T. ciliata, a dendrometer-band study was conducted in addition to the tree-ring analysis. Stem increments revealed a common period of dormancy during winter and the measurements were found to correlate with both precipitation and temperature, depending on the site. For the first time, our tree-ring analysis demonstrated that samples from different individuals can be cross-dated and the resulting site index from Upper Kangaroo Valley (New South Wales) has the potential to reconstruct early season temperatures and late-season rainfall.

The eastern grey kangaroo is a common and iconic species of Australia. Its specialised behaviour and reproduction have evolved as adaptations to the Australian environment, allowing the species to survive and flourish, despite wide climatic and seasonal variations in habitat. Across its range, the eastern grey kangaroo is harvested and subjected to population management for a variety of reasons, including localised over-abundance, livestock competition, crop grazing, native habitat conservation, animal welfare and direct threats to human safety. Population management of kangaroos is most commonly undertaken by shooting, although other methods such as reproductive control, translocation and repellents may also contribute successfully to management. Kangaroo harvesting and population control are controversial and divisive, because the kangaroo is perceived as both a national icon and as a pest species. Although a limited number of surveys have been undertaken on attitudes towards kangaroos and their management, the socio-political aspects affecting these issues are yet to be systematically investigated. Within this review we discuss the relevance of culture and language to species management and conservation, as well as the importance of scrutiny of stakeholder perceptions, motivations and values. Future directions should examine human dimensions that influence kangaroo-management decisions and conservation. The following three key aspects are recommended as research and management priorities: (1) experimental determination of whether gaps exist between actual and perceived impacts of kangaroo populations, (2) empirical investigation of how stakeholder language, culture, identity and values influence perceptions of kangaroos and their management, and (3) where population control is determined to be necessary, an incorporation of stakeholder differences within decision making to ensure best outcomes for both species conservation and population management.

Eastern grey kangaroos are widespread on the east coast of Australia and frequently reach high densities in reserves and parkland near urban areas. Management of these populations is highly contentious and non-lethal fertility-control technologies are sought as an alternative option to manage population size. This study evaluated the potential of slow-release gonadotrophin-releasing hormone agonist (deslorelin) implants to inhibit reproduction in female kangaroos. Deslorelin treatment effectively inhibited reproduction in adult females for periods of 559 ± 111 days (n = 6) and 651 ± 21 days (n = 5) after administration of one or two 10-mg implants respectively. Animals treated with the lower dosage tended to resume breeding earlier than those that received a total of 20 mg of deslorelin (minimum duration of 18 months). Deslorelin treatment had no effect on blastocyst reactivation in a single treated female and repeat treatment had no negative side-effects. This study has demonstrated that slow-release deslorelin implants can successfully inhibit reproduction for extended periods in the female eastern grey kangaroos. This approach may have potential application in reproductive management of problem kangaroo populations.

Many theories attempt to explain patterns of community organisation among large herbivores. We explored the role of body size, diet type and residence time on habitat use in a community comprising four metatherians (western grey kangaroo, Macropus fuliginosus; eastern grey kangaroo, M. giganteus; red-necked wallaby, Notamacropus rufogriseus; swamp wallaby, Wallabia bicolor) and two eutherians (red deer, Cervus elaphus; European rabbit, Oryctolagus cuniculus) in south-eastern Australia. We used camera traps to estimate habitat occupancy, quantified habitat specialisation using relative entropy, and ran regressions using percentage grass consumed, log(mass) and log(time at site) as predictor variables and relative entropy as the response. If body size influenced habitat use, we predicted smaller species would occupy fewer habitats. If diet type influenced habitat use, we predicted intermediate feeders would use more habitats. If the time that a species had been present at a site predicted community organisation, newer species would use more habitats. None of these theories explained habitat use in our community. Red deer used a narrower range of habitats than expected, perhaps due to the poor suitability of habitats available in the Grampians. While interactions between our hypotheses are likely to be important, the body size model deserves further attention in this community.

Examination of the stomach contents of 74 foxes from a south-western Queensland sheep grazing property revealed a diverse range of prey. Mammals formed the bulk of the diet representing 64% of the total weight of food items and occurred in 80% of stomachs. Sheep and kangaroo carrion were the main mammalian prey. Insects and other invertebrates were an important but lesser component of the diet. Dietary trends were heavily influenced by human activity, rainfall, and season. These results differ from those of other studies conducted in southern parts of Australia due to the large proportions of scavenged food items in the diet (63% by weight) and relatively high consumption levels of non-mammalian prey. The lack of a small to medium sized staple prey source in the study area, which were available in southern areas appears to be the reason for the foxes reliance on such a varied prey base.

I determined the sex of a total of 251 road-kills of six macropod species in southern Australia over a 13-year period. There was a significant bias towards males in five species, ranging from 65 to 92% males, but there was no difference from parity in the red kangaroo, Macropus rufus. Male eastern grey kangaroos, M. giganteus, and male western grey kangaroos, M. fuliginosus, probably behave in ways that expose them to vehicles more than females. Male-biased road-kills of swamp wallabies, Wallabia bicolor, may reflect skewed population sex ratios. There are insufficient data on the behaviour and population structure of the red-necked wallaby, M. rufogriseus, and rufous-bellied pademelon, Thylogale billardierii, to determine which explanation is responsible for male-biased road mortality in these species.

Removing cattle as a management tool to conserve biodiversity may not necessarily alter grazing impacts on vegetation if other introduced or native herbivores move in and replace the cattle after removal. This study investigated whether there was a difference in the abundance of native red kangaroos (Osphranter (Macropus) rufus) and introduced feral camels (Camelus dromedarius) on arid rangelands where cattle had been recently removed compared with where cattle remained. Activity was measured by clearing and weighing dung, and by counting animal sightings. Kangaroos were encountered more frequently in high quality habitat (gidgee woodland) where cattle had been recently removed. However, kangaroo dung in newly cattle-free areas comprised only ~1.5% of the weight of cattle dung in this habitat where cattle still grazed, indicating no grazing compensation by the native herbivore. Camels showed no clear preference for particular habitat types but used dune tops usually avoided by kangaroos and cattle. There was no indication of camels using habitats differently in areas where cattle were removed. Camel dung collected across all habitats comprised less than a tenth the weight of cattle dung, but almost five times as much as kangaroo dung. As cattle removal had occurred relatively recently, further monitoring is needed to determine its impact over longer periods, especially through low and high rainfall cycles. Methods to improve the monitoring of large herbivores in the presence and absence of livestock and to assess whether anticipated conservation goals are achieved are discussed.

The effects of roads on wildlife behaviour and ecological function are poorly known in arid Australia. The most obvious impact is roadkill from wildlife-vehicle collisions. Therefore we collected statistics on kangaroo-vehicle collisions, investigated the causal factors of these collisions, and related roadkill mortality to the population structure, size and distribution of four kangaroo species in two intensive six month studies during and following drought. The research was conducted along a 21.2 km sealed section of the Silver City Highway between Broken Hill and Tibooburra that passes through the University of New South Wales (NSW) Arid Zone Research Station at ‘Fowlers Gap’ in north-western NSW. The rate of roadkill was higher during drought (20.8 roadkills month-1) than non-drought (2.6 roadkills month-1). Affected species were red kangaroos (Macropus rufus), euros (Macropus robustus erubescens), western grey kangaroos (Macropus fuliginosus) and eastern grey kangaroos (Macropus giganteus). During drought, M. fuliginosus and M. giganteus were killed in lower proportions than their proportion in the source population, otherwise species were killed in proportion to their density along the road. There were no sex biases but male M. r. erubescens were much more likely to be beside the road than females and thus were killed more often during drought. The majority of roadkills were young individuals around 2 years old. Curves and stockraces along the road significantly increased the likelihood of roadkills. Likewise the frequency of roadkills was a function of the kangaroo population density along the road, night time traffic volume, low rainfall and higher vegetation cover and greenness along the road relative to surrounding areas. We evaluate the relationships between these causal factors and kangaroovehicle collisions, and discuss the possible effects of these collisions on kangaroo population structure under drought and post-drought conditions.

Abstract Osphranter rufus (Desmarest, 1822) is a macropod commonly called the red kangaroo and is the largest extant marsupial. Sexually dimorphic in size and coat color, this large macropod is one of four species in the genus Osphranter. In general, males are larger than females, and are reddish-brown in color, whereas females are bluish-gray. O. rufus is endemic to Australia, where it inhabits both arid and semiarid areas with wide habitat preferences that include open plains, open desert, grassland, woodland, or shrubland habitats. Although it is regularly harvested for its meat and hide, O. rufus is an abundant species that is not of special conservation concern and it is listed as “Least Concern” by the International Union for Conservation of Nature and Natural Resources.

Context Poison baits are often used to control both foxes and feral cats but success varies considerably. Aims This study investigated the influence of bait type, placement and lures on bait uptake by the feral cat, red fox and non-target species to improve baiting success and reduce non-target uptake. Methods Six short field trials were implemented during autumn and winter over a five-year period in northern South Australia. Key results Results suggest that poison baiting with Eradicat or dried kangaroo meat baits was inefficient for feral cats due to both low rates of bait detection and poor ingestion rates for baits that were encountered. Cats consumed more baits on dunes than swales and uptake was higher under bushes than in open areas. The use of auditory or olfactory lures adjacent to baits did not increase ingestion rates. Foxes consumed more baits encountered than cats and exhibited no preference between Eradicat and kangaroo meat baits. Bait uptake by native non-target species averaged between 14 and 57% of baits during the six trials, accounting for up to 90% of total bait uptake. Corvid species were primarily responsible for non-target uptake. Threatened mammal species investigated and nibbled baits but rarely consumed them; however, corvids and some common rodent species ingested enough poison to potentially receive a lethal dose. Conclusions It is likely that several factors contributed to poor bait uptake by cats including the presence of alternative prey, a preference for live prey, an aversion to scavenging or eating unfamiliar foods and a stronger reliance on visual rather than olfactory cues for locating food. Implications Further trials for control of feral cats should concentrate on increasing ingestion rates without the requirement for hunger through either involuntary ingestion via grooming or development of a highly palatable bait.

arboreal folivores, such as Lumholtz’s Tree-kangaroo (Dendrolagus lumholtzi) in Far North Queensland, Australia, scat counts seem to be the most promising ecological technique. However, the occurrence of Lumholtz’s Tree-kangaroos in seasonal rainforests with dense understory, a high diversity of coprophagous invertebrates and with sympatric folivores increases the probability of invalidating results based on scat surveys. This study investigates scat production and scat decomposition patterns to select diagnostic traits of Lumholtz’s Tree-kangaroo scats that can, under varying environmental conditions, assist in distinguishing between fresh and old scats to reduce false positive and false negative errors in species presence due to non- or/and misidentification of scats. Scat production rates of six captive Lumholtz’s Tree-kangaroos were highly variable resulting in different scat numbers and masses. Changes in scat size (mass and circumference), pH and the appearance of mould were monitored under different laboratory conditions and in forest trials. Under wet conditions scats gained mass until they reached an apparent plateau of 130% of their original mass. Scats under dry conditions lost up to 90% of their original mass. Changes in mass were accompanied by changes in circumference of scats. By Day 3 scats had developed signs of mould under laboratory conditions and showed an acidic pH. Field trials revealed a high loss of scats due primarily to their consumption by dung beetles (Scarabaeoidea). For studying Lumholtz’s Tree-kangaroos in their rainforest environment, scat surveys should be confined to dry periods to reduce the probability of false negative errors due to activity of coprophagous invertebrates. Additionally, only fresh scats of average size and with an acidic pH should be used to minimize the risk of misidentifying small sized scats from Red-legged Pademelons (Thylogale stigmatica) as tree-kangaroo scats. More studies on species-specific diagnostic traits of Lumholtz’s Tree-kangaroo scats are necessary to validate false negative and false positive errors in scat counts for this species.

Abstract ContextAerial surveys provide valuable information about the population status and distribution of many native and pest vertebrate species. They are vital for evidence-based monitoring, budget planning and setting management targets. Despite aircraft running costs, they remain one of the most cost-effective ways to capture distribution and abundance data over a broad area. In Australia, annual surveys of large macropods are undertaken in several states to inform management, and in some jurisdictions, to help set commercial kangaroo harvest quotas. Improvements in the cost efficiencies of these surveys are continually sought. Aerial thermal imaging techniques are increasingly being tested for wildlife surveys, but to date no studies have directly compared population data derived from thermal imaging with data collected by human observers during the same flight. AimsDuring an aerial survey of western grey kangaroos (Macropus fuliginosus), eastern grey kangaroos (M. giganteus) and red kangaroos (Osphranter rufus) across the state of Victoria, Australia, the objective was to conduct a direct comparison of the effectiveness of thermal camera technology and human observers for estimating kangaroo populations from aerial surveys. MethodsA thermal camera was mounted alongside an aerial observer on one side of the aircraft for a total of 1360km of transect lines. All thermal footage was reviewed manually. Population density estimates and distance sampling models were compared with human observer counts. Key resultsOverall, the kangaroo density estimates obtained from the thermal camera data were around 30% higher than estimates derived from aerial observer counts. This difference was greater in wooded habitats. Conversely, human-derived counts were greater in open habitats, possibly due to interference from sunlight and flushing. It was not possible to distinguish between species of macropod in the thermal imagery. ConclusionsThermal survey techniques require refining, but the results of the present study suggest that with careful selection of time of day for surveys, more accurate population estimates may be possible than with conventional aerial surveys. ImplicationsConventional aerial surveys may be underestimating animal populations in some habitats. Further studies that directly compare the performance of aerial observers and thermal imaging are required across a range of species and habitats.

Fur or feathers provide protection against heat loads from solar radiation for birds and mammals. The red kangaroo (Macropus rufus) and the emu (Dromaius novaehollandiae) are conspicuous in arid environments of Australia where there is potential for high solar loads. The diurnal D. novaehollandiae feeds in the open yet it has a dark coat with a high absorptivity (83%), which contrasts with that of M. rufus (61%), but M. rufus generally shelters in shade during the day. We examined the effect of coat characteristics on the heat load from solar radiation at skin level. Coat depth and density (thermal conductance or insulation) and the level of penetration of solar radiation into the coat were important determinants of solar heat load. For M. rufus less than 25% of incident radiation reached the body at low wind speeds and this diminished to below 15% at moderate wind speeds. In the modest shade M. rufus seeks on summer days, their heat load from solar radiation appears minimal. Colour differences among M. rufus did not affect thermal load. D. novaehollandiae on the other hand is exposed to the full incident solar load in the open but its plumage provides almost complete protection from solar radiation. Solar radiation is absorbed at the feather surface and the insulation provided by the deep coat prevents heat transmission to the skin.

Invasive mammalian predators are linked to terrestrial vertebrate extinctions worldwide. Prey naïveté may explain the large impact invasive predators have on native prey; prey may fail to detect and react appropriately to the cues of novel predators, which results in high levels of depredation. In Australia, the feral cat ( Felis catus ) and the red fox ( Vulpes vulpes ) are implicated in more than 30 animal extinctions and the naïveté of native prey is often used to explain this high extinction rate. Reptiles are one group of animals that are heavily preyed upon by F. catus and V. vulpes . However, very few studies have examined whether reptiles are naive to their cues. In this study, we examine the ability of two native reptile species ( Morethia boulengeri and Christinus marmoratus ) to detect and distinguish between the chemical cues of two invasive predators ( V. vulpes and F. catus ) and three native predators (spotted-tailed quoll, Dasyurus maculatus; dingo, Canis lupus dingo ; eastern brown snake, Pseudonaja textilis ), as well as two non-predator controls (eastern grey kangaroo, Macropus giganteus and water). We conducted experiments to quantify the effects of predator scents on lizard foraging (the amount of food eaten) during 1 h trials within Y-maze arenas. We found both study species reduced the amount they consumed when exposed to predator scents—both native and invasive—indicating that these species are not naive to invasive predators. An evolved generalized predator-recognition system, rapid evolution or learned behaviour could each explain the lack of naïveté in some native Australian reptiles towards invasive predators.

Introduction Alpha (⍺)-gal syndrome (AGS) is an immunoglobulin E (IgE) antibody response against the glycoprotein carbohydrate galactose-⍺-1,3-galactose-β-1-(3)4-N-acetylglucosamine-R (Gal⍺-1,3Galβ1-(3)4GlcNAc-R or ⍺-gal) that is present in Ixodida (tick) saliva and noncatarrhine mammals as well as cetuximab, antivenom, and the zoster vaccine. The most frequently observed anaphylactic reactions in AGS are observed after beef, pork, lamb, and deer meat consumption. We present the first case of anaphylaxis to buffalo meat. Case Report A 55-year-old man presented with a history of recurrent urticaria that only developed approximately 7 hours after buffalo consumption. The patient denied history of Ixodidae bites but admitted to frequent hiking outdoors. Anti-⍺-1,3-gal IgE was positive (30.80 kU/L). The patient was advised to strictly avoid red meat. Discussion The prevalence of AGS has been increased in all continents in the past decade, and several Ixodidae species have been associated with this hypersensitivity. The list of IgE-mediated reactions to various types of meat has expanded to kangaroo, whale, seal, and crocodile, although these have not been associated with AGS. van Nunen only cautioned against consumption of exotic meats, such as buffalo, but no published case report describes AGS associated with anaphylaxis to this type of meat. Conclusion AGS is a mammalian meat allergy that has been increasingly prevalent worldwide, especially in Ixodidae endemic regions of Australia and the United States. Multiple AGS case reports published in the past decade demonstrate rapidly increasing understanding of underlying mechanisms provoking ongoing sensitization to help devise management strategies and dietary information. We offer the first case report of delayed anaphylaxis to buffalo meat.

This study reports change in the bird, mammal and amphibian fauna of the Emerald district, central Queensland, as detected from comparison of an inventory study undertaken in 1973–76, with a resurvey undertaken in 2001–02. Over this period, the region was subjected to unusually high rates of vegetation clearance, with the extent of native vegetation declining from 87% to 41%. In Australia, and elsewhere, there are remarkably few such long-term longitudinal studies, and particularly so for those that sample the same sites using identical procedures, and for those undertaken in a region of such dramatic environmental change. The ability to detect change from this dataset is constrained by the relatively small number of survey sites (24–45 survey sites, depending upon the taxonomic group considered). The interpretation of change is also affected by very different climatic conditions between the baseline and resurvey. Higher rainfall in the baseline survey period contributed to the most evident change, a major reduction in the number of waterbirds. However, even with waterbirds excluded, there was a significant change in the bird assemblage across the set of survey sites between the two periods. There were significant increases for a number of typically grassland birds (e.g. red-backed fairy-wren (Malurus melanocephalus), brown quail (Coturnix ypsilophora)) and significant decreases for a range of typically forest or woodland birds (e.g. grey shrike-thrush (Colluricincla harmonica), spiny-cheeked honeyeater (Acanthagenys rufogularis), striped honeyeater (Plectorhyncha lanceolata), grey fantail (Rhipidura fuliginosa)). These changes were largely maintained even when the dataset was restricted to only those sites that remained uncleared: that is, changes were evident not only across the changing landscape as a whole but there were also significant (consequential) changes at uncleared sites. Most of the native mammal species that were recorded sufficiently often to test for change showed a pattern of decline. Again, for some species (pale field-rat (Rattus tunneyi), greater glider (Petauroides volans) and eastern grey kangaroo (Macropus giganteus)), this decline occurred even within uncleared woodland sites. The most notable change in the frog fauna was the major increase in the exotic cane toad (Bufo marinus), but there were also significant declines for two native frog species. These results suggest a general trajectory of decline in distinctive woodland species, and their broad-scale replacement by more commensal species (weedy generalists favoured by human modification of the landscape).

Two new species of Paraopisthosyllis are described herein, P. correiae sp. nov. (State of Pernambuco, NE Brazil) and P. kuluguhin sp. nov. (Philippines). Paraopisthosyllis correiae sp. nov. represents the first record for the genus in Brazilian waters and it is also the second species known to occur outside the Pacific Ocean. This species is characterized by having a marked color pattern, with a transverse red stripe between dorsal cirri on each segment and an inverted V anteriorly and a V posteriorly on some segments, small papillae on body, large, distinct papillae on dorsal cirri, compound chaetae with elongated, bidentate blades, shafts with moderate subdistal serration on margin, pharyngeal tooth located on anterior third of pharynx, near the pharyngeal opening, and reproduction by schizogamy. Paraopisthosyllis kuluguhin sp. nov. represents the first report of the genus for the Philippines, together with P. pardus, originally known from Australia and also found in the Philippines in the present study. This new species is characterized by its color pattern, with dark patches irregularly distributed on anterior segments, forming one anterior pigmented short band and two lateral areas on each chaetiger after the proventricle, club-shaped dorsal cirri, and short, bidentate compound chaetae. Our findings allow us to synonymize the genus Basidiosyllis to Paraopisthosyllis and represent the first report of sexual stolons (scissiparity) in this genus, which supports its allocation into the subfamily Syllinae.

The resistance of a diverse range of Trifolium species (clovers) to a highly virulent bluegreen aphid (BGA, Acyrthosiphon kondoi Shinji) population (Urrbrae 2011) collected in South Australia was assessed in greenhouse and field experiments, with the aims of determining the potential impact of this insect pest on biomass and identifying resistant genotypes for future plant-breeding activities. Resistance to BGA was found in populations of clovers that show some level of outcrossing—white clover (T. repens L.), rose clover (T. hirtum All.), crimson clover (T. incarnatum L.) and red clover (T. pratense L.)—and in one entry of the inbreeding subspecies of subterranean clover, T. subterraneum L. subsp. subterraneum (Katzn. and Morley). Resistance was not found in T. s. brachycalycinum (Katzn. and Morley) or T. s. yanninicum (Katzn. and Morley). In a greenhouse experiment, damage from BGA resulted in forage yield penalties of 72–100% when aphids were inoculated at 14 days after sowing and 13−74% when inoculated at 42 days after sowing, showing that in optimum conditions BGA can be a serious pest of clovers. Observations of severe damage caused by BGA in two regenerating field trials in southern New South Wales confirmed that field damage could occur in seasons favourable to aphid growth and reproduction. The severe damage that BGA can cause to clovers, and the sources of resistance we found, suggest that breeding for BGA resistance in clovers is warranted and feasible.

The rarely encountered giant burrowing frog, Heleioporus australiacus, is distributed widely in a variety of sclerophyll forest habitats east of the Great Dividing Range in south-eastern Australia. Analyses of variation in nucleotide sequences of the mitochondrial ND4 gene and thousands of nuclear gene SNPs revealed the presence of two deeply divergent lineages. Multivariate morphological comparisons show the two lineages differ in body proportions with > 91% of individuals being correctly classified in DFA. The two lineages differ in the number and size of spots on the lateral surfaces and the degree by which the cloaca is surrounded by colour patches. The mating calls are significantly different in number of pulses in the note. The presence of a F2 hybrid in the area where the distribution of the two taxa come into closest proximity leads us to assign subspecies status to the lineages, as we have not been able to assess the extent of potential genetic introgression. In our sampling, the F2 hybrid sample sits within an otherwise unsampled gap of ~90km between the distributions of the two lineages. The nominate northern sub-species is restricted to the Sydney Basin bioregion, while the newly recognised southern subspecies occurs from south of the Kangaroo Valley in the mid-southern coast of New South Wales to near Walhalla in central Gippsland in Victoria. The habitat of the two subspecies is remarkably similar. Adults spend large portions of their lives on the forest floor where they forage and burrow in a variety of vegetation communities. The southern subspecies occurs most commonly in dry sclerophyll forests with an open understory in the south and in open forest and heath communities with a dense understory in the north of its distribution. The northern subspecies is also found in dry open forests and heaths in association with eroded sandstone landscapes in the Sydney Basin bioregion. Males of both taxa call from both constructed burrows and open positions on small streams, differing from the five Western Australian species of Heleioporus where males call only from constructed burrows. Using the IUCN Red List process, we found that the extent of occupancy and area of occupancy along with evidence of decline for both subspecies are consistent with the criteria for Endangered (A2(c)B2(a)(b)).

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

‘Xanthorrhoea…is in habit one of the most remarkable genera of Terra Australis, and gives a peculiar character to the vegetation of that part of the country where it abounds’ Robert Brown (1814). Grasstrees (arborescent Xanthorrhoea, Dasypogon, Kingia), with their crown of long narrow leaves and blackened leafbase-covered trunk (caudex), are a characteristic growth form in the Australian flora. Xanthorrhoea is the most widespread genus, with 28 species that are prominent from heathlands to sclerophyll forests. While leaf production for X. preissii reaches a peak in spring–summer, growth never stops even in the cool winter or dry autumn seasons. Summer rain, accompanied by a rapid rise in leaf water potential, may be sufficient to stimulate leaf production, whereas root growth is confined to the usual wet season. Grasstrees are highly flammable yet rarely succumb to fire: while retained dead leaves may reach >1000°C during fire, the temperature 100 mm above the stem apex remains <60°C and the roots are insulated completely. Immediately following fire, leaf production from the intact apical meristem is up to six times greater than that at unburnt sites. For X. preissii, pre-fire biomass is restored within 40 weeks; the mass of live leaves remains uniform from thereon, whereas the mass of dead leaves increases steadily. Leaves usually survive for >2 years. In X. preissii, the post-fire growth flush corresponds to a reduction in starch storage by desmium in the caudex. Minerals, especially P, are remobilised from the caudex to the crown following a spring fire, but accumulate there following an autumn fire. At least 80% of P is withdrawn from senescing leaves, while >95% K and Na are leached from dead leaves. Most stored N and S are volatilised by fire, with 1–85% of all minerals returned as ash. Despite monthly clipping for 16 months, X. preissii plants recover, although starch reserves are depleted by 90%, indicating considerable resilience to herbivory. Analysis of colour band patterns in the leafbases of X. preissii shows that elongation of the caudex may vary more than 5–50 mm per annum, with 10–20 mm being typical. Exceptionally tall plants (>3 m) may reach an age of 250 years, with a record at 450 years (6 m). Fires, recorded as black bands on the leafbases, in south-western Australia have been decreasing in frequency but increasing in variability since 1750–1850. Some grasstrees have survived a mean fire interval of 3–4 years over the last two centuries. In more recent times, some grasstrees have not been burnt for >50 years. The band-analysis technique has been used to show a downward trend in plant δ13C of 2–5.5‰ from 1935 to the present. Grasstrees are most likely to flower in the first spring after fire. A single inflorescence is initiated from the apical meristem, elongating at up to 100 mm day–1 and reaching a length up to 3 m, with one recorded at 5.5 m. This rapid rate of elongation is achieved through leaf (and inflorescence) photosynthesis and desmium starch mobilisation. The developing spike and seeds are vulnerable to a moth larva. Leaf production recommences from axillary buds and the trade-off with reproduction is equivalent to 240 leaves in X. preissii. Flowering and seed production are affected by time of fire. Grasstrees are mainly insect-pollinated. Up to 8000 seeds per spike are produced, although pre-dispersal granivory is common. Seeds are released in autumn and persist in the soil for <2 years. Most fresh seeds germinate in the laboratory but germination is inhibited by light. At any time, seedlings and juveniles may account for most plants in the population, although there may be up to an 80% reduction within 1 year of seedling emergence, often due to kangaroo herbivory. In the absence of fire, mortality of adults may be 4% per annum. Although few grasstree species are considered rare or threatened, their conservation requirements, especially in regard to a suitable fire regime, remain unknown. Grasstrees are particularly susceptible to the exotic root pathogen, Phytophthora cinnamomi, although recruitment among some species has been observed 20–30 years after pathogen invasion. Much remains to be known about the biology of this icon of the Australian bush.

Abstract STUDY QUESTION What was the utilization, effectiveness and safety of practices in ART globally in 2012 and what global trends could be observed? SUMMARY ANSWER The total number of ART cycles increased by almost 20% since 2011 and the main trends were an increase in frozen embryo transfers (FET), oocyte donation, preimplantation genetic testing and single embryo transfers (SET), whereas pregnancy and delivery rates (PR, DR) remained stable, and multiple deliveries decreased. WHAT IS KNOWN ALREADY ART is widely practiced throughout the world, but continues to be characterized by significant disparities in utilization, availability, practice, effectiveness and safety. The International Committee for Monitoring Assisted Reproductive Technologies (ICMART) annual world report provides a major tool for tracking trends in ART treatment for over 25 years and gives important data to ART professionals, public health authorities, patients and the general public. STUDY DESIGN, SIZE, DURATION A retrospective, cross-sectional survey on the utilization, effectiveness and safety of ART procedures performed globally during 2012 was carried out. PARTICIPANTS/MATERIALS, SETTING, METHODS Sixty-nine countries and 2600 ART clinics submitted data on ART cycles performed during the year 2012, and their pregnancy outcome, through national and regional ART registries. ART cycles and outcomes are described at country, regional and global levels. Aggregate country data were processed and analyzed based on methods developed by ICMART. MAIN RESULTS AND ROLE OF CHANCE A total of 1 149 817 ART cycles were reported for the treatment year 2012. After imputing data for missing values and non-reporting clinics in reporting countries, 1 948 898 cycles (an increase of 18.6% from 2011) resulted in &gt;465 286 babies (+17.9%) in reporting countries. China did not report and is not included in this estimate. The best estimate of global utilization including China is ∼2.8 million cycles and 0.9 million babies. From 2011 to 2012, the number of reported aspirations and FET cycles increased by 6.9% and 16.0%, respectively. The proportion of women aged 40 years or older undergoing non-donor ART increased from 24.0% in 2011 to 25.2% in 2012. ICSI, as a percentage of non-donor aspiration cycles, increased from 66.5% in 2011 to 68.9% in 2012. The IVF/ICSI combined delivery rates per fresh aspiration and FET cycles were 19.8% and 22.1%, respectively. In fresh non-donor cycles, SET increased from 31.4% in 2011 to 33.7% in 2012, while the average number of transferred embryos decreased from 1.91 to 1.88, respectively—but with wide country variation. The rates of twin deliveries following fresh non-donor transfers decreased from 19.6% in 2011 to 18.0% in 2012, and the triplet rate decreased from 0.9% to 0.8%. In FET non-donor cycles, SET was 54.8%, with an average of 1.54 embryos transferred and twin and triplet rates of 11.1% and 0.4%, respectively. The cumulative DR per aspiration increased from 28.0% in 2011 to 28.9% in 2012. The overall perinatal mortality rate per 1000 births was 21.4 following fresh IVF/ICSI and 15.9 per 1000 following FET. LIMITATIONS, REASONS FOR CAUTION The data presented depend on the quality and completeness of data submitted by individual countries to ICMART directly or through regional registries. This report covers approximately two-thirds of` world ART activity, with a major missing country, China. Continued efforts to improve the quality and consistency of reporting ART data by registries are still needed, including the use of internationally agreed standard definitions (International Glossary of Infertility and Fertility Care). WIDER IMPLICATIONS OF THE FINDINGS The ICMART world reports provide the most comprehensive global statistical census and review of ART utilization, effectiveness, safety and quality. While ART treatment continues to increase globally, the wide disparities in access to treatment, procedures performed and embryo transfer practices warrant attention by clinicians and policy makers. With the increasing practice of SET and of freeze all and resulting increased proportion of FET cycles, it is clear that PR and DR per aspiration in fresh cycles do not give an overall accurate estimation of ART efficiency. It is time to use cumulative live birth rate per aspiration, combining the outcomes of FET cycles with the associated fresh cycle from which the embryos were obtained, and to obtain global consensus on this approach. STUDY FUNDING/COMPETING INTEREST(S) The authors declare no conflict of interest and no specific support from any organizations in relation to this manuscript. ICMART gratefully acknowledges financial support from the following organizations: American Society for Reproductive Medicine; European Society for Human Reproduction and Embryology; Fertility Society of Australia; Japan Society for Reproductive Medicine; Japan Society of Fertilization and Implantation; Red Latinoamericana de Reproduccion Asistida; Society for Assisted Reproductive Technology; Ferring Pharmaceuticals and Abbott (both providing ICMART unrestricted grants unrelated to world reports). TRIAL REGISTRATION NUMBER NA.

This article explores how human and animal agencies shape the socio-ecological lifeworlds of kangaroos as cultural icons, native wildlife, problematic pests, and commercial meat in contemporary Australia. Kangaroos’ resistance to Western, colonial ways of knowing and ordering the world fundamentally challenged the classificatory logic and foundations of early natural science. Kangaroos’ biological and behavioral resistance to domestication and farming – the traditional loci of animal exploitation – speaks to their inherent wildness, at the same time as it reveals their complicated dependence on ecosystems adapted for introduced livestock. Meanwhile, kangaroos’ resistance to government-endorsed population control programs, and the contested logic of (over)abundance that justifies kangaroo culling, both challenges and legitimates human calculations of who and what “counts” as worth conserving or killing. In tandem, the sensorial and symbolic valences of kangaroo flesh, compounded with the growing voices of animal welfare movements, generate visceral and political resistance to kangaroo meat as an unpalatable foodstuff. The article further centers the polysemic valences of kangaroos as a form of resistance to symbolic unity and coherence. Existing as many things at once, kangaroos eschew classification and treatment as any one thing. Instead, their ontology multiplies across the many epistemologies vying to determine kangaroos’ actual being and future becoming. The article concludes by assessing the opportunities and challenges of centering resistance and its diverse epistemic, vitalist, symbolic, and carnal manifestations to understand animal lifeways and deathways amidst entrenched capitalist and colonial regimes, whose reproduction depends on the production of the non-human as “killable.”

Historians have often been compared with detectives; searching for clues as evidence of a mystery they are seeking to solve. I would prefer an association with food, making history like a trained cook who blends particular ingredients, some fresh, some traditional, using specific methods to create an object that is consumed. There are primary sources, fresh and raw ingredients that you often have to go to great lengths to procure, and secondary sources, prepared initially by someone else. The same recipe may yield different meals, the same meal may provoke different responses. On a continuum of approaches to history and food, there are those who approach both as a scientific endeavour and, at the other end of the spectrum, those who make history and food as art. Brought together, it is possible to see cookbooks as history in at least two important ways; they give meaning to the past by representing culinary heritage and they are in themselves sources of history as documents and blueprints for experiences that can be interpreted to represent the past. Many people read cookbooks and histories with no intention of preparing the meal or becoming a historian. I do a little of both. I enjoy reading history and cookbooks for pleasure but, as a historian, I also read them interchangeably; histories to understand cookbooks and cookbooks to find out more about the past. History and the past are different of course, despite their use in the English language. It is not possible to relive the past, we can only interpret it through the traces that remain. Even if a reader had an exact recipe and an antique stove, vegetables grown from heritage seeds in similar conditions, eggs and grains from the same region and employed the techniques his or her grandparents used, they could not replicate their experience of a meal. Undertaking those activities though would give a reader a sense of that experience. Active examination of the past is possible through the processes of research and writing, but it will always be an interpretation and not a reproduction of the past itself. Nevertheless, like other histories, cookbooks can convey a sense of what was important in a culture, and what contemporaries might draw on that can resonate a cultural past and make the food palatable. The way people eat relates to how they apply ideas and influences to the material resources and knowledge they have. Used in this way, cookbooks provide a rich and valuable way to look at the past. Histories, like cookbooks, are written in the present, inspired and conditioned by contemporary issues and attitudes and values. Major shifts in interpretation or new directions in historical studies have more often arisen from changes in political or theoretical preoccupations, generated by contemporary social events, rather than the recovery of new information. Likewise, the introduction of new ingredients or methods rely on contemporary acceptance, as well as familiarity. How particular versions of history and new recipes promote both the past and present is the concern of this paper. My focus below will be on the nineteenth century, although a much larger study would reveal the circumstances that separated that period from the changes that followed. Until the late nineteenth century Australians largely relied on cookbooks that were brought with them from England and on their own private recipe collection, and that influenced to a large extent the sort of food that they ate, although of course they had to improvise by supplementing with local ingredients. In the first book of recipes that was published in Australia, The English and Australian Cookery Book that appeared in 1864, Edward Abbott evoked the ‘roast beef of old England Oh’ (Bannerman, Dictionary). The use of such a potent symbol of English identity in the nineteenth century may seem inevitable, and colonists who could afford them tended to use their English cookbooks and the ingredients for many years, even after Abbott’s publication. New ingredients, however, were often adapted to fit in with familiar culinary expectations in the new setting. Abbott often drew on native and exotic ingredients to produce very familiar dishes that used English methods and principles: things like kangaroo stuffed with beef suet, breadcrumbs, parsley, shallots, marjoram, thyme, nutmeg, pepper, salt, cayenne, and egg. It was not until the 1890s that a much larger body of Australian cookbooks became available, but by this time the food supply was widely held to be secure and abundant and the cultivation of exotic foods in Australia like wheat and sheep and cattle had established a long and familiar food supply for English colonists. Abbott’s cookbook provides a record of the culinary heritage settlers brought with them to Australia and the contemporary circumstances they had to adapt to. Mrs Beeton’s Cookery Book and Household Guide is an example of the popularity of British cookbooks in Australia. Beeton’s Kangaroo Tail Curry was included in the Australian cooking section of her household management (2860). In terms of structure it is important for historians as one of the first times, because Beeton started writing in the 1860s, that ingredients were clearly distinguished from the method. This actually still presents considerable problems for publishers. There is debate about whether that should necessarily be the case, because it takes up so much space on the page. Kangaroo Tail CurryIngredients:1 tail2 oz. Butter1 tablespoon of flour1 tablespoon of curry2 onions sliced1 sour apple cut into dice1 desert spoon of lemon juice3/4 pint of stocksaltMethod:Wash, blanch and dry the tail thoroughly and divide it at the joints. Fry the tail in hot butter, take it up, put it in the sliced onions, and fry them for 3 or 4 minutes without browning. Sprinkle in the flour and curry powder, and cook gently for at least 20 minutes, stirring frequently. Add the stock, apple, salt to taste, bring to the boil, stirring meanwhile, and replace the tail in the stew pan. Cover closely, and cook gently until tender, then add the lemon juice and more seasoning if necessary. Arrange the pieces of tail on a hot dish, strain the sauce over, and serve with boiled rice.Time: 2-3 hoursSufficient for 1 large dish. Although the steps are not clearly distinguished from each other the method is more systematic than earlier recipes. Within the one sentence, however, there are still two or three different sorts of tasks. The recipe also requires to some extent a degree of discretion, knowledge and experience of cooking. Beeton suggests adding things to taste, cooking something until it is tender, so experience or knowledge is necessary to fulfil the recipe. The meal also takes between two and three hours, which would be quite prohibitive for a lot of contemporary cooks. New recipes, like those produced in Delicious have recipes that you can do in ten minutes or half an hour. Historically, that is a new development that reveals a lot about contemporary conditions. By 1900, Australian interest in native food had pretty much dissolved from the record of cookbooks, although this would remain a feature of books for the English public who did not need to distinguish themselves from Indigenous people. Mrs Beeton’s Cookery Book and Household Guide gave a selection of Australian recipes but they were primarily for the British public rather than the assumption that they were being cooked in Australia: kangaroo tail soup was cooked in the same way as ox tail soup; roast wallaby was compared to hare. The ingredients were wallaby, veal, milk and butter; and parrot pie was said to be not unlike one made of pigeons. The novelty value of such ingredients may have been of interest, rather than their practical use. However, they are all prepared in ways that would make them fairly familiar to European tastes. Introducing something new with the same sorts of ingredients could therefore proliferate the spread of other foods. The means by which ingredients were introduced to different regions reflects cultural exchanges, historical processes and the local environment. The adaptation of recipes to incorporate local ingredients likewise provides information about local traditions and contemporary conditions. Starting to see those ingredients as a two-way movement between looking at what might have been familiar to people and what might have been something that they had to do make do with because of what was necessarily available to them at that time tells us about their past as well as the times they are living in. Differences in the level of practical cooking knowledge also have a vital role to play in cookbook literature. Colin Bannerman has suggested that the shortage of domestic labour in Australia an important factor in supporting the growth of the cookbook industry in the late nineteenth century. The poor quality of Australian cooking was also an occasional theme in the press during the same time. The message was generally the same: bad food affected Australians’ physical, domestic, social and moral well-being and impeded progress towards civilisation and higher culture. The idea was really that Australians had to learn how to cook. Colin Bannerman (Acquired Tastes 19) explains the rise of domestic science in Australia as a product of growing interest in Australian cultural development and the curse of bad cookery, which encouraged support for teaching girls and women how to cook. Domestic Economy was integrated into the Victorian and New South Wales curriculum by the end of the nineteenth century. Australian women have faced constant criticism of their cooking skills but the decision to teach cooking shouldn’t necessarily be used to support that judgement. Placed in a broader framework is possible to see the support for a modern, scientific approach to food preparation as part of both the elevation of science and systematic knowledge in society more generally, and a transnational movement to raise the status of women’s role in society. It would also be misleading not to consider the transnational context. Australia’s first cookery teachers were from Britain. The domestic-science movement there can be traced to the congress on domestic economy held in Manchester in 1878, at roughly the same time as the movement was gaining strength in Australia. By the 1890s domestic economy was widely taught in both British and Australian schools, without British women facing the same denigration of their cooking skills. Other comparisons with Britain also resulted from Australia’s colonial heritage. People often commented on the quality of the ingredients in Australia and said they were more widely available than they were in England but much poorer in quality. Cookbooks emerged as a way of teaching people. Among the first to teach cookery skills was Mina Rawson, author of The Antipodean Cookery Book and the Kitchen Companion first published in 1885. The book was a compilation of her own recipes and remedies, and it organised and simplified food preparation for the ordinary housewife. But the book also included directions and guidance on things like household tasks and how to cure diseases. Cookbooks therefore were not completely distinct from other aspects of everyday life. They offered much more than culinary advice on how to cook a particular meal and can similarly be used by historians to comment on more than food. Mrs Rawson also knew that people had to make do. She included a lot of bush foods that you still do not get in a lot of Australian meals, ingredients that people could substitute for the English ones they were used to like pig weed. By the end of the nineteenth century cooking had become a recognised classroom subject, providing early training in domestic service, and textbooks teaching Australians how to cook also flourished. Measurements became much more uniform, the layout of cookbooks became more standardised and the procedure was clearly spelled out. This allowed companies to be able to sell their foods because it also meant that you could duplicate the recipes and they could potentially taste the same. It made cookbooks easier to use. The audience for these cookbooks were mostly young women directed to cooking as a way of encouraging social harmony. Cooking was elevated in lots of ways at this stage as a social responsibility. Cookbooks can also be seen as a representation of domestic life, and historically this prescribed the activities of men and women as being distinct The dominance of women in cookbooks in the nineteenth and early twentieth centuries attested to the strength of that idea of separate spheres. The consequences of this though has been debated by historians: whether having that particular kind of market and the identification that women were making with each other also provided a forum for women’s voices and so became quite significant in women’s politics at a later date. Cookbooks have been a strategic marketing device for products and appliances. By the beginning of the twentieth century food companies began to print recipes on their packets and to release their own cookbooks to promote their products. Davis Gelatine produced its first free booklet in 1904 and other companies followed suit (1937). The largest gelatine factory was in New South Wales and according to Davis: ‘It bathed in sunshine and freshened with the light breezes of Botany all year round.’ These were the first lavishly illustrated Australian cookbooks. Such books were an attempt to promote new foods and also to sell local foods, many of which were overproduced – such as milk, and dried fruits – which provides insights into the supply chain. Cookbooks in some ways reflected the changing tastes of the public, their ideas, what they were doing and their own lifestyle. But they also helped to promote some of those sorts of changes too. Explaining the reason for cooking, Isabella Beeton put forward an historical account of the shift towards increasing enjoyment of it. She wrote: "In the past, only to live has been the greatest object of mankind, but by and by comforts are multiplied and accumulating riches create new wants. The object then is to not only live but to live economically, agreeably, tastefully and well. Accordingly the art of cookery commences and although the fruits of the earth, the fowls of the air, the beasts of the field and the fish of the sea are still the only food of mankind, yet these are so prepared, improved and dressed by skill and ingenuity that they are the means of immeasurably extending the boundaries of human enjoyment. Everything that is edible and passes under the hands of cooks is more or less changed and assumes new forms, hence the influence of that functionary is immense upon the happiness of the household" (1249). Beeton anticipates a growing trend not just towards cooking and eating but an interest in what sustains cooking as a form of recreation. The history of cookbook publishing provides a glimpse into some of those things. The points that I have raised provide a means for historians to use cookbooks. Cookbooks can be considered in terms of what was eaten, by whom and how: who prepared the food, so to whom the books were actually directed? Clever books like Isabella Beeton’s were directed at both domestic servants and at wives, which gave them quite a big market. There are also changes in the inclusion of themes. Economy and frugality becomes quite significant, as do organisation and management at different times. Changes in the extent of detail, changes in authorship, whether it is women, men, doctors, health professionals, home economists and so on all reflect contemporary concerns. Many books had particular purposes as well, used to fund raise or promote a particular perspective, relate food reform and civic life which gives them a political agenda. Promotional literature produced by food and kitchen equipment companies were a form of advertising and quite significant to the history of cookbook publishing in Australia. Other themes include the influence of cookery school and home economics movements; advice on etiquette and entertaining; the influence of immigration and travel; the creation of culinary stars and authors of which we are all fairly familiar. Further themes include changes in ingredients, changes in advice about health and domestic medicine, and the impact of changes in social consciousness. It is necessary to place those changes in a more general historical context, but for a long time cookbooks have been ignored as a source of information in their own right about the period in which they were published and the kinds of social and political changes that we can see coming through. More than this active process of cooking with the books as well becomes a way of imagining the past in quite different ways than historians are often used to. Cookbooks are not just sources for historians, they are histories in themselves. The privileging of written and visual texts in postcolonial studies has meant other senses, taste and smell, are frequently neglected; and yet the cooking from historical cookbooks can provide an embodied, sensorial image of the past. From nineteenth century cookbooks it is possible to see that British foods were central to the colonial identity project in Australia, but the fact that “British” culinary culture was locally produced, challenges the idea of an “authentic” British cuisine which the colonies tried to replicate. By the time Abbot was advocating rabbit curry as an Australian family meal, back “at home” in England, it was not authentic Indian food but the British invention of curry power that was being incorporated into English cuisine culture. More than cooks, cookbook authors told a narrative that forged connections and disconnections with the past. They reflected the contemporary period and resonated with the culinary heritage of their readers. Cookbooks make history in multiple ways; by producing change, as the raw materials for making history and as historical narratives. References Abbott, Edward. The English and Australian Cookery Book: Cookery for the Many, as well as the Upper Ten Thousand. London: Sampson Low, Son & Marston, 1864. Bannerman, Colin. Acquired Tastes: Celebrating Australia’s Culinary History. Canberra: National Library of Australia, 1998. Bannerman, Colin. "Abbott, Edward (1801–1869)." Australian Dictionary of Biography. National Centre of Biography, Australian National University. 21 May 2013. . Beeton, Isabella. Mrs Beeton’s Book of Household Management. New Ed. London and Melbourne: Ward, Lock and Co. Ltd., n.d. (c. 1909). Davis Gelatine. Davis Dainty Dishes. Rev ed. Sydney: Davis Gelatine Organization, 1937. Rawson, Lance Mrs. The Antipodean Cookery Book and Kitchen Companion. Melbourne: George Robertson & Co., 1897.

Kangatarianism is the rather inelegant word coined in the first decade of the twenty-first century to describe an omnivorous diet in which the only meat consumed is that of the kangaroo. First published in the media in 2010 (Barone; Zukerman), the term circulated in Australian environmental and academic circles including the Global Animal conference at the University of Wollongong in July 2011 where I first heard it from members of the Think Tank for Kangaroos (THINKK) group. By June 2017, it had gained enough attention to be named the Oxford English Dictionary’s Australian word of the month (following on from May’s “smashed avo,” another Australian food innovation), but it took the Nine Network reality television series Love Island Australia to raise kangatarian to trending status on social media (Oxford UP). During the first episode, aired in late May 2018, Justin, a concreter and fashion model from Melbourne, declared himself to have previously been a kangatarian as he chatted with fellow contestant, Millie. Vet nurse and animal lover Millie appeared to be shocked by his revelation but was tentatively accepting when Justin explained what kangatarian meant, and justified his choice on the grounds that kangaroo are not farmed. In the social media response, it was clear that eating only the meat of kangaroos as an ethical choice was an entirely new concept to many viewers, with one tweet stating “Kangatarian isn’t a thing”, while others variously labelled the diet brutal, intriguing, or quintessentially Australian (see #kangatarian on Twitter).There is a well developed literature around the arguments for and against eating kangaroo, and why settler Australians tend to be so reluctant to do so (see for example, Probyn; Cawthorn and Hoffman). Here, I will concentrate on the role that ethics play in this food choice by examining how the adoption of kangatarianism can be understood as a bargain struck to help to manage grief in the Anthropocene, and the limitations of that bargain. As Lesley Head has argued, we are living in a time of loss and of grieving, when much that has been taken for granted is becoming unstable, and “we must imagine that drastic changes to everyday life are in the offing” (313). Applying the classic (and contested) model of five stages of grief, first proposed by Elisabeth Kübler-Ross in her book On Death and Dying in 1969, much of the population of the western world seems to be now experiencing denial, her first stage of loss, while those in the most vulnerable environments have moved on to anger with developed countries for destructive actions in the past and inaction in the present. The next stages (or states) of grieving—bargaining, depression, and acceptance—are likely to be manifested, although not in any predictable sequence, as the grief over current and future losses continues (Haslam).The great expansion of food restrictive diets in the Anthropocene can be interpreted as part of this bargaining state of grieving as individuals attempt to respond to the imperative to reduce their environmental impact but also to limit the degree of change to their own diet required to do so. Meat has long been identified as a key component of an individual’s environmental footprint. From Frances Moore Lappé’s 1971 Diet for a Small Planet through the United Nations’ Food and Agriculture Organisation’s 2006 report Livestock’s Long Shadow to the 2019 report of the EAT–Lancet Commission on Healthy Diets from Sustainable Food Systems, the advice has been consistent: meat consumption should be minimised in, if not eradicated from, the human diet. The EAT–Lancet Commission Report quantified this to less than 28 grams (just under one ounce) of beef, lamb or pork per day (12, 25). For many this would be keenly felt, in terms of how meals are constructed, the sensory experiences associated with eating meat and perceptions of well-being but meat is offered up as a sacrifice to bring about the return of the beloved healthy planet.Rather than accept the advice to cut out meat entirely, those seeking to bargain with the Anthropocene also find other options. This has given rise to a suite of foodways based around restricting meat intake in volume or type. Reducing the amount of commercially produced beef, lamb and pork eaten is one approach, while substituting a meat the production of which has a smaller environmental footprint, most commonly chicken or fish, is another. For those willing to make deeper changes, the meat of free living animals, especially those which are killed accidentally on the roads or for deliberately for environmental management purposes, is another option. Further along this spectrum are the novel protein sources suggested in the Lancet report, including insects, blue-green algae and laboratory-cultured meats.Kangatarianism is another form of this bargain, and is backed by at least half a century of advocacy. The Australian Conservation Foundation made calls to reduce the numbers of other livestock and begin a sustainable harvest of kangaroo for food in 1970 when the sale of kangaroo meat for human consumption was still illegal across the country (Conservation of Kangaroos). The idea was repeated by biologist Gordon Grigg in the late 1980s (Jackson and Vernes 173), and again in the Garnaut Climate Change Review in 2008 (547–48). Kangaroo meat is high in protein and iron, low in fat, and high in healthy polyunsaturated fatty acids and conjugated linoleic acid, and, as these authors showed, has a smaller environmental footprint than beef, lamb, or pork. Kangaroo require less water than cattle, sheep or pigs, and no land is cleared to grow feed for them or give them space to graze. Their paws cause less erosion and compaction of soil than do the hooves of common livestock. They eat less fodder than ruminants and their digestive processes result in lower emissions of the powerful greenhouse gas methane and less solid waste.As Justin of Love Island was aware, kangaroo are not farmed in the sense of being deliberately bred, fed, confined, or treated with hormones, drugs or chemicals, which also adds to their lighter impact on the environment. However, some pastoralists argue that because they cannot prevent kangaroos from accessing the food, water, shelter, and protection from predators they provide for their livestock, they do effectively farm them, although they receive no income from sales of kangaroo meat. This type of light touch farming of kangaroos has a very long history in Australia going back to the continent’s first peopling some 60,000 years ago. Kangaroos were so important to Aboriginal people that a wide range of environments were manipulated to produce their favoured habitats of open grasslands edged by sheltering trees. As Bill Gammage demonstrated, fire was used as a tool to preserve and extend grassy areas, to encourage regrowth which would attract kangaroos and to drive the animals from one patch to another or towards hunters waiting with spears (passim, for example, 58, 72, 76, 93). Gammage and Bruce Pascoe agree that this was a form of animal husbandry in which the kangaroos were drawn to the areas prepared for them for the young grass or, more forcefully, physically directed using nets, brush fences or stone walls. Burnt ground served to contain the animals in place of fencing, and regular harvesting kept numbers from rising to levels which would place pressure on other species (Gammage 79, 281–86; Pascoe 42–43). Contemporary advocates of eating kangaroo have promoted the idea that they should be deliberately co-produced with other livestock instead of being killed to preserve feed and water for sheep and cattle (Ellicott; Wilson 39). Substituting kangaroo for the meat of more environmentally damaging animals would facilitate a reduction in the numbers of cattle and sheep, lessening the harm they do.Most proponents have assumed that their audience is current meat eaters who would substitute kangaroo for the meat of other more environmentally costly animals, but kangatarianism can also emerge from vegetarianism. Wendy Zukerman, who wrote about kangaroo hunting for New Scientist in 2010, was motivated to conduct the research because she was considering becoming an early adopter of kangatarianism as the least environmentally taxing way to counter the longterm anaemia she had developed as a vegetarian. In 2018, George Wilson, honorary professor in the Australian National University’s Fenner School of Environment and Society called for vegetarians to become kangatarians as a means of boosting overall consumption of kangaroo for environmental and economic benefits to rural Australia (39).Given these persuasive environmental arguments, it might be expected that many people would have perceived eating kangaroo instead of other meat as a favourable bargain and taken up the call to become kangatarian. Certainly, there has been widespread interest in trying kangaroo meat. In 1997, only five years after the sale of kangaroo meat for human consumption had been legalised in most states (South Australia did so in 1980), 51% of 500 people surveyed in five capital cities said they had tried kangaroo. However, it had not become a meat of choice with very few found to eat it more than three times a year (Des Purtell and Associates iv). Just over a decade later, a study by Ampt and Owen found an increase to 58% of 1599 Australians surveyed across the country who had tried kangaroo but just 4.7% eating it at least monthly (14). Bryce Appleby, in his study of kangaroo consumption in the home based on interviews with 28 residents of Wollongong in 2010, specifically noted the absence of kangatarians—then a very new concept. A study of 261 Sydney university students in 2014 found that half had tried kangaroo meat and 10% continued to eat it with any regularity. Only two respondents identified themselves as kangatarian (Grant 14–15). Kangaroo meat advocate Michael Archer declared in 2017 that “there’s an awful lot of very, very smart vegetarians [who] have opted for semi vegetarianism and they’re calling themselves ‘kangatarians’, as they’re quite happy to eat kangaroo meat”, but unless there had been a significant change in a few years, the surveys did not bear out his assertion (154).The ethical calculations around eating kangaroo are complicated by factors beyond the strictly environmental. One Tweeter advised Justin: “‘I’m a kangatarian’ isn’t a pickup line, mate”, and certainly the reception of his declaration could have been very cool, especially as it was delivered to a self declared animal warrior (N’Tash Aha). All of the studies of beliefs and practices around the eating of kangaroo have noted a significant minority of Australians who would not consider eating kangaroo based on issues of animal welfare and animal rights. The 1997 study found that 11% were opposed to the idea of eating kangaroo, while in Grant’s 2014 study, 15% were ethically opposed to eating kangaroo meat (Des Purtell and Associates iv; Grant 14–15). Animal ethics complicate the bargains calculated principally on environmental grounds.These ethical concerns work across several registers. One is around the flesh and blood kangaroo as a charismatic native animal unique to Australia and which Australians have an obligation to respect and nurture. Sheep, cattle and pigs have been subject to longterm propaganda campaigns which entrench the idea that they are unattractive and unintelligent, and veil their transition to meat behind euphemistic language and abattoir walls, making it easier to eat them. Kangaroos are still seen as resourceful and graceful animals, and no linguistic tricks shield consumers from the knowledge that it is a roo on their plate. A proposal in 2009 to market a “coat of arms” emu and kangaroo-flavoured potato chip brought complaints to the Advertising Standards Bureau that this was disrespectful to these native animals, although the flavours were to be simulated and the product vegetarian (Black). Coexisting with this high regard to kangaroos is its antithesis. That is, a valuation of them informed by their designation as a pest in the pastoral industry, and the use of the carcasses of those killed to feed dogs and other companion animals. Appleby identified a visceral, disgust response to the idea of eating kangaroo in many of his informants, including both vegetarians who would not consider eating kangaroo because of their commitment to a plant-based diet, and at least one omnivore who would prefer to give up all meat rather than eat kangaroo. While diametrically opposed, the end point of both positions is that kangaroo meat should not be eaten.A second animal ethics stance relates to the imagined kangaroo, a cultural construct which for most urban Australians is much more present in their lives and likely to shape their actions than the living animals. It is behind the rejection of eating an animal which holds such an iconic place in Australian culture: to the dexter on the 1912 national coat of arms; hopping through the Hundred Acre Wood as Kanga and Roo in A.A. Milne’s Winnie-the-Pooh children’s books from the 1920s and the Disney movies later made from them; as a boy’s best friend as Skippy the Bush Kangaroo in a fondly remembered 1970s television series; and high in the sky on QANTAS planes. The anthropomorphising of kangaroos permitted the spectacle of the boxing kangaroo from the late nineteenth century. By framing natural kangaroo behaviours as boxing, these exhibitions encouraged an ambiguous understanding of kangaroos as human-like, moving them further from the category of food (Golder and Kirkby). Australian government bodies used this idea of the kangaroo to support food exports to Britain, with kangaroos as cooks or diners rather than ingredients. The Kangaroo Kookery Book of 1932 (see fig. 1 below) portrayed kangaroos as a nuclear family in a suburban kitchen and another official campaign supporting sales of Australian produce in Britain in the 1950s featured a Disney-inspired kangaroo eating apples and chops washed down with wine (“Kangaroo to Be ‘Food Salesman’”). This imagining of kangaroos as human-like has persisted, leading to the opinion expressed in a 2008 focus group, that consuming kangaroo amounted to “‘eating an icon’ … Although they are pests they are still human nature … these are native animals, people and I believe that is a form of cannibalism!” (Ampt and Owen 26). Figure 1: Rather than promoting the eating of kangaroos, the portrayal of kangaroos as a modern suburban family in the Kangaroo Kookery Book (1932) made it unthinkable. (Source: Kangaroo Kookery Book, Director of Australian Trade Publicity, Australia House, London, 1932.)The third layer of ethical objection on the ground of animal welfare is more specific, being directed to the method of killing the kangaroos which become food. Kangaroos are perhaps the only native animals for which state governments set quotas for commercial harvest, on the grounds that they compete with livestock for pasturage and water. In most jurisdictions, commercially harvested kangaroo carcasses can be processed for human consumption, and they are the ones which ultimately appear in supermarket display cases.Kangaroos are killed by professional shooters at night using swivelling spotlights mounted on their vehicles to locate and daze the animals. While clean head shots are the ideal and regulations state that animals should be killed when at rest and without causing “undue agonal struggle”, this is not always achieved and some animals do suffer prolonged deaths (NSW Code of Practice for Kangaroo Meat for Human Consumption). By regulation, the young of any female kangaroo must be killed along with her. While averting a slow death by neglect, this is considered cruel and wasteful. The hunt has drawn international criticism, including from Greenpeace which organised campaigns against the sale of kangaroo meat in Europe in the 1980s, and Viva! which was successful in securing the withdrawal of kangaroo from sale in British supermarkets (“Kangaroo Meat Sales Criticised”). These arguments circulate and influence opinion within Australia.A final animal ethics issue is that what is actually behind the push for greater use of kangaroo meat is not concern for the environment or animal welfare but the quest to turn a profit from these animals. The Kangaroo Industries Association of Australia, formed in 1970 to represent those who dealt in the marsupials’ meat, fur and skins, has been a vocal advocate of eating kangaroo and a sponsor of market research into how it can be made more appealing to the market. The Association argued in 1971 that commercial harvest was part of the intelligent conservation of the kangaroo. They sought minimum size regulations to prevent overharvesting and protect their livelihoods (“Assn. Backs Kangaroo Conservation”). The Association’s current website makes the claim that wild harvested “Australian kangaroo meat is among the healthiest, tastiest and most sustainable red meats in the world” (Kangaroo Industries Association of Australia). That this is intended to initiate a new and less controlled branch of the meat industry for the benefit of hunters and processors, rather than foster a shift from sheep or cattle to kangaroos which might serve farmers and the environment, is the opinion of Dr. Louise Boronyak, of the Centre for Compassionate Conservation at the University of Technology Sydney (Boyle 19).Concerns such as these have meant that kangaroo is most consumed where it is least familiar, with most of the meat for human consumption recovered from culled animals being exported to Europe and Asia. Russia has been the largest export market. There, kangaroo meat is made less strange by blending it with other meats and traditional spices to make processed meats, avoiding objections to its appearance and uncertainty around preparation. With only a low profile as a novelty animal in Russia, there are fewer sentimental concerns about consuming kangaroo, although the additional food miles undermine its environmental credentials. The variable acceptability of kangaroo in more distant markets speaks to the role of culture in determining how patterns of eating are formed and can be shifted, or, as Elspeth Probyn phrased it “how natural entities are transformed into commodities within a context of globalisation and local communities”, underlining the impossibility of any straightforward ethics of eating kangaroo (33, 35).Kangatarianism is a neologism which makes the eating of kangaroo meat something it has not been in the past, a voluntary restriction based on environmental ethics. These environmental benefits are well founded and eating kangaroo can be understood as an Anthropocenic bargain struck to allow the continuation of the consumption of red meat while reducing one’s environmental footprint. Although superficially attractive, the numbers entering into this bargain remain small because environmental ethics cannot be disentangled from animal ethics. The anthropomorphising of the kangaroo and its use as a national symbol coexist with its categorisation as a pest and use of its meat as food for companion animals. Both understandings of kangaroos made their meat uneatable for many Australians. Paired with concerns over how kangaroos are killed and the commercialisation of a native species, kangaroo meat has a very mixed reception despite decades of advocacy for eating its meat in favour of that of more harmed and more harmful introduced species. Given these constraints, kangatarianism is unlikely to become widespread and indeed it should be viewed as at best a temporary exigency. As the climate warms and rainfall becomes more erratic, even animals which have evolved to suit Australian conditions will come under increasing pressure, and humans will need to reach Kübler-Ross’ final state of grief: acceptance. In this case, this would mean acceptance that our needs cannot be placed ahead of those of other animals.ReferencesAmpt, Peter, and Kate Owen. Consumer Attitudes to Kangaroo Meat Products. Canberra: Rural Industries Research and Development Corporation, 2008.Appleby, Bryce. “Skippy the ‘Green’ Kangaroo: Identifying Resistances to Eating Kangaroo in the Home in a Context of Climate Change.” BSc Hons, U of Wollongong, 2010 <http://ro.uow.edu.au/thsci/103>.Archer, Michael. “Zoology on the Table: Plenary Session 4.” Australian Zoologist 39, 1 (2017): 154–60.“Assn. Backs Kangaroo Conservation.” The Beverley Times 26 Feb. 1971: 3. 22 Feb. 2019 <http://nla.gov.au/nla.news-article202738733>.Barone, Tayissa. “Kangatarians Jump the Divide.” Sydney Morning Herald 9 Feb. 2010. 13 Apr. 2019 <https://www.smh.com.au/lifestyle/kangatarians-jump-the-divide-20100209-gdtvd8.html>.Black, Rosemary. “Some Australians Angry over Idea for Kangaroo and Emu-Flavored Potato Chips.” New York Daily News 4 Dec. 2009. 5 Feb. 2019 <https://www.nydailynews.com/life-style/eats/australians-angry-idea-kangaroo-emu-flavored-potato-chips-article-1.431865>.Boyle, Rhianna. “Eating Skippy.” Big Issue Australia 578 11-24 Jan. 2019: 16–19.Cawthorn, Donna-Mareè, and Louwrens C. Hoffman. “Controversial Cuisine: A Global Account of the Demand, Supply and Acceptance of ‘Unconventional’ and ‘Exotic’ Meats.” Meat Science 120 (2016): 26–7.Conservation of Kangaroos. Melbourne: Australian Conservation Foundation, 1970.Des Purtell and Associates. Improving Consumer Perceptions of Kangaroo Products: A Survey and Report. Canberra: Rural Industries Research and Development Corporation, 1997.Ellicott, John. “Little Pay Incentive for Shooters to Join Kangaroo Meat Industry.” The Land 15 Mar. 2018. 28 Mar. 2019 <https://www.theland.com.au/story/5285265/top-roo-shooter-says-harvesting-is-a-low-paid-job/>.Garnaut, Ross. Garnaut Climate Change Review. 2008. 26 Feb. 2019 <http://www.garnautreview.org.au/index.htm>.Gammage, Bill. The Biggest Estate on Earth: How Aborigines Made Australia. Sydney: Allen and Unwin, 2012.Golder, Hilary, and Diane Kirkby. “Mrs. Mayne and Her Boxing Kangaroo: A Married Woman Tests Her Property Rights in Colonial New South Wales.” Law and History Review 21.3 (2003): 585–605.Grant, Elisabeth. “Sustainable Kangaroo Harvesting: Perceptions and Consumption of Kangaroo Meat among University Students in New South Wales.” Independent Study Project (ISP). U of NSW, 2014. <https://digitalcollections.sit.edu/isp_collection/1755>.Haslam, Nick. “The Five Stages of Grief Don’t Come in Fixed Steps – Everyone Feels Differently.” The Conversation 22 Oct. 2018. 28 Mar. 2019 <https://theconversation.com/the-five-stages-of-grief-dont-come-in-fixed-steps-everyone-feels-differently-96111>.Head, Lesley. “The Anthropoceans.” Geographical Research 53.3 (2015): 313–20.Kangaroo Industries Association of Australia. Kangaroo Meat. 26 Feb. 2019 <http://www.kangarooindustry.com/products/meat/>.“Kangaroo Meat Sales Criticised.” The Canberra Times 13 Sep. 1984: 14. 22 Feb 2019 <http://nla.gov.au/nla.news-article136915919>.“Kangaroo to Be Food ‘Salesman.’” Newcastle Morning Herald and Miners’ Advocate, 2 Dec. 1954. 22 Feb 2019 <http://nla.gov.au/nla.news-article134089767>.Kübler-Ross, Elisabeth. On Death and Dying: What the Dying Have to Teach Doctors, Nurses, Clergy, and their own Families. New York: Touchstone, 1997.Jackson, Stephen, and Karl Vernes. Kangaroo: Portrait of an Extraordinary Marsupial. Sydney: Allen and Unwin, 2010.Lappé, Frances Moore. Diet for a Small Planet. New York: Ballantine Books, 1971.N’Tash Aha (@Nsvasey). “‘I’m a Kangatarian’ isn’t a Pickup Line, Mate. #LoveIslandAU.” Twitter post. 27 May 2018. 5 Apr. 2019 <https://twitter.com/Nsvasey/status/1000697124122644480>.“NSW Code of Practice for Kangaroo Meat for Human Consumption.” Government Gazette of the State of New South Wales 24 Mar. 1993. 22 Feb. 2019 <http://nla.gov.au/nla.news-page14638033>.Oxford University Press, Australia and New Zealand. Word of the Month. June 2017. <https://www.oup.com.au/dictionaries/word-of-the-month>.Pascoe, Bruce. Dark Emu, Black Seeds: Agriculture or Accident? Broome: Magabala Books, 2014.Probyn, Elspeth. “Eating Roo: Of Things That Become Food.” New Formations 74.1 (2011): 33–45.Steinfeld, Henning, Pierre Gerber, Tom Wassenaar, Vicent Castel, Mauricio Rosales, and Cees d Haan. Livestock’s Long Shadow: Environmental Issues and Options. Rome: Food and Agriculture Organisation of the United Nations, 2006.Trust Nature. Essence of Kangaroo Capsules. 26 Feb. 2019 <http://ncpro.com.au/products/all-products/item/88139-essence-of-kangaroo-35000>.Victoria Department of Environment, Land, Water and Planning. Kangaroo Pet Food Trial. 28 Mar. 2019 <https://www.wildlife.vic.gov.au/managing-wildlife/wildlife-management-and-control-authorisations/kangaroo-pet-food-trial>.Willett, Walter, et al. “Food in the Anthropocene: The EAT–Lancet Commission on Healthy Diets from Sustainable Food Systems.” The Lancet 16 Jan. 2019. 26 Feb. 2019 <https://www.thelancet.com/commissions/EAT>.Wilson, George. “Kangaroos Can Be an Asset Rather than a Pest.” Australasian Science 39.1 (2018): 39.Zukerman, Wendy. “Eating Skippy: The Future of Kangaroo Meat.” New Scientist 208.2781 (2010): 42–5.

AbstractInvasive predators, land clearing and altered fire regimes have been implicated in species decline and extinction worldwide. Enhanced knowledge of how these factors interact and influence medium-sized mammals is warranted. We tested three hypotheses using occupancy data for a diverse mammal assemblage including three threatened species, five common species, two introduced mesopredators and an apex predator in eastern Australia. We hypothesised that occupancy of mammal species within the assemblage would be influenced by (i) the physical environment (rainfall, vegetation type and elevation), (ii) habitat disturbance (number of fires and habitat fragmentation) and (iii) mesopredator release, whereby occupancy and/or detection of medium-sized mammals are influenced by mesopredators, the feral cat (Felis catus) and the red fox (Vulpes vulpes), which are influenced by an apex predator, the dingo (Canis familiaris). We utilised camera-trapping data from 173 sites (692 camera locations) across a north–south gradient spanning ~ 1500 km in eastern Australia. Although hypotheses i (physical environment) and ii (habitat disturbance) are not mutually exclusive, we show that the variables considered in each were only weakly correlated. We conducted occupancy modelling to investigate the physical environment and habitat disturbance hypotheses. We conducted co-occurrence modelling to investigate interactions between species. The physical environment hypothesis best supported occupancy models for six mammal species: red-necked pademelon (Thylogale thetis), bandicoots (Isoodon macrourus and Perameles nasuta), swamp wallaby (Wallabia bicolor), red-necked wallaby (Macropus rufogriseus), eastern grey kangaroo (Macropus giganteus) and feral cat. The disturbance hypothesis best supported occupancy models for four mammal species: long-nosed potoroo (Potorous tridactylus), red-necked pademelon and both mesopredators. Support for the mesopredator release hypothesis was equivocal. Large macropods showed site avoidance towards the red fox. Four species showed higher detection at sites where mesopredators were not detected. The fox showed a negative detection interaction to the dingo and the cat did not. Our study highlights how factors such as rainfall, land clearing, elevation and number of fires influence the occupancy of species within a diverse mammal assemblage at the macroecological scale. Our findings have implications for the conservation of threatened species in managed landscapes and suggestions for further research following the recent 2019–2020 wildfires.

Abstract This study provided biological information on 146 specimens of the poorly known deepwater mastigoteuthid squid Idioteuthis cordiformis. Mantle length ranged from 200–500 mm for males and 270–702 mm for females. The largest female weighed just under 12 kg. The majority of males were mature and all females were immature. The fins were larger and thicker than the mantle. Mantle weight of males and females was 44.8% and 55.2% of fin weight, respectively, and were significantly different. There was a significant sex effect on mantle length, total weight, mantle weight and fin weight, with females having greater values in all categories. There was a small season effect for mantle weight and fin weight. There was little ingested prey material except fluid and oil in the caecum that was typically bright orange or red. Total fluid volume ranged from 23–230 ml and 20–550 ml for males and females, respectively. The per cent oil component of total fluids in the caecum ranged from 6.9–50% and 10.8–50% for males and females, respectively, with no significant difference in per cent oil between males and females. There was a significant positive relationship between total weight and oil volume for females, and for males and females combined. The function of the oil is uncertain. While this study provided information on sex differences in the body size, sexual dimorphism and caecum oil content, information is still incomplete regarding reproduction due to the lack of any mature females captured in this study.

In early 1888, Miss Margaret Pearson arrived in Melbourne under engagement to the Working Men’s College there to give cookery lessons to young women. The College committee had applied to the National School of Cookery in London—an establishment effusively praised in the colonial press—for a suitable culinary educator, and Pearson, a graduate of that institute, was dispatched. After six months or so spent educating her antipodean pupils she published a cookbook, Cookery Recipes For The People, which she described in the preface as a handbook of “plain wholesome cookery” (Pearson 3). The book ran to three editions and sold more than 13,000 copies. A decade later, Hanna Maclurcan, co-proprietor of the popular Queen’s Hotel in Townsville, published Mrs Maclurcan’s Cookery Book: A Collection of Practical Recipes, Specially Suitable for Australia. A review of this work in the Brisbane Courier described it, positively, as a book of “good plain cooking”. Maclurcan had gained some renown as a cook after the Governor of Queensland, Lord Lamington, publicly praised the meals he had eaten at the Queen’s as “exceptionally good and above the average of Australian hotels” (Morning Bulletin 5). The first print run of Mrs Maclurcan’s Cookery Book sold out in weeks, and a second edition was swiftly produced. By 1903 there were 26,000 copies of Maclurcan’s book in print—one of which was deposited in the library of Queen Victoria. While the existence of any particular cookbook does not constitute evidence that any person ever reproduced a recipe from it, the not immodest sales enjoyed by Pearson and Maclurcan can, at the least, be taken to indicate a popular interest in the style of cookery, that is “plain cookery”, delineated in their respective works. If those who bought these books never actually turned them into working copies—that is, cooked from them—they likely aspired to do so. Practical classes in plain cookery were also popular in Australia in the latter part of the nineteenth century. The adjectival coupling of the word “plain” to “cookery” in colonial Australia can be seen then to have formed an appealing duet at that time If a modern author or reviewer described the body of recipes encapsulated in a cookbook as “plain cookery”, it would not serve to recommend it to the contemporary market—indeed it would likely condemn such a publication to pulping, rather than sales of many thousands—as the term would be understood by most modern cooks, and eaters, to describe food that was dull and lacking in flavour and cosmopolitan appeal. We now prefer cookery books that offer instruction on the preparation of dishes that are described as “exotic”, “global”, “ethnic”, “seasonal”, “local”, and “full of flavour”, and that lend those that prepare and consume the dishes they contain the “glamour of culinary ethnicity” (Appadurai 10). It would seem to be stating the obvious then to say that “plain cookery” meant something entirely different to colonial Australians, except that modern Australians commonly believe that their nineteenth century brethren ate an “abominable”, “monotonous”, “low standard” diet (Santich, The High and The Low 37), and therefore if they preferred their meals to be plain cooked, that these would have been exactly as our present-day interpretation would have them. Yet Pearson describes plain cookery as an “art” (3), arguably a rhetorical epithet, but she was a zealous educator and would not have used such a term to describe a style of cookery that she expected to turn out low quality dishes that were vile and dull. What Pearson and Maclurcan actually present in their respective books is English cookery: which was also known as plain cookery. The Anglo-Celtic population of Australia in the nineteenth century held varied opinions—ranging from obsequious to hateful—about England, depending on their background. The majority, however, considered it their natural home—including many who were colonial born—and the cultural model they reproduced, with local modifications, was that of the “mother country” (Abbott 10) some 10,000 long miles away. English political, legal, economic, and social systems were the foundation of white Australian society. In keeping with this, colonial cooks “perpetuated an English style of cookery, English food values, [and] an English meal structure” (Santich, Looking for Flavour 6) and English cookbooks were the models that colonial cooks and cookery writers drew upon. When Polly, the heroine of Henry Handel Richardson’s novel The Fortunes of Richard Mahoney, teaches herself to make pastry from a cookbook in her rudimentary kitchen on the Victorian goldfields circa 1853, historical accuracy requires her to have employed an imported publication to guide her. It was another decade before the first Australian cookbook, Edward Abbott’s The English And Australian Cookery Book, was published in 1864. Prior to the appearance of Abbott’s work, colonial cooks wanting the guidance of a culinary manual were reliant on the imported English titles stocked by Australian booksellers, such as Eliza Acton’s Modern Cookery for Private Families, Beeton’s Book of Household Management and William Kitchiner’s The Cook’s Oracle. These three particular cookbooks were amongst the most successful and influential works in the nineteenth century Anglo-sphere and were commonly considered as manuals of plain cookery: Acton’s particular work is also the source of the most commonly quoted definition of “plain cookery” as “the principles of roasting, boiling, stewing and baking” (Acton 167) and I am going let it stand as the model of such in this piece. If a curt literary catalogue, such as that used by Acton to delineate plain cookery, were used to describe any cuisine it would serve to make it seem austere, and the reputation of English food and cookery has likely suffered from a face value acceptance of it (and by association so has its Australian culinary doppelganger). A considered inspection of Acton’s work shows that her instructions for the plain methods of roasting, boiling, and stewing of food, cover 13 pages, followed by more than 100 pages of recipes for 19 different varieties of meat, poultry, and game that are further divided into numerous variant cuts. Three pages were dedicated to instruction for boiling potatoes properly. When preparing any of these dishes she enjoins her readers to follow the “slow methods of cooking recommended” (167) to ensure a superior end product. The principles of baking were elucidated across several chapters, taking under this classification the preparation of various types of pastry and a multitude of baked puddings, cakes and biscuits: all prepared from base ingredients—not a packet harmed in their production. We now venerate the taste of so-called “slow cooked” food, so to discover that this was the method prescribed for producing plain cooked dishes suggests that plain cookery potentially had more flavour than we imagine. Acton’s work also challenges the charge that the product of plain cookery was monotonous. We have developed a view that we must have a multitudinous array of different types of food available, all year round, for it to be satisfactory to us. Acton demonstrates that variety in cookery can be achieved in other ways such as in types and cuts of meat, and that “plain” was not necessarily synonymous with sameness. The celebrated twentieth century English food writer Elizabeth David says that Modern Cookery was the “most admired and copied English cookery book of the nineteenth century” (305). As the aspiration of most colonial cooks was the reproduction of English cookery it is not unreasonable to expect that Acton’s work might have had some influence on those that wrote cookery manuals for them. We know that Edward Abbott borrowed from her as he writes in his introduction that he has combined “the advantages of Acton’s work” (5) into this own. Neither Pearson or Maclurcan acknowledge any influence at all upon their works but their respective manuals are not particularly original in content—with the exception of some unique regional recipes in Maclurcan—and they must have drawn upon other cookery manuals of the same style to develop their repertoire. By the time they were writing, “large portions [of Acton’s] volume [had] been appropriated [by] contemporary [cookbook] authors [such as Abbott] without the slightest acknowledgment” (Acton 4): the famous Mrs. Beeton is generally considered to have borrowed heavily from Acton for the cookery section of her successful tome Household Management. If Pearson and Maclurcan did not draw directly on Acton—and they well might have—then they likely used culinary sources that had subsumed her influence as their inspiration. What was considered to constitute plain cookery was not as straightforward as Acton’s definition; it was also “generally understood” to be free of any French influence (David 35). It was a commonly held suspicion amongst nineteenth century English men and women that Gallic cooks employed sauces and strong flavourings such as garlic and other “low and treacherous devices” (Saunders 4), to disguise the fact that they had such poor quality ingredients to work with. On the other hand, the English “had such faith” in the superior quality of their native produce that they considered it only required treatment with plain cookery techniques to be rendered toothsome: this culinary Francophobia persisted in the colonies. In the novel, The Three Miss Kings, set in Melbourne in 1880, the trio of the title take lodgings with a landlady, who informs them from the outset that she is “only a plain cook, and can’t make them French things which spile [sic] the stomach” (Cambridge 36). While a good plain cook might have defined herself by the absence of any Gallic, or indeed any other “foreign”, influence in the meals she created, there had been a significant absorption of elements of both of these in the plain cookery she practised, but these had become so far embedded in English cookery that she was unaware of it. A telling example of this is the unremarked inclusion of curry in the plain cookery cannon. While the name and homogenised form of this dish is of British invention, it retained the varied spices, including pungent chillies, of the Indian cuisine it simulated. Pearson and Maclurcan, and Abbott, all included recipes for curries and curried dishes in their respective cookery books. Over time, plain cookery seems to have become conflated with “plain food”, but the latter was not necessarily the result of the former. There was little of Pearson’s “art” involved in creating plain food, except perhaps an ability to keep this style of food so flavourless and dull that it offered neither pleasure nor temptation to eat any more than that required to sustain life. This very real plainness was actively sought by some as “plain food was synonymous with moral rectitude […] and the plainer the food the more virtuous the eater” (Santich, Looking 28). A common societal appreciation of moral virtue is barely perceptible in modern Australian society but it was an attribute that was greatly valued in the nineteenth century Anglo-world and the consumption of plain food a necessary practice in the achievement of good character. (Our modern habit of labelling of foods “good” or “bad” shows that we continue to imbue food with moral overtones.) The list of “gustatory temptations” “proscribed by the plain food lobby” included “salt, spices, sauces and any flavourings that might have cheered the senses” (Santich, Looking 28). If this were the case then both Pearson and Maclurcan’s cookbooks would have dramatically failed to qualify as manuals of plain food. The recipes contained in their respective works feature a much greater use of components associated with flavour enhancement than we imagine to have been employed in plain cookery, particularly if we erroneously believe it to be analogous to plain food. Spices are used extensively in sweet and savoury dishes, as are various fresh green herbs and lemon juice and rind; homemade condiments such as mushroom ketchup (a type of essence pressed from a seasonal abundance of fungi), and a liberal employment of sherry, port, Madeira, and brandy that a “virtuous” plain food advocate would have considered most intemperate. Pearson and Maclurcan both give instructions for preparing rich stocks and gravies drawn from meat, bones and aromatic vegetables, and prescribe the end product of this process as the foundation for a variety of soups, sauces, and stews. Recipes are given for a greater diversity of vegetables than the stereotyped cabbage and potatoes of colonial culinary legend. Maclurcan displays a distinct tropical regionalism in her book providing recipes that use green bananas and pawpaw as vegetables, alongside other exotic species—for that time—such as eggplant, choko, mango, granadilla, passionfruit, rosella, prickly pear, and guava. Her distinct location, the coastal city of Townsville, is also reflected in the extensive selection of recipes for local species of fish and seafood such as beche-de-mer, prawns, and barramundi, which won Maclurcan a reputation as an expert on seafood. Ultimately, to gain a respectably informed understanding as to the taste, aroma, and texture of the plain cookery presented in the respective works of Pearson and Maclurcan one needs to prepare their recipes: I have done so, reproducing a wide selection of dishes from both books. Admittedly, I am a professionally trained cook with the skills to execute recipes to a high standard, but my practice is to scrupulously maintain the original listing of ingredients in the reproduction and follow the method as best I can. Through this practice I have made some delicious discoveries, which have helped inform my opinion that some colonial Australians, and perhaps significant numbers of them, must have been eating meals that were a long way from dull, flavourless and monotonous. It has been said that we employ our tongues for the “twin offices of rhetoric and taste” (Jaine 61). Words can exercise a significant influence on how we value the taste of—or actually taste—any particular food or indeed a cuisine. In the case of the popularly held opinion about the unappetizing state of colonial meals, it might be that the absence of rhetoric has contributed to this. Colonial food writers such as Pearson and Maclurcan did not “mince words” (Bannerman 166) and chose to use “plain titling” (David 306) and language that lacked the excessive adjectives and laudatory hyperbole typically employed by modern food writers. Perhaps if Pearson or Maclurcan had indulged in anointing their own works with enthusiastic recommendation and reference to international influences in their recipes, this might have contributed to a more positive impression of the food of our Anglo-Celtic ancestors. As an experiment with this idea I have taken a recipe from Cookery Recipes For The People and reframed its title and description in a modern food writing style. The recipe in question is titled “White Sauce” and Pearson writes that “this sauce will answer well for boiled fowl” (48): hardly language to make the dish sound appealing to the modern cook, and likely to confirm an expectation of plain cookery as tasteless and boring. But what if the recipe remained the same but the words used to describe it were changed, for example: the title to “Salsa Blanca” and the introductory remark to “this luxurious silky sauce infused with eschalot, mace, lemon, and sherry wine is perfect for perking up poached free-range chicken”. How much better might it then taste? References Abbott, Edward. The English And Australian Cookery Book: Cookery For The Many, As Well As The Upper Ten Thousand. London: Sampson Low, Son, & Marston, 1864. Acton, Eliza. Modern Cookery for Private Families. London: Longman, Brown, Green, Longmans, and Roberts, 1858. Appadurai, Arjun. “How to Make a National Cuisine: Cookbooks in Contemporary India”. Comparative Studies in Society and History 30 (1988): 3–24. Bannerman, Colin. A Friend In The Kitchen. Kenthurst NSW: Kangaroo Press, 1996. Brisbane Courier. “Mrs Maclurcan’s Cookery Book: A Collection of Practical Recipes, Specially Suitable for Australia [review].” Brisbane Courier c.1898. [Author’s manuscript collection.] Cambridge, Ada. The Three Miss Kings. London: Virago Press, 1987 (1st pub. Melbourne, 1891). David, Elizabeth. An Omelette and a Glass of Wine. London: Penguin, 1986. Freeman, Sarah. Mutton and Oysters: The Victorians and their Food. London: Victor Golllancz, 1989. Humble, Nicola. Culinary Pleasures. London, Faber & Faber, 2005. Jaine, Tom. “Banquets and Meals”. Pleasures of the Table: Proceedings of the Fifth Symposium of Australian Gastronomy (1991): 61–4. Jones, Shar, and Otto, Kirsten. Colonial Food and Drink 1788-1901. Sydney: Historic Houses Trust of New South Wales, 1985. Hartley, Dorothy. Food in England. London: Macdonald General, 1979. Hughes, Kathryn. The Short Life & Long Times of Mrs Beeton. London: Harper Perennial, 2006. Maclurcah, Hannah. Mrs Maclurcan’s Cookery Book: A Collection of Practical Recipes, Specially Suitable for Australia. Melbourne: George Robertson, 1905 (1st pub. Townsville, 1898). Morning Bulletin. “Gossip.” Morning Bulletin (Rockhampton) 10 May 1898: 5. Pearson, Margaret. Cookery Recipes for the People. Melbourne: Hutchinson, 1888. Richardson, Henry Handel. The Fortunes of Richard Mahony. London: Heinemann, 1954. Santich, Barbara. What the Doctors Ordered: 150 Years of Dietary Advice in Australia. Melbourne: Hyland House, 1995. ---. “The High and the Low: Australian Cuisine in the Late Nineteenth and Early Twentieth Centuries”. Journal of Australian Studies 30 (2006): 37–49. ---. Looking For Flavour. Kent Town: Wakefield, 1996 Saunders, Alan. “Why Do We Want An Australian Cuisine?”. Journal of Australian Studies 30 (2006): 1-17. Young, Linda. Middle-Class Culture in the Nineteenth Century: America, Australia and Britain. Basingstoke: Palgrave Macmilian, 2002.

Introduction: From Trifle to Tiramisu Tiramisu is an Italian dessert cake, usually comprising sponge finger biscuits soaked in coffee and liquor, layered with a mixture of egg yolk, mascarpone and cream, and topped with sifted cocoa. Once a gourmet dish, tiramisu, which means “pick me up” in Italian (Volpi), is today very popular in Australia where it is available for purchase not only in restaurants and cafés, but also from fast food chains and supermarkets. Recipes abound in cookery books and magazines and online. It is certainly more widely available and written about in Australia than the once ubiquitous English trifle which, comprising variations on the theme of sherry soaked sponge cake, custard and cream, it closely resembles. It could be asserted that its strong coffee taste has enabled the tiramisu to triumph over the trifle in contemporary Australia, yet coffee is also a recurrent ingredient in cakes and icings in nineteenth and early twentieth century Australian cookbooks. Acknowledging that coffee consumption in Australia doubled during the years of the Second World War and maintained high rates of growth afterwards (Khamis; Adams), this article draws on examples of culinary writing during this period of increasing popularity to investigate the use of coffee in cookery as well as a beverage in these mid-twentieth century decades. In doing so, it engages with a lively scholarly discussion on what has driven this change—whether the American glamour and sophistication associated with coffee, post-war immigration from the Mediterranean and other parts of Europe, or the influence of the media and developments in technology (see, for discussion, Adams; Collins et al.; Khamis; Symons). Coffee in Australian Mid-century Epicurean Writing In Australian epicurean writing in the 1950s and 1960s, freshly brewed coffee is clearly identified as the beverage of choice for those with gourmet tastes. In 1952, The West Australian reported that Johnnie Walker, then president of the Sydney Gourmet Society had “sweated over an ordinary kitchen stove to give 12 Melbourne women a perfect meal” (“A Gourmet” 8). Walker prepared a menu comprising: savoury biscuits; pumpkin soup made with a beef, ham, and veal stock; duck braised with “26 ounces of dry red wine, a bottle and a half of curacao and orange juice;” Spanish fried rice; a “French lettuce salad with the Italian influence of garlic;” and, strawberries with strawberry brandy and whipped cream. He served sherry with the biscuits, red wine with the duck, champagne with the sweet, and coffee to finish. It is, however, the adjectives that matter here—that the sherry and wine were dry, not sweet, and the coffee was percolated and black, not instant and milky. Other examples of epicurean writing suggested that fresh coffee should also be unadulterated. In 1951, American food writer William Wallace Irwin who travelled to, and published in, Australia as “The Garrulous Gourmet,” wrote scathingly of the practice of adding chicory to coffee in France and elsewhere (104). This castigation of the French for their coffee was unusual, with most articles at this time praising Gallic gastronomy. Indicative of this is Nancy Cashmore’s travel article for Adelaide’s Advertiser in 1954. Titled “In Dordogne and Burgundy the Gourmet Will Find … A Gastronomic Paradise,” Cashmore details the purchasing, preparation, presentation, and, of course, consumption of excellent food and wine. Good coffee is an integral part of every meal and every day: “from these parts come exquisite pate de fois, truffles, delicious little cakes, conserved meats, wild mushrooms, walnuts and plums. … The day begins with new bread and coffee … nothing is imported, nothing is stale” (6). Memorable luncheons of “hors-d’oeuvre … a meat course, followed by a salad, cheese and possibly a sweet” (6) always ended with black coffee and sometimes a sugar lump soaked in liqueur. In Australian Wines and Food (AW&F), a quarterly epicurean magazine that was published from 1956 to 1960, coffee was regularly featured as a gourmet kitchen staple alongside wine and cheese. Articles on the history, growing, marketing, blending, roasting, purchase, and brewing of coffee during these years were accompanied with full-page advertisements for Bushell’s vacuum packed pure “roaster fresh” coffee, Robert Timms’s “Royal Special” blend for “coffee connoisseurs,” and the Masterfoods range of “superior” imported and locally produced foodstuffs, which included vacuum packed coffee alongside such items as paprika, bay leaves and canned asparagus. AW&F believed Australia’s growing coffee consumption the result of increased participation in quality dining experiences whether in restaurants, the “scores of colourful coffee shops opening their doors to a new generation” (“Coffee” 39) or at home. With regard to domestic coffee drinking, AW&F reported a revived interest in “the long neglected art of brewing good coffee in the home” (“Coffee” 39). Instructions given range from boiling in a pot to percolating and “expresso” (Bancroft 10; “Coffee” 37-9). Coffee was also mentioned in every issue as the only fitting ending to a fine meal, when port, other fortified wines or liqueurs usually accompanied a small demi-tasse of (strong) black coffee. Coffee was also identified as one of the locally produced speciality foods that were flown into the USA for a consulate dinner: “more than a ton of carefully selected foodstuffs was flown to New York by Qantas in three separate airlifts … beef fillet steaks, kangaroo tails, Sydney rock oysters, King prawns, crayfish tails, tropical fruits and passion fruit, New Guinea coffee, chocolates, muscatels and almonds” (“Australian” 16). It is noteworthy that tea is not profiled in the entire run of the magazine. A decade later, in the second half of the 1960s, the new Australian gourmet magazine Epicurean included a number of similar articles on coffee. In 1966 and 1969, celebrity chef and regular Epicurean columnist Graham Kerr also included an illustrated guide to making coffee in two of the books produced alongside his television series, The Graham Kerr Cookbook (125) and The Graham Kerr Cookbook by the Galloping Gourmet (266-67). These included advice to buy freshly roasted beans at least once a week and to invest in an electric coffee grinder. Kerr uses a glass percolator in each and makes an iced (milk) coffee based on double strength cooled brewed coffee. Entertaining with Margaret Fulton (1971) is the first Margaret Fulton cookery book to include detailed information on making coffee from ground beans at home. In this volume, which was clearly aimed at the gourmet-inclined end of the domestic market, Fulton, then cookery editor for popular magazine Woman’s Day, provides a morning coffee menu and proclaims that “Good hot coffee will never taste so good as it does at this time of the day” (90). With the stress on the “good,” Fulton, like Kerr, advises that beans be purchased and ground as they are needed or that only a small amounts of freshly ground coffee be obtained at one time. For Fulton, quality is clearly linked to price—“buy the best you can afford” (90)—but while advising that “Mocha coffee, which comes from Aden and Mocha, is generally considered the best” (90), she also concedes that consumers will “find by experience” (90) which blends they prefer. She includes detailed information on storage and preparation, noting that there are also “dozens of pieces of coffee making equipment to choose from” (90). Fulton includes instructions on how to make coffee for guests at a wedding breakfast or other large event, gently heating home sewn muslin bags filled with finely ground coffee in urns of barely boiling water (64). Alongside these instructions, Fulton also provides recipes for a sophisticated selection of coffee-flavoured desserts such as an iced coffee soufflé and coffee biscuits and meringues that would be perfect accompaniments to her brewed coffees. Cooking with Coffee A prominent and popular advocate of Continental and Asian cookery in Melbourne in the 1950s, Maria Kozslik Donovan wrote and illustrated five cookery books and had a successful international career as a food writer in the 1960s and 1970s. Maria Kozslik was Hungarian by birth and education and was also educated in the USA before marrying Patrick Donovan, an Australian, and migrating to Sydney with him in 1950. After a brief stay there and in Adelaide, they relocated to Melbourne in 1953 where she ran a cookery school and wrote for prominent daily newspaper The Age, penning hundreds of her weekly “Epicure’s Corner: Continental Recipes with Maria Kozslik” column from 1954 to 1961. Her groundbreaking Continental Cookery in Australia (1955) collects some 140 recipes, many of which would appear in her column—predominantly featuring French, Italian, Viennese, and Hungarian dishes, as well as some from the Middle East and the Balkans—each with an informative paragraph or two regarding European cooking and dining practices that set the recipes in context. Continental Cookery in Australia includes one recipe for Mocha Torte (162), which she translates as Coffee Cream Cake and identifies as “the favourite of the gay and party-loving Viennese … [in] the many cafés and sweet shops of Salzburg and Vienna” (162). In this recipe, a plain sponge is cut into four thin layers and filled and covered with a rich mocha cream custard made from egg yolks, sugar and a good measure of coffee, which, when cooled, is beaten into creamed butter. In her recipe for Mocha Cream, Donovan identifies the type of coffee to be used and its strength, specifying that “strong Mocha” be used, and pleading, “please, no essence!” She also suggests that the cake’s top can be decorated with shavings of the then quite exotic “coffee bean chocolate,” which she notes can be found at “most continental confectioners” (162), but which would have been difficult to obtain outside the main urban centres. Coffee also appears in her Café Frappe, where cooled strong black coffee is poured into iced-filled glasses, and dressed with a touch of sugar and whipped cream (165). For this recipe the only other direction that Donovan gives regarding coffee is to “prepare and cool” strong black coffee (165) but it is obvious—from her eschewing of other convenience foods throughout the volume—that she means freshly brewed ground coffee. In contrast, less adventurous cookery books paint a different picture of coffee use in the home at this time. Thus, the more concise Selected Continental Recipes for the Australian Home (1955) by the Australian-born Zelmear M. Deutsch—who, stating that upon marrying a Viennese husband, she became aware of “the fascinating ways of Continental Cuisine” (back cover)—includes three recipes that include coffee. Deutsch’s Mocha Creams (chocolate truffles with a hint of coffee) (76-77), almond meringues filled with coffee whipped cream (89-90), and Mocha Cream Filling comprising butter beaten with chocolate, vanilla, sugar, and coffee (95), all use “powdered” instant coffee, which is, moreover, used extremely sparingly. Her Almond Coffee Torte, for example, requires only half a teaspoon of powdered coffee to a quarter of a pint (300 mls) of cream, which is also sweetened with vanilla sugar (89-90). In contrast to the examples from Fulton and Donovan above (but in common with many cookbooks before and after) Deutsch uses the term “mocha” to describe a mix of coffee and chocolate, rather than to refer to a fine-quality coffee. The term itself is also used to describe a soft, rich brown color and, therefore, at times, the resulting hue of these dishes. The word itself is of late eighteenth century origin, and comes from the eponymous name of a Red Sea port from where coffee was shipped. While Selected Continental Recipes appears to be Deutsch’s first and only book, Anne Mason was a prolific food, wine and travel writer. Before migrating to England in 1958, she was well known in Australia as the presenter of a live weekly television program, Anne Mason’s Home-Tested Recipes, which aired from 1957. She also wrote a number of popular cookery books and had a long-standing weekly column in The Age. Her ‘Home-Tested Recipes’ feature published recipes contributed by readers, which she selected and tested. A number of these were collected in her Treasury of Australian Cookery, published in London in 1962, and included those influenced by “the country cooking of England […] Continental influence […] and oriental ideas” (11). Mason includes numerous recipes featuring coffee, but (as in Deutsch above) almost all are described as mocha-flavoured and listed as such in the detailed index. In Mason’s book, this mocha taste is, in fact, featured more frequently in sweet dishes than any of the other popular flavours (vanilla, honey, lemon, apple, banana, coconut, or passionfruit) except for chocolate. These mocha recipes include cakes: Chocolate-Mocha Refrigerator cake—plain sponge layered with a coffee-chocolate mousse (134), Mocha Gateau Ring—plain sponge and choux pastry puffs filled with cream or ice cream and thickly iced with mocha icing (136) and Mocha Nut Cake—a coffee and cocoa butter cake filled and iced with mocha icing and almonds (166). There are also recipes for Mocha Meringues—small coffee/cocoa-flavoured meringue rosettes joined together in pairs with whipped cream (168), a dessert Mocha Omelette featuring the addition of instant coffee and sugar to the eggs and which is filled with grated chocolate (181) and Mocha-Crunch Ice Cream—a coffee essence-scented ice cream with chocolate biscuit crumbs (144) that was also featured in an ice cream bombe layered with chocolate-rum and vanilla ice creams (152). Mason’s coffee recipes are also given prominence in the accompanying illustrations. Although the book contains only nine pages in full colour, the Mocha Gateau Ring is featured on both the cover and opposite the title page of the book and the Mocha Nut Cake is given an entire coloured page. The coffee component of Mason’s recipes is almost always sourced from either instant coffee (granules or powdered) or liquid coffee essence, however, while the cake for the Mocha Nut Cake uses instant coffee, its mocha icing and filling calls for “3 dessertspoons [of] hot black coffee” (167). The recipe does not, however, describe if this is made from instant, essence, or ground beans. The two other mocha icings both use instant coffee mixed with cocoa, icing sugar and hot water, while one also includes margarine for softness. The recipe for Mocha Cup (202) in the chapter for Children’s Party Fare (198-203), listed alongside clown-shaped biscuits and directions to decorate cakes with sweets, plastic spaceships and dolls, surprisingly comprises a sophisticated mix of grated dark chocolate melted in a pint of “hot black coffee” lightened with milk, sugar and vanilla essence, and topped with cream. There are no instructions for brewing or otherwise making fresh coffee in the volume. The Australian culinary masterwork of the 1960s, The Margaret Fulton Cookbook, which was published in 1968 and sold out its first (record) print run of 100,000 copies in record time, is still in print, with a revised 2004 edition bringing the number of copies sold to over 1.5 million (Brien). The first edition’s cake section of the book includes a Coffee Sponge sandwich using coffee essence in both the cake and its creamy filling and topping (166) and Iced Coffee Cakes that also use coffee essence in the cupcakes and instant coffee powder in the glacé icing (166). A Hazelnut Swiss Roll is filled with a coffee butter cream called Coffee Creme au Beurre, with instant coffee flavouring an egg custard which is beaten into creamed butter (167)—similar to Koszlik’s Mocha Cream but a little lighter, using milk instead of cream and fewer eggs. Fulton also includes an Austrian Chocolate Cake in her Continental Cakes section that uses “black coffee” in a mocha ganache that is used as a frosting (175), and her sweet hot coffee soufflé calls for “1/2 cup strong coffee” (36). Fulton also features a recipe for Irish Coffee—sweetened hot black coffee with (Irish) whiskey added, and cream floated on top (205). Nowhere is fresh or brewed coffee specified, and on the page dedicated to weights, measures, and oven temperatures, instant coffee powder appears on the list of commonly used ingredients alongside flour, sugar, icing sugar, golden syrup, and butter (242). American Influence While the influence of American habits such as supermarket shopping and fast food on Australian foodways is reported in many venues, recognition of its influence on Australian coffee culture is more muted (see, for exceptions, Khamis; Adams). Yet American modes of making and utilising coffee also influenced the Australian use of coffee, whether drunk as beverage or employed as a flavouring agent. In 1956, the Australian Women’s Weekly published a full colour Wade’s Cornflour advertorial of biscuit recipes under the banner, “Dione Lucas’s Manhattan Mochas: The New Coffee Cookie All America Loves, and Now It’s Here” (56). The use of the American “cookie” instead of the Australian “biscuit” is telling here, the popularity of all things American sure to ensure, the advert suggested, that the Mochas (coffee biscuits topped with chocolate icing) would be so popular as to be “More than a recipe—a craze” (56). This American influence can also been seen in cakes and other baked goods made specifically to serve with coffee, but not necessarily containing it. The recipe for Zulu Boys published in The Argus in 1945, a small chocolate and cinnamon cake with peanuts and cornflakes added, is a good example. Reported to “keep moist for some time,” these were “not too sweet, and are especially useful to serve with a glass of wine or a cup of black coffee” (Vesta Junior 9), the recipe a precursor to many in the 1950s and 1960s. Margaret Fulton includes a Spicy Coffee Cake in The Margaret Fulton Cookbook. This is similar to her Cinnamon Tea Cake in being an easy to mix cake topped with cinnamon sugar, but is more robust in flavour and texture with the addition of whole bran cereal, raisins and spices (163). Her “Morning Coffee” section in Entertaining with Margaret Fulton similarly includes a selection of quite strongly flavoured and substantially textured cakes and biscuits (90-92), while her recipes for Afternoon Tea are lighter and more delicate in taste and appearance (85-89). Concluding Remarks: Integration and Evolution, Not Revolution Trusted Tasmanian writer on all matters domestic, Marjorie Bligh, published six books on cookery, craft, home economics, and gardening, and produced four editions of her much-loved household manual under all three of her married names: Blackwell, Cooper and Bligh (Wood). The second edition of At Home with Marjorie Bligh: A Household Manual (published c.1965-71) provides more evidence of how, rather than jettisoning one form in favour of another, Australian housewives were adept at integrating both ground and other more instant forms of coffee into their culinary repertoires. She thus includes instructions on both how to efficiently clean a coffee percolator (percolating with a detergent and borax solution) (312) as well as how to make coffee essence at home by simmering one cup of ground coffee with three cups of water and one cup of sugar for one hour, straining and bottling (281). She also includes recipes for cakes, icings, and drinks that use both brewed and instant coffee as well as coffee essence. In Entertaining with Margaret Fulton, Fulton similarly allows consumer choice, urging that “If you like your coffee with a strong flavour, choose one to which a little chicory has been added” (90). Bligh’s volume similarly reveals how the path from trifle to tiramisu was meandering and one which added recipes to Australian foodways, rather than deleted them. Her recipe for Coffee Trifle has strong similarities to tiramisu, with sponge cake soaked in strong milk coffee and sherry layered with a rich custard made from butter, sugar, egg yolks, and black coffee, and then decorated with whipped cream, glace cherries, and walnuts (169). This recipe precedes published references to tiramisu as, although the origins of tiramisu are debated (Black), references to the dessert only began to appear in the 1980s, and there is no mention of the dish in such authoritative sources as Elizabeth David’s 1954 Italian Food, which features a number of traditional Italian coffee-based desserts including granita, ice cream and those made with cream cheese and rice. By the 1990s, however, respected Australian chef and food researcher, the late Mietta O’Donnell, wrote that if pizza was “the most travelled of Italian dishes, then tiramisu is the country’s most famous dessert” and, today, Australian home cooks are using the dish as a basis for a series of variations that even include replacing the coffee with fruit juices and other flavouring agents. Long-lived Australian coffee recipes are similarly being re-made in line with current taste and habits, with celebrated chef Neil Perry’s recent Simple Coffee and Cream Sponge Cake comprising a classic cream-filled vanilla sponge topped with an icing made with “strong espresso”. To “glam up” the cake, Perry suggests sprinkling the top with chocolate-covered roasted coffee beans—cycling back to Maria Koszlik’s “coffee bean chocolate” (162) and showing just how resilient good taste can be. Acknowledgements The research for this article was completed while I was the recipient of a Research Fellowship in the Special Collections at the William Angliss Institute (WAI) of TAFE in Melbourne, where I utilised their culinary collections. Thank you to the staff of the WAI Special Collections for their generous assistance, as well as to the Faculty of Arts, Business, Informatics and Education at Central Queensland University for supporting this research. Thank you to Jill Adams for her assistance with this article and for sharing her “Manhattan Mocha” file with me, and also to the peer reviewers for their generous and helpful feedback. All errors are, of course, my own.References “A Gourmet Makes a Perfect Meal.” The West Australian 4 Jul. 1952: 8.Adams, Jill. “Australia’s American Coffee Culture.” Australasian Journal of Popular Culture (2012): forthcoming. “Australian Wines Served at New York Dinner.” Australian Wines and Food 1.5 (1958): 16. Bancroft, P. A. “Let’s Make Some Coffee.” Australian Wines & Food Quarterly 4.1 (1960): 10. Black, Jane. “The Trail of Tiramisu.” Washington Post 11 Jul. 2007. 15 Feb. 2012 ‹http://www.washingtonpost.com/wp-dyn/content/article/2007/07/10/AR2007071000327.html›. Bligh, Marjorie. At Home with Marjorie Bligh: A Household Manual. Devonport: M. Bligh, c.1965-71. 2nd ed. Brien, Donna Lee. “Australian Celebrity Chefs 1950-1980: A Preliminary Study.” Australian Folklore 21 (2006): 201-18. Cashmore, Nancy. “In Dordogne and Burgundy the Gourmet Will Find … A Gastronomic Paradise.” The Advertiser 23 Jan. (1954): 6. “Coffee Beginnings.” Australian Wines & Food Quarterly 1.4 (1957/1958): 37-39. Collins, Jock, Katherine Gibson, Caroline Alcorso, Stephen Castles, and David Tait. A Shop Full of Dreams: Ethnic Small Business in Australia. Sydney: Pluto Press, 1995. David, Elizabeth. Italian Food. New York: Penguin Books, 1999. 1st pub. UK: Macdonald, 1954, and New York: Knoft, 1954. Donovan, Maria Kozslik. Continental Cookery in Australia. Melbourne: William Heinemann, 1955. Reprint ed. 1956. -----.“Epicure’s Corner: Continental Recipes with Maria Kozslik.” The Age 4 Jun. (1954): 7. Fulton, Margaret. The Margaret Fulton Cookbook. Dee Why West: Paul Hamlyn, 1968. -----. Entertaining with Margaret Fulton. Dee Why West: Paul Hamlyn, 1971. Irwin, William Wallace. The Garrulous Gourmet. Sydney: The Shepherd P, 1951. Khamis, Susie. “It Only Takes a Jiffy to Make: Nestlé, Australia and the Convenience of Instant Coffee.” Food, Culture & Society 12.2 (2009): 217-33. Kerr, Graham. The Graham Kerr Cookbook. Wellington, Auckland, and Sydney: AH & AW Reed, 1966. -----. The Graham Kerr Cookbook by The Galloping Gourmet. New York: Doubleday, 1969. Mason, Anne. A Treasury of Australian Cookery. London: Andre Deutsch, 1962. Mason, Peter. “Anne Mason.” The Guardian 20 Octo.2006. 15 Feb. 2012 Masterfoods. “Masterfoods” [advertising insert]. Australian Wines and Food 2.10 (1959): btwn. 8 & 9.“Masters of Food.” Australian Wines & Food Quarterly 2.11 (1959/1960): 23. O’Donnell, Mietta. “Tiramisu.” Mietta’s Italian Family Recipe, 14 Aug. 2004. 15 Feb. 2012 ‹http://www.miettas.com/food_wine_recipes/recipes/italianrecipes/dessert/tiramisu.html›. Perry, Neil. “Simple Coffee and Cream Sponge Cake.” The Age 12 Mar. 2012. 15 Feb. 2012 ‹http://www.theage.com.au/lifestyle/cuisine/baking/recipe/simple-coffee-and-cream-sponge-cake-20120312-1utlm.html›. Symons, Michael. One Continuous Picnic: A History of Eating in Australia. Adelaide: Duck Press, 2007. 1st. Pub. Melbourne: Melbourne UP, 1982. ‘Vesta Junior’. “The Beautiful Fuss of Old Time Baking Days.” The Argus 20 Mar. 1945: 9. Volpi, Anna Maria. “All About Tiramisu.” Anna Maria’s Open Kitchen 20 Aug. 2004. 15 Feb. 2012 ‹http://www.annamariavolpi.com/tiramisu.html›. Wade’s Cornflour. “Dione Lucas’ Manhattan Mochas: The New Coffee Cookie All America Loves, and Now It’s Here.” The Australian Women’s Weekly 1 Aug. (1956): 56. Wood, Danielle. Housewife Superstar: The Very Best of Marjorie Bligh. Melbourne: Text Publishing, 2011.

IntroductionAustralia is at a particular point in its history where there is a noticeable diaspora of artists and creative practitioners away from the major capitals of Sydney and Melbourne (in particular), driven in no small part by ballooning house prices of the last eight years. This has meant big changes for some regional spaces, and in turn, for the face of Australian cultural life. Regional cultural precincts are forming with tourist flows, funding attention and cultural economies. Likewise, there appears to be growing consciousness in the ‘art centres’ of Melbourne and Sydney of interesting and relevant activities outside their limits. This research draws on my experience as an art practitioner, curator and social researcher in one such region (Castlemaine in Central Victoria), and particularly from a recent interview series I have conducted in collaboration with art space in that region, Wide Open Road Art. In this, 23 regional and city-based artists were asked about the social, economic and local conditions that can and have supported their art practices. Drawing from these conversations and Bourdieu’s ideas around cultural production, the article suggests that authentic, diverse, interesting and disruptive creative practices in Australian cultural life involve the increasingly pressing need for security while existing outside the modern imperative of high consumption; of finding alternative ways to live well while entering into the shared space of cultural production. Indeed, it is argued that often it is the capacity to defy key economic paradigms, for example of ‘rational (economic) self-interest’, that allows creative life to flourish (Bourdieu Field; Ley “Artists”). While regional spaces present new opportunities for this, there are pitfalls and nuances worth exploring.Changes in Regional AustraliaAustralia has long been an urbanising nation. Since Federation our cities have increased from a third to now constituting two-thirds of the country’s total population (Gray and Lawrence 6; ABS), making us one of the most urbanised countries in the world. Indeed, as machines replaced manual labour on farms; as Australia’s manufacturing industry began its decline; and as young people in particular left the country for city universities (Gray and Lawrence), the post-war industrial-economic boom drove this widespread demographic and economic shift. In the 1980s closures of regional town facilities like banks, schools and hospitals propelled widespread belief that regional Australia was in crisis and would be increasingly difficult to sustain (Rentschler, Bridson, and Evans; Gray and Lawrence 2; Barr et al.; ABS). However, the late 1990s and early 21st century saw a turnaround that has been referred to by some as the rise of the ‘sea change’. That is, widespread renewed interest and idealisation of not just coastal areas but anywhere outside the city (Murphy). It was a simultaneous pursuit of “a small ‘a’ alternative lifestyle” and escape from rising living costs in urban areas, especially for the unemployed, single parents and those with disabilities (Murphy). This renewed interest has been sustained. The latest wave, or series of waves, have coincided with the post-GFC house price spike, of cheap credit and lenient lending designed to stimulate the economy. This initiative in part led to Sydney and Melbourne median dwelling prices rising by up to 114% in eight years (Scutt 2017), which alone had a huge influence on who was able to afford to live in city areas and who was not. Rapid population increases and diminished social networks and familial support are also considered drivers that sent a wave of people (a million since 2011) towards the outer fringes of the cities and to ‘commuter belt’ country towns (Docherty; Murphy). While the underprivileged are clearly most disadvantaged in what has actually been a global development process (see Jayne on this, and on the city as a consumer itself), artists and creatives are also a unique category who haven’t fared well with hyper-urbanisation (Ley “Artists”). Despite the class privilege that often accompanies such a career choice, the economic disadvantage art professions often involve has seen a diaspora of artists moving to regional areas, particularly those in the hinterlands around and train lines to major centres. We see the recent ‘rise of a regional bohemia’ (Regional Australia Institute): towns like Toowoomba, Byron Bay, Surf Coast, Gold Coast-Tweed, Kangaroo Valley, Wollongong, Warburton, Bendigo, Tooyday, New Norfolk, and countless more being re-identified as arts towns and precincts. In Australia in 2016–17, 1 in 6 professional artists, and 1 in 4 visual artists, were living in a regional town (Throsby and Petetskaya). Creative arts in regional Australia makes up a quarter of the nation’s creative output and is a $2.8 billion industry; and our regions particularly draw in creative practitioners in their prime productive years (aged 24 to 44) (Regional Australia Institute).WORA Conservation SeriesIn 2018 artist and curator Helen Mathwin and myself received a local shire grant to record a conversation series with 23 artists who were based in the Central Goldfields region of Victoria as well as further afield, but who had a connection to the regional arts space we run, WideOpenRoadArt (WORA). In videoed, in-depth, approximately hour-long, semi-structured interviews conducted throughout 2018, we spoke to artists (16 women and 7 men) about the relocation phenomenon we were witnessing in our own growing arts town. Most were interviewed in WORA’s roving art float, but we seized any ad hoc opportunity we had to have genuine discussions with people. Focal points were around sustainability of practice and the social conditions that supported artists’ professional pursuits. This included accessing an arts community, circles of cultural production, and the ‘art centre’; the capacity to exhibit; but also, social factors such as affordable housing and the ability to live on a low-income while having dependants; and so on. The conversations were rich with lived experiences and insights on these issues.Financial ImperativesIn line with the discussion above, the most prominent factor we noticed in the interviews was the inescapable importance of being able to live cheaply. The consistent message that all of the interviewees, both regional- and city-based, conveyed was that a career in art-making required an important independence from the need to earn a substantial income. One interviewee commented: “I do run my art as a business, I have an ABN […] it makes a healthy loss! I don’t think I’ve ever made a profit […].” Another put it: “now that I’m in [this] town and I have a house and stuff I do feel like there is maybe a bit more security around those daily things that will hopefully give me space to [make artworks].”Much has been said on the pervasive inability to monetise art careers, notably Bourdieu’s observations that art exists on an interdependent field of cultural capital, determining for itself an autonomous conception of value separate to economics (Bourdieu, Field 39). This is somewhat similar to the idea of art as a sacred phenomenon irreducible to dollar terms (Abbing 38; see also Benjamin’s “aura”; “The Work of Art”). Art’s difficult relationship with commodification is part of its heroism that Benjamin described (Benjamin Charles Baudelaire 79), its potential to sanctify mainstream society by staying separate to the lowly aspirations of commerce (Ley “Artists” 2529). However, it is understood, artists still need to attain professional education and capacities, yet they remain at the bottom of the income ladder not only professionally, but in the case of visual artists, they remain at the bottom of the creative income hierarchies as well. Further to this, within visual arts, only a tiny proportion achieve financially backed success (Menger 277). “Artistic labour markets are characterised by high risk of failure, excess supply of recruits, low artistic income level, skewed income distribution and multiple jobholding” (Mangset, Torvik Heian, Kleppe, and Løyland; Menger). Mangset et al. point to ideas that have long surrounded the “charismatic artist myth,” of a quasi-metaphysical calling to be an artist that can lead one to overlook the profession’s vast pitfalls in terms of economic sustainability. One interviewee described it as follows: “From a very young age I wanted to be an artist […] so there’s never been a time that I’ve thought that’s not what I’m doing.” A 1% rule seems widely acknowledged in how the profession manages the financial winners against those who miss out; the tiny proportion of megastar artists versus a vast struggling remainder.As even successful artists often dip below the poverty line between paid engagements, housing costs can make the difference between being able to live in an area and not (Turnbull and Whitford). One artist described:[the reason we moved here from Melbourne] was financial, yes definitely. We wouldn’t have been able to purchase a property […] in Melbourne, we would not have been able to live in place that we wanted to live, and to do what we wanted to do […]. It was never an option for us to get a big mortgage.Another said:It partly came about as a financial practicality to move out here. My partner […] wanted to be in the bush, but I was resistant at first, we were in Melbourne but we just couldn’t afford Melbourne in the end, we had an apartment, we had a studio. My partner was a cabinet maker then. You know, just every month all our money went to rent and we just couldn’t manage anymore. So we thought, well maybe if we come out to the bush […] It was just by a happy accident that we found a property […] that we could afford, that was off-grid so it cut the bills down for us [...] that had a little studio and already had a little cottage on there that we could rent that out to get money.For a prominent artist we spoke to this issue was starkly reflected. Despite large exhibitions at some of the highest profile galleries in regional Victoria, the commissions offered for these shows were so insubstantial that the artist and their family had to take on staggering sums of personal debt to execute the ambitious and critically acclaimed shows. Another very successful artist we interviewed who had shown widely at ‘A-list’ international arts institutions and received several substantial grants, spoke of their dismay and pessimism at the idea of financial survival. For all artists we spoke to, pursuing their arts practice was in constant tension with economic imperatives, and their lives had all been shaped by the need to make shrewd decisions to continue practising. There were two artists out of the 23 we interviewed who considered their artwork able to provide full-time income, although this still relied on living costs remaining extremely low. “We are very lucky to have bought a very cheap property [in the country] that I can [also] have my workshop on, so I’m not paying for two properties in Melbourne […] So that certainly takes a fair bit of pressure off financially.” Their co-interviewee described this as “pretty luxurious!” Notably, the two who thought they could live off their art practices were both men, mid-career, whose works were large, spectacular festival items, which alongside the artists’ skill and hard work was also a factor in the type of remuneration received.Decongested LivingBeyond more affordable real estate and rental spaces, life outside our cities offers other benefits that have particular relevance to creative practitioners. Opera and festival director Lindy Hume described her move to the NSW South Coast in terms of space to think and be creative. “The abundance of time, space and silence makes living in places like [Hume’s town] ideal for creating new work” (Brown). And certainly, this was a theme that arose frequently in our interviews. Many of our regionally based artists were in part choosing the de-pressurised space of non-metro areas, and also seeking an embedded, daily connection to nature for themselves, their art-making process and their families. In one interview this was described as “dreamtime”. “Some of my more creative moments are out walking in the forest with the dog, that sort of semi-daydreamy thing where your mind is taken away by the place you’re in.”Creative HubsAll of our regional interviewees mentioned the value of the local community, as a general exchange, social support and like-minded connection, but also specifically of an arts community. Whether a tree change by choice or a more reactive move, the diaspora of artists, among others, has led to a type of rural renaissance in certain popular areas. Creative hubs located around the country, often in close proximity to the urban centres, are creating tremendous opportunities to network with other talented people doing interesting things, living in close proximity and often open to cross-fertilisation. One said: “[Castlemaine] is the best place in Australia, it has this insane cultural richness in a tiny town, you can’t go out and not meet people on the street […] For someone who has not had community in their life that is so gorgeous.” Another said:[Being an artist here] is kind of easy! Lots of people around to connect—with […] other artists but also creatively minded people [...] So it means you can just bump into someone from down the street and have an amazing conversation in five minutes about some amazing thing! […] There’s a concentration here that works.With these hubs, regional spaces are entering into a new relevance in the sphere of cultural production. They are generating unique and interesting local creative scenes for people to live amongst or visit, and generating strong local arts economies, tourist economies, and funding opportunities (Rentschler, Bridson, and Evans). Victoria in particular has burgeoned, with tourist flows to its regions increasing 13 per cent in 5 years and generating tourism worth $10 billion (Tourism Victoria). Victoria’s Greater Bendigo is Australia’s most popularly searched tourist destination on Trip Advisor, with tourism increasing 52% in 10 years (Boland). Simultaneously, funding flows have increased to regional zones, as governments seek to promote development outside Australia’s urban centres and are confident in the arts as a key strategy in boosting health, economies and overall wellbeing (see Rentschler, Bridson, and Evans; see also the 2018 Regional Centre for Culture initiative, Boland). The regions are also an increasingly relevant participant in national cultural life (Turnbull and Whitford; Mitchell; Simpson; Woodhead). Opportunities for an openness to productive exchange between regional and metropolitan sites appear to be growing, with regional festivals and art events gaining importance and unique attributes in the consciousness of the arts ‘centre’ (see for example Fairley; Simpson; Farrelly; Woodhead).Difficulties of Regional LocationDespite this, our interviews still brought to light the difficulties and barriers experienced living as a regional artist. For some, living in regional Victoria was an accepted set-back in their ambitions, something to be concealed and counteracted with education in reputable metropolitan art schools or city-based jobs. For others there was difficulty accessing a sympathetic arts community—although arts towns had vibrant cultures, certain types of creativity were preferred (often craft-based and more community-oriented). Practitioners who were active in maintaining their links to a metropolitan art scene voiced more difficulty in fitting in and successfully exhibiting their (often more conceptual or boundary-pushing) work in regional locations.The Gentrification ProblemThe other increasingly obvious issue in the revivification of some non-metropolitan areas is that they can and are already showing signs of being victims of their own success. That is, some regional arts precincts are attracting so many new residents that they are ceasing to be the low-cost, hospitable environments for artists they once were. Geographer David Ley has given attention to this particular pattern of gentrification that trails behind artists (Ley “Artists”). Ley draws from Florida’s ideas of late capitalism’s ascendency of creativity over the brute utilitarianism of the industrial era. This has got to the point that artists and creative professionals have an increasing capacity to shape and generate value in areas of life that were previous overlooked, especially with built environments (2529). Now more than ever, there is the “urbane middle-class” pursuing ‘the swirling milieu of artists, bohemians and immigrants” (Florida) as they create new, desirable landscapes with the “refuse of society” (Benjamin Charles Baudelaire 79; Ley New Middle Class). With Australia’s historic shifts in affordability in our major cities, this pattern that Ley identified in urban built environments can be seen across our states and regions as well.But with gentrification comes increased costs of living, as housing, shops and infrastructure all alter for an affluent consumer-resident. This diminishes what Bourdieu describes as “the suspension and removal of economic necessity” fundamental to the avant-garde (Bourdieu Distinction 54). That is to say, its relief from heavy pressure to materially survive is arguably critical to the reflexive, imaginative, and truly new offerings that art can provide. And as argued earlier, there seems an inbuilt economic irrationality in artmaking as a vocation—of dedicating one’s energy, time and resources to a pursuit that is notoriously impoverishing. But this irrationality may at the same time be critical to setting forth new ideas, perspectives, reflections and disruptions of taken-for-granted social assumptions, and why art is so indispensable in the first place (Bourdieu Field 39; Ley New Middle Class 2531; Weber on irrationality and the Enlightenment Project; also Adorno’s the ‘primitive’ in art). Australia’s cities, like those of most developed nations, increasingly demand we busy ourselves with the high-consumption of modern life that makes certain activities that sit outside this almost impossible. As gentrification unfolds from the metropolis to the regions, Australia faces a new level of far-reaching social inequality that has real consequences for who is able to participate in art-making, where these people can live, and ultimately what kind of diversity of ideas and voices participate in the generation of our national cultural life. ConclusionThe revival of some of Australia’s more popular regional towns has brought new life to some regional areas, particularly in reshaping their identities as cultural hubs worth experiencing, living amongst or supporting their development. Our interviews brought to life the significant benefits artists have experienced in relocating to country towns, whether by choice or necessity, as well as some setbacks. It was clear that economics played a major role in the demographic shift that took place in the area being examined; more specifically, that the general reorientation of social life towards consumption activities are having dramatic spatial consequences that we are currently seeing transform our major centres. The ability of art and creative practices to breathe new life into forgotten and devalued ideas and spaces is a foundational attribute but one that also creates a gentrification problem. Indeed, this is possibly the key drawback to the revivification of certain regional areas, alongside other prejudices and clashes between metro and regional cultures. It is argued that the transformative and redemptive actions art can perform need to involve the modern irrationality of not being transfixed by matters of economic materialism, so as to sit outside taken-for-granted value structures. This emphasises the importance of equality and open access in our spaces and landscapes if we are to pursue a vibrant, diverse and progressive national cultural sphere.ReferencesAbbing, Hans. Why Artists Are Poor: The Exceptional Economy of the Arts. Amsterdam: Amsterdam UP, 2002.Adorno, Theodor. Aesthetic Theory. London: Routledge, 1983.Australian Bureau of Statistics. “Population Growth: Capital City Growth and Development.” 4102.0—Australian Social Trends. Canberra: Australian Bureau of Sttaistics, 1996. <http://www.abs.gov.au/ausstats/abs@.nsf/2f762f95845417aeca25706c00834efa/924739f180990e34ca2570ec0073cdf7!OpenDocument>.Barr, Neil, Kushan Karunaratne, and Roger Wilkinson. Australia’s Farmers: Past, Present and Future. Land and Water Resources Research and Development Corporation, 2005. 1 Mar. 2019 <http://inform.regionalaustralia.org.au/industry/agriculture-forestry-and-fisheries/item/australia-s-farmers-past-present-and-future>.Benjamin, Walter. Charles Baudelaire: A Lyric Poet in the Era of High Capitalism. London: NLB, 1973.———. “The Work of Art in the Age of Mechanical Reproduction.” Illuminations. Ed. Hannah Arendt. Trans. Harry Zohn. New York: Schocken Books, 1969.Boland, Brooke. “What It Takes to Be a Leading Regional Centre of Culture.” Arts Hub 18 July 2018. 1 Mar. 2019 <https://www.artshub.com.au/festival/news-article/sponsored-content/festivals/brooke-boland/what-it-takes-to-be-a-leading-regional-centre-of-culture-256110>.Bourdieu, Pierre. Distinction. Cambridge, MA: Harvard UP, 1984.———. The Field of Cultural Production. New York: Columbia UP, 1993.Brown, Bill. “‘Restless Giant’ Lures Queensland Opera’s Artistic Director Lindy Hume to the Regional Art Movement.” ABC News 13 Sep. 2017. 10 Mar. 2019 <https://www.abc.net.au/news/2017-09-12/regional-creative-industries-on-the-rise/8895842>.Docherty, Glenn. “Why 5 Million Australians Can’t Get to Work, Home or School on Time.” Sydney Morning Herald 17 Feb. 2019. 10 Mar. 2019 <https://www.smh.com.au/national/why-5-million-australians-can-t-get-to-work-home-or-school-on-time-20190215-p50y1x.html>.Fairley, Gina. “Big Hit Exhibitions to See These Summer Holidays.” Arts Hub 14 Dec. 2018. 1 Mar. 2019 <https://visual.artshub.com.au/news-article/news/visual-arts/gina-fairley/big-hit-exhibitions-to-see-these-summer-holidays-257016>.Farrelly, Kate. “Bendigo: The Regional City That’s Transformed into a Foodie and Cultural Hub.” Domain 9 Apr. 2019. 10 Mar. 2019 <https://www.domain.com.au/news/bendigo-the-regional-city-you-didnt-expect-to-become-a-foodie-and-cultural-hub-813317/>.Florida, Richard. “A Creative, Dynamic City Is an Open, Tolerant City.” The Globe and Mail 24 Jun. 2002: T8.Gray, Ian, and Geoffrey Lawrence. A Future For Regional Australia: Escaping Global Misfortune. Cambridge: Cambridge University Press, 2001.Hume, Lindy. Restless Giant: Changing Cultural Values in Regional Australia. Strawberry Hills: Currency House, 2017.Jayne, Mark. Cities and Consumption. London: Routledge, 2005.Ley, David. The New Middle Class and the Remaking of the Central City. Oxford: Oxford University Press, 1996.———. “Artists, Aestheticisation and Gentrification.” Urban Studies 40.12 (2003): 2527–44.Menger, Pierre-Michel. “Artistic Labor Markets: Contingent Works, Excess Supply and Occupational Risk Management.” Handbook of the Economics of Art and Culture. Eds. Victor Ginsburgh and David Throsby. Amsterdam: Elsevier, 2006. 766–811.Mangset, Per, Mari Torvik Heian, Bard Kleppe and Knut Løyland. “Why Are Artists Getting Poorer: About the Reproduction of Low Income among Artists.” International Journal of Cultural Policy 24.4 (2018): 539-58.Mitchell, Scott. “Want to Start Collecting Art But Don’t Know Where to Begin? Trust Your Own Taste, plus More Tips.” ABC Life, 31 Mar. 2019 <https://www.abc.net.au/life/tips-for-buying-art-starting-collection/10084036>.Murphy, Peter. “Sea Change: Re-Inventing Rural and Regional Australia.” Transformations 2 (March 2002).Regional Australia Institute. “The Rise of the Regional Bohemians.” Regional Australia Institute 24 May. 2017. 1 Mar. 2019 <http://www.regionalaustralia.org.au/home/2017/05/rise-regional-bohemians-painting-new-picture-arts-culture-regional-australia/>.Rentschler, Ruth, Kerrie Bridson, and Jody Evans. Regional Arts Australia Stats and Stories: The Impact of the Arts in Regional Australia. Regional Arts Australia [n.d.]. <https://www.cacwa.org.au/documents/item/477>.Simpson, Andrea. “The Regions: Delivering Exceptional Arts Experiences to the Community.” ArtsHub 11 Apr. 2019. <https://visual.artshub.com.au/news-article/sponsored-content/visual-arts/andrea-simpson/the-regions-delivering-exceptional-arts-experiences-to-the-community-257752>.

Women in federal politics are under-represented today and always have been. At no time in the history of the federal parliament have women achieved equal representation with men. There have never been an equal number of women in any federal cabinet. Women have never held an equitable number of executive positions of the Australian Labor Party (ALP) or the Liberal Party. Australia has had only one female Prime Minister, Julia Gillard, and she was the recipient of sexist treatment in the parliament and the media. A 2019 report by Plan International found that girls and women, were “reluctant to pursue a career in politics, saying they worry about being treated unfairly.” The Report author said the results were unsurprisingwhen you consider how female politicians are still treated in Parliament and the media in this country, is it any wonder the next generation has no desire to expose themselves to this world? Unfortunately, in Australia, girls grow up seeing strong, smart, capable female politicians constantly reduced to what they’re wearing, comments about their sexuality and snipes about their gender.What voters may not always see is how women in politics respond to sexist treatment, or to bullying, or having to vote against their principles because of party rules, or to having no support to lead the party. Rather than being political victims and quitting, there is a ground-swell of women who are fighting back. The rage they feel at being excluded, bullied, harassed, name-called, and denied leadership opportunities is being channelled into rage against the structures that deny them equality. The rage they feel is building resilience and it is building networks of women across the political divide. This article highlights some female MPs who are “maintaining the rage”. It suggests that the rage that is evident in their public responses is empowering them to stand strong in the face of adversity, in solidarity with other female MPs, building their resilience, and strengthening calls for social change and political equality.Her-story of Women’s MovementsThroughout the twentieth century, women stood for equal rights and personal empowerment driven by rage against their disenfranchisement. Significant periods include the early 1900s, with suffragettes gaining the vote for women. The interwar period of 1919 to 1938 saw women campaign for financial independence from their husbands (Andrew). Australian women were active citizens in a range of campaigns for improved social, economic and political outcomes for women and their children.Early contributions made by women to Australian society were challenges to the regulations and of female sexuality and reproduction. Early twentieth century feminist organisations such The Women’s Peace Army, United Association of Women, the Australian Federation of Women’s Societies for Equal Citizenship, the Union of Australian Women, the National Council of Women, and the Australian Federation of Women Voters, proved the early forerunners to the 1970s Women’s Liberation Movement (WLM). It was in many of these early campaigns that the rage expressed in the concept of the “personal is political” (Hanisch) became entrenched in Australian feminist approaches to progressive social change. The idea of the “personal is political” encapsulated that it was necessary to challenge and change power relations, achievable when women fully participated in politics (van Acker 25). Attempts by women during the 1970s to voice concerns about issues of inequality, including sexuality, the right to abortion, availability of childcare, and sharing of household duties, were “deemed a personal problem” and not for public discussion (Hanisch). One core function of the WLM was to “advance women’s positions” via government legislation or, as van Acker (120) puts it, the need for “feminist intervention in the state.” However, in advocating for policy reform, the WLM had no coherent or organised strategy to ensure legislative change. The establishment of the Women’s Electoral Lobby (WEL), together with the Femocrat strategy, sought to rectify this. Formed in 1972, WEL was tasked with translating WLM concerns into government policy.The initial WEL campaign took issues of concern to WLM to the incoming Whitlam government (1972-1975). Lyndall Ryan (73) notes: women’s liberationists were the “stormtroopers” and WEL the “pragmatic face of feminism.” In 1973 Whitlam appointed Elizabeth Reid, a member of WLM, as Australia’s first Women’s Advisor. Of her appointment, Reid (3) said, “For the first time in our history we were being offered the opportunity to attempt to implement what for years we had been writing, yelling, marching and working towards. Not to respond would have felt as if our bluff had been called.” They had the opportunity in the Whitlam government to legislatively and fiscally address the rage that drove generations of women to yell and march.Following Reid were the appointments of Sara Dowse and Lyndall Ryan, continuing the Femocrat strategy of ensuring women were appointed to executive bureaucratic roles within the Whitlam government. The positions were not well received by the mainly male-dominated press gallery and parliament. As “inside agitators” (Eisenstein) for social change the central aim of Femocrats was social and economic equity for women, reflecting social justice and progressive social and public policy. Femocrats adopted a view about the value of women’s own lived experiences in policy development, application and outcome. The role of Senator Susan Ryan is of note. In 1981, Ryan wrote and introduced the Sex Discrimination Bill, the first piece of federal legislation of its type in Australia. Ryan was a founding member of WEL and was elected to the Senate in 1975 on the slogan “A woman’s place is in the Senate”. As Ryan herself puts it: “I came to believe that not only was a woman’s place in the House and in the Senate, as my first campaign slogan proclaimed, but a feminist’s place was in politics.” Ryan, the first Labor woman to represent the ACT in the Senate, was also the first Labor woman appointed as a federal Minister.With the election of the economic rationalist Hawke and Keating Governments (1983-1996) and the neoliberal Howard Government (1996-2007), what was a “visible, united, highly mobilised and state-focused women’s movement” declined (Lake 260). This is not to say that women today reject the value of women’s voices and experiences, particularly in politics. Many of the issues of the 1970s remain today: domestic violence, unequal pay, sexual harassment, and a lack of gender parity in political representation. Hence, it remains important that women continue to seek election to the national parliament.Gender Gap: Women in Power When examining federal elections held between 1972 and 2016, women have been under-represented in the lower house. In none of these elections have women achieved more than 30 per cent representation. Following the 1974 election less that one per cent of the lower house were women. No women were elected to the lower house at the 1975 or 1977 election. Between 1980 and 1996, female representation was less than 10 per cent. In 1996 this rose to 15 per cent and reached 29 per cent at the 2016 federal election.Following the 2016 federal election, only 32 per cent of both chambers were women. After the July 2016 election, only eight women were appointed to the Turnbull Ministry: six women in Cabinet and two women in the Outer Cabinet (Parliament of Australia). Despite the higher representation of women in the ALP, this is not reflected in the number of women in the Shadow Cabinet. Just as female parliamentarians have never achieved parity, neither have women in the Executive Branch.In 2017, Australia was ranked 50th in the world in terms of gender representation in parliament, between The Philippines and South Sudan. Globally, there are 38 States in which women account for less than 10 per cent of parliamentarians. As at January 2017, the three highest ranking countries in female representation were Rwanda, Bolivia and Cuba. The United Kingdom was ranked 47th, and the United States 104th (IPU and UNW). Globally only 18 per cent of government ministers are women (UNW). Between 1960 and 2013, 52 women became prime ministers worldwide, of those 43 have taken office since 1990 (Curtin 191).The 1995 United Nations (UN) Fourth World Conference on Women set a 30 per cent target for women in decision-making. This reflects the concept of “critical mass”. Critical mass proposes that for there to be a tipping balance where parity is likely to emerge, this requires a cohort of a minimum of 30 per cent of the minority group.Gender scholars use critical mass theory to explain that parity won’t occur while there are only a few token women in politics. Rather, only as numbers increase will women be able to build a strong enough presence to make female representation normative. Once a 30 per cent critical mass is evident, the argument is that this will encourage other women to join the cohort, making parity possible (Childs & Krook 725). This threshold also impacts on legislative outcomes, because the larger cohort of women are able to “influence their male colleagues to accept and approve legislation promoting women’s concerns” (Childs & Krook 725).Quotas: A Response to Gender InequalityWith women representing less than one in five parliamentarians worldwide, gender quotas have been introduced in 90 countries to redress this imbalance (Krook). Quotas are an equal opportunity measure specifically designed to re-dress inequality in political representation by allocating seats to under-represented groups (McCann 4). However, the effectiveness of the quota system is contested, with continued resistance, particularly in conservative parties. Fine (3) argues that one key objection to mandatory quotas is that they “violate the principle of merit”, suggesting insufficient numbers of women capable or qualified to hold parliamentary positions.In contrast, Gauja (2) suggests that “state-mandated electoral quotas work” because in countries with legislated quotas the number of women being nominated is significantly higher. While gender quotas have been brought to bear to address the gender gap, the ability to challenge the majority status of men has been limited (Hughes).In 1994 the ALP introduced rule-based party quotas to achieve equal representation by 2025 and a gender weighting system for female preselection votes. Conversely, the Liberal Party have a voluntary target of reaching 50 per cent female representation by 2025. But what of the treatment of women who do enter politics?Fig. 1: Portrait of Julia Gillard AC, 27th Prime Minister of Australia, at Parliament House, CanberraInside Politics: Misogyny and Mobs in the ALPIn 2010, Julia Gillard was elected as the leader of the governing ALP, making her Australia’s first female Prime Minister. Following the 2010 federal election, called 22 days after becoming Prime Minister, Gillard was faced with the first hung parliament since 1940. She formed a successful minority government before losing the leadership of the ALP in June 2013. Research demonstrates that “being a female prime minister is often fraught because it challenges many of the gender stereotypes associated with political leadership” (Curtin 192). In Curtin’s assessment Gillard was naïve in her view that interest in her as the country’s first female Prime Minister would quickly dissipate.Gillard, argues Curtin (192-193), “believed that her commitment to policy reform and government enterprise, to hard work and maintaining consensus in caucus, would readily outstrip the gender obsession.” As Curtin continues, “this did not happen.” Voters were continually reminded that Gillard “did not conform to the traditional.” And “worse, some high-profile men, from industry, the Liberal Party and the media, indulged in verbal attacks of a sexist nature throughout her term in office (Curtin 192-193).The treatment of Gillard is noted in terms of how misogyny reinforced negative perceptions about the patriarchal nature of parliamentary politics. The rage this created in public and media spheres was double-edged. On the one hand, some were outraged at the sexist treatment of Gillard. On the other hand, those opposing Gillard created a frenzy of personal and sexist attacks on her. Further attacking Gillard, on 25 February 2011, radio broadcaster Alan Jones called Gillard, not only by her first-name, but called her a “liar” (Kwek). These attacks and the informal way the Prime Minister was addressed, was unprecedented and caused outrage.An anti-carbon tax rally held in front of Parliament House in Canberra in March 2011, featured placards with the slogans “Ditch the Witch” and “Bob Brown’s Bitch”, referring to Gillard and her alliance with the Australian Greens, led by Senator Bob Brown. The Opposition Leader Tony Abbott and other members of the Liberal Party were photographed standing in front of the placards (Sydney Morning Herald, Vertigo). Criticism of women in positions of power is not limited to coming from men alone. Women from the Liberal Party were also seen in the photo of derogatory placards decrying Gillard’s alliances with the Greens.Gillard (Sydney Morning Herald, “Gillard”) said she was “offended when the Leader of the Opposition went outside in the front of Parliament and stood next to a sign that said, ‘Ditch the witch’. I was offended when the Leader of the Opposition stood next to a sign that ascribed me as a man’s bitch.”Vilification of Gillard culminated in October 2012, when Abbott moved a no-confidence motion against the Speaker of the House, Peter Slipper. Abbott declared the Gillard government’s support for Slipper was evidence of the government’s acceptance of Slipper’s sexist attitudes (evident in allegations that Slipper sent a text to a political staffer describing female genitals). Gillard responded with what is known as the “Misogyny speech”, pointing at Abbott, shaking with rage, and proclaiming, “I will not be lectured about sexism and misogyny by this man” (ABC). Apart from vilification, how principles can be forsaken for parliamentary, party or electoral needs, may leave some women circumspect about entering parliament. Similar attacks on political women may affirm this view.In 2010, Labor Senator Penny Wong, a gay Member of Parliament and advocate of same-sex marriage, voted against a bill supporting same-sex marriage, because it was not ALP policy (Q and A, “Passion”). Australian Marriage Equality spokesperson, Alex Greenwich, strongly condemned Wong’s vote as “deeply hypocritical” (Akersten). The Sydney Morning Herald (Dick), under the headline “Married to the Mob” asked:a question: what does it now take for a cabinet minister to speak out on a point of principle, to venture even a mild criticism of the party position? ... Would you object if your party, after fixing some areas of discrimination against a minority group of which you are a part, refused to move on the last major reform for that group because of ‘tradition’ without any cogent explanation of why that tradition should remain? Not if you’re Penny Wong.In 2017, during the postal vote campaign for marriage equality, Wong clarified her reasons for her 2010 vote against same-sex marriage saying in an interview: “In 2010 I had to argue a position I didn’t agree with. You get a choice as a party member don’t you? You either resign or do something like that and make a point, or you stay and fight and you change it.” Biding her time, Wong used her rage to change policy within the ALP.In continuing personal attacks on Gillard, on 19 March 2012, Gillard was told by Germaine Greer that she had a “big arse” (Q and A, “Politics”) and on 27 August 2012, Greer said Gillard looked like an “organ grinder’s monkey” (Q and A, “Media”). Such an attack by a prominent feminist from the 1970s, on the personal appearance of the Prime Minister, reinforced the perception that it was acceptable to criticise a woman in this position, in ways men have never been. Inside Politics: Leadership and Bullying inside the Liberal PartyWhile Gillard’s leadership was likely cut short by the ongoing attacks on her character, Liberal Deputy leader Julie Bishop was thwarted from rising to the leadership of the Liberal Party, thus making it unlikely she will become the Liberal Party’s first female Prime Minister. Julie Bishop was Australia’s Minister for Foreign Affairs from 2013 to 2018 and Deputy Leader of the Liberal Party from 2007 to 2018, having entered politics in 1998.With the impending demise of Prime Minister Turnbull in August 2018, Bishop sought support from within the Liberal Party to run for the leadership. In the second round of leadership votes Bishop stood for the leadership in a three-cornered race, coming last in the vote to Peter Dutton and Scott Morrison. Bishop resigned as the Foreign Affairs Minister and took a seat on the backbench.When asked if the Liberal Party would elect a popular female leader, Bishop replied: “When we find one, I’m sure we will.” Political journalist Annabel Crabb offered further insight into what Bishop meant when she addressed the press in her red Rodo shoes, labelling the statement as “one of Julie Bishop’s chilliest-ever slapdowns.” Crabb, somewhat sardonically, suggested this translated as Bishop listing someone with her qualifications and experience as: “Woman Works Hard, Is Good at Her Job, Doesn't Screw Up, Loses Out Anyway.”For political journalist Tony Wright, Bishop was “clearly furious with those who had let their testosterone get the better of them and their party” and proceeded to “stride out in a pair of heels in the most vivid red to announce that, despite having resigned the deputy position she had occupied for 11 years, she was not about to quit the Parliament.” In response to the lack of support for Bishop in the leadership spill, female members of the federal parliament took to wearing red in the parliamentary chambers signalling that female members were “fed up with the machinations of the male majority” (Wright).Red signifies power, strength and anger. Worn in parliament, it was noticeable and striking, making a powerful statement. The following day, Bishop said: “It is evident … that there is an acceptance of a level of behaviour in Canberra that would not be tolerated in any other workplace across Australia" (Wright).Colour is political. The Suffragettes of the early twentieth century donned the colours of purple and white to create a statement of unity and solidarity. In recent months, Dr Kerryn Phelps used purple in her election campaign to win the vacated seat of Wentworth, following Turnbull’s resignation, perhaps as a nod to the Suffragettes. Public anger in Wentworth saw Phelps elected, despite the electorate having been seen as a safe Liberal seat.On 21 February 2019, the last sitting day of Parliament before the budget and federal election, Julie Bishop stood to announce her intention to leave politics at the next election. To some this was a surprise. To others it was expected. On finishing her speech, Bishop immediately exited the Lower House without acknowledging the Prime Minister. A proverbial full-stop to her outrage. She wore Suffragette white.Victorian Liberal backbencher Julia Banks, having declared herself so repelled by bullying during the Turnbull-Dutton leadership delirium, announced she was quitting the Liberal Party and sitting in the House of Representatives as an Independent. Banks said she could no longer tolerate the bullying, led by members of the reactionary right wing, the coup was aided by many MPs trading their vote for a leadership change in exchange for their individual promotion, preselection endorsements or silence. Their actions were undeniably for themselves, for their position in the party, their power, their personal ambition – not for the Australian people.The images of male Liberal Members of Parliament standing with their backs turned to Banks, as she tended her resignation from the Liberal Party, were powerful, indicating their disrespect and contempt. Yet Banks’s decision to stay in politics, as with Wong and Bishop is admirable. To maintain the rage from within the institutions and structures that act to sustain patriarchy is a brave, but necessary choice.Today, as much as any time in the past, a woman’s place is in politics, however, recent events highlight the ongoing poor treatment of women in Australian politics. Yet, in the face of negative treatment – gendered attacks on their character, dismissive treatment of their leadership abilities, and ongoing bullying and sexism, political women are fighting back. They are once again channelling their rage at the way they are being treated and how their abilities are constantly questioned. They are enraged to the point of standing in the face of adversity to bring about social and political change, just as the suffragettes and the women’s movements of the 1970s did before them. The current trend towards women planning to stand as Independents at the 2019 federal election is one indication of this. Women within the major parties, particularly on the conservative side of politics, have become quiet. Some are withdrawing, but most are likely regrouping, gathering the rage within and ready to make a stand after the dust of the 2019 election has settled.ReferencesAndrew, Merrindahl. Social Movements and the Limits of Strategy: How Australian Feminists Formed Positions on Work and Care. Canberra. Australian National University. 2008.Akersten, Matt. “Wong ‘Hypocrite’ on Gay Marriage.” SameSame.com 2010. 12 Sep. 2016 <http://www.samesame.com.au/news/5671/Wong-hypocrite-on-gay-marriage>.Banks, Julia. Media Statement, 27 Nov. 2018. 20 Jan. 2019 <http://juliabanks.com.au/media-release/statement-2/>.Childs, Sarah, and Mona Lena Krook. “Critical Mass Theory and Women’s Political Representation.” Political Studies 56 (2008): 725-736.Crabb, Annabel. “Julie Bishop Loves to Speak in Code and She Saved Her Best One-Liner for Last.” ABC News 28 Aug. 2018. 20 Jan. 2019 <https://www.abc.net.au/news/2018-08-28/julie-bishop-women-in-politics/10174136>.Curtin, Jennifer. “The Prime Ministership of Julia Gillard.” Australian Journal of Political Science 50.1 (2015): 190-204.Dick, Tim. “Married to the Mob.” Sydney Morning Herald 26 July 2010. 12 Sep. 2016 <http://m.smh.com.au/federal-election/married-to-the-mob-20100726-0r77.html?skin=dumb-phone>.Eisenstein, Hester. Inside Agitators: Australian Femocrats and the State. Sydney: Allen and Unwin, 1996.Fine, Cordelia. “Do Mandatory Gender Quotas Work?” The Monthly Mar. 2012. 6 Feb. 2018 <https://www.themonthly.com.au/issue/2012/march/1330562640/cordelia-fine/status-quota>.Gauja, Anika. “How the Liberals Can Fix Their Gender Problem.” The Conversation 13 Oct. 2017. 16 Oct. 2017 <https://theconversation.com/how-the-liberals-can-fix-their-gender-problem- 85442>.Hanisch, Carol. “Introduction: The Personal is Political.” 2006. 18 Sep. 2016 <http://www.carolhanisch.org/CHwritings/PIP.html>.Hughes, Melanie. “Intersectionality, Quotas, and Minority Women's Political Representation Worldwide.” American Political Science Review 105.3 (2011): 604-620.Inter-Parliamentary Union. Equality in Politics: A Survey of Women and Men in Parliaments. 2008. 25 Feb. 2018 <http://archive.ipu.org/pdf/publications/equality08-e.pdf>.Inter-Parliamentary Union and United Nations Women. Women in Politics: 2017. 2017. 29 Jan. 2018 <https://www.ipu.org/resources/publications/infographics/2017-03/women-in-politics-2017>.Krook, Mona Lena. “Gender Quotas as a Global Phenomenon: Actors and Strategies in Quota Adoption.” European Political Science 3.3 (2004): 59–65.———. “Candidate Gender Quotas: A Framework for Analysis.” European Journal of Political Research 46 (2007): 367–394.Kwek, Glenda. “Alan Jones Lets Rip at ‘Ju-liar’ Gillard.” Sydney Morning Herald 25 Feb. 2011. 12 Sep. 2016 <http://www.smh.com.au/entertainment/tv-and-radio/alan-jones-lets-rip-at-juliar-gillard-20110224-1b7km.html>.Lake, Marilyn. Getting Equal: The History of Australian Feminism. Sydney: Allen and Unwin, 1999.McCann, Joy. “Electoral Quotas for Women: An International Overview.” Parliament of Australia Library 14 Nov. 2013. 1 Feb. 2018 <https://www.aph.gov.au/About_Parliament/Parliamentary_Departments/Parliamentary_Library/pubs/rp/rp1314/ElectoralQuotas>.Parliament of Australia. “Current Ministry List: The 45th Parliament.” 2016. 11 Sep. 2016 <http://www.aph.gov.au/about_parliament/parliamentary_departments/parliamentary_library/parliamentary_handbook/current_ministry_list>.Plan International. “Girls Reluctant to Pursue a Life of Politics Cite Sexism as Key Reason.” 2018. 20 Jan. 2019 <https://www.plan.org.au/media/media-releases/girls-have-little-to-no-desire-to-pursue-a-career-in-politics>.Q and A. “Mutilation and the Media Generation.” ABC Television 27 Aug. 2012. 28 Sep. 2016 <http://www.abc.net.au/tv/qanda/txt/s3570412.htm>.———. “Politics and Porn in a Post-Feminist World.” ABC Television 19 Mar. 2012. 12 Sep. 2016 <http://www.abc.net.au/tv/qanda/txt/s3451584.htm>.———. “Where Is the Passion?” ABC Television 26 Jul. 2010. 23 Mar. 2018 <http://www.abc.net.au/tv/qanda/txt/s2958214.htm?show=transcript>.Reid, Elizabeth. “The Child of Our Movement: A Movement of Women.” Different Lives: Reflections on the Women’s Movement and Visions of Its Future. Ed. Jocelynne Scutt. Ringwood: Penguin 1987. 107-120.Ryan, L. “Feminism and the Federal Bureaucracy 1972-83.” Playing the State: Australian Feminist Interventions. Ed. Sophie Watson. Sydney: Allen and Unwin 1990.Ryan, Susan. “Fishes on Bicycles.” Papers on Parliament 17 (Sep. 1992). 1 Mar. 2018 <https://www.aph.gov.au/~/~/link.aspx?_id=981240E4C1394E1CA3D0957C42F99120>.Sydney Morning Herald. “‘Pinocchio Gillard’: Strong Anti-Gillard Emissions at Canberra Carbon Tax Protest.” 23 Mar. 2011. 12 Sep. 2016 <http://www.smh.com.au/environment/climate-change/pinocchio-gillard-strong-antigillard-emissions-at-canberra-carbon-tax-protest-20110323-1c5w7.html>.———. “Gillard v Abbott on the Slipper Affair.” 10 Oct. 2012. 12 Sep. 2016 <http://www.abc.net.au/news/2012-10-09/gillard-vs-abbott-on-the-slipper-affair/4303618>.United Nations Women. Facts and Figures: Leadership and Political Participation. 2017. 1 Mar. 2018 <http://www.unwomen.org/en/what-we-do/leadership-and-political-participation/facts-and-figures>.Van Acker, Elizabeth. Different Voices: Gender and Politics in Australia. Melbourne: MacMillan Education Australia, 1999.Wright, Tony. “No Handmaids Here! Liberal Women Launch Their Red Resistance.” Sydney Morning Herald 17 Sep. 2018. 20 Jan. 2019 <https://www.smh.com.au/politics/federal/no-handmaids-here-liberal-women-launch-their-red-resistance-20180917-p504bm.html>.Wong, Penny. “Marriage Equality Plebiscite.” Interview Transcript. The Project 1 Aug. 2017. 1 Mar. 2018 <https://www.pennywong.com.au/transcripts/the-project-2/>.

Special Care Notice This paper discusses trauma and violence inflicted upon the Indigenous peoples of Tasmania through the process of colonisation. Content within this paper may be distressing to some readers. Introduction The decimation of the First Peoples of Van Diemen’s Land (now Tasmania) was systematic and swift. First Contact was an emotionally, intellectually, physically, and spiritually confronting series of encounters for the Indigenous inhabitants. There were, according to some early records, a few examples of peaceful interactions (Morris 84). Yet, the inevitable competition over resources, and the intensity with which colonists pursued their “claims” for food, land, and water, quickly transformed amicable relationships into hostile rivalries. Jennifer Gall has written that, as “European settlement expanded in the late 1820s, violent exchanges between settlers and Aboriginal people were frequent, brutal and unchecked” (58). Indeed, the near-annihilation of the original custodians of the land was, if viewed through the lens of time, a process that could be described as one that was especially efficient. As John Morris notes: in 1803, when the first settlers arrived in Van Diemen’s Land, the Aborigines had already inhabited the island for some 25,000 years and the population has been estimated at 4,000. Seventy-three years later, Truganinni, [often cited as] the last Tasmanian of full Aboriginal descent, was dead. (84) Against a backdrop of extreme violence, often referred to as the Black War (Clements 1), there were some, admittedly dubious, efforts to contain the bloodshed. One such effort, in the late 1820s, was the production, and subsequent distribution, of a set of Proclamation Boards. Approximately 100 Proclamation Boards (the Board) were introduced by the Lieutenant Governor of the day, George Arthur (after whom Port Arthur on the Tasman Peninsula is named). The purpose of these Boards was to communicate, via a four-strip pictogram, to the Indigenous peoples of the island colony that all people—black and white—were considered equal under the law. “British Justice would protect” everyone (Morris 84). This is reflected in the narrative of the Boards. The first image presents Indigenous peoples and colonists living peacefully together. The second, and central, image shows “a conciliatory handshake between the British governor and an Aboriginal ‘chief’, highly reminiscent of images found in North America on treaty medals and anti-slavery tokens” (Darian-Smith and Edmonds 4). The third and fourth images depict the repercussions for committing murder, with an Indigenous man hanged for spearing a colonist and a European man also hanged for shooting an Aborigine. Both men executed under “gubernatorial supervision” (Turnbull 53). Image 1: Governor Davey's [sic - actually Governor Arthur's] Proclamation to the Aborigines, 1816 [sic - actually c. 1828-30]. Image Credit: Mitchell Library, State Library of NSW (Call Number: SAFE / R 247). The Board is an interesting re-imagining of one of the traditional methods of communication for Indigenous peoples; the leaving of images on the bark of trees. Such trees, often referred to as scarred trees, are rare in modern-day Tasmania as “the expansion of settlements, and the impact of bush fires and other environmental factors” resulted in many of these trees being destroyed (Aboriginal Heritage Tasmania online). Similarly, only a few of the Boards, inspired by these trees, survive today. The Proclamation Board was, in the 1860s, re-imagined as the output of a different Governor: Lieutenant Governor Davey (after whom Port Davey, on the south-west coast of Tasmania is named). This re-imagining of the Board’s creator was so effective that the Board, today, is popularly known as Governor Davey’s Proclamation to the Aborigines. This paper outlines several other re-imaginings of this Board. In addition, this paper offers another, new, re-imagining of the Board, positing that this is an early “pamphlet” on crime, justice and punishment which actually presents as a pre-cursor to the modern Australian true crime tale. In doing so this work connects the Proclamation Board to the larger genre of crime fiction. One Proclamation Board: Two Governors Labelled Van Diemen’s Land and settled as a colony of New South Wales in 1803, this island state would secede from the administration of mainland Australia in 1825. Another change would follow in 1856 when Van Diemen’s Land was, in another process of re-imagining, officially re-named Tasmania. This change in nomenclature was an initiative to, symbolically at least, separate the contemporary state from a criminal and violent past (Newman online). Tasmania’s violent history was, perhaps, inevitable. The island was claimed by Philip Gidley King, the Governor of New South Wales, in the name of His Majesty, not for the purpose of building a community, but to “prevent the French from gaining a footing on the east side of that island” and also to procure “timber and other natural products, as well as to raise grain and to promote the seal industry” (Clark 36). Another rationale for this land claim was to “divide the convicts” (Clark 36) which re-fashioned the island into a gaol. It was this penal element of the British colonisation of Australia that saw the worst of the British Empire forced upon the Aboriginal peoples. As historian Clive Turnbull explains: the brutish state of England was reproduced in the English colonies, and that in many ways its brutishness was increased, for now there came to Australia not the humanitarians or the indifferent, but the men who had vested interests in the systems of restraint; among those who suffered restraint were not only a vast number who were merely unfortunate and poverty-stricken—the victims of a ‘depression’—but brutalised persons, child-slaughterers and even potential cannibals. (Turnbull 25) As noted above the Black War of Tasmania saw unprecedented aggression against the rightful occupants of the land. Yet, the Aboriginal peoples were “promised the white man’s justice, the people [were] exhorted to live in amity with them, the wrongs which they suffer [were] deplored” (Turnbull 23). The administrators purported an egalitarian society, one of integration and peace but Van Diemen’s Land was colonised as a prison and as a place of profit. So, “like many apologists whose material benefit is bound up with the systems which they defend” (Turnbull 23), assertions of care for the health and welfare of the Aboriginal peoples were made but were not supported by sufficient policies, or sufficient will, and the Black War continued. Colonel Thomas Davey (1758-1823) was the second person to serve as Lieutenant Governor of Van Diemen’s Land; a term of office that began in 1813 and concluded in 1817. The fourth Lieutenant Governor of the island was Colonel Sir George Arthur (1784-1854); his term of office, significantly longer than Davey’s, being from 1824 to 1836. The two men were very different but are connected through this intriguing artefact, the Proclamation Board. One of the efforts made to assert the principle of equality under the law in Van Diemen’s Land was an outcome of work undertaken by Surveyor General George Frankland (1800-1838). Frankland wrote to Arthur in early 1829 and suggested the Proclamation Board (Morris 84), sometimes referred to as a Picture Board or the Tasmanian Hieroglyphics, as a tool to support Arthur’s various Proclamations. The Proclamation, signed on 15 April 1828 and promulgated in the The Hobart Town Courier on 19 April 1828 (Arthur 1), was one of several notices attempting to reduce the increasing levels of violence between Indigenous peoples and colonists. The date on Frankland’s correspondence clearly situates the Proclamation Board within Arthur’s tenure as Lieutenant Governor. The Board was, however, in the 1860s, re-imagined as the output of Davey. The Clerk of the Tasmanian House of Assembly, Hugh M. Hull, asserted that the Board was the work of Davey and not Arthur. Hull’s rationale for this, despite archival evidence connecting the Board to Frankland and, by extension, to Arthur, is predominantly anecdotal. In a letter to the editor of The Hobart Mercury, published 26 November 1874, Hull wrote: this curiosity was shown by me to the late Mrs Bateman, neé Pitt, a lady who arrived here in 1804, and with whom I went to school in 1822. She at once recognised it as one of a number prepared in 1816, under Governor Davey’s orders; and said she had seen one hanging on a gum tree at Cottage Green—now Battery Point. (3) Hull went on to assert that “if any old gentleman will look at the picture and remember the style of military and civil dress of 1810-15, he will find that Mrs Bateman was right” (3). Interestingly, Hull relies upon the recollections of a deceased school friend and the dress codes depicted by the artist to date the Proclamation Board as a product of 1816, in lieu of documentary evidence dating the Board as a product of 1828-1830. Curiously, the citation of dress can serve to undermine Hull’s argument. An early 1840s watercolour by Thomas Bock, of Mathinna, an Aboriginal child of Flinders Island adopted by Lieutenant Governor John Franklin (Felton online), features the young girl wearing a brightly coloured, high-waisted dress. This dress is very similar to the dresses worn by the children on the Proclamation Board (the difference being that Mathinna wears a red dress with a contrasting waistband, the children on the Board wear plain yellow dresses) (Bock). Acknowledging the simplicity of children's clothing during the colonial era, it could still be argued that it would have been unlikely the Governor of the day would have placed a child, enjoying at that time a life of privilege, in a situation where she sat for a portrait wearing an old-fashioned garment. So effective was Hull’s re-imagining of the Board’s creator that the Board was, for many years, popularly known as Governor Davey’s Proclamation to the Aborigines with even the date modified, to 1816, to fit Davey’s term of office. Further, it is worth noting that catalogue records acknowledge the error of attribution and list both Davey and Arthur as men connected to the creation of the Proclamation Board. A Surviving Board: Mitchell Library, State Library of New South Wales One of the surviving Proclamation Boards is held by the Mitchell Library. The Boards, oil on Huon pine, were painted by “convict artists incarcerated in the island penal colony” (Carroll 73). The work was mass produced (by the standards of mass production of the day) by pouncing, “a technique [of the Italian Renaissance] of pricking the contours of a drawing with a pin. Charcoal was then dusted on to the drawing” (Carroll 75-76). The images, once outlined, were painted in oil. Of approximately 100 Boards made, several survive today. There are seven known Boards within public collections (Gall 58): five in Australia (Mitchell Library, State Library of NSW, Sydney; Museum Victoria, Melbourne; National Library of Australia, Canberra; Tasmanian Museum and Art Gallery, Hobart; and Queen Victoria Museum and Art Gallery, Launceston); and two overseas (The Peabody Museum of Archaeology and Ethnology, Harvard University and the Museum of Archaeology and Ethnology, University of Cambridge). The catalogue record, for the Board held by the Mitchell Library, offers the following details:Paintings: 1 oil painting on Huon pine board, rectangular in shape with rounded corners and hole at top centre for suspension ; 35.7 x 22.6 x 1 cm. 4 scenes are depicted:Aborigines and white settlers in European dress mingling harmoniouslyAboriginal men and women, and an Aboriginal child approach Governor Arthur to shake hands while peaceful soldiers look onA hostile Aboriginal man spears a male white settler and is hanged by the military as Governor Arthur looks onA hostile white settler shoots an Aboriginal man and is hanged by the military as Governor Arthur looks on. (SAFE / R 247) The Mitchell Library Board was purchased from J.W. Beattie in May 1919 for £30 (Morris 86), which is approximately $2,200 today. Importantly, the title of the record notes both the popular attribution of the Board and the man who actually instigated the Board’s production: “Governor Davey’s [sic – actually Governor Arthur] Proclamation to the Aborigines, 1816 [sic – actually c. 1828-30].” The date of the Board is still a cause of some speculation. The earlier date, 1828, marks the declaration of martial law (Turnbull 94) and 1830 marks the Black Line (Edmonds 215); the attempt to form a human line of white men to force many Tasmanian Aboriginals, four of the nine nations, onto the Tasman Peninsula (Ryan 3). Frankland’s suggestion for the Board was put forward on 4 February 1829, with Arthur’s official Conciliator to the Aborigines, G.A. Robinson, recording his first sighting of a Board on 24 December 1829 (Morris 84-85). Thus, the conception of the Board may have been in 1828 but the Proclamation project was not fully realised until 1830. Indeed, a news item on the Proclamation Board did appear in the popular press, but not until 5 March 1830: We are informed that the Government have given directions for the painting of a large number of pictures to be placed in the bush for the contemplation of the Aboriginal Inhabitants. […] However […] the causes of their hostility must be more deeply probed, or their taste as connoisseurs in paintings more clearly established, ere we can look for any beneficial result from this measure. (Colonial Times 2) The remark made in relation to becoming a connoisseur of painting, though intended to be derogatory, makes some sense. There was an assumption that the Indigenous peoples could easily translate a European-styled execution by hanging, as a visual metaphor for all forms of punishment. It has long been understood that Indigenous “social organisation and religious and ceremonial life were often as complex as those of the white invaders” (McCulloch 261). However, the Proclamation Board was, in every sense, Eurocentric and made no attempt to acknowledge the complexities of Aboriginal culture. It was, quite simply, never going to be an effective tool of communication, nor achieve its socio-legal aims. The Board Re-imagined: Popular Media The re-imagining of the Proclamation Board as a construct of Governor Davey, instead of Governor Arthur, is just one of many re-imaginings of this curious object. There are, of course, the various imaginings of the purpose of the Board. On the surface these images are a tool for reconciliation but as “the story of these paintings unfolds […] it becomes clear that the proclamations were in effect envoys sent back to Britain to exhibit the ingenious attempts being applied to civilise Australia” (Carroll 76). In this way the Board was re-imagined by the Administration that funded the exercise, even before the project was completed, from a mechanism to assist in the bringing about of peace into an object that would impress colonial superiors. Khadija von Zinnenburg Carroll has recently written about the Boards in the context of their “transnational circulation” and how “objects become subjects and speak of their past through the ventriloquism of contemporary art history” (75). Carroll argues the Board is an item that couples “military strategy with a fine arts propaganda campaign” (Carroll 78). Critically the Boards never achieved their advertised purpose for, as Carroll explains, there were “elaborate rituals Aboriginal Australians had for the dead” and, therefore, “the display of a dead, hanging body is unthinkable. […] being exposed to the sight of a hanged man must have been experienced as an unimaginable act of disrespect” (92). The Proclamation Board would, in sharp contrast to feelings of unimaginable disrespect, inspire feelings of pride across the colonial population. An example of this pride being revealed in the selection of the Board as an object worthy of reproduction, as a lithograph, for an Intercolonial Exhibition, held in Melbourne in 1866 (Morris 84). The lithograph, which identifies the Board as Governor Davey’s Proclamation to the Aborigines and dated 1816, was listed as item 572, of 738 items submitted by Tasmania, for the event (The Commissioners 69-85). This type of reproduction, or re-imagining, of the Board would not be an isolated event. Penelope Edmonds has described the Board as producing a “visual vernacular” through a range of derivatives including lantern slides, lithographs, and postcards. These types of tourist ephemera are in addition to efforts to produce unique re-workings of the Board as seen in Violet Mace’s Proclamation glazed earthernware, which includes a jug (1928) and a pottery cup (1934) (Edmonds online). The Board Re-imagined: A True Crime Tale The Proclamation Board offers numerous narratives. There is the story that the Board was designed and deployed to communicate. There is the story behind the Board. There is also the story of the credit for the initiative which was transferred from Governor Arthur to Governor Davey and subsequently returned to Arthur. There are, too, the provenance stories of individual Boards. There is another story the Proclamation Board offers. The story of true crime in colonial Australia. The Board, as noted, presents through a four-strip pictogram an idea that all are equal under the rule of law (Arthur 1). Advocating for a society of equals was a duplicitous practice, for while Aborigines were hanged for allegedly murdering settlers, “there is no record of whites being charged, let alone punished, for murdering Aborigines” (Morris 84). It would not be until 1838 that white men would be punished for the murder of Aboriginal people (on the mainland) in the wake of the Myall Creek Massacre, in northern New South Wales. There were other examples of attempts to bring about a greater equity under the rule of law but, as Amanda Nettelbeck explains, there was wide-spread resistance to the investigation and charging of colonists for crimes against the Indigenous population with cases regularly not going to trial, or, if making a courtroom, resulting in an acquittal (355-59). That such cases rested on “legally inadmissible Aboriginal testimony” (Reece in Nettelbeck 358) propped up a justice system that was, inherently, unjust in the nineteenth century. It is important to note that commentators at the time did allude to the crime narrative of the Board: when in the most civilized country in the world it has been found ineffective as example to hang murderers in chains, it is not to be expected a savage race will be influenced by the milder exhibition of effigy and caricature. (Colonial Times 2) It is argued here that the Board was much more than an offering of effigy and caricature. The Proclamation Board presents, in striking detail, the formula for the modern true crime tale: a peace disturbed by the act of murder; and the ensuing search for, and delivery of, justice. Reinforcing this point, are the ideas of justice seen within crime fiction, a genre that focuses on the restoration of order out of chaos (James 174), are made visible here as aspirational. The true crime tale does not, consistently, offer the reassurances found within crime fiction. In the real world, particularly one as violent as colonial Australia, we are forced to acknowledge that, below the surface of the official rhetoric on justice and crime, the guilty often go free and the innocent are sometimes hanged. Another point of note is that, if the latter date offered here, of 1830, is taken as the official date of the production of these Boards, then the significance of the Proclamation Board as a true crime tale is even more pronounced through a connection to crime fiction (both genres sharing a common literary heritage). The year 1830 marks the release of Australia’s first novel, Quintus Servinton written by convicted forger Henry Savery, a crime novel (produced in three volumes) published by Henry Melville of Hobart Town. Thus, this paper suggests, 1830 can be posited as a year that witnessed the production of two significant cultural artefacts, the Proclamation Board and the nation’s first full-length literary work, as also being the year that established the, now indomitable, traditions of true crime and crime fiction in Australia. Conclusion During the late 1820s in Van Diemen’s Land (now Tasmania) a set of approximately 100 Proclamation Boards were produced by the Lieutenant Governor of the day, George Arthur. The official purpose of these items was to communicate, to the Indigenous peoples of the island colony, that all—black and white—were equal under the law. Murderers, be they Aboriginal or colonist, would be punished. The Board is a re-imagining of one of the traditional methods of communication for Indigenous peoples; the leaving of drawings on the bark of trees. The Board was, in the 1860s, in time for an Intercolonial Exhibition, re-imagined as the output of Lieutenant Governor Davey. This re-imagining of the Board was so effective that surviving artefacts, today, are popularly known as Governor Davey’s Proclamation to the Aborigines with the date modified, to 1816, to fit the new narrative. The Proclamation Board was also reimagined, by its creators and consumers, in a variety of ways: as peace offering; military propaganda; exhibition object; tourism ephemera; and contemporary art. This paper has also, briefly, offered another re-imagining of the Board, positing that this early “pamphlet” on justice and punishment actually presents a pre-cursor to the modern Australian true crime tale. The Proclamation Board tells many stories but, at the core of this curious object, is a crime story: the story of mass murder. Acknowledgements The author acknowledges the Palawa peoples: the traditional custodians of the lands known today as Tasmania. The author acknowledges, too, the Gadigal people of the Eora nation upon whose lands this paper was researched and written. The author extends thanks to Richard Neville, Margot Riley, Kirsten Thorpe, and Justine Wilson of the State Library of New South Wales for sharing their knowledge and offering their support. The author is also grateful to the reviewers for their careful reading of the manuscript and for making valuable suggestions. ReferencesAboriginal Heritage Tasmania. “Scarred Trees.” Aboriginal Cultural Heritage, 2012. 12 Sep. 2015 ‹http://www.aboriginalheritage.tas.gov.au/aboriginal-cultural-heritage/archaeological-site-types/scarred-trees›.Arthur, George. “Proclamation.” The Hobart Town Courier 19 Apr. 1828: 1.———. Governor Davey’s [sic – actually Governor Arthur’s] Proclamation to the Aborigines, 1816 [sic – actually c. 1828-30]. Graphic Materials. Sydney: Mitchell Library, State Library of NSW, c. 1828-30.Bock, Thomas. Mathinna. Watercolour and Gouache on Paper. 23 x 19 cm (oval), c. 1840.Carroll, Khadija von Zinnenburg. Art in the Time of Colony: Empires and the Making of the Modern World, 1650-2000. Farnham, UK: Ashgate Publishing, 2014.Clark, Manning. History of Australia. Abridged by Michael Cathcart. Melbourne: Melbourne University Press, 1997 [1993]. Clements, Nicholas. The Black War: Fear, Sex and Resistance in Tasmania. St Lucia, Qld.: U of Queensland P, 2014.Colonial Times. “Hobart Town.” Colonial Times 5 Mar. 1830: 2.The Commissioners. Intercolonial Exhibition Official Catalogue. 2nd ed. Melbourne: Blundell & Ford, 1866.Darian-Smith, Kate, and Penelope Edmonds. “Conciliation on Colonial Frontiers.” Conciliation on Colonial Frontiers: Conflict, Performance and Commemoration in Australia and the Pacific Rim. Eds. Kate Darian-Smith and Penelope Edmonds. New York: Routledge, 2015. 1–14. Edmonds, Penelope. “‘Failing in Every Endeavour to Conciliate’: Governor Arthur’s Proclamation Boards to the Aborigines, Australian Conciliation Narratives and Their Transnational Connections.” Journal of Australian Studies 35.2 (2011): 201–18.———. “The Proclamation Cup: Tasmanian Potter Violet Mace and Colonial Quotations.” reCollections 5.2 (2010). 20 May 2015 ‹http://recollections.nma.gov.au/issues/vol_5_no_2/papers/the_proclamation_cup_›.Felton, Heather. “Mathinna.” Companion to Tasmanian History. Hobart: Centre for Tasmanian Historical Studies, University of Tasmania, 2006. 29 Sep. 2015 ‹http://www.utas.edu.au/library/companion_to_tasmanian_history/M/Mathinna.htm›.Gall, Jennifer. Library of Dreams: Treasures from the National Library of Australia. Canberra: National Library of Australia, 2011.Hull, Hugh M. “Tasmanian Hieroglyphics.” The Hobart Mercury 26 Nov. 1874: 3.James, P.D. Talking about Detective Fiction. New York: Alfred A. Knopf, 2009.Mace, Violet. Violet Mace’s Proclamation Jug. Glazed Earthernware. Launceston: Queen Victoria Museum and Art Gallery, 1928.———. Violet Mace’s Proclamation Cup. Glazed Earthernware. Canberra: National Museum of Australia, 1934.McCulloch, Samuel Clyde. “Sir George Gipps and Eastern Australia’s Policy toward the Aborigine, 1838-46.” The Journal of Modern History 33.3 (1961): 261–69.Morris, John. “Notes on a Message to the Tasmanian Aborigines in 1829, popularly called ‘Governor Davey’s Proclamation to the Aborigines, 1816’.” Australiana 10.3 (1988): 84–7.Nettelbeck, Amanda. “‘Equals of the White Man’: Prosecution of Settlers for Violence against Aboriginal Subjects of the Crown, Colonial Western Australia.” Law and History Review 31.2 (2013): 355–90.Newman, Terry. “Tasmania, the Name.” Companion to Tasmanian History, 2006. 16 Sep. 2015 ‹http://www.utas.edu.au/library/companion_to_tasmanian_history/T/Tasmania%20name.htm›.Reece, Robert H.W., in Amanda Nettelbeck. “‘Equals of the White Man’: Prosecution of Settlers for Violence against Aboriginal Subjects of the Crown, Colonial Western Australia.” Law and History Review 31.2 (2013): 355–90.Ryan, Lyndall. “The Black Line in Van Diemen’s Land: Success or Failure?” Journal of Australian Studies 37.1 (2013): 3–18.Savery, Henry. Quintus Servinton: A Tale Founded upon Events of Real Occurrence. Hobart Town: Henry Melville, 1830.Turnbull, Clive. Black War: The Extermination of the Tasmanian Aborigines. Melbourne: Sun Books, 1974 [1948].

IntroductionThe Sydney Opera House is Australia’s, if not the world’s, most recognisable building. It is universally recognised as an architectural icon and as a masterpiece of the built environment, which has captured the imagination of many (Commonwealth of Australia 4). The construction of the Sydney Opera House, between 1959 and 1973, utilised many ground-breaking methods and materials which, together, pushed the boundaries of technical possibilities to the limits of human knowledge at the time (Commonwealth of Australia 36, 45). Typical investigations into the Sydney Opera House focus on its architects, the materials, construction, or the events that occur on its stages. The role of the illumination, in the perception and understanding of Australia’s most famous performing arts centre, is an under-investigated aspect of its construction and its use today (Dwyer Backstage Biography 1; Dwyer “Utzon’s Use” 131).This article examines the illumination of the Sydney Opera House from the perspective of light as a construction material, another element that is used to ‘build’ the structure on Bennelong Point. This article examines the illumination from an historical view as Jørn Utzon’s (1918-2008) concepts for the building, including the lighting design intentions, were not all realised as he did not complete the project. The task of finishing this structure was allocated to the architectural cooperative of Hall, Todd & Littlemore who replaced Utzon in 1966. The Danish-born Utzon was appointed in January 1957 having won an international competition, from a field of over 230 entries, to design a national opera house for Sydney. He quickly began the task of resolving his design, transforming the roughly-sketched concepts presented in his competition entry, into detailed drawings that articulated how the opera house would be realised. The iteration of these concepts can be most succinctly identified in Utzon’s formal design reports to the Opera House Committee which are often referred to based on the colour of their cover design. The first report, the ‘red book’ was issued in 1958 with further developments of the architectural and services designs outlined in the ‘yellow book’ which followed in 1962. The last of the original architects’ publications was the Utzon Design Principles (2002) which was created as part of the reengagement process—between the Government of New South Wales and the Sydney Opera House with the original architect—that commenced in 1999.As with many modern buildings (such as Eero Saarinen’s TWA Flight Center, Richard Meier’s Jubilee Church or Adrian D. Smith’ Burj Khalifa), concrete was selected to form the basic structural element of the Sydney Opera House. Working with the, now internationally-renowned, engineering firm Ove Arup and Partners, Utzon designed some of the most significant shapes and finishes that have become synonymous with the site. The concrete elements range from basic blade walls with lustrous finishes to the complex, shape-changing beams that rise from under the monumental stairs and climb to terminate in the southern foyers. Thus, demonstrating the use of concrete as both a structural element and a high quality architectural finish. Another product used throughout the Sydney Opera House is granite. As a hardwearing stone, it is used in a crushed form as part of the precast panels that line the walls and internal flooring and as setts on the forecourt. As with the concrete the use of the same material inside and out blurs the distinction between interior and exterior. The forecourt forms a wide-open plaza before the building rises like a headland as it meets the harbour. The final, and most recognisable element is that of the shell (or roof) tiles. After many years of research Utzon settled on a simple mix of gloss and matt tiles of approximately 120mm square that, carefully arranged, produced a chevron shaped ‘lid’ and results in an effect likened to snow and ice (Commonwealth of Australia 51).These construction elements would all remain invisible if not illuminated by light, natural or artificial. This paper posits that the illumination reinforces the architecture of the structure and extends the architectural and experiential narratives of the Sydney Opera House across time and space. That, light is—like concrete, granite and tiles—a critical component of the Opera House’s build.Building a Narrative with LightIn creating the Sydney Opera House, Utzon set about harnessing natural and artificial illumination that are intrinsic parts of the human condition. Light shapes every facet of our lives from defining working and leisure hours to providing the mechanism for high speed communications and is, therefore, an obvious choice to reinforce the structure of the building and to link the built environment with the natural world that enveloped his creation. Light was to play a major role in the narrative of the Sydney Opera House starting from a patron’s approach to the site.Utzon’s staged approach to a performance at the Sydney Opera House is well documented, from the opening passages of the Descriptive Narrative (Utzon 1-2) to the Lighting Master Plan (Steensen Varming). The role of artificial light in the preparation of the audience extends beyond the simple visibility necessary to navigate the site. Light provides a linking element that guides an audience member along their ‘journey’ through several phases of transformation from the physicality of the city on the forecourt to “another world–a make believe atmosphere, which will exclude all outside impressions and allow the patrons to be absorbed into the theatre mood, which the actors and the producers wish to create” (Utzon Descriptive Narrative 2) in the theatres. Utzon conceived of light as part of the storytelling process, expressing the building’s narrative in a way that allows illumination is to be so much more than signposts to points of activity such as cloaking areas, theatre entries and the like. The lighting was intended to delineate various stages on the ‘journey’ noted above, to reinforce the transition from one world to another such that the combination of light and architecture would provide a series of successive stimuli that would build until the crescendo of the performance itself. This supports the transition of the visitor from the world of the everyday into the narrative of the Sydney Opera House and a world of make believe. Yet, in providing a narrative between these two ‘worlds’ the lighting becomes an anchor—or an element held in suspension – a mediator in the tension between the city at the beginning of the ‘journey’ and the ‘other world’ of the performance at the end. There is a balance to be maintained between illuminating the Sydney Opera House so that it remains prominent in its harbour location, easily read as a distinct sculptural structure on the peninsular separate from, but still an essential part of, the city that lies beyond Circular Quay to the south. Utzon alludes to the challenges of crafting the illumination so that it meets these requirements, noting that the illumination of the broardwalks “must be compatible with the lighting on the approach roads” (Utzon Descriptive Narrative 68) while maintaining that “the floodlit building will be the first and last impression for [… an audience] to receive” (Utzon Descriptive Narrative 1). These lighting requirements are also tempered by the desire that the “night time [...] view will be all lights and reflections, [that] stretch all along the harbour for many miles” (Utzon Descriptive Narrative 1) reinforcing the use of light as an anchor that provides both a point of reference and serves as a mediator of the Sydney Opera House’s place within the city.The narrative of the materials and elements that are combined to give the final, physical form its striking sensory presence is also told through light, in particular colour. Or, perhaps more precisely in an illumination sense, the accurate reproduction of colour and by extension accurate presentation of the construction materials used in the creation of the Sydney Opera House. Expression of the ‘truth’ in the materials he used was important for Utzon and the faithful representation of details such as the fine grains in timber and the smooth concrete finishes required careful lighting to enhance these features. When extended to the human occupants of the Sydney Opera House, there is a short, yet very descriptive instruction: the lighting is to give “life to the skin and hair on the human form in much the same way as the light from candles” (Utzon Descriptive Narrative 67). Thus, the narrative of the materials and their quality was as important as the final structure and those who would occupy it. It is the role of light to build upon the story of the materials to contribute to the overall narrative of the Sydney Opera House.Building an Experience through IlluminationUtzon envisaged that light would do much more than provide illumination or tell the narrative of the materials he had selected – light was also to build a unique architectural experience for a patron. The experience of light was to be subtle; the architecture was to retain a position of centre stage, reinforced by, rather than ever replaced by, the illumination. In this way, concealed lighting was proposed which would be “designed in close collaboration with the acoustical engineers as they will become an integral part of overall acoustic design” and “installed in carefully selected places based on knowledge gleaned from experimental work” (Utzon Descriptive Narrative 67). Through concealing the light source, the architecture did not become cluttered or over powered by a dazzling array of fixtures and fittings that detracted from the audience’s experiences. For instance, to illuminate the monumental steps, Utzon proposed that the fittings would be recessed into the handrails, while the bar and lounge areas would be lit from discreet fittings installed within the plywood ceiling panels (Utzon Descriptive Narrative 16) to create an experience of light that was unified across the site. In addition to the aesthetical improvements gained from the removal of the light sources from the field of view, unwanted glare is also reduced reinforcing the ‘whole’ of the architectural experience.During the time that Utzon was conceptualising the illumination of the Sydney Opera House, the Major Hall (what is now known as the Concert Hall) was envisaged as what might be considered as a modern multipurpose venue, one that could accommodate among other activities: symphonic concerts; opera; ballet and dance; choral concerts; pageants and mass meetings (NSW Department of Local Government 24). The Concert Hall was the terminus for the ‘journey’—where the actors and audience find themselves in the same space, the ‘other world’—“a make believe atmosphere, which will exclude all outside impressions and allow the patrons to be absorbed into the theatre mood, which the actors and the producers wish to create” (Utzon Descriptive Narrative 2). This other world was to sumptuously explode with rich colours “which uplift you in that festive mood, away from daily life, that you expect when you go to the theatre, a play, an opera or a concert” (Utzon Utzon Design Principles 34). These highly decorated and colourful finishes contrast with the white shells further highlighting the ‘journey’ that has taken place. Utzon proposed to use the illumination to reinforce this distance and provide the link between the natural colours of the raw materials used outside the theatre and highly decorated colours of the performance spaces.The lighting treatment of the theatres extended into the foyers and their public amenities to ensure that the lighting design contributed to the overall enhancement of a patron’s visit and delivered the experience of the ‘journey’ that was envisaged by Utzon (Dwyer “Utzon’s Use” 130-32). This standardised approach was in concert with Utzon’s architectural philosophy where repetitive systems of construction elements were utilised, for instance, in the construction of the shells. Utzon clearly articulated this approach in The Descriptive Narrative, noting that “standard light fittings will be chosen […] to suit each location” (67), however the standardisation would not compromise other considerations of the space such as the acoustical performance, with Utzon noting that the “fittings for auditoria and rehearsal rooms must be of necessity, designed in close collaboration with the acoustical engineers as they will become an integral part of over acoustic design” (Utzon Descriptive Narrative 67). Another parallel between the architectural development of the Sydney Opera House and Utzon’s approach to the lighting concepts was, uncommon at the time, his preference for prototyping and experimentation with lighting effects and various fittings (Utzon Descriptive Narrative 67). A sharp contrast to the usual practices of the day which relied upon more straightforward procurement processes with generic rather than tailored solutions. Peter Hall, of Hall, Todd & Littlemore, discussed the typical method of lighting design which was prevalent during the construction of the Sydney Opera House, as a method which “amounted to the electrical engineers laying out on a plan sufficient off-the-shelf light fittings to achieve the desired illumination levels […] the resulting effects were dull even if brightly lit” (Hall 180). Thus, Utzon’s careful approach to ensure that light and architecture were in harmony as “nothing is introduced into the scheme, before it has been carefully investigated and has proved to be the right solution to the problem” (Utzon Descriptive Narrative 2) was highly innovative for its time.The use of light to provide an experience was not necessarily new, for example RSL Clubs, theme parks and department stores all used light to attract attention to their products and services, however the scale and proposed execution of these concepts was pioneering for Australia in the 1950s and 1960s. Utzon’s concepts provided a highly experiential unified design to provide the patron with a unique architectural experience built through the careful use of light.Building the Scenery with LightArchitecture might be considered set design on a grand scale (for example see Raban, Rasmuseen and Read). Both architects and set designers are concerned with the relationship between the creative designs and the viewers and both set up opportunities for interactions between people (as actors or users) and structure. However, without light, the scene remains literally, in the dark, isolated from its surroundings and unperceetable to an audience.Utzon was acutely aware of the relationship between the Sydney Opera House and the city in which it stands. The positioning of the structure on the site is no accident and the interplay between the ‘sails’ and the sun is perhaps the most recognised lighting feature of the Sydney Opera House. By varying the angle of the shells, the reflections and the effects of the sunlight are constantly varying depending on the viewer’s position and focus. More importantly, these subtle variations in the light enhance the sculptural effect of the direct illumination and help create the effect of “matt snow and shining ice” (Commonwealth of Australia 51): the ‘shimmer of life’ so desired by Utzon as the sunlight strikes the ceramic tiles. This ‘shimmer’ is not the only natural lighting effect. The use of the different angles ensures variation in the light, clouds and resulting shadows to heighten interest and create an ever-changing scene that plays out on the shells as the sun moves across the sky, as Utzon notes, “something new goes on all the time and it is so important–this interplay is so important that together with the sun, the light and the clouds, it makes it a living thing” (Utzon Sydney Opera House 49). This scene is enhanced by the changing quality of the sunlight; the shells appear to be deep amber at first light their shadows long and faint before becoming shorter and stronger as the sun moves towards its midday position with the colour changing slowly to ‘pure’ white before the shadows change sides, the process reverses and they again disappear under the cover of darkness. Although the scene replays daily, the relative location of the sun and changing weather patterns ensure infinite variation in the effect.This changing scene, on a grand scale, with light as the central character is just as important as the theatrical performances taking place indoors on the stages. With a mobile audience, the detailing of the visual scene that is the structure becomes more important. The Sydney Opera House competes for attention with shipping movements in the harbour, the adjacent bridge with the ant-like procession of climbers and the activities of the city to the south. Utzon foresaw this noting that the “position on a peninsular, which is overlooked from all angles makes it important to maintain an all-round elevation. There can be no backsides to the building and nothing can be hidden from the view” (Utzon Descriptive Narrative 1). The use of natural light to enhance the sculptural form and reinforce isolation of the structure on the peninsular, centre stage on the harbour is therefore not a coincidence. Utzon has deliberately harnessed the natural light to ensure that the Sydney Opera House is just as vibrant a performer as its surroundings. In this way, Utzon has used light to anchor the Sydney Opera House both in the city it serves and for the performances it houses.It is not just the natural light that is used as such an anchor point. Utzon planned for artificial lighting of the sails and surrounding site to ensure that after dark the ‘shimmer’ of the white tiles would be maintained with an equivalent, if manufactured, effect. For Utzon, the sculptural qualities of structure were important and should be clearly ‘read’ at night, even against a dark harbour on one side and the brighter city on the other. Through the use of artificial lighting, Utzon set the scene on Bennelong Point with the structure clearly centred in the set that is the Sydney skyline. This reinforced the notion that a journey into the Sydney Opera House was something special, a transition from the everyday to the ‘other’ world.ConclusionFor Utzon light was just as essential as concrete and other building materials for the design of the Sydney Opera House. The traditional bright lights of the stage had no place in the architectural illumination, replaced instead by a much more subtle, understated use of light, and indeed its absence. Utzon planned for the lighting to envelope an audience but not to smother them. Unfortunately, he was unable to complete his project and in 1968 J.M. Waldram was eventually appointed to complete the lighting design. Waldram’s lighting solutions—many of which are still in place today—borrowed or significantly drew upon Utzon’s original illumination concepts, thus demonstrating their strength and timeless qualities. In this way light builds on the story of the structure, reinforcing the architecture of the building and extending the narratives of the construction elements used to build the Sydney Opera House.AcknowledgementsThe author acknowledges the assistance of Rachel Franks for her input on an early draft of this article and thanks the blind peer reviewers for their generous feedback and suggestions, of course any remain errors or omissions are my own. ReferencesCommonwealth of Australia. Sydney Opera House Nomination by the Government of Australia for Inscription on the World Heritage List. Canberra: Commonwealth of Australia, 2006.Cleaver, Jack. Surface and Textured Finishes for Concrete and Their Impact upon the Environment. Sydney: Steel Reinforcement Institute of Australia, 2005.Dwyer, Simon. A Backstage Biography of the Sydney Opera House. Proceedings of the 7th Annual Conference of the Popular Culture Association of Australia and New Zealand (PopCAANZ) 2016: 1-10.———. “Utzon’s Use of Light to Influence the Audience’s Perception of the Sydney Opera House”. Inhabiting the Meta Visual: Contemporary Performance Themes. Eds. Helene Gee Markstein and Arthur Maria Steijn. Oxford: Inter-Disciplinary P, 2016.Hall, Peter. Sydney Opera House: The Design Approach to the Building with Recommendations on Its Conservation. Sydney: Sydney Opera House Trust, 1990.NSW Department of Local Government. An International Competition for a National Opera House at Bennelong Point Sydney, New South Wales, Australia: Conditions and Program (“The ‘Brown’ Book”). Sydney: NSW Government Printer, 1957.Raban, Jonathan. Soft City. London: Picador, 2008.Rasmuseen, Steen. Experiencing Architecture. Cambridge: Massachusetts Institute of Technology P, 1964.Read, Gary. “Theater of Public Space: Architectural Experimentation in the Théâtre de l'Espace (Theater of Space), Paris 1937.” Journal of Architectural Education 58.4 (2005): 53-62.Steensen Varming. Lighting Master Plan. Sydney: Sydney Opera House Trust, 2007.Utzon, Jørn. Sydney Opera House: The Descriptive Narrative. Sydney: Sydney Opera House Trust, 1965.———. The Sydney Opera House. Zodiac, 1965. 48-93.———. Untitled. (The ‘Red’ Book). Unpublished, 1958.———. Untitled. (The ‘Yellow’ Book). Unpublished, 1962.———. Utzon Design Principles. Sydney: Sydney Opera House Trust, 2002.

Neural tube defects (NTDs), such as spinal cord and brain defects, are due to abnormal embryonic development of the neural tube and associated with increased fetal and infant mortality, morbidity, lifelong disability, and high economic costs. Globally, more than 260,000 pregnancies are estimated to be affected by NTDs, and 75% of the NTD live births result in under-5 deaths.1 Majority of NTDs are folic acid-sensitive; with much of the NTD burden preventable through consumption of folic acid before and during early pregnancy (periconception). An association between low folate status of women of reproductive age (WRA) and risk of NTD-affected pregnancy was first proposed in 1965 by Hibbard et al.2 and was subsequently substantiated in several randomized controlled trials which demonstrated the effectiveness of folic acid supplementation during periconception in preventing the first occurrence of NTDs.3 These findings resulted in a recommendation in 1992 by the U.S. Public Health Service that WTA consume 400 μg of folic acid daily to prevent occurrence of an NTD-affected pregnancy.4 This recommendation together with other large-scale, global intervention studies demonstrated the efficacy of a daily periconceptional supplement of 400 μg in preventing a large percentage of NTDs.5 Folic acid is a synthetic, oxidized form of folate that acts as a coenzyme in the biosynthesis of DNA and RNA. With 4 mg folic acid daily, it may take 20 weeks to reach red-blood-cell folate levels between 1050 and 1340 nmol/L, which is optimal for reduction of the neural tube defect risk. Therefore, folic acid supplementation should be started 5–6 months before conception. The residual risk with optimal red-blood-cell folate levels is reportedly 4.5 per 10,000 total births whereas the residual risk in pooled data from countries with mandatory folic acid fortification is 7.5 per 10,000 pregnancies, regardless of pre-fortification rates.6 In one study, the optimal RBC folate level was achieved in 80.4% of women who started FA 400 μg 4–8 weeks before their last menstrual period (LMP) compared to only 53.6% in women who started 4–8 weeks after their LMP (P < 0.001). 7 A worldwide survey of folic acid supplementation in WRA showed inadequate compliance to folic acid intake.8 A systematic review and meta-analysis of pooled prevalence estimates of folic acid compliance showed 32–51% in North America, 9–78% in Europe, 21–46% in Asia, 4–34% in the Middle East, 32–39% in Australia/New Zealand, and 0% in Africa. Poor compliance was secondary to many factors. In the United States, the recommendation of 400 μg supplemental intake of folic acid daily has limitations as many pregnancies, including up to 50% of all pregnancies are unplanned.9 In many countries, particularly among low- and middle-income countries, many barriers exist for the access of WRA to folic acid supplements, such as procurement of the micronutrients in a relatively costly prepackaged form and ineffective distribution system. An evaluation of NTD trends in multiple countries indicated that, regardless of form, timing, or intended target, issuing recommendations on folic acid use alone, in the absence of fortification, had no detectable impact on NTD incidence. Thus, food fortification with folic acid has been a component of national public health strategies; in particular, where folate status is insufficient and a fortifiable food vehicle, processed by a centralized industry is consumed regularly by WRA.10,11 Other factors associated with poor compliance in folic acid intake include low income, smoking during pregnancy, alcohol consumption, multiple pregnancy, geographic location, and religious beliefs. On the other hand, preconception counselling, previous infertility therapy, multivitamin intake before pregnancy, older age planned pregnancy, previous infertility therapy, and multivitamin intake before pregnancy increased compliance.12-16 Women who also believed that they had good general and obstetric health (e.g., no history of illness or miscarriage) had attitudes of not being susceptible to the health consequences of not taking folic acid supplements and were the low users of folic acid supplement.17 In the Philippines, although WRA are advised to consume 320 ug dietary folate equivalent per day,18 about 0.9 % (around 1 in 5) are folate-deficient based on red cell folate count, while 38.7% (around 2 in 5) are folate-deficient based on serum folate.19 Congenital malformations including NTDs remain in the top ten leading causes of infant mortality from 1960 to 2005.20 In the index paper of Bernardo21 a cross-sectional, cluster sampling survey of 184 healthy, pregnant women, of age 15–49 years was conducted in the Batangas province from May to July 2017 to assess the level of knowledge, attitude, and perceived practice among the subjects on the importance of folate periconceptionally. A pretested interview questionnaire was used. The mean scores were 77% (moderate level) for knowledge, 82% for positive attitude, and 71% for positive perceived practice. The scores in the survey were related to patient’s age, civil status and to some extent, education. The study suggested that while respondents knew about folate (70%), they had low knowledge of the effect of its deficiency especially as it can lead to infant death. Knowledge had significant and positive moderate correlation with attitude (r = 0.7) and perceived practice (r = 0.5), but there was a weak positive correlation between attitude and perceived practice (r = 0.4). This likely indicates failure to emphasize the translation of knowledge and awareness properly and sufficiently into actual practice. As recommended by the author, education is the principal means to achieve the desired outcome. However, it is not clear in the study whether some amount of educational intervention besides determination of prevalence was included. As in any prevalence study, the golden opportunity to improve health outcomes is to accompany the survey with educational intervention, which in many instances, is required by the institutional board review. Some regression analysis of the data may also have been useful to determine which factors contributed most to the outcome measures. Enrique M. Ostrea, Jr., MD Wayne State University Hutzel Women’s Hospital Children’s Hospital of Michigan Detroit, Michigan, United States of America; National Institutes of Health University of the Philippines, Manila REFERENCES Blencowe H, Kancherla V, Moorthie S, Darlison D, Modell B. Estimates of global and regional prevalence of neural tube defects for 2015: a systematic analysis. Ann NY Acad Sci. 2018; 1414:31-46. Hibbard B, Hibbard E, Jeffcoate J. Folic acid and reproduction. Acta Obstet Gynecol Scand. 1965; 44:375-400. MRC Vitamin Study Research Group. Prevention of neural tube defects: Results of the Medical Research Council Vitamin Study. Lancet 1991; 338:131-7. Centers for Disease Control and Prevention. Recommendations for the use of folic acid to reduce the number of cases of spina bifida and other neural tube defects. MMWR Recomm Rep. 1992; 11:1-7. Berry R, Li Z, Erickson J, Li S, Moore C, Wang H, et al. Prevention of neural-tube defects with folic acid in China. N Engl J Med. 1999; 341:1485-890. Cawley S, McCartney D, Woodside J, Sweeney M, McDonnell R, Molloy A, et al. Optimization of folic acid supplementation in the prevention of neural tube defects. J Public Health (Oxf ). 2018; 40:827-34. van Gool J, Hirche H, Lax H, De Schaepdrijver L. Folic acid and primary prevention of neural tube defects: A review. Reprod Toxicol. 2018; 80:73-84. Crider K, Bailey L, Berry R. Folic acid food fortification: Its history, effect, concerns and future directions. Nutrients. 2011; 3:370-84. Finer L, Henshaw S. Disparities in rates of unintended pregnancy in the United States, 1994 and 2001. Perspect Sex Reprod. Health. 2006;38: 90-6. Botto L, Lisi A, Robert-Gnansia E, Erickson Stein J, Vollset E, Mastroiacovo P, et al. International retrospective cohort study of neural tube defects in relation to folic acid recommendations: are the recommendations working? BMJ 2005; 330: 571. Garrett G, Bailey L. A public health approach for preventing neural tube defects: Folic acid fortification and beyond. Ann N Y Acad Sci. 2018; 1414:47-58. Forster D, Wills G, Denning A, Bolger M. The use of folic acid and other vitamins before and during pregnancy in a group of women in Melbourne, Australia. Midwifery. 2009; 25:134-46. Tamirat K, Kebede F, Gonete T, Tessema G, Tessema Z. Geographical variations and determinants of iron and folic acid supplementation during pregnancy in Ethiopia: Analysis of 2019 mini demographic and health survey. BMC Pregnancy Childbirth. 2022; 22:127. De Santis M, Quattrocchi T, Mappa I, Spagnuolo T, Licameli A, Chiaradia G, De Luca C. Folic acid use in planned pregnancy: an Italian survey. Matern Child Health J. 2013; 17:661-6. Felipe-Dimog E, Yu C, Ho C, Liang F. Factors influencing the compliance of pregnant women with iron and folic acid supplementation in the Philippines. 2017 Philippine Demographic and Health Survey Analysis. Nutrients. 2021; 13: 3060.1-9. Toivonen K, Lacroix E, Flynn M, Ronksley P, Oinonen K, Metcalfe A, et al. Folic acid supplementation during the preconception period: A systematic review and meta-analysis. Prev Med. 2018; 114:1-17. Fulford B, Macklon N, Boivin J. Mental models of pregnancy may explain low adherence to folic acid supplementation guidelines: a cross-sectional international survey. Eur J Obstet Gynecol Reprod Biol. 2014 May; 176:99-103. Philippine Dietary and Reference Intakes. Food and Nutrition Research Institute - Department of Science and Technology (FNRIDOST). 2015. DOST Complex, FNRI Bldg., Bicutan, Taguig City, Metro Manila Philippines. Available from: https://www.fnri.dost.gov.ph/images/images/news/PDRI-2018.pdf. Desnacido JA, Cheong RL, Madriaga JR, Perlas IA & Marcos JM. Folate status of Filipino women of childbearing age: Philippines 2008. [Internet]. [cited 2019 May]. Available from: http://122.53.86.125/Seminar%20Series/38th/folate%20status_filipino%20women.pdf. David-Padilla C, Cutiongco-dela Paz E, Cavan BC, Abarquez C, Sur ALD, Sale RI, et al. Establishment of the Philippine Birth Defects Surveillance. Acta Med Philipp. 2011; 45 (4). [Internet]. [cited 2019 May]. Available from: https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source. Bernardo A. Assessment of knowledge, attitude, and perceived practices on the importance of folate among Filipino women of child-bearing age in the province of Batangas. Acta Med Philipp. May 2021, doi:10.47895/amp.vi0.1462.