Journal articles: 'Pu02'

1

Li, Quan, Zhenghe Zhu, Hongyan Wang, and Gang Jiang. "Potential energy function for PuO2+, PuH2+ and PuN2+ ions." Journal of Molecular Structure: THEOCHEM 578, no. 1-3 (February 2002): 177–80. http://dx.doi.org/10.1016/s0166-1280(01)00700-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Dulanská, Silvia, Boris Remenec, L’ubomír Mátel, and Igor Antalík. "Validation of 239,240Pu, 238Pu separation method using molecular recognition product AnaLig® Pu02 gel and extraction chromatography TRU® resin." Journal of Radioanalytical and Nuclear Chemistry 292, no. 1 (August 10, 2011): 97–101. http://dx.doi.org/10.1007/s10967-011-1370-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Dulanská, Silvia, Boris Remenec, Ľubomír Mátel, and Dušan Galanda. "The selective separation of Pu isotopes using molecular recognition technology product AnaLig® Pu02 gel and extraction chromatography TRU® resin." Journal of Radioanalytical and Nuclear Chemistry 287, no. 3 (September 18, 2010): 841–45. http://dx.doi.org/10.1007/s10967-010-0836-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Archibong, E. F., and A. K. Ray. "An ab initio study of PuO2 and of PuN2." Journal of Molecular Structure: THEOCHEM 530, no. 1-2 (September 2000): 165–70. http://dx.doi.org/10.1016/s0166-1280(00)00332-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Dulanská, Silvia, Boris Remenec, L’ubomír Mátel, and Erik Durkot. "Rapid determination of 239,240Pu, 238Pu, 241Am and 90Sr in radioactive waste using combined SPE sorbents AnaLig® Pu02, AnaLig® Sr01 and TRU® Resin." Journal of Radioanalytical and Nuclear Chemistry 293, no. 1 (March 18, 2012): 81–85. http://dx.doi.org/10.1007/s10967-012-1727-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Chacon, Hernan, Heidis Cano, Joaquin Hernández Fernández, Yoleima Guerra, Esneyder Puello-Polo, John Fredy Ríos-Rojas, and Yolima Ruiz. "Effect of Addition of Polyurea as an Aggregate in Mortars: Analysis of Microstructure and Strength." Polymers 14, no. 9 (April 26, 2022): 1753. http://dx.doi.org/10.3390/polym14091753.

Full text

Abstract:

The addition of polymers in construction is a new tendency and an important step toward the production of structures with better functional properties. This work investigates the addition of polyurea (PU) as a polymeric material in mortars. Polymer mortars were manufactured with the addition of polyurea retained in different sieves (T50 and T100) and different concentrations (2% and 5%). The characterization of the, polyurea (PU)control mortar (PU0%) and manufactured polyurea mortars (PU2%T50, PU5%T50, PU2%T100, and PU5%T100) was conducted by means of morphological analysis, SEM, XRF, TGA, and a compressive strength test of hydraulic mortars. The results show that mortars with polyurea retained in sieve 100 with a particle size of 150 μm exhibit better thermal behavior and a greater resistance to compression with a concentration of 5% polyurea with respect to the other samples. The present work reveals that polyurea retained in sieve 100 can be considered as a polymeric additive for mortars, indicating that it could be a candidate for applications such as construction.

APA, Harvard, Vancouver, ISO, and other styles

7

Kitashiro, S., T. Iwasaka, T. Sugiura, Y. Takayama, T. Tamura, K. Tamura, and M. Inada. "Monitoring urine oxygen tension during acute change in cardiac output in dogs." Journal of Applied Physiology 79, no. 1 (July 1, 1995): 202–4. http://dx.doi.org/10.1152/jappl.1995.79.1.202.

Full text

Abstract:

To evaluate whether renal blood flow (RBF) can be monitored during acute change in cardiac index, ureter urine oxygen tension (PuO2) and bladder urine oxygen tension (PbO2) were measured in six mongrel dogs. PuO2, cardiac index, and RBF increased after dobutamine infusion and decreased after propranolol infusion. PuO2 had an excellent correlation with RBF (r = 0.94) and a fair correlation with cardiac index (r = 0.50) and mean blood pressure (r = 0.56); RBF had a fair correlation with mean blood pressure (r = 0.52, P < 0.05) but was not related to cardiac index. With multiple-regression analysis, PuO2 was found to be the significant factor related to RBF. PbO2 had a good correlation with PuO2 (r = 0.94) at control levels. Furthermore, when two dogs were added to evaluate relationships among PbO2, PuO2, and RBF, PbO2 had an excellent correlation with PuO2 (r = 0.92) and RBF (r = 0.91). These data indicate that PuO2 is a more sensitive predictor of RBF than cardiac index and mean blood pressure and that PbO2 can be a noninvasive indicator reflecting RBF during acute circulatory change in dogs.

APA, Harvard, Vancouver, ISO, and other styles

8

Shang, Zhijie, Yuxuan Wang, Lixun Chai, and Gengpu Yang. "Pumilio RNA Binding Family Member 2 Promotes the Proliferation and Metastasis of Lung Cancer Cells by Regulating Ca2+ Signaling Pathway via Targeting C-X-C Chemokine Receptor Type 4." Journal of Biomaterials and Tissue Engineering 11, no. 7 (July 1, 2021): 1339–45. http://dx.doi.org/10.1166/jbt.2021.2692.

Full text

Abstract:

The aim of the present study was to investigate the mechanism by which pumilio RNA binding family member 2 (PUM2), an RNA-binding protein (RBP) of C-X-C chemokine receptor type 4 (CXCR4), exerts its effects on the development of lung cancer. RT-qPCR and western blot analysis were utilized to measure the expression of PUM2 in several lung cancer cell lines. Cell Counting Kit-8 (CCK-8), colony formation assay, transwell- and wound healing assays were employed to determine the proliferation, invasion and migration of NCI-H520 cells, respectively. Next, the expression of CXCR4 was measured using western blot analysis, and the combination between PUM2 and CXCR4 was verified by RNA immunoprecipitation (RIP) assay and RNA pull down assay. Finally, whether the expression of PUM2 can affect the Ca2+ signaling pathway was confirmed by western blot assay. Results revealed that the expression level of PUM2 was notably upregulated in lung cancer cells, and knockdown of PUM2 significantly inhibited the proliferation, invasion and migration of NCI-H520 cells. PUM2 was confirmed to be the RBP of CXCR4, and PUM2 knockdown decreased the expression of CXCR4. In addition, PUM2 silencing inhibited the phosphorylation of CaMKII, ERK, and MEK. Taken together, these findings demonstrated that PUM2 could promote the proliferation and metastasis of lung cancer cells by regulating Ca2+ signaling pathway via targeting CXCR4, which may provide a novel insight for the future treatment of lung cancer.

APA, Harvard, Vancouver, ISO, and other styles

9

Schieweck, Rico, Elisa-Charlott Schöneweiss, Max Harner, Daniela Rieger, Christin Illig, Barbara Saccà, Bastian Popper, and Michael A. Kiebler. "Pumilio2 Promotes Growth of Mature Neurons." International Journal of Molecular Sciences 22, no. 16 (August 20, 2021): 8998. http://dx.doi.org/10.3390/ijms22168998.

Full text

Abstract:

RNA-binding proteins (RBPs) are essential regulators controlling both the cellular transcriptome and translatome. These processes enable cellular plasticity, an important prerequisite for growth. Cellular growth is a complex, tightly controlled process. Using cancer cells as model, we looked for RBPs displaying strong expression in published transcriptome datasets. Interestingly, we found the Pumilio (Pum) protein family to be highly expressed in all these cells. Moreover, we observed that Pum2 is regulated by basic fibroblast growth factor (bFGF). bFGF selectively enhances protein levels of Pum2 and the eukaryotic initiation factor 4E (eIF4E). Exploiting atomic force microscopy and in vitro pulldown assays, we show that Pum2 selects for eIF4E mRNA binding. Loss of Pum2 reduces eIF4E translation. Accordingly, depletion of Pum2 led to decreased soma size and dendritic branching of mature neurons, which was accompanied by a reduction in essential growth factors. In conclusion, we identify Pum2 as an important growth factor for mature neurons. Consequently, it is tempting to speculate that Pum2 may promote cancer growth.

APA, Harvard, Vancouver, ISO, and other styles

10

Siddiqui, A. H., and M. C. Brandriss. "A regulatory region responsible for proline-specific induction of the yeast PUT2 gene is adjacent to its TATA box." Molecular and Cellular Biology 8, no. 11 (November 1988): 4634–41. http://dx.doi.org/10.1128/mcb.8.11.4634.

Full text

Abstract:

Deletion analysis of the promoter of the PUT2 gene that functions in the proline utilization pathway of Saccharomyces cerevisiae identified a PUT2 upstream activation site (UAS). It is contained within a single 40-base-pair (bp) region located immediately upstream of the TATA box and is both necessary and sufficient for proline induction. When placed upstream of a CYC7-lacZ gene fusion, the 40-bp sequence conferred proline regulation on CYC7-lacZ. A 35-bp deletion within the PUT2 UAS in an otherwise intact PUT2 promoter resulted in noninducible expression of a PUT2-lacZ gene fusion. When a plasmid bearing this UAS-deleted promoter was placed in a strain carrying a constitutive mutation in the positive regulatory gene PUT3, expression of PUT2-lacZ was not constitutive but occurred at levels below those found under noninducing conditions. In heterologous as well as homologous gene fusions, the PUT2 UAS appeared to be responsible for uninduced as well as proline-induced levels of expression. Although located immediately adjacent to the PUT2 UAS, the TATA box did not appear to play a regulatory role, as indicated by the results of experiments in which it was replaced by the CYC7 TATA box. A 26-bp sequence containing this TATA box was critical to the expression of PUT2, since a deletion of this region completely abolished transcriptional activity of the gene under both inducing and noninducing conditions. Our results indicate that the PUT2 promoter has a comparatively simple structure, requiring UAS and TATA sequences as well as the PUT3 gene product (directly or indirectly) for its expression.

APA, Harvard, Vancouver, ISO, and other styles

11

Siddiqui, A. H., and M. C. Brandriss. "A regulatory region responsible for proline-specific induction of the yeast PUT2 gene is adjacent to its TATA box." Molecular and Cellular Biology 8, no. 11 (November 1988): 4634–41. http://dx.doi.org/10.1128/mcb.8.11.4634-4641.1988.

Full text

Abstract:

Deletion analysis of the promoter of the PUT2 gene that functions in the proline utilization pathway of Saccharomyces cerevisiae identified a PUT2 upstream activation site (UAS). It is contained within a single 40-base-pair (bp) region located immediately upstream of the TATA box and is both necessary and sufficient for proline induction. When placed upstream of a CYC7-lacZ gene fusion, the 40-bp sequence conferred proline regulation on CYC7-lacZ. A 35-bp deletion within the PUT2 UAS in an otherwise intact PUT2 promoter resulted in noninducible expression of a PUT2-lacZ gene fusion. When a plasmid bearing this UAS-deleted promoter was placed in a strain carrying a constitutive mutation in the positive regulatory gene PUT3, expression of PUT2-lacZ was not constitutive but occurred at levels below those found under noninducing conditions. In heterologous as well as homologous gene fusions, the PUT2 UAS appeared to be responsible for uninduced as well as proline-induced levels of expression. Although located immediately adjacent to the PUT2 UAS, the TATA box did not appear to play a regulatory role, as indicated by the results of experiments in which it was replaced by the CYC7 TATA box. A 26-bp sequence containing this TATA box was critical to the expression of PUT2, since a deletion of this region completely abolished transcriptional activity of the gene under both inducing and noninducing conditions. Our results indicate that the PUT2 promoter has a comparatively simple structure, requiring UAS and TATA sequences as well as the PUT3 gene product (directly or indirectly) for its expression.

APA, Harvard, Vancouver, ISO, and other styles

12

Li, Meili, Zuo Xu, Xingmei Zou, Yuanfang Wang, Yiwen Li, Xiaowen Ou, Yangxi Deng, et al. "Intracellular distribution of pseudorabies virus UL2 and detection of its nuclear import mechanism." Biological Chemistry 401, no. 2 (February 25, 2020): 309–17. http://dx.doi.org/10.1515/hsz-2019-0311.

Full text

Abstract:

AbstractPseudorabies virus (PRV) UL2 (pUL2) is a multifunctional protein, which is homologous with herpes simplex virus 1 early protein UL2 (hUL2) and crucial for the viral propagation. Yet, how pUL2 executes its roles in the viral life cycle remain inadequately understood. In order to uncover its effect on the procedure of PRV infection, investigation was performed to examine the subcellular distribution of pUL2 and establish its trafficking mechanism. In the present study, enhanced yellow fluorescent protein or Myc tag fused pUL2 was transiently overexpressed in transfected cells and exhibited an absolutely nuclear accumulation without the existence of other PRV proteins. Additionally, the nuclear trafficking of pUL2 was proved to rely on Ran-, transportin-1, importin β1, importin α1, α3 and α5. Accordingly, these data will benefit the knowledge of pUL2-mediated biological effects in PRV infection cycle.

APA, Harvard, Vancouver, ISO, and other styles

13

Osawa, Eduardo Atsushi, Salvatore Lucio Cutuli, Laurent Bitker, Emmanuel Canet, Luca Cioccari, Naoya Iguchi, Yugeesh R. Lankadeva, et al. "Effect of Furosemide on Urinary Oxygenation in Patients with Septic Shock." Blood Purification 48, no. 4 (2019): 336–45. http://dx.doi.org/10.1159/000501512.

Full text

Abstract:

Background: Renal medullary hypoxia precedes the development of acute kidney injury in experimental sepsis and can now be assessed by continuous measurement of urinary oxygen tension (PuO2). Objectives: We aimed to test if PuO2 measurements in patients with septic shock would be similar to those shown in experimental sepsis and would detect changes induced by the administration of furosemide. Method: Pilot prospective observational cohort study in a tertiary intensive care unit (ICU). Seven adult patients with septic shock admitted to ICU had PuO2 measurements recorded minutely. There were 29 episodes of intravenous furosemide (20 mg n = 19; 40 mg n = 10). Results: The median pre-furosemide PuO2 was low at 21.2 mm Hg (interquartile range [IQR] 17.73–24.86) and increased to 26 mm Hg (IQR 20.27–29.95) at 20 min (p < 0.01), to 27.5 mm Hg (IQR 24.06–33.18) at 40 min (p < 0.01) and to 28.5 mm Hg (IQR 22.65–31.03) at 60 min (p < 0.01). The increase in PuO2 was greater in episodes with a diuretic response >2 mL/kg/h than during episodes without such a response (p < 0.01). Conclusions: PuO2 measurements in patients are reflective of the low values reported in experimental models of sepsis. PuO2 values increased following furosemide administration with a response independently associated with greater diuresis.

APA, Harvard, Vancouver, ISO, and other styles

14

Yang, Jie, Danislav S. Spassov, Ronald G. Nachtman, and Roland Jurecic. "Pum2 Protein Supports Maintenance and Suppresses Differentiation of Multipotent Hematopoietic Progenitors by Regulating the Function and Activation of c-kit Receptor." Blood 104, no. 11 (November 16, 2004): 1692. http://dx.doi.org/10.1182/blood.v104.11.1692.1692.

Full text

Abstract:

Abstract Intrinsic mechanisms that regulate self-renewal of mammalian stem cells remain largely unknown. Stem cell maintenance and self-renewal in Drosophila and C. elegans are regulated by members of the conserved Pumilio family of RNA-binding proteins. We have previously described cloning and characterization of two mouse and human Pumilio genes (Pum1 and Pum2), which are abundantly transcribed in hematopoietic stem cells (HSC). To study the role of mammalian Pum proteins in HSC, Pum2 was over-expressed in a SCF-dependent multipotent progenitor cell line EML, which has the capacity for multilineage (erythroid, myeloid, B and T lymphoid) differentiation in vitro. In the presence of SCF EML cells undergo SCF-dependent self-renewal, thus remaining undifferentiated and retaining an immature phenotype. When cultured with hematopoietic cytokines (IL-3, GM-CSF, Epo, Tpo) EML cells differentiate into lineage-committed hematopoietic progenitors (e.g. granulocyte/macrophage (CFU-GM), burst-forming unit erythroid (BFU-E) and megakaryocytic (CFU-Meg) progenitors). Pum2 over-expression leads to uncoupling of the survival and differentiation signals in EML cells, and their SCF-independent maintenance. EML cells over-expressing Pum2 (Pum2-EML cells) also exhibit almost complete block of differentiation into multiple lineages in the absence of SCF. Moreover, although the culture with cytokine cocktail (IL-3, Epo, Tpo and GM-CSF) and retinoic acid enhances differentiation capacity of wild type EML cells, it was not sufficient to overcome the differentiation block in Pum2-EML cells. However, the repression of Pum2-EML cell differentiation is a reversible phenomenon, since the addition of SCF to Pum2-EML cell cultures, for at least 48 hours, restores their capacity to undergo multilineage differentiation and generate hematopoietic colonies. The SCF-independent maintenance of Pum2-EML cells seems to be caused by upregulated expression and constitutive activation of the SCF receptor c-kit, and is accompanied by constitutive activation of MAPK, PI3K and PLCγ signaling pathways in the absence of SCF. More importantly, Pum2-EML cells also exhibit upregulated expression and constitutive activation of a novel truncated form of c-kit receptor called tr-kit, which was found previously to be expressed preferentially in HSC. Tr-kit could play a critical role in the SCF-independent activation of the full-length c-kit receptor, leading to SCF-independent maintenance of Pum2-EML cells, and inhibition of their multilineage differentiation. The observation that Pum2-EML cells, maintained with or without SCF, are resistant to treatment with blocking anti-c-kit antibody (ACK2) and c-kit inhibitor STI-571, supports the notion that maintenance and survival of Pum2-EML cells in the presence of SCF is not due to an external activation of c-kit receptor through ligand binding. Taken together, these findings suggest a model in which survival and maintenance of multipotent hematopoietic progenitors are mediated through SCF-independent c-kit signaling, whereas their differentiation depends on the canonical SCF-induced c-kit signaling. In summary, mouse Pum2 protein could play an important role in supporting maintenance of HSC and multipotent progenitors through regulation of the SCF/c-kit signaling pathway, and could represent a part of the mechanism through which HSCs balance their self-renewal and commitment to differentiation.

APA, Harvard, Vancouver, ISO, and other styles

15

Brandriss, M. C., and K. A. Krzywicki. "Amino-terminal fragments of delta 1-pyrroline-5-carboxylate dehydrogenase direct beta-galactosidase to the mitochondrial matrix in Saccharomyces cerevisiae." Molecular and Cellular Biology 6, no. 10 (October 1986): 3502–12. http://dx.doi.org/10.1128/mcb.6.10.3502.

Full text

Abstract:

delta 1-Pyrroline-5-carboxylate (P5C) dehydrogenase, the second enzyme in the proline utilization (Put) pathway of Saccharomyces cerevisiae and the product of the PUT2 gene, was localized to the matrix compartment by a mitochondrial fractionation procedure. This result was confirmed by demonstrating that the enzyme had limited activity toward an externally added substrate that could not penetrate the inner mitochondrial membrane (latency). To learn more about the nature of the import of this enzyme, three gene fusions were constructed that carried 5'-regulatory sequences through codons 14, 124, or 366 of the PUT2 gene ligated to the lacZ gene of Escherichia coli. When these fusions were introduced into S. cerevisiae either on multicopy plasmids or stably integrated into the genome, proline-inducible beta-galactosidase was made. The shortest gene fusion, PUT2-lacZ14, caused the production of a high level of beta-galactosidase that was found exclusively in the cytoplasm. The PUT2-lacZ124 and PUT2-lacZ366 fusions made lower levels of beta-galactosidases that were mitochondrially localized. Mitochondrial fractionation and protease-protection experiments showed that the PUT2-lacZ124 hybrid protein was located exclusively in the matrix, while the PUT2-lacZ366 hybrid was found in the matrix as well as the inner membrane. Thus, the amino-terminal 124 amino acids of P5C dehydrogenase carries sufficient information to target and deliver beta-galactosidase to the matrix compartment. The expression of the longer hybrids had deleterious effects on cell growth; PUT2-lacZ366-containing strains failed to grow on proline as the sole source of nitrogen. In the presence of the longest hybrid beta-galactosidase, the wild-type P5C dehydrogenase was still properly localized in the matrix compartment, but its activity was reduced. The nature of the effects of these hybrid proteins on cell growth is discussed.

APA, Harvard, Vancouver, ISO, and other styles

16

Brandriss, M. C., and K. A. Krzywicki. "Amino-terminal fragments of delta 1-pyrroline-5-carboxylate dehydrogenase direct beta-galactosidase to the mitochondrial matrix in Saccharomyces cerevisiae." Molecular and Cellular Biology 6, no. 10 (October 1986): 3502–12. http://dx.doi.org/10.1128/mcb.6.10.3502-3512.1986.

Full text

Abstract:

delta 1-Pyrroline-5-carboxylate (P5C) dehydrogenase, the second enzyme in the proline utilization (Put) pathway of Saccharomyces cerevisiae and the product of the PUT2 gene, was localized to the matrix compartment by a mitochondrial fractionation procedure. This result was confirmed by demonstrating that the enzyme had limited activity toward an externally added substrate that could not penetrate the inner mitochondrial membrane (latency). To learn more about the nature of the import of this enzyme, three gene fusions were constructed that carried 5'-regulatory sequences through codons 14, 124, or 366 of the PUT2 gene ligated to the lacZ gene of Escherichia coli. When these fusions were introduced into S. cerevisiae either on multicopy plasmids or stably integrated into the genome, proline-inducible beta-galactosidase was made. The shortest gene fusion, PUT2-lacZ14, caused the production of a high level of beta-galactosidase that was found exclusively in the cytoplasm. The PUT2-lacZ124 and PUT2-lacZ366 fusions made lower levels of beta-galactosidases that were mitochondrially localized. Mitochondrial fractionation and protease-protection experiments showed that the PUT2-lacZ124 hybrid protein was located exclusively in the matrix, while the PUT2-lacZ366 hybrid was found in the matrix as well as the inner membrane. Thus, the amino-terminal 124 amino acids of P5C dehydrogenase carries sufficient information to target and deliver beta-galactosidase to the matrix compartment. The expression of the longer hybrids had deleterious effects on cell growth; PUT2-lacZ366-containing strains failed to grow on proline as the sole source of nitrogen. In the presence of the longest hybrid beta-galactosidase, the wild-type P5C dehydrogenase was still properly localized in the matrix compartment, but its activity was reduced. The nature of the effects of these hybrid proteins on cell growth is discussed.

APA, Harvard, Vancouver, ISO, and other styles

17

Zhang, Yu, Yifeng Ding, Wanning Li, Wenjuan Zhu, Jia Wang, and Xiaohong Wang. "Application of a Novel Lytic Podoviridae Phage Pu20 for Biological Control of Drug-Resistant Salmonella in Liquid Eggs." Pathogens 10, no. 1 (January 4, 2021): 34. http://dx.doi.org/10.3390/pathogens10010034.

Full text

Abstract:

Salmonella is a globally distributed zoonotic pathogen. Among them, S. pullorum is a host-specific pathogen that seriously affects the development of the poultry breeding industry in China. It mainly infects chickens and can cause white scabs, and the mortality rate after infection is almost 100%. As antibiotics are widely used in animal feed and other production processes, Salmonella resistance has gradually increased. Therefore, there is an increasing need to develop new technologies to control multi-drug resistant (MDR) pathogens and confirm their actual effectiveness in the target food matrix. Bacteriophage can efficiently and specifically lyse bacteria, and will be a potential bactericide to replace antibiotics. In this study, 34 strains of Salmonella bacteriophages were isolated from environmental resources. Therein, phage Pu20 with the widest host spectrum had the strongest ability to lyse tested Salmonella strains. Further studies showed that Pu20 had high pH tolerance and heat resistance, short incubation period. Pu20 can effectively inhibit the growth of two strains of MDR Salmonella in liquid egg white and yolk at 4 °C and 25 °C, respectively. According to morphological and phylogenetic analysis, Pu20 belongs to the Podoviridae family. Genomic analysis of Pu20 indicates a linear 59435 bp dsDNA sequence with no homology to virulence or antibiotic resistance-related genes. Together, these results sheds light on the potential biocontrol application value of Pu20 in food products.

APA, Harvard, Vancouver, ISO, and other styles

18

Uyhazi, Katherine E., Yiying Yang, Na Liu, Hongying Qi, Xiao A. Huang, Winifred Mak, Scott D. Weatherbee, et al. "Pumilio proteins utilize distinct regulatory mechanisms to achieve complementary functions required for pluripotency and embryogenesis." Proceedings of the National Academy of Sciences 117, no. 14 (March 20, 2020): 7851–62. http://dx.doi.org/10.1073/pnas.1916471117.

Full text

Abstract:

Gene regulation in embryonic stem cells (ESCs) has been extensively studied at the epigenetic-transcriptional level, but not at the posttranscriptional level. Pumilio (Pum) proteins are among the few known translational regulators required for stem-cell maintenance in invertebrates and plants. Here we report the essential function of two murine Pum proteins, Pum1 and Pum2, in ESCs and early embryogenesis. Pum1/2 double-mutant ESCs display severely reduced self-renewal and differentiation, and Pum1/2 double-mutant mice are developmentally delayed at the morula stage and lethal by embryonic day 8.5. Remarkably, Pum1-deficient ESCs show increased expression of pluripotency genes but not differentiation genes, whereas Pum2-deficient ESCs show decreased pluripotency markers and accelerated differentiation. Thus, despite their high homology and overlapping target messenger RNAs (mRNAs), Pum1 promotes differentiation while Pum2 promotes self-renewal in ESCs. Pum1 and Pum2 achieve these two complementary aspects of pluripotency by forming a negative interregulatory feedback loop that directly regulates at least 1,486 mRNAs. Pum1 and Pum2 regulate target mRNAs not only by repressing translation, but also by promoting translation and enhancing or reducing mRNA stability of different target mRNAs. Together, these findings reveal distinct roles of individual mammalian Pum proteins in ESCs and their essential functions in ESC pluripotency and embryogenesis.

APA, Harvard, Vancouver, ISO, and other styles

19

Galez, Henri A., Françoise M. Roelants, Sarah M. Palm, Kendra K. Reynaud, Nicholas T. Ingolia, and Jeremy Thorner. "Phosphorylation of mRNA-Binding Proteins Puf1 and Puf2 by TORC2-Activated Protein Kinase Ypk1 Alleviates Their Repressive Effects." Membranes 11, no. 7 (June 30, 2021): 500. http://dx.doi.org/10.3390/membranes11070500.

Full text

Abstract:

Members of the Puf family of RNA-binding proteins typically associate via their Pumilio homology domain with specific short motifs in the 3’-UTR of an mRNA and thereby influence the stability, localization and/or efficiency of translation of the bound transcript. In our prior unbiased proteome-wide screen for targets of the TORC2-stimulated protein kinase Ypk1, we identified the paralogs Puf1/Jsn1 and Puf2 as high-confidence substrates. Earlier work by others had demonstrated that Puf1 and Puf2 exhibit a marked preference for interaction with mRNAs encoding plasma membrane-associated proteins, consistent with our previous studies documenting that a primary physiological role of TORC2-Ypk1 signaling is maintenance of plasma membrane homeostasis. Here, we show, first, that both Puf1 and Puf2 are authentic Ypk1 substrates both in vitro and in vivo. Fluorescently tagged Puf1 localizes constitutively in cortical puncta closely apposed to the plasma membrane, whereas Puf2 does so in the absence of its Ypk1 phosphorylation, but is dispersed in the cytosol when phosphorylated. We further demonstrate that Ypk1-mediated phosphorylation of Puf1 and Puf2 upregulates production of the protein products of the transcripts to which they bind, with a concomitant increase in the level of the cognate mRNAs. Thus, Ypk1 phosphorylation relieves Puf1- and Puf2-mediated post-transcriptional repression mainly by counteracting their negative effect on transcript stability. Using a heterologous protein-RNA tethering and fluorescent protein reporter assay, the consequence of Ypk1 phosphorylation in vivo was recapitulated for full-length Puf1 and even for N-terminal fragments (residues 1-340 and 143-295) corresponding to the region upstream of its dimerization domain (an RNA-recognition motif fold) encompassing its two Ypk1 phosphorylation sites (both also conserved in Puf2). This latter result suggests that alleviation of Puf1-imposed transcript destabilization does not obligatorily require dissociation of Ypk1-phosphorylated Puf1 from a transcript. Our findings add new insight about how the TORC2-Ypk1 signaling axis regulates the content of plasma membrane-associated proteins to promote maintenance of the integrity of the cell envelope.

APA, Harvard, Vancouver, ISO, and other styles

20

Jha, Bhaskar Anand, Abeer Fadda, Clementine Merce, Elisha Mugo, Dorothea Droll, and Christine Clayton. "Depletion of the Trypanosome Pumilio Domain Protein PUF2 or of Some Other Essential Proteins Causes Transcriptome Changes Related to Coding Region Length." Eukaryotic Cell 13, no. 5 (March 28, 2014): 664–74. http://dx.doi.org/10.1128/ec.00018-14.

Full text

Abstract:

ABSTRACT Pumilio domain RNA-binding proteins are known mainly as posttranscriptional repressors of gene expression that reduce mRNA translation and stability. Trypanosoma brucei has 11 PUF proteins. We show here that PUF2 is in the cytosol, with roughly the same number of molecules per cell as there are mRNAs. Although PUF2 exhibits a low level of in vivo RNA binding, it is not associated with polysomes. PUF2 also decreased reporter mRNA levels in a tethering assay, consistent with a repressive role. Depletion of PUF2 inhibited growth of bloodstream-form trypanosomes, causing selective loss of mRNAs with long open reading frames and increases in mRNAs with shorter open reading frames. Reexamination of published RNASeq data revealed the same trend in cells depleted of some other proteins. We speculate that these length effects could be caused by inhibition of the elongation phase of transcription or by an influence of translation status or polysomal conformation on mRNA decay.

APA, Harvard, Vancouver, ISO, and other styles

21

Tamai, Katsuyuki K., and Chikashi Shimoda. "The novel HECT-type ubiquitin-protein ligase Pub2p shares partially overlapping function with Pub1p in Schizosaccharomyces pombe." Journal of Cell Science 115, no. 9 (May 1, 2002): 1847–57. http://dx.doi.org/10.1242/jcs.115.9.1847.

Full text

Abstract:

The fission yeast Schizosaccharomyces pombe has three putative ubiquitin-protein ligases of the Nedd4/Rsp5 family, named Pub1p, Pub2p and Pub3p. Pub1p has been reported to be involved in cell cycle regulation and proliferation under acidic pH conditions. Here we characterize Pub2p, which contains a conserved HECT domain and a WW domain but lacks a C2 domain. Transcription of the pub2+ gene was constitutive and further enhanced by nitrogen starvation. A pub2-null mutation gave no remarkable phenotypes, but intensified temperature sensitivity in a pub1Δ background. Moderately overexpressed pub2+ suppressed the temperature sensitivity of pub1Δ cells, which suggests that the function of Pub2p overlaps with that of Pub1p. Overexpression of pub2+ by a strong nmt1 promoter in wild-type strains caused growth arrest and cell elongation, probably owing to defects in G2 progression or the G2/M transition. Unlike Pub1p, however, overexpression of Pub2p did not reduce the levels of Cdc25p. Pub2-GFP was found throughout the cell, especially at the cell surface in the polar regions. Pub2p contains a conserved cysteine residue(Cys639) in its putative catalytic HECT domain that can be thiol-ubiquitinated. Substitution of Cys639 by alanine (Pub2CA) caused a functional defect, because growth arrest and cell elongation were not induced by overexpression of Pub2CA. A chimeric Pub1 protein, in which the HECT domain was replaced by the Pub2 HECT domain, completely suppressed the temperature sensitivity of pub1Δ cells, suggesting that the HECT domain of Pub2p has the catalytic activity of a ubiquitin ligase. We conclude that Pub2p is a HECT-type ubiquitin-protein ligase that shares partially overlapping function with Pub1p.

APA, Harvard, Vancouver, ISO, and other styles

22

Greco, Francesca, Domenica Musumeci, Nicola Borbone, Andrea Patrizia Falanga, Stefano D’Errico, Monica Terracciano, Ilaria Piccialli, Giovanni Nicola Roviello, and Giorgia Oliviero. "Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin." Molecules 27, no. 9 (May 7, 2022): 2997. http://dx.doi.org/10.3390/molecules27092997.

Full text

Abstract:

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

APA, Harvard, Vancouver, ISO, and other styles

23

Kato, Masato, Hiroki Nakamura, Masashi Watanabe, Taku Matsumoto, and Masahiko Machida. "Defect Chemistry and Basic Properties of Non-Stoichiometric PuO₂." Defect and Diffusion Forum 375 (May 2017): 57–70. http://dx.doi.org/10.4028/www.scientific.net/ddf.375.57.

Full text

Abstract:

The basic properties of PuO2−x were reviewed, and the equilibrium defects in PuO2−x were evaluated from the experimental data of the oxygen potential and electrical conductivity as well as the Ab-initio calculation results. Consistency among various properties was confirmed, and the mechanistic models for thermal property representations were derived.

APA, Harvard, Vancouver, ISO, and other styles

24

Yang, Jie, Kyle Di Vito, Ronald G. Nachtman, and Roland Jurecic. "By Maintaining Cells in an Inactive CD34− State RNA-Binding Protein Pum2 Promotes Proliferation and Inhibits Differentiation of Multipotent Hematopoietic Cells." Blood 108, no. 11 (November 16, 2006): 1354. http://dx.doi.org/10.1182/blood.v108.11.1354.1354.

Full text

Abstract:

Abstract Previously we have reported that over-expression of RNA-binding protein Pum2 supports self-renewal and severely attenuates mutilineage differentiation of murine HSC-like cell line EML. To analyze further the impact of Pum2 on maintenance and differentiation of EML cells, we examined the expression of c-kit, Sca-1, Flk-2 and CD34 HSC markers on wild type EML cells and EML cells over-expressing Pum2 (Pum2-EML cells). Almost all wt EML cells are Sca-1+c-kit+ Flk2−, but exhibit heterogeneous expression of CD34, with 20–40% of cells being CD34−, and 60–80% of cells being CD34+. Similarly, almost all Pum2-EML cells are Sca-1+c-kit+Flk2−, but the vast majority of Pum2-EML cells are CD34− (80–95%). To determine the functional significance of this change in CD34 expression, wt EML and Pum2-EML cells were sorted into CD34+ and CD34− populations (>99% purity), and their differentiation capacity assessed using colony-forming assays. The wt EML and Pum2-EML CD34+ cell population repeatedly contained almost all of the cells capable of mutilineage differentiation in response to cytokines, and forming for example BFU-E, CFU-Meg and CFU-GM colonies. In contrast, the CD34− subpopulation of wt EML and Pum2-EML cells differentiated poorly or not at all. Thus, in terms of the phenotype and cytokine-induced differentiation the CD34− and CD34+ subpopulations of EML cells resemble CD34− and CD34+ subpopulations of HSC-enriched Lin−Sca-1+c-kit+Flk-2− BM cells. Our results also raised the question of developmental relationship between CD34− and CD34+ EML cells. Interestingly, several studies have shown that mouse CD34− HSC become CD34+ after G-CSF mobilization or 5-FU treatment, and that after transplant these “activated” CD34+ HSC revert back to CD34− “inactive” state. These studies have uncovered a putative new link between HSC activation and CD34 expression. In view of these findings we tested whether CD34− and CD34+ EML cell populations represent different developmental stages, where e.g. CD34− cells give rise to CD34+ cells, orwhether CD34 expression is linked to cell “activation”, and EML cells can alternate between CD34− inactive (differentiation inhibited) and CD34+ active (differentiation ready) state. For that purpose sorted CD34− and CD34+ EML cells (>99% pure) were cultured separately for 3 weeks. An aliquot of cells from these cultures was taken each day and analyzed by flow cytometry for CD34 expression. These experiments have revealed that CD34+ cells started to appear in CD34− cell cultures after 24 hours, and were maintained at different frequencies throughout the culture. Interestingly, we also observed initial slow appearance of CD34− cells in CD34+ cell cultures, however their percentage subsequently increased and was maintained during the culture period. Taken together, our results suggest that Sca-1+ c-kit+ Flk2− CD34− population of EML cells is in “inactive” self-renewal state and differentiates poorly or not at all, whereas the CD34+ population could represent “activated” state at which the cells are ready to undergo differentiation. Furthermore, our results indicate that normally a balance is maintained between CD34− inactive and CD34+ active state of EML cells, andthat increased levels of Pum2 protein tip that balance and maintain the cells in the CD34− inactive state, thus promoting proliferation and inhibiting differentiation, two critical components of self-renewal.

APA, Harvard, Vancouver, ISO, and other styles

25

Zayas, Jennifer, John George, Ronald Nachtman, and Roland Jurecic. "RNA-Binding Protein Pum2 Promotes Self-Renewal and Suppresses Differentiation of Multipotent Hematopoietic Cells by Maintaining Them in Inactive CD34− State." Blood 110, no. 11 (November 16, 2007): 2231. http://dx.doi.org/10.1182/blood.v110.11.2231.2231.

Full text

Abstract:

Abstract Over-expression of RNA-binding protein Pum2 supports maintenance and suppresses mutilineage differentiation of murine multipotent HSC/MPP-like cell line EML. The analysis of HSC and MPP markers has revealed that ∼80% of wt EML cells are Sca–1+c-kit+ Flk2− CD34+ and ∼20% are Sca–1+ c-kit+ Flk− CD34−. In contrast, the majority (80–95%) of EML cells over-expressing Pum2 (Pum2-EML) are Sca–1+ c-kit+ Flk− CD34−. Functional analysis has revealed that purified CD34+ wt EML and Pum2-EML cells reproducibly contained the majority of progenitors capable of mutilineage differentiation in response to cytokines, whereas CD34− wt EML and Pum2-EML cells differentiated poorly or not at all. The CD34+ wt EML cells can be divided into CD34low, CD34medium and CD34high subpopulations, and the analysis of their progenitor cell content has reproducibly shown that the majority of progenitors reside within CD34high and CD34med cells, whereas CD34low cells contain very small percentage of progenitors. These findings indicated that CD34+ wt EML cells are functionally heterogeneous, and that the overall multilineage differentiation of EML cells strongly correlates with the CD34 expression levels. Since the majority of LTR-HSC reside within LKS Flk2− CD34− BM cells, and LKS Flk2− CD34+ BM cells are highly enriched for STR-HSC and MPPs, we tested whether CD34− EML cells are more primitive and give rise to CD34+ cells. Multiple experiments have revealed that purified CD34− and CD34+ wt EML cells can generate each other in culture, suggesting that although the CD34− EML cells could be more primitive, a subpopulation of CD34+ cells retains the capacity to give rise to CD34− cells. Identical experiments have revealed that Pum2-EML cells are maintained predominantly as CD34− cells that generate a small population of CD34low cells. Further analysis has revealed that among CD34+ wt EML cells the CD34low cells have the highest capacity to give rise to CD34− EML cells. Previous studies have shown that mouse LTR-HSC can alternate between CD34− “inactive” and CD34+ “activated” state, and that the heterogeneous population of LKS CD34+ BM cells contains activated LTR-HSC, STR-HSC and MPPs. Thus, we have proposed a model in which the CD34− EML cells are more primitive cells in an “inactive” (differentiate inhibited) state that give rise to all CD34+ EML cells. On the other hand, the heterogeneous population of CD34+ EML cells consists of CD34med/high cells that can readily differentiate into multiple lineages, and CD34low cells that are in “activated” state and can revert back to the CD34− state. Cumulatively, these results support the notion that Pum2 protein supports proliferation and suppresses differentiation (two critical components of self-renewal) of multipotent hematopoietic cells by maintaining them in an inactive CD34− state. To start elucidating molecular differences between wt EML and Pum2-EML cells, and their CD34+ and CD34− subpopulations, we performed expression analysis using Agilent 44K microarrays. Out of 14,868 expressed genes, 760 exhibited significant differences in expression level between wt EML and Pum2-EML cells, and included Mmp14, Mpp1, Ripk3, Calmodulin 5, DDEF2 (Development and differentiation enhancing factor 2), C/EBPbeta, TXK tyrosine kinase, Egr3, Ermap, Eraf, TNFR1a, Jam4 and others. Among 760 differentially expressed genes, 146 genes exhibited >10-fold higher expression in wt EML cells, and 85 genes exhibited >10-fold higher expression in Pum2-EML cells.

APA, Harvard, Vancouver, ISO, and other styles

26

Willie, Ahli K. D., Hongtao Zhao, M. Mustafa Azeem, and Teplinskaya Svetlana. "Analysis of Burnup effects and Its Integrity Assessment in the Interim of Irradiation with Molecular Dynamics." MRS Advances 5, no. 33-34 (2020): 1799–810. http://dx.doi.org/10.1557/adv.2020.19.

Full text

Abstract:

Abstract:Burnups can cause major structural changes in the edge of the fuel rod and a general degradation of the thermal conductivity. In irradiated mixed oxide fuels of UO2, PuO2 with NpO2 as fission products (FP) various chemical states depending on the conditions of the fuel is developed. This work, we firstly applied the MD relation to obtain the thermal conductivity of UO2, PuO2, and (U, Pu) O2 in temperature range of 300–2000 K. Lattice parameter, Burnup and the thermal conductivity were then calculated for specified UO2 and PuO2. This calculation relates the degradation of thermal conductivity with a number of pores and increasing temperature. Finally, the migration energy barrier and the recovery energies of the obstruction type defects were calculated with molecular dynamics simulation.

APA, Harvard, Vancouver, ISO, and other styles

27

Marczak, J. E., and M. C. Brandriss. "Isolation of constitutive mutations affecting the proline utilization pathway in Saccharomyces cerevisiae and molecular analysis of the PUT3 transcriptional activator." Molecular and Cellular Biology 9, no. 11 (November 1989): 4696–705. http://dx.doi.org/10.1128/mcb.9.11.4696.

Full text

Abstract:

The enzymes of the proline utilization pathway (the products of the PUT1 and PUT2 genes) in Saccharomyces cerevisiae are coordinately regulated by proline and the PUT3 transcriptional activator. To learn more about the control of this pathway, constitutive mutations in PUT3 as well as in other regulators were sought. A scheme using a gene fusion between PUT1 (S. cerevisiae proline oxidase) and galK (Escherichia coli galactokinase) was developed to select directly for constitutive mutations affecting the PUT1 promoter. These mutations were secondarily screened for their effects in trans on the promoter of the PUT2 (delta 1-pyrroline-5-carboxylate dehydrogenase) gene by using a PUT2-lacZ (E. coli beta-galactosidase) gene fusion. Three different classes of mutations were isolated. The major class consisted of semidominant constitutive PUT3 mutations that caused PUT2-lacZ expression to vary from 2 to 22 times the uninduced level. A single dominant mutation in a new locus called PUT5 resulted in low-level constitutive expression of PUT2-lacZ; this mutation was epistatic to the recessive, noninducible put3-75 allele. Recessive constitutive mutations were isolated that had pleiotropic growth defects; it is possible that these mutations are not specific to the proline utilization pathway but may be in genes that control several pathways. Since the PUT3 gene appears to have a major role in the regulation of this pathway, a molecular analysis was undertaken. This gene was cloned by functional complementation of the put3-75 mutation. Strains carrying a complete deletion of this gene are viable, proline nonutilizing, and indistinguishable in phenotype from the original put3-75 allele. The PUT3 gene encodes a 2.8-kilobase-pair transcript that is not regulated by proline at the level of RNA accumulation. The presence of the gene on a high-copy-number plasmid did not alter the regulation of one of its target genes, PUT2-lacZ, suggesting that the PUT3 gene product is not limiting and that a titratable repressor is not involved in the regulation of this pathway.

APA, Harvard, Vancouver, ISO, and other styles

28

Marczak, J. E., and M. C. Brandriss. "Isolation of constitutive mutations affecting the proline utilization pathway in Saccharomyces cerevisiae and molecular analysis of the PUT3 transcriptional activator." Molecular and Cellular Biology 9, no. 11 (November 1989): 4696–705. http://dx.doi.org/10.1128/mcb.9.11.4696-4705.1989.

Full text

Abstract:

The enzymes of the proline utilization pathway (the products of the PUT1 and PUT2 genes) in Saccharomyces cerevisiae are coordinately regulated by proline and the PUT3 transcriptional activator. To learn more about the control of this pathway, constitutive mutations in PUT3 as well as in other regulators were sought. A scheme using a gene fusion between PUT1 (S. cerevisiae proline oxidase) and galK (Escherichia coli galactokinase) was developed to select directly for constitutive mutations affecting the PUT1 promoter. These mutations were secondarily screened for their effects in trans on the promoter of the PUT2 (delta 1-pyrroline-5-carboxylate dehydrogenase) gene by using a PUT2-lacZ (E. coli beta-galactosidase) gene fusion. Three different classes of mutations were isolated. The major class consisted of semidominant constitutive PUT3 mutations that caused PUT2-lacZ expression to vary from 2 to 22 times the uninduced level. A single dominant mutation in a new locus called PUT5 resulted in low-level constitutive expression of PUT2-lacZ; this mutation was epistatic to the recessive, noninducible put3-75 allele. Recessive constitutive mutations were isolated that had pleiotropic growth defects; it is possible that these mutations are not specific to the proline utilization pathway but may be in genes that control several pathways. Since the PUT3 gene appears to have a major role in the regulation of this pathway, a molecular analysis was undertaken. This gene was cloned by functional complementation of the put3-75 mutation. Strains carrying a complete deletion of this gene are viable, proline nonutilizing, and indistinguishable in phenotype from the original put3-75 allele. The PUT3 gene encodes a 2.8-kilobase-pair transcript that is not regulated by proline at the level of RNA accumulation. The presence of the gene on a high-copy-number plasmid did not alter the regulation of one of its target genes, PUT2-lacZ, suggesting that the PUT3 gene product is not limiting and that a titratable repressor is not involved in the regulation of this pathway.

APA, Harvard, Vancouver, ISO, and other styles

29

Smialek, Maciej J., Erkut Ilaslan, Marcin P. Sajek, Aleksandra Swiercz, Damian M. Janecki, Kamila Kusz-Zamelczyk, Tomasz Wozniak, et al. "Characterization of RNP Networks of PUM1 and PUM2 Post-Transcriptional Regulators in TCam-2 Cells, a Human Male Germ Cell Model." Cells 9, no. 4 (April 16, 2020): 984. http://dx.doi.org/10.3390/cells9040984.

Full text

Abstract:

Mammalian Pumilio (PUM) proteins are sequence-specific, RNA-binding proteins (RBPs) with wide-ranging roles. They are involved in germ cell development, which has functional implications in development and fertility. Although human PUM1 and PUM2 are closely related to each other and recognize the same RNA binding motif, there is some evidence for functional diversity. To address that problem, first we used RIP-Seq and RNA-Seq approaches, and identified mRNA pools regulated by PUM1 and PUM2 proteins in the TCam-2 cell line, a human male germ cell model. Second, applying global mass spectrometry-based profiling, we identified distinct PUM1- and PUM2-interacting putative protein cofactors, most of them involved in RNA processing. Third, combinatorial analysis of RIP and RNA-Seq, mass spectrometry, and RNA motif enrichment analysis revealed that PUM1 and PUM2 form partially varied RNP-regulatory networks (RNA regulons), which indicate different roles in human reproduction and testicular tumorigenesis. Altogether, this work proposes that protein paralogues with very similar and evolutionary highly conserved functional domains may play divergent roles in the cell by combining with different sets of protein cofactors. Our findings highlight the versatility of PUM paralogue-based post-transcriptional regulation, offering insight into the mechanisms underlying their diverse biological roles and diseases resulting from their dysfunction.

APA, Harvard, Vancouver, ISO, and other styles

30

Owen, Elisabeth A., and Max A. Keniry. "Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor." Australian Journal of Chemistry 62, no. 11 (2009): 1544. http://dx.doi.org/10.1071/ch09169.

Full text

Abstract:

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

APA, Harvard, Vancouver, ISO, and other styles

31

Uchida, Teppei, Takeo Sunaoshi, Kenji Konashi, and Masato Kato. "Thermal expansion of PuO2." Journal of Nuclear Materials 452, no. 1-3 (September 2014): 281–84. http://dx.doi.org/10.1016/j.jnucmat.2014.05.039.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Robouch, P., and P. Vitorge. "Solubility of PuO2(CO3)." Inorganica Chimica Acta 140 (December 1987): 239–42. http://dx.doi.org/10.1016/s0020-1693(00)81091-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Lee, ChangHwan, Patricia Occhipinti, and Amy S. Gladfelter. "PolyQ-dependent RNA–protein assemblies control symmetry breaking." Journal of Cell Biology 208, no. 5 (February 23, 2015): 533–44. http://dx.doi.org/10.1083/jcb.201407105.

Full text

Abstract:

Dendritic growth in fungi and neurons requires that multiple axes of polarity are established and maintained within the same cytoplasm. We have discovered that transcripts encoding key polarity factors including a formin, Bni1, and a polarisome scaffold, Spa2, are nonrandomly clustered in the cytosol to initiate and maintain sites of polarized growth in the fungus Ashbya gossypii. This asymmetric distribution requires the mRNAs to interact with a polyQ-containing protein, Whi3, and a Pumilio protein with a low-complexity sequence, Puf2. Cells lacking Whi3 or Puf2 had severe defects in establishing new sites of polarity and failed to localize Bni1 protein. Interaction of mRNAs with Whi3 and Puf2 promotes enrichment of transcripts at established sites of polarized growth and clustering of polarity transcripts throughout the cell body. Thus, aggregation-prone proteins make functional assemblies to position polarity transcripts, and nonrandom positioning of transcripts is required for symmetry-breaking events. This reveals a physiological function for polyQ-driven assemblies in regulating cell polarity.

APA, Harvard, Vancouver, ISO, and other styles

34

Kutty, T. R. G., P. V. Hegde, K. B. Khan, S. Majumdar, and D. S. C. Purushotham. "Sintering studies on UO2–PuO2 pellets with varying PuO2 content using dilatometry." Journal of Nuclear Materials 282, no. 1 (November 2000): 54–65. http://dx.doi.org/10.1016/s0022-3115(00)00394-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Kutty, T. R. G., P. V. Hegde, J. Banerjee, K. B. Khan, A. K. Sengupta, G. C. Jain, S. Majumdar, and H. S. Kamath. "Densification behaviour of ThO2–PuO2 pellets with varying PuO2 content using dilatometry." Journal of Nuclear Materials 312, no. 2-3 (February 2003): 224–35. http://dx.doi.org/10.1016/s0022-3115(02)01643-4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Shirokov, S., and V. Zaets. "Глибина вигорання ядерного палива ВВЕР з різними вигораючими поглиначами." Nuclear and Radiation Safety, no. 4(52) (December 6, 2011): 29–32. http://dx.doi.org/10.32918/nrs.2011.4(52).04.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Díez-García, Iñigo, Arantxa Eceiza, and Agnieszka Tercjak. "Improvement of Mechanical Properties and Self-Healing Efficiency by Ex-Situ Incorporation of TiO2 Nanoparticles to a Waterborne Poly(Urethane-Urea)." Polymers 11, no. 7 (July 19, 2019): 1209. http://dx.doi.org/10.3390/polym11071209.

Full text

Abstract:

This research work was focused on the incorporation of TiO2 nanoparticles into synthesized solvent-free waterborne poly(urethane-urea) (WPUU) based on hydrophilic poly(ethylene oxide) (PU0) in order to improve both the mechanical properties and self-healing effectiveness of a polymer matrix. The incorporation of TiO2 nanoparticles resulted in a successful enhancement of the mechanical properties of nanocomposite films when compared to PU0. Simultaneously, the obtained nanocomposite films did not only maintain the self-healing ability of the PU0 film, measured by means of mechanical properties after successive cutting/recovery cycles, but they also showed a higher self-healing efficiency than the PU0 film. Moreover, the well-dispersed TiO2 nanoparticles, visualized by atomic force microscopy (AFM), kept their conductive properties when embedded in the PU0 matrix, as was confirmed by electrostatic force microscopy (EFM). This research work described a simple and industrially appealing way to control the dispersion of commercially available TiO2 nanoparticles in waterborne poly(urethane-urea) for the designing of inorganic/organic hybrid nanocomposites with enhanced mechanical properties and self-healing efficiency, in which TiO2 nanoparticles preserved their conductive properties within the polymer matrix.

APA, Harvard, Vancouver, ISO, and other styles

38

Neilson, William D., Helen Steele, Nikolas Kaltsoyannis, and Samuel T. Murphy. "Accommodation of helium in PuO_2±x and the role of americium." Physical Chemistry Chemical Physics 24, no. 14 (2022): 8245–50. http://dx.doi.org/10.1039/d1cp05570d.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Shelley, A., H. Akie, H. Takano, and H. Sekimoto. "Radiotoxicity hazard of U-free PuO2+ZrO2 and PuO2+ThO2 spent fuels in LWR." Progress in Nuclear Energy 37, no. 1-4 (January 2000): 377–82. http://dx.doi.org/10.1016/s0149-1970(00)00074-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Chirayath, Sunil Sunny, Gordon Hollenbeck, Jean Ragusa, and Paul Nelson. "Neutronic and nonproliferation characteristics of (PuO2–UO2) and (PuO2–ThO2) as fast reactor fuels." Nuclear Engineering and Design 239, no. 10 (October 2009): 1916–24. http://dx.doi.org/10.1016/j.nucengdes.2009.05.019.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Yang, Jie, Candice I. Saltiel, Ronald G. Nachtman, Xin Jing, and Roland Jurecic. "The Role of Truncated c-kit Receptor (tr-kit) in Maintenance and Differentiation of Hematopoietic Stem Cells and Multipotent Hematopoietic Progenitors." Blood 106, no. 11 (November 16, 2005): 4193. http://dx.doi.org/10.1182/blood.v106.11.4193.4193.

Full text

Abstract:

Abstract Intrinsic mechanisms that regulate self-renewal of mammalian stem cells are slowly being elucidated. Self-renewal of stem cells in Drosophila and C. elegans is regulated by members of the conserved Pumilio family of RNA-binding proteins. Previously, we have cloned and characterized two mouse and human Pumilio genes (Pum1 and Pum2), which are abundantly transcribed in hematopoietic stem cells (HSC). To study the function of mammalian Pum proteins in HSC and multipotent progenitors, the RNA-binding domain of Pum2 was over-expressed in a stem cell factor (SCF)-dependent HSC-like cell line EML. In the presence of SCF EML cells undergo SCF-dependent self-renewal and remain undifferentiated. In the presence of various cytokines (IL-3, GM-CSF, G-CSF, Epo, Tpo, IL-7, Flt3L) EML cells differentiate into erythroid, granulocytic, megakaryocytic and lymphoid cell lineages in vitro. The over-expression of Pum2-RBD leads to SCF-independent maintenance of EML cells, and suppresses their mutilineage differentiation in the absence of SCF. This uncoupling of the maintenance and differentiation signals in EML cells is accompanied by (a) an increased expression of the full-length c-kit and a novel truncated c-kit receptor called tr-kit, (b) cell intrinsic, SCF-independent activation of c-kit, and (c) constitutive activation of MAPK, PI3K and PLCγ signaling pathways in the absence of SCF. These results indicate that Pum2 could be supporting maintenance of multipotent hematopoietic cells through regulation of SCF/c-kit signaling pathway. An in depth analysis of the pattern of tr-kit expression in murine fetal liver and bone marrow-derived HSC, multipotent progenitors, lineage-committed progenitors and immature blood cells has shown that tr-kit expression is restricted to cell populations highly enriched for HSC and multipotent progenitors. This observation and the finding that an increased expression of tr-kit protein correlates with SCF-independent maintenance of EML cells, suggest that tr-kit could play an important role in SCF-independent activation of full-length c-kit receptor, and participate in the regulation of the balance between maintenance (self-renewal) and differentiation of HSC and multipotent progenitors. The fact that Pum2 and tr-kit are co-expressed in bone marrow cells enriched for HSC and early multipotent progenitors (e.g. Lin-Sca-1+c-kit+ cells), but not in later progenitors (e.g. Lin-Sca-1−c-kit− cells), suggests an exciting possibility that HSC and early multipotent progenitors utilize distinct SCF-dependent and SCF-independent c-kit signaling pathways. In contrast, more differentiated progenitors that lack self-renewal ability and do not express tr-kit, utilize only the canonical SCF-induced c-kit signaling. In this hypothetical model, the survival and maintenance of HSC and multipotent hematopoietic progenitors is mediated through SCF-independent c-kit signaling, whereas their differentiation depends on the canonical SCF-induced c-kit signaling. We are currently studying the effects of Pum2 and tr-kit over-expression and attenuation on (a) HSC and progenitor cell maintenance and differentiation, (b) HoxB4 and Notch1 pathways, involved in HSC maintenance and expansion, and (c) maintenance and differentiation of HSC expressing SLAM receptor CD150. Further study of Pum2 and tr-kit function could provide important new insights into the molecular regulation of two critical elements of self-renewal, inhibition of differentiation and induction of proliferation.

APA, Harvard, Vancouver, ISO, and other styles

42

Xu, S., D. A. Falvey, and M. C. Brandriss. "Roles of URE2 and GLN3 in the proline utilization pathway in Saccharomyces cerevisiae." Molecular and Cellular Biology 15, no. 4 (April 1995): 2321–30. http://dx.doi.org/10.1128/mcb.15.4.2321.

Full text

Abstract:

The yeast Saccharomyces cerevisiae can use alternative nitrogen sources such as arginine, urea, allantoin, gamma-aminobutyrate, or proline when preferred nitrogen sources like glutamine, asparagine, or ammonium ions are unavailable in the environment. Utilization of alternative nitrogen sources requires the relief of nitrogen repression and induction of specific permeases and enzymes. The products of the GLN3 and URE2 genes are required for the appropriate transcription of many genes in alternative nitrogen assimilatory pathways. GLN3 appears to activate their transcription when good nitrogen sources are unavailable, and URE2 appears to repress their transcription when alternative nitrogen sources are not needed. The participation of nitrogen repression and the regulators GLN3 and URE2 in the proline utilization pathway was evaluated in this study. Comparison of PUT gene expression in cells grown in repressing or derepressing nitrogen sources, in the absence of the inducer proline, indicated that both PUT1 and PUT2 are regulated by nitrogen repression, although the effect on PUT2 is comparatively small. Recessive mutations in URE2 elevated expression of the PUT1 and PUT2 genes 5- to 10-fold when cells were grown on a nitrogen-repressing medium. Although PUT3, the proline utilization pathway transcriptional activator, is absolutely required for growth on proline as the sole nitrogen source, a put3 ure2 strain had somewhat elevated PUT gene expression, suggesting an effect of the ure2 mutation in the absence of the PUT3 product. PUT1 and PUT2 gene expression did not require the GLN3 activator protein for expression under either repressing or derepressing conditions. Therefore, regulation of the PUT genes by URE2 does not require a functional GLN3 protein. The effect of the ure2 mutation on the PUT genes is not due to increased internal proline levels. URE2 repression appears to be limited to nitrogen assimilatory systems and does not affect genes involved in carbon, inositol, or phosphate metabolism or in mating-type control and sporulation.

APA, Harvard, Vancouver, ISO, and other styles

43

Woods, Dawn, Mouna Saoudi, Clinton Mayhew, and Rosaura Ham-Su. "CHARACTERIZATION OF PLUTONIUM DISTRIBUTION IN THO2–PUO2 MIXED OXIDES BY ELECTRON PROBE MICROANALYSIS." CNL Nuclear Review 7, no. 2 (December 1, 2018): 157–63. http://dx.doi.org/10.12943/cnr.2017.00014.

Full text

Abstract:

Thoria–plutonia (ThO2–PuO2) pellets with a nominal composition of 9.0 wt% PuO2 were prepared using a fabrication route similar to an industrial process for production of urania–plutonia (UO2–PuO2) mixed oxide fuel. The green fuel pellets were separated into 2 batches and the sintering of each batch was carried out under a reducing atmosphere at 1820 °C or 1750 °C. The distribution of plutonium (Pu) in the sintered pellets was investigated by electron probe microanalysis using X-ray mapping and quantitative point analyses. The results show that the pellet samples consist of Pu-rich agglomerates with Pu content close to that of the mastermix blend and a thorium (Th)-rich matrix. The matrix and the Pu-rich agglomerates are separated by a transition zone with Pu content varying from practically nil to the Pu content of the Pu-rich agglomerates. X-ray maps taken from random regions of the centre of the pellets show different sizes of Pu-rich agglomerates irregularly dispersed in the Th-rich matrix. Image analysis of the Pu X-ray maps indicate that the average diameter of the Pu-rich agglomerates of the material sintered at 1820 °C and 1750 °C were 68 μm and 161 μm, respectively.

APA, Harvard, Vancouver, ISO, and other styles

44

Tasi, Agost, Xavier Gaona, David Fellhauer, Melanie Böttle, Jörg Rothe, Kathy Dardenne, Dieter Schild, et al. "Redox behavior and solubility of plutonium under alkaline, reducing conditions." Radiochimica Acta 106, no. 4 (March 28, 2018): 259–79. http://dx.doi.org/10.1515/ract-2017-2870.

Full text

Abstract:

AbstractThe solubility and redox behavior of hydrous Pu(IV) oxide was comprehensively investigated by an experimental multi-method approach as a function of different redox conditions in 0.1 M NaCl solutions, allowing a detailed characterization of Pu(IV) and Pu(III) solubility and solid phase stability in these systems. Samples were prepared at ~3≤pHm≤~6 (pHm=–log${{\text{m}}_{{{\text{H}}^{\text{ + }}}}})$and ~8≤pHm≤~13 atT=(22±2)°C under Ar atmosphere. No redox buffer was used in one set of samples, whereas mildly and strongly reducing redox conditions were buffered in two series with hydroquinone or SnCl2, respectively, resulting in (pe+pHm)=(9.5±1) and (2±1). XRD, XANES and EXAFS confirmed the predominance of Pu(IV) and the nanocrystalline character of the original, aged PuO2(ncr,hyd) solid phase used as a starting material. Rietveld analysis of the XRD data indicated an average crystal (domain) size of (4±1) nm with a mean cell parameter of (5.405±0.005) Å. The solubility constant of this solid phase was determined as log$^ * K{^\circ _{{\text{s}},0}}$=–(58.1±0.3) combining solubility data in acidic conditions and redox speciation by solvent extraction and CE–SF–ICP–MS. This value is in excellent agreement with the current thermodynamic selection in the NEA-TDB. Synchrotron-basedin-situXRD, XANES and EXAFS indicate that PuO2(ncr,hyd) is the solid phase controlling the solubility of Pu in hydroquinone buffered samples. Under these redox conditions and ~8≤pHm≤~13, the solubility of Pu is very low (~10−10.5m) and pH-independent. This is consistent with the solubility equilibrium PuO2(am,hyd)+2H2O(l)⇔ Pu(OH)4(aq). Althoughin-situXRD unequivocally shows the predominance of PuO2in Sn(II)-buffered systems, XANES analyses indicate a significant contribution of Pu(III) (30±5%) in the solid phases controlling the solubility of Pu at (pe+pHm)=(2±1). For this system, EXAFS shows a systematic shortening of Pu–O and Pu–Pu distances compared to the starting Pu material and hydroquinone-buffered systems. The solubility of Pu remains very low (~10−10.5m) at pHm>9, but shows a very large scattering (~10−9–10−10.5m) at pHm=8. Experimental observations collected in Sn(II) buffered systems can be explained by the co-existence of both PuO2(ncr,hyd) and Pu(OH)3(am) solid phases, but also by assuming the formation of a sub-stoichiometric PuO2−x(s) phase. This extensive study provides robust upper limits for Pu solubility in alkaline, mildly to strongly reducing conditions relevant in the context of nuclear waste disposal. The potential role of Pu(III) in the solid phases controlling the solubility of Pu under these conditions is analysed and discussed in view of the current NEA-TDB thermodynamic selection, which supports the predominance of PuO2(am,hyd) and constrains the formation of Pu(OH)3(am) at pHm>8 outside the stability field of water.

APA, Harvard, Vancouver, ISO, and other styles

45

Murakami, H., D. Pain, and G. Blobel. "70-kD heat shock-related protein is one of at least two distinct cytosolic factors stimulating protein import into mitochondria." Journal of Cell Biology 107, no. 6 (December 1, 1988): 2051–57. http://dx.doi.org/10.1083/jcb.107.6.2051.

Full text

Abstract:

We have developed an in vitro system in which the posttranslational import of Put2 (delta-pyrroline-5-carboxylate dehydrogenase), into yeast mitochondria is dependent on the addition of yeast postribosomal supernatant (PRS). When mRNA for a nuclear-encoded yeast mitochondrial matrix protein, Put2, was translated in a wheat germ cell-free system, import into posttranslationally added yeast mitochondria was negligible. However, when a yeast PRS was added, significant import was observed. The import stimulating activity of the yeast PRS was shown to consist of at least two distinct factors. One of these is the recently purified 70-kD heat shock-related protein Ssalp/Ssa2p, two proteins that are 98% homologous. The other factor is an N-ethylmaleimide-sensitive protein(s). Both factors act synergistically.

APA, Harvard, Vancouver, ISO, and other styles

46

Boguslawski, Katharina, Florent Réal, Paweł Tecmer, Corinne Duperrouzel, André Severo Pereira Gomes, Örs Legeza, Paul W. Ayers, and Valérie Vallet. "On the multi-reference nature of plutonium oxides: PuO22+, PuO2, PuO3 and PuO2(OH)2." Physical Chemistry Chemical Physics 19, no. 6 (2017): 4317–29. http://dx.doi.org/10.1039/c6cp05429c.

Full text

APA, Harvard, Vancouver, ISO, and other styles

47

Borisov, Oleg V., Christopher J. Bannochie, and Richard E. Russo. "Laser Ablation Inductively Coupled Plasma Mass Spectrometry of Pressed Pellet Surrogates for Pu Materials Disposition." Applied Spectroscopy 55, no. 10 (October 2001): 1304–11. http://dx.doi.org/10.1366/0003702011953658.

Full text

Abstract:

Successful Pu disposition by immobilization in glass or ceramic form requires accurate and precise knowledge of impurity amounts. Analysis of Pu material by conventional liquid nebulization requires dissolution, which is difficult due to the refractory nature of the samples. Laser ablation is a suitable sampling technique for direct analysis of solids. This paper demonstrates the procedures that were established for PuO2 analysis using laser ablation inductively coupled plasma mass spectrometer (ICP-MS). Pressed pellets prepared from CeO2 were used to simulate PuO2. Effects of laser conditions, sample preparation, and matrix composition, specifically mass of a matrix element and color, on the analyses of CeO2, Bi2O3, and PtO2 based pressed pellets were examined. Influence of mixing/grinding time on particle sizes, sample homogeneity, and ablation efficiency were investigated. Laser conditions that produce stoichiometric sampling were examined.

APA, Harvard, Vancouver, ISO, and other styles

48

Agarwal, Rahul, Rama Mohana Rao Dumpala, Manoj K. Sharma, Donald M. Noronha, Jayashree S. Gamare, Kavitha Jayachandran, Chiranjit Nandi, and Santu Kaity. "Electrochemical recovery of plutonium from aqueous carbonate waste solutions." Chemical Communications 58, no. 8 (2022): 1111–14. http://dx.doi.org/10.1039/d1cc06603j.

Full text

Abstract:

A simple method was developed for the electrochemical recovery of Pu as pure PuO2 powder in the presence of different interfering ions and radiolytic and hydrolytic degradation products of TBP in a carbonate medium.

APA, Harvard, Vancouver, ISO, and other styles

49

De Bruycker, Franck, Konstantinos Boboridis, Dario Manara, Philipp Pöml, Matteo Rini, and Rudy J. M. Konings. "Reassessing the melting temperature of PuO2." Materials Today 13, no. 11 (November 2010): 52–55. http://dx.doi.org/10.1016/s1369-7021(10)70204-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Villa-Aleman, Eliel, Nicholas J. Bridges, Thomas C. Shehee, and Amanda L. Houk. "Raman microspectroscopy of PuO2 particulate aggregates." Journal of Nuclear Materials 515 (March 2019): 140–49. http://dx.doi.org/10.1016/j.jnucmat.2018.12.022.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Pu02'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles