Relevant bibliographies by topics / Primers

Academic literature on the topic 'Primers'

Author: Grafiati
Published: 4 June 2021
Last updated: 29 July 2024

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Contents

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Primers.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Primers"

1

Semenov, V. M., S. K. Yahorau, I. A. Lyatos, T. I. Dmitrachenko, A. A. Marchenko, M. S. Kosova, S. K. Zenkova, and K. A. Savochkina. "REAL-TIME PCR TEST SYSTEM FOR TTV DNA DETECTION IN BIOLOGICAL MATERIAL." Hepatology and Gastroenterology 8, no. 1 (June 10, 2024): 36–41. http://dx.doi.org/10.25298/2616-5546-2024-8-1-36-41.

Full text
Abstract:
Background. The study of biological material for the presence of TTV DNA using the PCR method allows for a timely assessment of the functional state of the human liver and immune system. Objective. To develop components for real-time PCR for TTV DNA detection in biological material. Material and methods. The design and selection of optimal primers and probes (taking into account the size (length) of the amplicon, annealing temperature, nucleotide composition, distribution of nucleotides along the length of the primer, length of primers, the possibility of formation of hairpins and dimers by primers) were performed using the Primer-BLAST/Primer3, FastPCR programs. Since primers, even absolutely unique for certain DNA sequences, could anneal at nonspecific sites, not related to the gene analyzed, we checked the correspondence of the primers to the sequences of the target gene. For this purpose, we used the NCBI Primer BLAST online service and assessed the local pairwise alignment of each primer with all nucleotide sequences of the Refseq databases. Results. As the result of studies carried out on the selection of the optimal primer annealing temperature, primer concentrations, as well as the selection of the optimal nucleotide pair, the main parameters of the designed primers were determined. Conclusions. A kit for the detection and quantification of TTV DNA using the polymerase chain reaction method with hybridization-fluorescent detection in real time was created and became the basis for the development of a commercial test system.
APA, Harvard, Vancouver, ISO, and other styles
2

Levi, Amnon, William P. Wechter, Karen R. Harris, Angela R. Davis, and Zhangjun Fei. "High-frequency Oligonucleotides in Watermelon Expressed Sequenced Tag-unigenes Are Useful in Producing Polymorphic Polymerase Chain Reaction Markers among Watermelon Genotypes." Journal of the American Society for Horticultural Science 135, no. 4 (July 2010): 369–78. http://dx.doi.org/10.21273/jashs.135.4.369.

Full text
Abstract:
In this study, we report a simple procedure for developing and using new types of polymerase chain reaction (PCR) primers, named “high-frequency oligonucleotides–targeting active genes” (HFO-TAG). The HFO-TAG primers were constructed by first using a “practical extraction and report language” script to identify oligonucleotides (8, 9, and 10 bases) that exist in high frequency in 4700 expressed sequence tag (EST)-unigenes of watermelon (Citrullus lanatus) fruit. This computer-based screening yielded 3162 oligonucleotides that exist 32 to 335 times in the 4700 EST-unigenes. Of these, 192 HFO-TAG primers (found 51 to 269 times in the 4700 EST-unigenes) were used to amplify genomic DNA of four closely related watermelon cultivars (Allsweet, Crimson Sweet, Charleston Gray, and Dixielee). The average number of DNA fragments produced by a single HFO-TAG primer among these four watermelon cultivars was considerably higher (an average of 5.74 bands per primer) than the number of fragments produced by intersimple sequence repeat (ISSR) or randomly amplified polymorphic DNA (RAPD) primers (an average of 2.32 or 4.15 bands per primer, respectively). The HFO-TAG primers produced a higher number of polymorphic fragments (an average of 1.77 polymorphic fragments per primer) compared with the ISSR and RAPD primers (an average of 0.89 and 0.47 polymorphic fragments per primer, respectively). Amplification of genomic DNA from 12 watermelon cultivars and two U.S. Plant Introductions with the HFO-TAG primers produced a significantly higher number of fragments than RAPD primers. Also, in PCR experiments examining the ability of primers to amplify fragments from a watermelon cDNA library, the HFO-TAG primers produced considerably more fragments (an average of 6.44 fragments per primer) compared with ISSR and RAPD primers (an average of 3.59 and 2.49 fragments per primer, respectively). These results indicate that the HFO-TAG primers should be more effective than ISSR or RAPD primers in targeting active gene loci. The extensive EST database available for a large number of plant and animal species should be a useful source for developing HFO-TAG primers that can be used in genetic mapping and phylogenic studies of important crop plants and animal species.
APA, Harvard, Vancouver, ISO, and other styles
3

Chubarov, Alexey S., Igor P. Oscorbin, Lidiya M. Novikova, Maxim L. Filipenko, Alexander A. Lomzov, and Dmitrii V. Pyshnyi. "Allele-Specific PCR for PIK3CA Mutation Detection Using Phosphoryl Guanidine Modified Primers." Diagnostics 13, no. 2 (January 9, 2023): 250. http://dx.doi.org/10.3390/diagnostics13020250.

Full text
Abstract:
Phosphoryl guanidine (PG) is the novel uncharged modification of internucleotide phosphates of oligonucleotides. Incorporating PG modification into PCR primers leads to increased discrimination between wild-type and mutated DNA, providing extraordinary detection limits in an allele-specific real-time polymerase chain reaction (AS-PCR). Herein, we used PG-modification to improve the specificity of AS primers with unfavorable Pyr/Pur primer’s 3′-end mismatch in the template/primer complex. Two mutations of the PIK3CA gene (E542K, E545K) were chosen to validate the advantages of the PG modification. Several primers with PG modifications were synthesized for each mutation and assessed using AS-PCR with the plasmid controls and DNA obtained from formalin-fixed paraffin-embedded (FFPE) tissues. The assay allows the detection of 0.5% of mutated DNA on the wild-type DNA plasmid template′s background with good specificity. Compared with ddPCR, the primers with PG-modification demonstrated 100% specificity and 100% sensitivity on the DNA from FFPE with mutation presence higher than 0.5%. Our results indicate the high potential of PG-modified primers for point mutation detection. The main principle of the developed methodology can be used to improve the specificity of primers regardless of sequences.
APA, Harvard, Vancouver, ISO, and other styles
4

Jackson, Roy A. "Prime primers." Philosophers' Magazine, no. 8 (1999): 51. http://dx.doi.org/10.5840/tpm1999823.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Weitzman, Jonathan B. "Modified primers." Genome Biology 3 (2002): spotlight—20020701–01. http://dx.doi.org/10.1186/gb-spotlight-20020701-01.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Satterfield, Brent C. "Cooperative Primers." Journal of Molecular Diagnostics 16, no. 2 (March 2014): 163–73. http://dx.doi.org/10.1016/j.jmoldx.2013.10.004.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Akhmetzianova, L. U., T. M. Davletkulov, I. M. Gubaidullin, and A. R. Islamgulov. "Parallel implementation of the primer search algorithm for loop-mediated isothermal amplification." Journal of Physics: Conference Series 2131, no. 2 (December 1, 2021): 022004. http://dx.doi.org/10.1088/1742-6596/2131/2/022004.

Full text
Abstract:
Abstract In the paper, the implementation of an algorithm of search for primers in a DNA sequence with a size varying between one nucleotide and multiple million nucleotides was discussed. This analysis was done within the objective of finding a set of six specific primers that are used for a conduction of the loop-mediated isothermal amplification (LAMP). For the fastest search result possible, a parallel search for the primer with the use of the Rabin-Karp Algorithm which enables the search for a primer’s entry in DNA sequence in each thread was proposed. A new software for search for primers was developed using Python with BioPython library which implements the algorithm.
APA, Harvard, Vancouver, ISO, and other styles
8

Tsurumi, T. "Primer terminus recognition and highly processive replication by Epstein-Barr virus DNA polymerase." Biochemical Journal 280, no. 3 (December 15, 1991): 703–8. http://dx.doi.org/10.1042/bj2800703.

Full text
Abstract:
The Epstein-Barr virus (EBV) DNA polymerase is essential for viral DNA replication in the lytic phase of the EBV life cycle. It efficiently extends RNA primers on the template DNA, suggesting the possible involvement of the EBV DNA polymerase in synthesizing Okazaki fragments from RNA primers on the lagging strand template. Competition experiments revealed that the EBV DNA polymerase had significantly higher affinity for primer termini hybridized to the template DNA than for the single-stranded DNA template or the single-stranded primer itself. ATP was not required either for primer terminus recognition or for sustainment of polymerization. The stimulation of the enzyme by (NH4)2SO4 was dependent on the template/primers utilized. These observations suggest that the primary and secondary structure of the template/primers are important factors for primer terminus recognition by the EBV DNA polymerase. The enzyme elongated synthetic RNA primer annealed to circular single-stranded M13 DNA coated with Escherichia coli single-stranded DNA-binding protein without dissociation. The processivity of the EBV DNA polymerase was strikingly high (greater than 7200 nucleotides) and the rate of polymerization was 12 nucleotides/s per polymerase molecule. The high processing capacity is a desirable feature in the synthesis of multiple copies of the EBV genome in rolling-circle DNA replication.
APA, Harvard, Vancouver, ISO, and other styles
9

Naqib, Ankur, Trisha Jeon, Kevin Kunstman, Weihua Wang, Yiding Shen, Dagmar Sweeney, Marieta Hyde, and Stefan J. Green. "PCR effects of melting temperature adjustment of individual primers in degenerate primer pools." PeerJ 7 (March 4, 2019): e6570. http://dx.doi.org/10.7717/peerj.6570.

Full text
Abstract:
Deep sequencing of small subunit ribosomal RNA (SSU rRNA) gene amplicons continues to be the most common approach for characterization of complex microbial communities. PCR amplifications of conserved regions of SSU rRNA genes often employ degenerate pools of primers to enable targeting of a broad spectrum of organisms. One little noticed feature of such degenerate primer sets is the potential for a wide range of melting temperatures between the primer variants. The melting temperature variation of primers in a degenerate pool could lead to variable amplification efficiencies and PCR bias. Thus, we sought to adjust the melting temperature of each primer variant individually. Individual primer modifications were used to reduce theoretical melting temperature variation between primers, as well as to introduce inter-cluster nucleotide diversity during Illumina sequencing of primer regions. We demonstrate here the suitability of such primers for microbial community analysis. However, no substantial differences in microbial community structure were revealed when using primers with adjusted melting temperatures, though the optimal annealing temperature decreased.
APA, Harvard, Vancouver, ISO, and other styles
10

Kumari, Rima, Pankaj Kumar, V. K. Sharma, and Harsh Kumar. "Genome profiling of differential salt stress responsive landraces and varieties of rice using ISSR markers." Genetika 52, no. 3 (2020): 1215–33. http://dx.doi.org/10.2298/gensr2003215k.

Full text
Abstract:
Using 14 ISSR primers for molecular profiling in relation to salinity tolerance of 18 landraces and varieties of rice, altogether 483 allelic variants including 236 shared and 247 unique alleles were generated with an average of 34.50 alleles per primer, revealing ample genetic differentiation and divergence amongst the entries under evaluation. Every primer generated polymorphic amplified products, but only 12 out of 14 primers yielded unique products. The primers having (AG)8YT, (CT)8A, (AG)8YA, (GA)8YT, (GA)8YC, (CT)8G, (TC)8C, (GATA)4 and (GA)8YG repeat motifs recorded relatively higher polymorphism per cent expressed in terms of the percentage of unique alleles in descending order of magnitude. Polymorphism information content of the primers varied from 0.612 to 0.992 for the primers (GACA)4 and (AG)8YA, respectively, with an average of 0.919 across the primers. Comparatively higher numerical values were obtained in respect of the primers (GA)8C, (CT)8A, (CT)8G, (TC)8C, (TC)8G, (AG)8YT, (AG)8YA, (GA)8YT, (GA)8YC, (GA)8YG and (GATA)4 amongst all the primers, reflecting their greater allelic richness and diversity. Poly-GA containing anchored primers produced the highest number (44.8) of allelic variants per primer followed by poly-CT, poly-AG and poly-TC containing anchored primers. But, the highest mean polymorphism per cent, highlighting the proportion of unique alleles, was exhibited by poly-AG followed by poly-GA, poly-CT and poly-TC containing anchored primers Clustering based on only poly-GA and poly-AG containing anchored primers provided more efficient genotypic discrimination in relation to salt stress responsiveness of the rice varieties. Moreover, a panel of only three poly-AG containing anchored primers facilitated perfect discrimination of rice varieties in accordance with their responsiveness to salinity stress. These primers can be efficiently utilized as functional instruments for connecting genotypic and phenotypic differences in relation to salt stress responsiveness. Principal coordinate analysis completely supported the results obtained from hierarchical classification of the landraces and varieties.
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "Primers"

1

Hosen, Joshua Carter. "Fundamental Analysis of Wood Adhesion Primers." Thesis, Virginia Tech, 2010. http://hdl.handle.net/10919/76869.

Full text
Abstract:
Hydroxymethyl resorcinol (HMR) is an effective adhesion promoter (primer) for wood bonding; it dramatically improves adhesion and enhances bond durability against moisture exposure. In an effort to improve understanding of the HMR mechanism of action, this work compared HMR with two other chemical treatments investigated as wood primers: alkyl-HMR (a-HMR), an HMR variant having reduced crosslink density, and a 5% solution of polymeric methylenebis(phenylisocyanate) in N-methylpyrrolidone (solution referred to as "pMDI"). The experimental system was red oak (Quercus rubra) bonded with a moisture-cure polyurethane adhesive (PUR). The objective was to document wood rheological changes induced by the three primers, and determine if these changes correlated to primer efficacy in PUR-bonded red oak. Adhesion was tested in mode-I (opening) fracture using dual cantilever beam specimens. HMR and a-HMR proved to be highly effective primers for PUR-bonded red oak; both primers dramatically improved bondline toughness and durability. Relative to HMR, the reduced crosslink density in a-HMR did not impair primer efficacy. In contrast, the pMDI primer was ineffective; it reduced bondline toughness and durability. Solvent-submersion, torsional dynamic mechanical analysis (DMA) was conducted on primer-treated red oak (with specimens immersed in dimethylformamide). Using all three grain orientations, the lignin glass/rubber transition was carefully studied with attention directed towards primer-induced changes in stiffness (storage modulus), the glass transition temperature (Tg), the associated damping (tan ° maximum intensity), and the breadth of tan ° transition. It was found that primer effectiveness correlated with a reduction in damping intensity, and also with a Tg increase greater than 5°C. Determination of these correlations was complicated by grain dependency, and also by rheological changes caused by solvent treatments that were used as primer control treatments.
Master of Science
APA, Harvard, Vancouver, ISO, and other styles
2

Chiu, Angela Chen-Yen. "DNA Typing of HLA-B by PCR with Primer Mixes Utilizing Sequence-Specific Primers." Thesis, University of North Texas, 1997. https://digital.library.unt.edu/ark:/67531/metadc278947/.

Full text
Abstract:
The aim of this study was to design a resolution typing system for the HLA-B gene. This technique involves a one-step PCR reaction utilizing genomic DNA and sequence-specific primers to determine the specificity of each allele and to produce a larger primer data base ideal for serological analysis. The application of this technique to serological analysis can improve serology detection which is currently hindered by antibody cross-reactivity and the unavailability of useful typing reagents.
APA, Harvard, Vancouver, ISO, and other styles
3

Angeli, Flora. "Micromachined substrates as primers for cartilage regeneration." Thesis, University of Strathclyde, 2005. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.424244.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Mori, Shigeo. "Water based adhesive primers on aluminum substrates." Thesis, This resource online, 1995. http://scholar.lib.vt.edu/theses/available/etd-10102009-020403/.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Valente, Daine Valente. "Prospecção e transferibilidade de marcadores est-ssr usados para análises filogenéticas em poa annua l." Universidade Federal do Pampa, 2016. http://dspace.unipampa.edu.br:8080/xmlui/handle/riu/361.

Full text
Abstract:
Submitted by Francine Silva (francine.silva@unipampa.edu.br) on 2016-06-23T14:11:43Z No. of bitstreams: 1 Dissertação Daiane Valente.pdf: 1062508 bytes, checksum: c859e0c99def78cdd42b20b323c13691 (MD5)
Approved for entry into archive by Vanessa Dias (vanessa.dias@unipampa.edu.br) on 2016-06-25T21:25:13Z (GMT) No. of bitstreams: 1 Dissertação Daiane Valente.pdf: 1062508 bytes, checksum: c859e0c99def78cdd42b20b323c13691 (MD5)
Made available in DSpace on 2016-06-25T21:25:13Z (GMT). No. of bitstreams: 1 Dissertação Daiane Valente.pdf: 1062508 bytes, checksum: c859e0c99def78cdd42b20b323c13691 (MD5) Previous issue date: 2016
Poa annua L. é a única espécie invasora de plantas com flores que obteve sucesso reprodutivo na Antártica, constituindo uma ameaça para as espécies nativas desse ecossistema. A hipótese da origem e colonização dessa gramínea nesse ambiente extremo é a de que as plantas pioneiras teriam vindo da Polônia, porém não é descartada a possibilidade de mútiplos eventos de introdução e diferentes fontes de distribuição. A disponibilidade de dados de sequências expressas (EST) tem facilitado o desenvolvimento de marcadores microssatélites (SSR) que podem ser utilizados como ferramentas para estudos populacionais em diferentes níveis, fluxo gênico, níveis de parentesco e informações sobre padrões filogeográficos. O objetivo desse trabalho foi desenvolver marcadores microssatélites a partir de sequências de regiões expressas da família Poaceae, testar o potencial de transferência em P. annua e utilizar esses marcadores para análise filogeográfica de P. annua, a fim de esclarecer a origem e colonização dessa espécie na Antártica. A prospecção de marcadores microssatélites foi desenvolvida com ferramentas de bioinformática, através de análises in sílico SSR em banco de dados EST para família Poaceae, disponíveis no Genbank (NCBI). Foram utilizados os programas CAP3 e SSRLocator para prospecção dos marcadores microssatélites. Uma pesquisa de Termos Gene Ontology (GO) foi realizada no banco de dados de sequências ESTs para avaliar associações entre locus SSR e processos biológicos, componentes celulares e função molecular de genes conhecidos, utilizando os programas Blast2GO e Revigo. O teste de transferência dos primers e análise molecular de P. annua foram conduzidos através da Reação em Cadeia da Polimerase (PCR). Foram prospectadas uma lista de 568 pares de primers, destes foram sintetizados 28 marcadores microssatélites para a transferência em P. annua. 68% dos marcadores EST-SSR tiveram potencial de transferência para esta espécie. A análise sugere que as amostras da Antártica são diferentes das amostras do Chile, Brasil, Irlanda e Argentina. Além disso, foram encontrados 613 transcritos divididos em 302 famílias gênicas. Com esta análise, foi possível desenvolver ferramentas moleculares para a análise genética com P. annua e outras espécies de gramíneas, mapear os motivos mais frequentes e funções dos genes em cada locus SSR, e sugerir que os diásporos de P. annua encontrados na Antártica podem ter vindos de fontes distintas das populações da America do Sul.
Poa annua L. is the only invasive species of flowering plants that reached reproductive success in Antarctica, posing a threat to native species of this ecosystem.The hypothesis of the origin and colonization of grass in this extreme environment is the pioneer plants would have come from Poland, but it is not ruled out event of multiple introduction and different sources of distribution. Recent increase in the availability of expressed sequence data (EST) has facilitated the development of microsatellite markers (SSR) can be used as tools for population studies at different levels, gene flow, relationship of levels and patterns phylogeographical information. The objective of this study was to develop microsatellite markers from expressed sequence regions of the Poaceae family, test the potential transfer in P. annua and use these markers for phylogeographic analysis of P. annua in order to clarify the origin and colonization of this species in Antarctica. The prospect of microsatellite markers was developed with bioinformatics tools, through an analysis in silico SSR in EST database to Poaceae family, available in Genbank (NCBI). Were used the CAP3 and SSRLocator programs for prospecting of microsatellite markers. A Search terms Gene Ontology (GO) were performed in ESTs sequences database to evaluate associations between SSR locus and biological processes, cellular components and molecular function of known genes, using the Blast2GO and Revigo programs. The transfer test of primers and molecular analysis of P. annua was conducted by Polymerase Chain Reaction (PCR). Were prospected a list of 568 primer pairs, these were synthesized 28 microsatellite markers for the transfer in P. annua. 68% of EST-SSR markers have potential transfer for this species. The analysis suggests that the samples from Antarctica are different from samples from Chile, Brazil, Argentina and Ireland. In addition, they found 613 transcripts divided into 302 genic families. With this analysis, it was possible to develop molecular tools for genetic analysis with P. annua and other grass species, mapping the most frequent motifs and functions of genes in each SSR locus, and suggest that the introduction of P. annua found in Antarctica may have come from sources other than South American populations.
APA, Harvard, Vancouver, ISO, and other styles
6

Haider, Nadia. "Development and Use of Universal Primers in Plants." Thesis, University of Reading, 2003. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.506069.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Arranz, Garcia Sara. "Primers episodis psicòtics, cànnabis, factors d'estrès, gènere i ètnia." Doctoral thesis, Universitat Rovira i Virgili, 2020. http://hdl.handle.net/10803/670353.

Full text
Abstract:
L’esquizofrènia és una malaltia complexa que s’origina per una alteració del neurodesenvolupament causada per la interacció de factors genètics i ambientals al llarg de les diferents etapes de la vida . El primer episodi psicòtic succeeix en èpoques primerenques, entre la adolescència i l’adultesa jove. La probabilitat de patir un episodi psicòtic per tant, té a veure amb la interacció de la vulnerabilitat genètica individual i els diferents factors ambientals. L’ estrès és un dels principals factors ambientals implicats en la etiologia de la psicosi dins el model diàtesis–estrès i per tant te especial rellevància la seva relació amb mesures de l’eix hipotàlem-hipòfisi-adrenal (HHA). En el nostre estudi hem volgut també centrar-nos en un dels principals riscos ambientals evitables , que és el consum del cànnabis i veure la seva interacció amb factors estressants com son el trauma a la infància i els esdeveniments vitals estressants en pacients amb psicosi d’inici control comparats amb grup control. Posteriorment em valorat l’efecte d’aquests factors ambientals sobre mesures biològiques de l’eix HHA. Per continuar hem explorat l’efecte del cànnabis i del gènere en les variables clíniques de pacients ingressats per un Primer Episodi Psicòtic ( PEP), així com les diferencies en raons de consum de cànnabis entre homes i dones. Finalment hem explorat si existien diferències en prevalença de consum de cànnabis, esdeveniments estressants i també en les variables clíniques principals entre PEPs immigrants d’origen marroquí i PEPs població autòctona. En conjunt aquests tesi posa en evidencia que existeix un efecte acumulatiu i un efecte dosi-resposta dels factors de risc ambientals estudiats en el risc de psicosi , essent el trauma a la infància el factor de risc més important. Alhora , el consum de cànnabis es va associar amb una alteració en les mesures de l’eix HHA però sense diferencies entre pacients i controls. Vàrem trobar diferencies de gènere en les raons de consum de cànnabis i una interacció de gènere i cànnabis en el funcionament. Finalment , no vàrem trobar diferencies en la prevalença de esdeveniments estressants entre PEPs d’origen marroquí i PEPs de població autòctona i una menor tendència a consumir cànnabis en aquesta població i un pitjor funcionament.
La esquizofrenia es una enfermedad compleja que se origina por una alteración del neurodesarrollo causada por la interacción de factores genéticos y ambientales a lo largo de las diferentes etapas de la vida. El primer episodio psicótico sucede en épocas tempranas, entre la adolescencia o los adultos jóvenes. La probabilidad de sufrir un primer episodio psicótico tiene que ver con la interacción de la vulnerabilidad genética individual y los factores ambientales. El estrés es uno de los principales factores implicados en la etiología de las psicosis dentro del modelo diátesis-estrés y por tanto tiene especial relevancia la relación de las medidas del eje hipotálamo-hipofisario-adrenal. En nuestro estudio hemos querido centrarnos también en unos de los principales riesgos ambientales evitables, que es el consumo de cannabis. Y ver su interacción con los factores estresantes como son el trauma infantil y los acontecimientos vitales estresantes en pacientes con psicosis de inicio reciente comparados con controles. Posteriormente hemos valorado el efecto de estos factores ambientales sobre las medidas del eje hipotálamo-hipofisario-adrenal. Para continuar hemos explorado las características clínicas de los pacientes de origen marroquí versus la población autóctona, siempre en una muestra de primeros episodios y observando el uso de cannabis. Y para finalizar, las diferencias de género, el consumo de cannabis y las razones para continuar el consumo. En conjunto, nuestro estudio muestra que el principal factor de riesgo para desarrollar una psicosis es el maltrato infantil (de los factores que hemos estudiado), potenciándose junto al consumo de cánnabis que incrementa el riesgo. En cambio, no hemos encontrado relación con el cortisol en los primeros episodios que consumían cannabis. Y en nuestros pacientes marroquíes que tienden más a ser hombres, a llevar más tratamiento inyectable y a consumir menos cannabis que la población autóctona. En cuanto al género, No hemos encontrado diferencias clínicas en el consumo de cánnabis, salvo mayor consumo para relajarse y mayor GAF al alta en mujeres.
The aetiology of schizophrenia is multi-factorial, consisting of interactions between genetic vulnerability and environmental risk factors. Schizophrenia is considerer as an illness of the neurodevelopment. The probability of suffering a first psychosis episode is an interaction between the genetic vulnerability and the environmental factors. According to the model of diathesis-stress, stress is one of the most important risk factors i the aetiology of schizophrenia, given relevance to obtain the measures of the hypothalamic-pituitary-adrenal axis function. In our study we want to study one of the most avoidable environmental risk, cannabis use. Cannabis is the third most common drug of dependence in the world, after tobacco and alcohol. There is now strong evidence that cannabis use is a risk factor for the development of psychosis. And determine whether the risk of psychosis depends on the severity of exposure to childhood trauma, recent life events and cannabis use and to determine whether there is an interaction and/or a cumulative effect among these environmental factors. In conclusion, our study provides evidence for a cumulative and a dose–response effect of environmental factors in the development of early psychosis. We did not find a relationship between HPA axis and first episodes. We find that our Moroccan patients tend to be male and tend to have LAI prescription more than native population. Considering gender, female show more "relax” as reason of use and a higher GAF at discharge.
APA, Harvard, Vancouver, ISO, and other styles
8

Thompson, Denis. "Finding homologous genes with primers designed using evolutionary models." NCSU, 2003. http://www.lib.ncsu.edu/theses/available/etd-10232003-122816/.

Full text
Abstract:
Genes homologous to a set of known, aligned, genes can be found by screening DNA libraries with PCR. PCR primers for such screens are commonly designed via a method described by Sells and Chernoff (1995). This standard design method does not make use of information about the evolutionary relationship between the known genes. The present study investigated the efficacy of using information about evolutionary relationships (inferred from the sequence data) in the design of PCR primers. This study compares the standard primer design method (represented herein by a modified multinomial distribution) with evolutionary model based primer design methods. The primer design method that, given an alignment of known sequences with one sequence left out, assigned a higher probability, on average, to the left-out sequence, was defined as the better method. By this measure of relative performance, an evolutionary model based primer design method sensitive to states correlated across sites of a sequence, outperformed the standard method, on the alignments studied.
APA, Harvard, Vancouver, ISO, and other styles
9

Rodriguez, Noris Marcela. "PCR diagnosis of Leishmania using nuclear and kinetoplast primers." Thesis, University of Cambridge, 1996. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.627544.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Cave, Nigel Graeme. "The adsorption and adhesion of long-chained organosilicon primers." Thesis, Imperial College London, 1990. http://hdl.handle.net/10044/1/47795.

Full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Books on the topic "Primers"

1

Pau, Vadell Vallbona, ed. Primers auxilis. Valls (Tarragona): Cossetània Edicions, 2007.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

L, Venezky Richard, and University Publications of America (Firm), eds. American primers. [Frederick, Md.]: UPA, 1990.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Mentorship Primer (Lang Primers). Peter Lang Publishing, 2004.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Canals, Maria Antònia. Primers nombres i primeres operacions. Associació de Mestres Rosa Sensat, 2009.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Canals, Maria Antònia. Primers nombres i primeres operacions. Associació de Mestres Rosa Sensat, 2009.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Popular Culture Primer (Lang Primers). Peter Lang Publishing, 2004.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

Shields, Carolyn M. Bakhtin Primer (Peter Lang Primers). Peter Lang Publishing, 2007.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Critical Constructivism Primer (Lang Primers). Peter Lang Publishing, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

Primers. Nine Arches Press, 2017.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

COMMANE. Primers. Nine Arches Press, 2019.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "Primers"

1

Jacob, Bruce. "Primers." In The Memory System, 3–27. Cham: Springer International Publishing, 2009. http://dx.doi.org/10.1007/978-3-031-01724-7_2.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Berendsen, A. M. "Prefabrication (Shop) Primers." In Marine Painting Manual, 167–77. Dordrecht: Springer Netherlands, 1989. http://dx.doi.org/10.1007/978-94-017-2186-8_5.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Gooch, Jan W. "Zinc Silicate Primers." In Encyclopedic Dictionary of Polymers, 825. New York, NY: Springer New York, 2011. http://dx.doi.org/10.1007/978-1-4419-6247-8_13006.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

van Pelt-Verkuil, E., and R. te Witt. "Primers and Probes." In Molecular Diagnostics, 51–95. Singapore: Springer Singapore, 2019. http://dx.doi.org/10.1007/978-981-13-1604-3_3.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Russell, Joanne, Gordon C. Machray, and Robbie Waugh. "Nuclear DNA Primers." In Molecular Tools for Screening Biodiversity, 239–48. Dordrecht: Springer Netherlands, 1998. http://dx.doi.org/10.1007/978-94-009-0019-6_46.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Sroka, Wendelin. "4.2. Rooster primers." In Children’s Literature, Culture, and Cognition, 319–35. Amsterdam: John Benjamins Publishing Company, 2023. http://dx.doi.org/10.1075/clcc.14.27sro.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Sroka, Wendelin, Matthew Grenby, Britta Juska-Bacher, Tuija Laine, and Johari Murray. "Appendix 5. Catechism primers." In Children’s Literature, Culture, and Cognition, 359–68. Amsterdam: John Benjamins Publishing Company, 2023. http://dx.doi.org/10.1075/clcc.14.app5.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Pasbøll, Per J., and Peter Arctander. "Primers for Animal Mitochondrial DNA: The Importance of Species-Specific Primers." In Molecular Tools for Screening Biodiversity, 249–55. Dordrecht: Springer Netherlands, 1998. http://dx.doi.org/10.1007/978-94-009-0019-6_47.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Souvenir, Richard, Jeremy Buhler, Gary Stormo, and Weixiong Zhang. "Selecting Degenerate Multiplex PCR Primers." In Lecture Notes in Computer Science, 512–26. Berlin, Heidelberg: Springer Berlin Heidelberg, 2003. http://dx.doi.org/10.1007/978-3-540-39763-2_36.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Abel, Marie-Laure. "Organosilanes: Adhesion Promoters and Primers." In Handbook of Adhesion Technology, 237–58. Berlin, Heidelberg: Springer Berlin Heidelberg, 2011. http://dx.doi.org/10.1007/978-3-642-01169-6_11.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Primers"

1

Spadini, Davide, Gül Çalikli, and Alberto Bacchelli. "Primers or reminders?" In ICSE '20: 42nd International Conference on Software Engineering. New York, NY, USA: ACM, 2020. http://dx.doi.org/10.1145/3377811.3380385.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Tomašegović, Tamara, Sanja Mahović Poljaček, Tomislav Hudika, and Andrea Marče. "Preliminary report on properties and interaction of layers in “board-biodegradable primer-printing ink” screen-printed system." In 11th International Symposium on Graphic Engineering and Design. University of Novi Sad, Faculty of technical sciences, Department of graphic engineering and design, 2022. http://dx.doi.org/10.24867/grid-2022-p80.

Full text
Abstract:
Surface phenomena in printing are extremely important for understanding and optimizing the interaction of materials involved in the process of graphic reproduction. In order to protect absorbent printing substrates from moisture penetration, to strengthen mechanical properties or to ensure better adhesion of the printing ink to the substrate, the substrates are often coated with protective coatings (primers) before printing. The adhesion parameters between the coating and the printing ink then become extremely important for assessing the durability, but also the quality of the print. In this research, biodegradable primers (polycaprolactone and polylactic acid) were applied on a board substrate with the primary aim of reducing the permeability to water vapour in combination with printed ink layers. Two types of water-based screen printing inks were printed on the primed substrates: ink prepared using the transparent base, and the ink prepared using the opaque white base. Two meshes with different screen count were used (32 l/cm and 60 l/cm). The research focused on the possibility of reducing the water vapour transmission rate using the inks and biodegradable primers, and at the same time analysing the interaction of biodegradable primers and printing inks by determining the surface and interfacial properties in the "printing substrate-primer-printing ink" system. The results of the research have contributed to the optimization of the screen-print quality on the primed absorbent and porous substrates.
APA, Harvard, Vancouver, ISO, and other styles
3

Akhmetzianova, L. U. "Design primers for LAMP-amplification." In Bioinformatics of Genome Regulation and Structure/Systems Biology (BGRS/SB-2022) :. Institute of Cytology and Genetics, the Siberian Branch of the Russian Academy of Sciences, 2022. http://dx.doi.org/10.18699/sbb-2022-002.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Akhmetzianova, L. U., T. M. Davletkulov, R. R. Garafutdinov, I. M. Gubaydullin, and A. V. Chemeris. "Design primers for LAMP-amplification." In Bioinformatics of Genome Regulation and Structure/Systems Biology (BGRS/SB-2022) :. Institute of Cytology and Genetics, the Siberian Branch of the Russian Academy of Sciences, 2022. http://dx.doi.org/10.18699/bgrs/sb-2022-002.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Dalpiaz, Giovana, NATASHA MALGAREZI, MARIANA ROST MEIRELES, and PRISCILA LORA. "DESENHO E PADRONIZAÇÃO DE PRIMERS PARA DETECÇÃO DE GENES DE RESISTÊNCIA À CARBAPENÊMICOS ENGLOBANDO MAIS DE 200 VARIANTES." In II Congresso Nacional de Microbiologia Clínica On-line. Revista Multidisciplinar em Saúde, 2022. http://dx.doi.org/10.51161/ii-conamic/17.

Full text
Abstract:
Introdução: A resistência bacteriana aos antibióticos carbapenêmicos corresponde atualmente a uma grande preocupação para a saúde pública, por estar associada a uma maior taxa de mortalidade e morbidade. A detecção precoce da resistência bacteriana a estes antibióticos diminui o tempo de hospitalização bem como complicações decorrentes de infecções. A associação de técnicas de biologia molecular e microbiologia tem potencial para agilizar e qualificar o diagnóstico clínico de resistência. Objetivo: O objetivo do presente estudo foi estabelecer primers para Polymerase chain reaction (PCR) que detectem as variantes mais prevalentes dos genes blaKPC, blaNDM, blaOXA e blaVIM. Material e métodos: Para tal, fizemos uma busca pelos genes no NCBI procurando sequências de nucleotídeos que pudessem ser usadas como primers, considerando os seguintes aspectos: tamanho entre 18-25 pares de base (pb), conteúdo G-C entre 40 e 60%, temperatura de Melting entre 58ºC e 60ºC, produto amplificado com cerca de 500-1000pb. Além disso, buscamos evitar complementaridade entre os primers. Utilizamos o software Primer 3 Plus seguindo as condições estipuladas acima, e verificamos os oligonucleotídeos escolhidos na ferramenta NetPrimer. Resultados: A partir dos resultados obtidos, utilizamos a ferramenta BLAST do NCBI para verificar as variantes de cada gene de resistência que poderiam ser amplificadas a partir dos primers desenhados. Conclusão: Concluímos que é possível identificar 88 variantes blaKPC (Primer Forward: 5’CAGCTCATTCAAGGGCTTTC’3 / Primer Reverse: 5’TATGGCACGGCAAATGACTA’3, temperatura anelamento: 50ºC), 36 blaNDM (Primer Forward: 5’CCAGCAAATGGAAACTGGC3’/ Primer Reverse: 5’ATCACGATCATGCGTGCCT3’3 temperatura anelamento: 66ºC), 41 blaOXA (Primer Forward: 5’ATTCCCAATAGCTTGATCGC’3/ Primer Reverse: 5’TGGTGGGTCGGTTGGGTT’3 temperatura anelamento: 51ºC) e 74 blaVIM (Primer Forward: 5’TGTCCGTGATGGTGATGAGT’3 / Primer Reverse: 5’GTGCTTCCGGGTAGTGTTGT’3 temperatura anelamento: 55ºC). Os primers foram testados a partir de culturas bacterianas de isolados clínicos que possuíam os genes de resistência. Para verificar sua especificidade utilizamos uma Klebsiella spp. como controle negativo. A aplicação da biologia molecular junto à microbiologia permitiu diferenciar bactérias resistentes e não-resistentes à carbapenêmicos com precisão. Além disso, os primers desenhados se mostraram específicos para cada um dos genes e suas variantes correspondentes, permitindo discriminar entre os tipos de resistência. Essas metodologias podem potencialmente facilitar a prescrição e aumentar a assertividade de medicamentos.
APA, Harvard, Vancouver, ISO, and other styles
6

Moura, Maria Eduarda Gobara de, Laís Stella Perassoli Nicchio, and Cristiane Suemi Shinobu Mesquita. "CONFECÇÃO DE PRIMERS PARA O GENE DA METALOPROTEINASE - 2 (MMP-2) PARA REALIZAÇÃO DE METODOLOGIA DE PCR EM TEMPO REAL." In I Congresso Nacional Multidisciplinar de Oncologia On-line. Revista Multidisciplinar em Saúde, 2021. http://dx.doi.org/10.51161/rems/1557.

Full text
Abstract:
Introdução: O câncer de mama (CM) é o segundo tipo de câncer mais frequente entre as mulheres, sendo responsável por 66.280 novos casos no ano passado. Biomarcadores são parâmetros biológicos que refletem desequilíbrios moleculares provenientes de patologias, colaborando com exames laboratoriais. A metaloproteinase de matriz 2 (MMP-2) é uma enzima que digere a matriz extracelular e responde à alterações moleculares, sendo que em células cancerígenas sua expressão é aumentada. Sua presença no soro e tecido de pacientes com câncer mamário pode indicar invasão tumoral. Objetivos: Confeccionar primers para detecção da expressão de MMP-2 em linhagem de células tumorais de mama. Materiais e métodos: A partir de levantamento bibliográfico no GenBank do gene da MMP-2 humana foram confeccionados primers para a realização da metodologia de PCR em tempo real. Os softwares IDT e Primer 3 foram os escolhidos para confecção dos primers forward e reverse. Após a confecção, os primers foram avaliados quanto aos parâmetros de reação e afinidade pelo gene alvo utilizando as plataformas Clustal Omega, IDT Tools e BLAST, para obtenção do melhor par de primers. Resultados: Foram confeccionados 5 pares de primers para MMP-2 e, após avaliação, foi selecionado o par de primers a seguir: GCAGCTCCTTACCAACCAGT e GGGGAGAGAGGGAAGGATGT. Conclusão: A etapa de confecção de primers é importante, pois a simulação em computador muitas vezes acaba se demonstrando diferente da reação in vitro. Portanto, quanto mais rigor na avaliação dos parâmetros de reação, maior chance de se obter um par de primers que apresente bom desempenho nas reações, poupando perda de tempo e de reagentes. A partir da confecção dos primers realizada neste trabalho, espera-se que os mesmo apresentem sensibilidade e especificidade suficientes para garantir que o produto formado durante a amplificação seja realmente a sequência esperada, confirmando que a etapa de confecção foi conduzida adequadamente.
APA, Harvard, Vancouver, ISO, and other styles
7

COURTNEY, ELYA, AMY COURTNEY, and MICHAEL COURTNEY. "COMPARING LEAD-BASED (CCI 41) AND LEAD-FREE (RUAG SINTOX) PRIMER PERFORMANCE IN 5.56MM NATO." In 32ND INTERNATIONAL SYMPOSIUM ON BALLISTICS. Destech Publications, Inc., 2022. http://dx.doi.org/10.12783/ballistics22/36082.

Full text
Abstract:
Previous work identified significant problems with lead-free primers reliably igniting propellant charges in 5.56 mm NATO and other cartridges. These problems include high incidence of misfires, increased barrel friction, and long ignition delays. To date, no lead-free primer has been identified which meets NATO ignition requirements and works with a range of propellant types after prolonged exposure to humidity. Ruag SINTOX primers are marketed to meet NATO specifications, but it was unclear how they would respond to exposure to humidity commonly encountered in real-world environments. This paper reports results of performance and ignition delay testing of lead-free Ruag SINTOX and lead-based CCI 41 primers after exposure to typical indoor ambient humidity (40-60% relative humidity) and 100% relative humidity for 8 months (both at ambient temperature). Tests were performed using four propellant types: Alliant Blue Dot (a flake powder), Hodgdon H4895 (a cylinder powder), St. Mark's SMP842 (a flash suppressed ball powder), and the Ruag ball powder that the SINTOX primers are paired with in Ruag's lead-free ammunition. The Ruag lead-free SINTOX primer performed comparably to the CCI 41 lead-based primer in all tests and met the NATO specification for ignition delay (< 4 ms), even after 8 months of storage exposed directly to 100% humidity.
APA, Harvard, Vancouver, ISO, and other styles
8

Jaric, M., J. Segal, E. Silva-Herzog, L. Schneper, K. Mathee, and G. Narasimhan. "Designing Primers with Higher Taxonomic Distinguishability." In 2013 29th Southern Biomedical Engineering Conference (SBEC 2013). IEEE, 2013. http://dx.doi.org/10.1109/sbec.2013.87.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Leandro-Espinoza, Tania. "How specific are specific primers? ABeauveriaandMetarhiziumcase." In 2016 International Congress of Entomology. Entomological Society of America, 2016. http://dx.doi.org/10.1603/ice.2016.117583.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Wang, Xiaojia, Zhihui Wang, Siyu Zhang, Jundou Liu, and Xun Wang. "Screening citrus SSR molecular marker primers." In 2018 7th International Conference on Energy and Environmental Protection (ICEEP 2018). Paris, France: Atlantis Press, 2018. http://dx.doi.org/10.2991/iceep-18.2018.311.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "Primers"

1

Hanley, Maria, ShangMin Lin, C. Elise Logan, Bob Wallace, Pamela Shirley, Thomas Bucher, Jovan Ilic, and Marija Prica. Power Market Primers. Office of Scientific and Technical Information (OSTI), April 2019. http://dx.doi.org/10.2172/1556069.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Marshall, Orange S., Beitelman Jr., and Alfred D. Evaluation of Alkyd Primers. Fort Belvoir, VA: Defense Technical Information Center, November 2000. http://dx.doi.org/10.21236/ada393834.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Wallace, Elah. High Solids Primers Enhancement. Fort Belvoir, VA: Defense Technical Information Center, April 2000. http://dx.doi.org/10.21236/ada382547.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Frihart, C. R., and J. F. Beecher. Binders for small-caliber gun primers:. Madison, WI: U.S. Department of Agriculture, Forest Service, Forest Products Laboratory, 2022. http://dx.doi.org/10.2737/fpl-gtr-295.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Paunesku, T., and G. E. Woloschak. Use of labeled primers for differential display. Office of Scientific and Technical Information (OSTI), January 1995. http://dx.doi.org/10.2172/10106839.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Ellis, Michael E. Environmentally Acceptable Medium Caliber Ammunition Percussion Primers. Fort Belvoir, VA: Defense Technical Information Center, October 2007. http://dx.doi.org/10.21236/ada487438.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Paunesku, T., and G. E. Woloschak. Use of labeled primers for differential display. Office of Scientific and Technical Information (OSTI), February 1995. http://dx.doi.org/10.2172/10114987.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Berry, R. B. Electrostatic Discharge testing of propellants and primers. Office of Scientific and Technical Information (OSTI), February 1994. http://dx.doi.org/10.2172/10131328.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Ellis, Michael. Environmental Acceptable Medium Caliber Ammunition Percussion Primers. Fort Belvoir, VA: Defense Technical Information Center, May 2008. http://dx.doi.org/10.21236/ada482027.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

OCEAN CITY RESEARCH CORP NJ. Overcoating of Inorganic Zinc Primers for Underwater Service. Fort Belvoir, VA: Defense Technical Information Center, July 1986. http://dx.doi.org/10.21236/ada443978.

Full text
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'Primers' for particular source types:
Journal articles Dissertations / Theses Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography