To see the other types of publications on this topic, follow the link: Powdery mildew disease: Plant diseases; Fungi.
Journal articles on the topic 'Powdery mildew disease: Plant diseases; Fungi'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Powdery mildew disease: Plant diseases; Fungi.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Wilson, Iain W., Céline L. Schiff, Douglas E. Hughes, and Shauna C. Somerville. "Quantitative Trait Loci Analysis of Powdery Mildew Disease Resistance in the Arabidopsis thaliana Accession Kashmir-1." Genetics 158, no. 3 (July 1, 2001): 1301–9. http://dx.doi.org/10.1093/genetics/158.3.1301.
Full textAbstract:
Abstract Powdery mildew diseases are economically important diseases, caused by obligate biotrophic fungi of the Erysiphales. To understand the complex inheritance of resistance to the powdery mildew disease in the model plant Arabidopsis thaliana, quantitative trait loci analysis was performed using a set of recombinant inbred lines derived from a cross between the resistant accession Kashmir-1 and the susceptible accession Columbia glabrous1. We identified and mapped three independent powdery mildew quantitative disease resistance loci, which act additively to confer disease resistance. The locus with the strongest effect on resistance was mapped to a 500-kbp interval on chromosome III.
2
Holcomb, G. E. "First Report of Powdery Mildew Caused by an Oidium sp. on Torenia fournieri." Plant Disease 83, no. 9 (September 1999): 878. http://dx.doi.org/10.1094/pdis.1999.83.9.878b.
Full textAbstract:
Torenia fournieri Lind. ex Fourn. (wishbone flower, bluewings) is a popular summer bedding plant in Louisiana. Clown Mixture cultivars are available in garden centers in March and April. Transplants of cultivar Clown Rose were purchased, transplanted to larger pots, and maintained in a greenhouse. A powdery mildew was observed on these plants in March and all plants (six) were severely diseased by May. Symptoms included leaf distortion and yellowing. Powdery mildew was not present on transplants and none was found in later checks of garden centers. An Oidium sp. was observed sporulating on both leaf surfaces of infected plants. Conidia were ellipsoid, produced in chains, lacked fibrosin bodies, and averaged 41 × 22 μm in dimensions. No sexual stage was observed. Healthy plants of Clown Mixture cultivars were obtained and inoculated by brushing conidia from infected plant leaves to leaves of healthy plants. Plants were maintained in a greenhouse where temperatures ranged from 16 to 26°C. Hyphal growth appeared on inoculated plants after 5 days and the reproductive structures formed later appeared the same as those on originally infected plants. Uninoculated plants remained healthy. No previous reports of powdery mildew diseases of T. fournieri in the United States were found. Other powdery mildew pathogens reported on T. fournieri are Sphaerotheca fuliginea (Schlechtend.:Fr.) Pollacci in Finland and Japan and an Erysiphe sp. in Japan (1). Reference: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Press, Tokyo, 1986.
3
Sholberg, P. L., J. H. Ginns, and T. S. C. Li. "First Report of Powdery Mildew, Caused by Erysiphe cichoracearum, on Coneflowers." Plant Disease 83, no. 7 (July 1999): 694. http://dx.doi.org/10.1094/pdis.1999.83.7.694b.
Full textAbstract:
Purple coneflowers (Echinacea purpurea) are grown in North America and Europe for their medicinal properties and as ornamental plants. In September 1997 and again in 1998, a previously undescribed disease was noticed on fully grown coneflower plants in Summerland and Oliver, British Columbia. Mycelia were observed on stems, foliage, and flowers, and distinct dark red to black, round (approximately 5 mm in diameter) lesions were observed on the flower petals. The disease appeared similar to powdery mildews that have been reported on numerous genera of the Asteraceae. Samples of the diseased tissue were examined and the salient features of the fungus on two specimens were determined: cleistothecia infrequent, subglobose or flattened on the side next to the leaf surface, 121 to 209 μm in diameter; epidermal (surface) cells 20 μm in diameter; appendages hyphoid, 5 μm in diameter, up to 200 μm long; asci, 10 to 19 in each cleistothecium, broadly ellipsoid, 47 to 85 × 28 to 37 μm with a short stalk, about 8 to 13 μm long and 8 μm in diameter; ascospores, immature, two per ascus, ellipsoid to broadly ellipsoid, 17 to 25 × 11 to 13 μm, thin walled, hyaline, and smooth; conidia oblong with sides slightly convex and apices truncate, 27 to 40 × 14 to 20 μm, walls hyaline, thin, smooth. Based on the occurrence of asci that contained two ascospores and the hyphoid appendages on the cleistothecia we concluded that the fungus was Erysiphe cichoracearum DC. Damage due to this disease was minimal in 1997 and 1998 because it developed very late in the growing season and occurred sporadically within the plantings. In order to complete Koch's postulates, Echinacea purpurea plants grown in the greenhouse were inoculated with a conidial suspension (105 to 106 conidia per ml) from field-infected plants. Powdery mildew first appeared 3 months later, eventually infecting leaves and stems of 12 of 49 inoculated plants. It was distinctly white and in discrete patches on leaves, compared with coalescing dark brown areas on the stems. Microscopic examination of the conidia confirmed that they were E. cichoracearum. Although powdery mildew caused by E. cichoracearum has been widely reported on lettuce, safflower, and other cultivated and wild Compositae, we found no reference to it on Echinacea spp. in Canada (1,2), the U.S. (3), or elsewhere in the world (4). The specimens have been deposited in the National Mycological Herbarium of Canada (DAOM) with accession numbers 225933 and 225934 for Oliver and Summerland, B.C., respectively. References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) I. L. Conners. 1967. An annotated index of plant diseases in Canada and fungi recorded on plants in Alaska, Canada, and Greenland. Canada Dept. of Agric. Pub. 1251. (3) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN. (4) J. Ginns. 1986. Compendium of plant disease and decay fungi in Canada, 1960-1980. Agriculture Canada Pub. 1813.
4
Mmbaga, Margaret T., Lucas M. Mackasmiel, and Frank A. Mrema. "Evaluation of Biological Agents for Control of Macrophomina Root Rot and Powdery Mildew in Flowering Dogwood (Cornus florida L.)." HortScience 53, no. 10 (October 2018): 1461–66. http://dx.doi.org/10.21273/hortsci13071-18.
Full textAbstract:
Six biological control agents (BCAs) (two bacteria, two fungi, and two yeasts) that were previously shown to be effective against powdery mildew (Erysiphe pulchra) were tested for efficacy against Macrophomina phaseolina root rot on flowering dogwood (Cornus florida) in the greenhouse. Two of the bacterial isolates, Stenotrophomonas sp. (B17A) and Serratia sp. (B17B), were effective in controlling both macrophomina root rot and powdery mildew, similar to fungicide control thiophanate methyl, when roots were drenched with the six BCAs individually. In addition, the two bacterial BCAs improved plant growth with respect to stem diameter, stem length, dry weight, and green foliage compared with fungicide-treated plants or nontreated controls grown in sterile soil. These results confirm previous results in which B17A and B17B suppressed powdery mildew and also promoted plant growth in flowering dogwood. Although macrophomina root rot has been previously reported as a potential problem in flowering dogwood, especially in field conditions, simultaneous infection with macrophomina root rot and powdery mildew has not been previously reported. This study confirmed that M. phaseolina infection was characterized by stubby roots and black root lesions, and plants infected with both powdery mildew and macrophomina root rot had smaller root mass compared with fungicide-treated plants. Neither of the two pathogens killed their host plants, but compounded infections significantly reduced the plant root system and plant growth. The efficacy of the two bacterial isolates in controlling both powdery mildew and macrophomina root rot suggests their potential utilization in controlling both diseases in dogwood nursery production and in other plants that are hosts to both powdery mildew and macrophomina root rot. Plant growth promoted by the two BCAs may be attributed to powdery mildew and macrophomina root rot control, but comparisons between fungicide-treated plants and control plants not inoculated with BCAs or root rot pathogen suggested that the two BCAs may play a role as bio-stimulants in growth enhancement. These results also suggest that the two biocontrol agents are not phytotoxic to dogwood.
5
Reis, Ailton, Leonardo Silva Boiteux, and Milton Luiz Paz-Lima. "Powdery mildew of ornamental species caused by Oidiopsis haplophylli in Brazil." Summa Phytopathologica 33, no. 4 (December 2007): 405–8. http://dx.doi.org/10.1590/s0100-54052007000400015.
Full textAbstract:
Oidiopsis haplophylli (syn. Oidiopsis sicula) was identified as the causal agent of powdery mildew diseases occurring on five ornamental species in Brazil. This disease was observed in plastic house-grown lisianthus (Eustoma grandiflorum: Gentianaceae), in nasturtium (Tropaeolum majus: Tropaeolaceae) cultivated under open field conditions and in greenhouse-grown calla lily (Zantedeschia aethiopica: Araceae), impatiens (Impatiens balsamina: Balsaminaceae) and balloon plant (Asclepias physocarpa: Asclepiadaceae). Typical disease symptoms consisted of chlorotic areas on the upper leaf surface corresponding to a fungal colony in the abaxial surface. With the disease progression, these chlorotic areas eventually turned to necrotic (brown) lesions. Fungi morphology on all hosts was similar to that described for the imperfect stage of Leveillula taurica (O. haplophylli). The Koch's postulates were fulfilled by inoculating symptom-free plants via leaf-to-leaf contact with fungal colonies. Additional inoculations using an isolate of O. haplophylli from sweet pepper (Capsicum annuum) demonstrated that it is pathogenic to all five species belonging to distinct botanical families, indicating lack of host specialization. This is the first formal report of a powdery mildew disease on lisianthus, calla lilly, impatiens and nasturtium in Brazil. It is, to our knowledge, the first report of O. haplophyllii infecting A. physocarpa, extending the host range of this atypical powdery mildew-inducing fungus. This disease might become important on these ornamental crops especially in protected cultivation and also under field conditions in hot and dry areas of Brazil.
6
Garibaldi, A., A. Minuto, D. Bertetti, and M. L. Gullino. "First Report of Powdery Mildew Caused by Oidium Subgenus Pseudoidium on Salvia scabra in Italy." Plant Disease 88, no. 6 (June 2004): 682. http://dx.doi.org/10.1094/pdis.2004.88.6.682c.
Full textAbstract:
Salvia scabra Thunb. is grown and used on the Italian Riviera as a potted plant and used in gardens. During the spring of 2003, severe outbreaks of a previously unknown powdery mildew were observed in a collection of Salvia spp. maintained at an experimental station at Albenga (northern Italy). Powdery mildew was observed only on S. scabra. Leaves were covered with white exophytic mycelia on both surfaces. As the disease progressed, infected leaves turned yellow and died. Conidia were single, hyaline, cylindric, and measured 21.3 to 35.5 × 12.5 to 22.5 μm (average 28.2 × 18.4 μm). Observations made with a light microscope revealed that foot cells were cylindric and appressoria lobed. Cleistothecia were not observed. The pathogen was identified as Oidium subgenus Pseudoidium (1,2), and pathogenicity was confirmed by gently pressing diseased leaves onto mature leaves of healthy, 40-day-old S. scabra plants. Five plants of S. scabra were used as replicates. Noninoculated plants served as controls. Inoculated and noninoculated plants were maintained in a growth chamber at 20°C. After 5 days, typical symptoms of powdery mildew developed on inoculated plants. Noninoculated plants did not show symptoms. To our knowledge, this is the first report of the presence of powdery mildew on S. scabra in Italy as well as in the world. Erysiphe polygoni DC. (Oidium subgenus Pseudoidium) and E. cichoracearum DC. (Oidium subgen us Reticuloidium) were previously reported as causal agents of powdery mildew on other species of Salvia (S. officinalis and S. sclarea) (3,4). Specimens of this disease are available at the DIVAPRA Collection at the University of Torino. References: (1) R. Belanger et al., eds. The Powdery Mildew A Comprehensive Treatise. The American Phytopathological Society, St Paul, MN, 2002. (2) U. Braun. Nova Hedwigia. 89:700, 1987. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (4) A. Pisi and M. G. Bellardi. Inf. Fitopatol. 48(10):57, 1998.
7
Genaev, Mikhail A., Ekaterina S. Skolotneva, Elena I. Gultyaeva, Elena A. Orlova, Nina P. Bechtold, and Dmitry A. Afonnikov. "Image-Based Wheat Fungi Diseases Identification by Deep Learning." Plants 10, no. 8 (July 21, 2021): 1500. http://dx.doi.org/10.3390/plants10081500.
Full textAbstract:
Diseases of cereals caused by pathogenic fungi can significantly reduce crop yields. Many cultures are exposed to them. The disease is difficult to control on a large scale; thus, one of the relevant approaches is the crop field monitoring, which helps to identify the disease at an early stage and take measures to prevent its spread. One of the effective control methods is disease identification based on the analysis of digital images, with the possibility of obtaining them in field conditions, using mobile devices. In this work, we propose a method for the recognition of five fungal diseases of wheat shoots (leaf rust, stem rust, yellow rust, powdery mildew, and septoria), both separately and in case of multiple diseases, with the possibility of identifying the stage of plant development. A set of 2414 images of wheat fungi diseases (WFD2020) was generated, for which expert labeling was performed by the type of disease. More than 80% of the images in the dataset correspond to single disease labels (including seedlings), more than 12% are represented by healthy plants, and 6% of the images labeled are represented by multiple diseases. In the process of creating this set, a method was applied to reduce the degeneracy of the training data based on the image hashing algorithm. The disease-recognition algorithm is based on the convolutional neural network with the EfficientNet architecture. The best accuracy (0.942) was shown by a network with a training strategy based on augmentation and transfer of image styles. The recognition method was implemented as a bot on the Telegram platform, which allows users to assess plants by lesions in the field conditions.
8
Bondarenko-Borisova, I. V., and T. S. Bulgakov. "Study of infectious diseases of ornamental plants of Asteraceae family in outdoor planting collections of the Donetsk Botanical Garden." Plant Biology and Horticulture: theory, innovation, no. 155 (November 16, 2020): 24–33. http://dx.doi.org/10.36305/2712-7788-2020-2-155-24-33.
Full textAbstract:
The need for regular phytopathological monitoring of collections in the Donetsk Botanical Garden is due to the risk of invasions of new plant pathogens on introduced ornamental plants under conditions phytopathogens in the 21st century, as well as the annual replenishment of the collections with new plant species, varieties, cultivars. A phytopathological examination ornamental plants collections of Asteraceae family was carried out in 2016-2019, according to which 15 genera, 19 species and 3 cultivated hybrids of plants showed various diseases caused by plant pathogenic organisms. Microfungi (30 species) predominates among the plant pathogens; plant damage caused by viral and bacterial diseases was also observed. The most common infectious diseases in the Donetsk Botanical Garden (DBG) were caused by powdery mildew fungi (recorded on 8 plant species) and rust fungi (on 5 plant species). There were found some new plant pathogenic microfungi in DBG, which were previously not recorded in the DBG and which can be treated as alien species to the region: powdery mildews of Symphyotrichum spp. (pathogen - Golovinomyces asterum ), Coreopsis spp. ( G. spadicaeus ) and Helianthus tuberosus ( G. latisporus ), rusts of Tanacetum balsamitae ( Puccinia balsamitae ) and Symphyotrichum spp. ( Coleosporium asterum ), and smut of Gaillaridia spp. ( Entyloma gaillardianum ). Various leaf spots were regularly noted in the collections, but they did not cause significant damage of Asteraceae plants in outdoor planting conditions. The most harmful types of diseases were wilting caused by Fusarium oxysporum and Verticillium albo-atrum , and rots of rhizomes and tubers of perennials such as chrysanthemums ( Chrysanthemum × hortorum ) and dahlias ( Dahlia × cultorum ) caused by Berkeleyomyces basicola , Ilyonectria destructans , Sclerotinia sclerotiorum and opportunistic pathogens Clonostachys rosea and Stachybotrys chartarum .
9
Li, Chunjie, Xingxu Zhang, L. I. Author, Zhibiao Nan, and C. L. Schardl. "Disease and pest resistance of endophyte infected and non-infected drunken horse grass." NZGA: Research and Practice Series 13 (January 1, 2007): 111–14. http://dx.doi.org/10.33584/rps.13.2006.3099.
Full textAbstract:
The naturally occurring mutualistic symbiosis of Neotyphodium gansuense and drunken horse grass (Achnatherum inebrians) was studied previously in China. In this paper, new data on the interactions of endophyte, host and pathogenic fungi, mite and insect pests are presented. Fungal diseases and pests were examined when test plants were grown in pots in a climate chamber or in the field. There were usually no significant (P>0.05) differences in the levels of powdery mildew infection (caused by Blumeria graminis) under climate chamber conditions; the only exception was that E+ plants had significantly less powdery mildew infection at 50% soil water holding capacity (WHC) than at 30% WHC. There was no significant difference (P
10
Sumartini, Sumartini, and Mudji Rahayu. "PENYAKIT EMBUN TEPUNG DAN CARA PENGENDALIANNYA PADA TANAMAN KEDELAI DAN KACANG HIJAU." Jurnal Penelitian dan Pengembangan Pertanian 36, no. 2 (December 28, 2017): 59. http://dx.doi.org/10.21082/jp3.v36n2.2017.p59-66.
Full textAbstract:
<p>Powdery mildew disease is caused by Erysiphae diffusa (Cook and Peck) fungi on soybeans and E. polygoni (DC Sawada) on mungbean. Both diseases are an important disease because of their widely spread and high yield loss, reaching 35% in soybeans and 26% in mungbean. In Indonesia, the disease occurs in central areas of soybean production and mungbean. The spread of the disease includes Asia, the United States of America , and Brazil. The symptoms of powdery mildew are easily recognizable in the presence of white flour on the top surface of the leaves. The intensity of powdery mildew is usually high in the dry season, when the temperature is cold in the morning and much mildew conditions around the plant. This situation will interfere with the process of photosynthesis and transpiration. In addition, Erysiphe’s haustorium absorbs plant nutrients that will interfere with some metabolic functions and processes. Control of powdery mildew will suppress the loss of grain bean and results nationally supports the availability of soybean and mungbean. Recommended control measures are spraying with plant materials (extracts of neem seeds, tea compost, cow´s whole milk, essential oil of citronella, lemongrass, eucalyptus, cinnamon, and tea tree) on the incidence of powdery mildew disease on soybean and the use of Vima1 varieties for control of powdery mildew disease on mungbean.</p><p>Keywords: Soybean, mungbean, powdery mildew, control</p><p> </p><p>Abstrak</p><p>Penyakit embun tepung disebabkan oleh cendawan Erysiphae diffusa (Cook and Peck) pada tanaman kedelai dan E. polygoni (DC Sawada) pada kacang hijau. Penyebaran penyakit penting ini menyebabkan kehilangan hasil mencapai 35% pada kedelai dan 26% pada kacang hijau. Di Indonesia, penyakit ini terjadi di sentra produksi kedelai dan kacang hijau. Di luar negeri, penyebaran penyakit embun tepung meliputi Asia, Amerika Serikat, dan Brazil. Intensitas penyakit biasanya tinggi pada musim kemarau, pada saat suhu dingin di pagi hari dan kondisi berembun di sekitar pertanaman. Gejala penyakit embun tepung mudah dikenali dengan ciri seperti tepung di permukaan atas daun. Hal ini dapat mengganggu proses fotosintesis dan transpirasi. Selain itu, haustorium Erysiphe menyerap nutrisi tanaman sehingga mengganggu beberapa fungsi dan proses metabolisme. Penyakit embun tepung perlu dikendalikan untuk menekan kehilangan hasil kedelai dan kacang hijau. Cara pengendalian yang disarankan adalah penyemprotan dengan bahan nabati (ekstrak biji mimba, kompos teh, susu sapi, minyak dari citronella, lemongrass, eucalyptus, cinnamon, dan tanaman teh) pada kedelai dan penggunaan varietas tahan Vima-1 pada kacang hijau.</p><p>Kata Kunci: Kedelai, kacang hijau, penyakit embun tepung, pengendalian</p><p> </p>
11
Choi, J. K., B. S. Kim, I. Y. Choi, S. E. Cho, and H. D. Shin. "First Report of Powdery Mildew Caused by Golovinomyces artemisiae on Artemisia annua in Korea." Plant Disease 98, no. 7 (July 2014): 1010. http://dx.doi.org/10.1094/pdis-01-14-0055-pdn.
Full textAbstract:
Artemisia annua L., known as sweet wormwood or sweet annie, is native to temperate Asia, but is naturalized throughout the world. It produces artemisinin, a potent antimalarial drug that is also effective in treating other parasitic diseases (4). In August 2013, hundreds of plants showing typical symptoms of powdery mildew were found in Seoul (37°36′29.4″ N 127°02′38.3″ E), Korea. Powdery mildew colonies first appeared as thin white patches, which progressed to abundant hyphal growth on both sides of the leaves, stems, and inflorescence. As symptoms continued to develop, the leaves became distorted and turned purplish-gray. Severe infections caused leaf withering and premature senescence. The same symptoms were found on sweet wormwoods in Nonsan (36°09′55.3″ N 127°01′07.1″ E) and Chuncheon (37°52′27.4″ N 127°43′10.0″ E), Korea. Voucher specimens were deposited in the Korea University Herbarium (KUS). Appressoria on the mycelium were nipple-shaped or occasionally lobed. Conidiophores were cylindrical, measured 120 to 230 × 10 to 12.5 μm, and produced 2 to 4 immature conidia in chains with a sinuate outline, followed by 2 to 3 cells. Foot-cells of conidiophores were straight, cylindrical, and 54 to 100 μm long. Conidia were hyaline, ellipsoid to barrel-shaped, measured 30 to 40 × 15 to 20 μm (length/width ratio of 1.5 to 2.1), lacked distinct fibrosin bodies, and showed reticulate wrinkling of the outer walls. Germ tubes were produced on the perihilar position of conidia. Primary conidia were apically rounded, basally subtruncate, and generally smaller than the secondary conidia. No chasmothecia were observed. The structures described above were typical of the powdery mildew Euoidium anamorph of the genus Golovinomyces, and the fungus measurements were similar to those of G. artemisiae (Grev.) V.P. Heluta (3). The complete internal transcribed spacer (ITS) region of rDNA from KUS-F27763 was amplified with primers ITS1/ITS4 and sequenced. The resulting sequence of 624 bp was deposited in GenBank (Accession No. KJ136112). The obtained ITS sequence shared >99% similarity with G. artemisiae on A. princeps and A. montana from Japan (AB077659 and AB077649) and A. argyi from China (KF056818). Pathogenicity was confirmed through inoculation by gently dusting conidia onto leaves of five healthy potted plants. Five non-inoculated plants served as controls. Inoculated plants developed symptoms after 5 days, whereas the control plants remained symptomless. The fungus present on the inoculated plants was identical morphologically to that originally observed on diseased plants. Powdery mildews of A. annua caused by G. artemisiae have been reported in Japan, China, the Russian Far East, and Romania (1,2). To our knowledge, this is the first report of powdery mildew caused by G. artemisiae on A. annua in Korea. Since sweet wormwood production was only recently started on a commercial scale in Korea, powdery mildew infections pose a serious threat to the production of this plant, especially in organic farming where chemical control options are limited. References: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Societies Press, Tokyo, 1986. (2) U. Braun. The Powdery Mildews (Erysiphales) of Europe. G. Fischer Verlag, Jena, 1995. (3) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No.11. CBS, Utrecht, 2012. (4) P. J. Weathers et al. Phytochem. Rev. 10:173, 2011.
12
Zhang, F. L., Y. Zhang, J. Zhang, K. D. Xu, K. Liu, Y. Wang, Y. J. Lu, et al. "First Report of Powdery Mildew Caused by Blumeria graminis on Festuca arundinacea in China." Plant Disease 98, no. 11 (November 2014): 1585. http://dx.doi.org/10.1094/pdis-06-14-0567-pdn.
Full textAbstract:
Tall fescue (Festuca arundinacea Schreb), a predominant cool-season perennial grass, is widely used as forage and turf grasses in China. In July 2013, powdery mildew was observed on 10 F. arundinacea lawns (about 0.5 ha in total) in Urumchi, Xinjiang Province, China, with 20 to 30% of the area being infected. Signs of the disease initially appeared as irregular white mycelial colonies on the adaxial surface of infected leaves. As the disease progressed, the colonies covered the whole adaxial surface and white patches appeared on the abaxial surface of infected leaves. Conidiophores were unbranched and cylindrical with swollen bases, measuring 13.3 to 15 × 16.7 to 20 μm, and borne vertically on hyphae. Each conidiophore produced 10 to 18 conidia in a chain. The conidia were oval, one-celled, and colorless, measuring 8.1 to 9.8 × 26 to 29.7 μm. Cleistothecia were black, spherical, and 164.3 to 207.3 μm in diameter, each of which contained 9 to 26 asci. Asci were oblong or ovate, measuring 32.1 to 40 × 85.7 to 96.4 μm. Asci were petiolate, containing eight ascospores. Ascospores were round to oval, colorless, one-celled, measuring 19.1 to 22.5 × 11.7 to 13.6 μm. Based on morphological characteristics of the anamorph and the teleomorph, the fungus was identified as Blumeria graminis (DC.) Speer. Additionally, the internal transcribed spacer (ITS) of 563 bp was amplified from DNA of conidia using ITS1 and ITS4 primers (4). The ITS sequence was deposited in GenBank (Accession No. KF545644). The ITS sequence showed 100% homogeneity with those of B. graminis on Poa pratensis in Swizerland (AB273540) and on P. bulbosa in Iran (AB273551) (1), which further confirmed the identification. Ten 3-week-old healthy plants were inoculated by spraying a spore suspension (1 × 105 conidia ml−1) made from conidia brushed from infected plants, and 10 plants sprayed with sterile distilled water were served as controls. All the plants were placed in the same growth chamber at 20°C, 80% humidity, and 16-h photoperiod. Twenty days after inoculation, typical signs and symptoms of powdery mildew were observed on all the inoculated plants, whereas no symptoms were observed on the controls. Microscopic and ITS analysis showed that the fungus on the inoculated plants is identical to that on diseased field plants. B. graminis on F. arundinacea has been observed in a few European countries (1), Israel (3), and the United States (2). To our knowledge, this is the first report of powdery mildew caused by B. graminis on F. arundinacea in China, which will increase the difficulty to prevent powdery mildew on grasses including cereals. References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena-Stuttgart-New York, 1995. (2) F. M. Dugan and G. Newcombe. Pacific Northwest Fungi. 2:1-5, 2007. (3) S. O. Voytyuk et al. Biodiversity of the Powdery Mildew Fungi (Erysiphales, Ascomycota) of Israel Vol. 7. Biodiversity of Cyanoprocaryotes, Algae and Fungi of Israel. Koeltz Scientific Books, 2009. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.
13
Garibaldi, A., D. Bertetti, and M. L. Gullino. "First Report of Powdery Mildew Caused by Erysiphe pulchra on Cornus florida in Italy." Plant Disease 93, no. 3 (March 2009): 320. http://dx.doi.org/10.1094/pdis-93-3-0320c.
Full textAbstract:
Cornus florida L. (Cornaceae), flowering dogwood, is a small deciduous tree whose showy inflorescences, clusters of bright red fruits and red and purple leaves in autumn, make it a much appreciated ornamental. During the summer of 2008, severe outbreaks of a previously unknown powdery mildew were observed in several gardens and nurseries in Piedmont (northern Italy). Young leaves were covered with dense, white mycelia and conidia, especially on the adaxial surface. As the disease progressed, infected leaves turned red. Conidia were hyaline, elliptical, borne singly, and measured 32 to 46 × 15 to 20 (average 38 × 17) μm. Conidiophores measured 68 to 77 × 8 to 9 (average 73 × 8) μm, with a cylindrical foot cell measuring 26 to 37 × 8 to 10 (average 31 × 9) μm, followed by two shorter cells. Fibrosin bodies were absent. No chasmothecia were observed. The ITS region (internal transcribed spacer) of rDNA was amplified using primers ITS4/ITS6 and sequenced. The 627-bp sequence (Accession No. EU FJ436989 in GenBank) has 99% identity with Erysiphe pulchra. As proof of pathogenicity, diseased leaves were pressed against leaves of three healthy 3-year-old plants. Three noninoculated plants served as controls. Inoculated and noninoculated plants were maintained outdoors at 13 to 21°C. After 15 days, typical powdery mildew colonies developed on inoculated plants. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of the presence of powdery mildew on C. florida caused by E. pulchra in Italy. Powdery mildew of dogwood, caused by Microsphaera (Erysiphe) pulchra, has been reported in the United States (3) and Japan (1). In Italy, a powdery mildew caused by an Oidium sp. has been reported on C. sanguinea (2). Herbarium specimens of this disease are available at AGROINNOVA Collection, University of Torino, Italy. References: (1) T. Kobayashi. Index of Fungi Inhabiting Woody Plants in Japan. Host, Distribution, and Literature. Zenkoku-Noson-Kyoikai Publishing Co., Ltd., Tokyo, 2007. (2) G. Sicoli et al. Inf. Agrario 56/48:84, 2000. (3) V. L. Smith. Plant Dis. 83:782, 1999.
14
Garibaldi, A., D. Bertetti, and M. L. Gullino. "First Report of Powdery Mildew Caused by Erysiphe aquilegiae var. aquilegiae on Aquilegia flabellata in Italy." Plant Disease 88, no. 6 (June 2004): 681. http://dx.doi.org/10.1094/pdis.2004.88.6.681a.
Full textAbstract:
Aquilegia flabellata Sieb. and Zucc. (columbine) is a perennial garden species belonging to the family Ranunculaceae. During the summer of 2003, a severe outbreak of a previously unknown powdery mildew was observed in several gardens near Biella (northern Italy). Upper surfaces of leaves were covered with a white mycelium and conidia, and as the disease progressed infected leaves turned yellow and died. Foot cell was cylindric and appressorium lobed. Conidia were hyaline, ellipsoid, and measured 31.2 to 47.5 × 14.4 to 33 μm (average 38.6 × 21.6 μm). Fibrosin bodies were not present. Cleistothecia were globose, brown, had simple appendages, ranged from 82 to 127 (average 105) μm in diameter, and contained one to two asci. Ascocarp appendages measured five to eight times the ascocarp diameter. Asci were cylindrical (ovoidal) and measured 45.3 to 58.2 × 30.4 to 40.2 μm. Ascospores (three to four per ascus) were ellipsoid or cylindrical and measured 28.3 to 31.0 × 14.0 to 15.0 μ;m. On the basis of its morphology, the pathogen was identified as Erysiphe aquilegiae var. aquilegiae (1). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of five, healthy A. flabellata plants. Five noninoculated plants served as controls. Inoculated and noninoculated plants were maintained in a garden where temperatures ranged between 20 and 30°C. After 10 days, typical powdery mildew symptoms developed on inoculated plants. Noninoculated plants did not show symptoms. To our knowledge, this is the first report of the presence of powdery mildew on Aquilegia flabellata in Italy. E. communis (Wallr.) Link and E. polygoni DC. were reported on several species of Aquilegia in the United States (2), while E. aquilegiae var. aquilegiae was previously observed on A. flabellata in Japan and the former Union of Soviet Socialist Republics (3). Specimens of this disease are available at the DIVAPRA Collection at the University of Torino. References: (1) U. Braun. Nova Hedwigia, 89:700, 1987. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (3) K. Hirata. Host Range and Geographical Distribution of the Powdery Mildews. Faculty of Agriculture, Niigata University, 1966.
15
Fitt, B. D. L., and A. W. Ferguson. "Effects of fungal diseases on linseed (Linum usitatissimum) growth and yield, 1988–1990." Journal of Agricultural Science 120, no. 2 (April 1993): 225–32. http://dx.doi.org/10.1017/s002185960007427x.
Full textAbstract:
SUMMARYEffects of diseases on growth and yield of linseed (cv. Antares) were assessed by controlling diseases with fungicide treatments in field experiments at Rothamsted from 1988 to 1990. Fungicide seed treatments decreased the incidence of Alternaria lesions on cotyledons and stem bases of emerging seedlings in 1989 but decreased emergence in 1990. The incidenceof leaf browning, associated with Alternaria spp. and Botrytis cinerea, was less in 1989 and 1990 than in 1988 when the period, in July, between flowering and harvest was wet, but the incidence of powdery mildew was greater in 1989 and 1990 than in 1988. Fungicide spraysdecreased leaf browning in 1988 and powdery mildew in 1990. In 1988 there were more capsules per plant and the crop was taller than in either 1990 or 1989, when July and August were hot withperiods of dry weather. The incidence of plants with dark brown stems, associated with Verticillhun dahliae, was greater in 1989 and 1990 than in 1988, but was not greatly affected byfungicide treatments. The incidence of Alternaria linicola on sepals, capsule cases and seed from capsules sampled before harvest was decreased by fungicide treatments. Other fungi isolated from these tissues included A. alternata, A. infectoria, B. cinerea, Fusarium spp. and V. dahliae. Yields of grain and oil were increased by fungicide treatments in all three years, but the yield increases were greatest in 1988 when fungicide treatments also increased 1000-grain weight. The incidence of fungi on the harvested seed was not greatly affected by fungicide treatments.
16
Garibaldi, A., D. Bertetti, M. T. Amatulli, and M. L. Gullino. "Powdery Mildew Caused by Golovinomyces cichoracearum on Moth Mullein (Verbascum blattaria) in Italy." Plant Disease 95, no. 2 (February 2011): 225. http://dx.doi.org/10.1094/pdis-10-10-0716.
Full textAbstract:
Moth mullein (Verbascum blattaria) is an herbaceous plant belonging to the Scrophulariaceae family. It has alternate, simple leaves on stiffly, erect, green stems. Flowers are yellow or white, borne in summer through fall, and is increasingly used in gardens in low-maintenance borders. During the fall of 2009, 4-month-old plants grown in a greenhouse near Torino (northern Italy) showed signs and symptoms of an unknown powdery mildew. The adaxial leaf surfaces were covered with white mycelia and conidia, while the abaxial surfaces were less infected. As the disease progressed, infected leaves turned yellow and wilted. Mycelia were also observed on stems, petioles, and flower calyxes of inflorescences. Powdery mildew was observed on moth mullein naturally diffused in Italian flora and on V. blattaria var albiflorum cv. White Blush. The same symptoms and signs were observed in summer 2010 on V. blattaria plants grown in a garden near Biella. Conidia were hyaline, elliptical, borne in short chains (as many as five conidia per chain), and measured 35 × 22 (29 to 42 × 19 to 24) μm. Conidiophores were erect with a cylindrical foot cell measuring 147 × 11 (93 to 177 × 10 to 12) μm, followed by one to two shorter cells measuring 23 × 11 (15 to 33 × 10 to 12) μm. Fibrosin bodies were absent. Chasmothecia were not observed in the collected samples. The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS4/ITS6 and sequenced (1) (GenBank Accession No. HQ316555). The 542-bp amplicon had 99% homology with the sequence of Golovinomyces cichoracearum (GenBank Accession No. EU819552. Pathogenicity was confirmed through inoculation by gently pressing diseased leaves onto leaves of healthy V. blattaria plants. Five plants were inoculated, while the same number of noninoculated plants served as a control. Plants were maintained at temperatures from 19 to 25°C. Fifteen days after inoculation, symptoms and signs of powdery mildew developed on inoculated plants. The conidial morphology of the powdery mildew fungus that developed on inoculated plants was identical to the conidial morphology observed in the original fungus. Noninoculated plants remained healthy. The pathogenicity test was carried out twice. G. cichoracearum, formerly Erysiphe verbasci (synonym E. cichoracearum), has been reported on V. blattaria in Hungary, Romania, and the former USSR (2,3). In conclusion, to our knowledge, it is the first report of G. cichoracearum affecting moth mullein in northern Italy. The economic importance of this disease is at present limited in Italy because of limited planting of this host. However, the ecological characteristics and flowering of V. blattaria make it interesting for low-maintenance gardens. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Societies Press. Tokyo, 1986. (3) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Stuttgart, Germany, 1995.
17
Choi, I. Y., B. S. Kim, S. E. Cho, J. H. Park, and H. D. Shin. "First Report of Powdery Mildew Caused by Erysiphe buhrii on Gypsophila paniculata in Korea." Plant Disease 98, no. 7 (July 2014): 1013. http://dx.doi.org/10.1094/pdis-03-14-0237-pdn.
Full textAbstract:
Gypsophila paniculata L. (baby's breath, family Caryophyllaceae), native to Central and Eastern Europe, is commonly cultivated as a commercial cut flower crop in greenhouses in Korea. Since 2011, baby's breath cv. Cassiopeia has been observed affected by a powdery mildew with nearly 100% disease incidence at the stage of harvesting in Iksan City. Powdery mildew colonies first appeared as thin white patches on stems and both sides of the leaves. As disease progressed, plants were covered with dense masses of spores, followed by senescence and reduction of quality of cut flowers. A voucher specimen was deposited in the Korea University Herbarium (Accession KUS-F27313). Appressoria were well-developed, multilobed or moderately lobed, and single or opposite in pairs. Conidiophores were straight, 95 to 150 × 7 to 10 μm, and composed of 3 to 4 cells. Foot-cells were cylindric or slightly sinuous at the base and 37 to 53 μm long. Singly produced conidia were cylindrical to oblong-elliptical, 35 to 56 × 12.5 to 18 μm with a length/width ratio of 2.1 to 3.6, devoid of fibrosin bodies, and with angular/rectangular wrinkling of outer walls. Germ tubes were in the perihilar position on conidia, and ended with lobed appressoria. No chasmothecia were found. These structures are typical of the Pseudoidium anamorph of the genus Erysiphe. Specific measurements and host range were consistent with those of E. buhrii U. Braun (2). To confirm identification, the complete internal transcribed spacer (ITS) region of rDNA of isolate KUS-F27313 was amplified with primers ITS1/ITS4, and sequenced directly. The resulting 725-bp sequence was deposited in GenBank (KJ530705). A GenBank BLAST search of the Korean isolate showed 99% similarity with E. buhrii on Acanthophyllum sp. (Caryophyllaceae) from Iran (AB128924). Pathogenicity was confirmed through inoculation by gently dusting conidia onto leaves of five healthy, potted baby's breath cv. Cassiopeia. Five non-inoculated plants served as controls. Inoculated plants were isolated from non-inoculated plants in separate rooms in a greenhouse at 25 ± 2°C. Inoculated plants developed signs and symptoms after 7 days, whereas the control plants remained symptomless. The fungus present on the inoculated plants was identical morphologically to that originally observed on diseased plants. Pathogenicity test was repeated twice. The powdery mildew disease caused by E. buhrii on baby's breath has been recorded in the former Soviet Union (Armenia, Kazakhstan, Ukraine), Romania, Turkey, Iran, Mongolia, and Argentina (1,3). Also, a fungus occurring on baby's breath was recorded as Oidium sp. from Japan (4). To our knowledge, this is the first report of powdery mildew caused by E. buhrii on baby's breath in Korea. Powdery mildew infections pose a serious threat to production of this cut flower crop. References: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Societies Press, Tokyo, 1986. (2) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No. 11. CBS, Utrecht, 2012. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved February 18, 2014. (4) M. Satou et al. Ann. Phytopathol. Soc. Jpn. 62:541, 1996.
18
Vuković, Slavica, Dragana Šunjka, Antonije Žunić, and Dragana Bošković. "Plant protection products in root vegetable." Biljni lekar 48, no. 6 (2020): 654–68. http://dx.doi.org/10.5937/biljlek2006654v.
Full textAbstract:
The production, value and quality of root vegetables are endangered by numerous phytopathogenic fungi and pests. Numerous causal agents cause economically significant diseases of root vegetables like carrot leaf blight and black rot of carrots (Alternaria dauci and Alternaria radicina), powdery mildew of carrot and sugar beet (Erysiphe heraclei and Erysiphe betae), Cercospora leaf spot of carrot (Cercospora carotae), black blight (Septoria apiicola), leaf bright parsley (Septo-ria petroselini), downy mildew (Peronospora farinosa f.sp. betae and P. farinosa f.sp. spinaciae), rust (Puccinia spp.) etc. Nine fungicides based on nine different active substances have been registered in the Republic of Serbia for the control of phytopathogenic fungi in root vegetable crops. The most important pests of root vegetables are wireworms (Elateridae), carrot flies (Psila rosae), celery flies (Acidia heraclei), onion flies (Delia antiqua), aphids (Aphididae), common spider mite (Tetranychus urticass), cabbage moth (Mamestra brassicae), cotton bollworm (Helicoverpa armigera) and others. The overall number of insecticides, registered in our country, for the control of root vegetable pests is eight, based on seven different active substances. The aim of this paper is to present registered plant protection products for the control of the most economically import-ant pathogens and pests of root vegetables, in the Republic of Serbia, classified according to the mode of action.
19
Garibaldi, A., D. Bertetti, S. Frati, and M. L. Gullino. "First Report of Powdery Mildew Caused by Golovinomyces cichoracearum on Orange Coneflower (Rudbeckia fulgida) in Italy." Plant Disease 92, no. 6 (June 2008): 975. http://dx.doi.org/10.1094/pdis-92-6-0975b.
Full textAbstract:
Rudbeckia fulgida (orange coneflower), a flowering plant belonging to the Asteraceae, is increasingly used as a border in parks and gardens. In September 2007, severe outbreaks of a previously unknown powdery mildew were observed on plants in a public park in Torino (northern Italy). More than 90% of the plants were affected by the disease. Both surfaces of leaves of affected plants were covered with white mycelia and conidia. As the disease progressed, infected leaves turned yellow and wilted. Mycelia and conidia also were observed on stems and flower calyxes. Conidia were hyaline, ellipsoid, borne in chains (as many as three to four conidia per chain) and measured 34 × 23 (30 to 39 × 21 to 25) μm. Conidiophores measured 129 × 12 (89 to 181 × 11 to 13) μm and showed a foot cell measuring 88 × 12 (48 to 129 × 11 to 13) μm followed by two shorter cells. Fibrosin bodies were absent. Chasmothecia were not observed in the collected samples. The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 619 bp showed a 100% homology with the sequence of Golovinomyces cichoracearum (3). The nucleotide sequence has been assigned GenBank Accession No. EU 233820. Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy R. fulgida plants. Twenty plants were inoculated. Fifteen noninoculated plants served as the control. Plants were maintained in a greenhouse at temperatures ranging from 18 to 22°C. Eight days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. The fungus observed on inoculated plants was morphologically identical to that originally observed. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on R. fulgida in Italy. Powdery mildew on Rudbeckia spp. was previously reported in the United States (4), Poland, and more recently, India and Switzerland. Particularly, in Switzerland the disease has been observed on R. laciniata and R. nitida (2). The economic importance of this disease is currently limited. Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. Bolay. Cryptogam. Helv. 20:1, 2005. (3) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000. (4) D. F. Farr et al. Page 82 in: Fungi on Plants and Plants Products in the United States. The American Phytopathological Society, St Paul, MN, 1989.
20
Koike, S. T., and P. Beckman. "Characterization of Powdery Mildew Caused by Leveillula taurica on Calla Lily in California." Plant Disease 86, no. 2 (February 2002): 187. http://dx.doi.org/10.1094/pdis.2002.86.2.187c.
Full textAbstract:
Spring calla lily (Zantedeschia spp.), also known as colored or miniature calla, has markedly increased in popularity in recent years, and the production acreage in the central coast counties of California (Monterey, Santa Cruz, and San Benito), therefore, has significantly increased. Commercial plantings of calla lily (Z. albo maculata and Z. rehmannii hybrids) in California have been infected with a powdery mildew for several years, with the disease particularly evident in late summer and fall. In 2001, powdery mildew was again prevalent, and the pathogen was examined in detail. Initial symptoms consisted of chlorotic, circular-to-oval leaf lesions with diffuse margins. As the disease progressed, white sporulation became visible on lesions. In advanced stages of the disease, the center tissue of lesions turned necrotic. For any such lesion, both the corresponding adaxial and abaxial sides of the leaf always exhibited the symptoms of the disease and developed sporulation of the pathogen. Epidermal strips from both sides of leaves and leaf cross sections were mounted in drops of lactophenol and aniline blue and examined with a light microscope. These preparations showed that epiphytic mycelium was absent and all conidiophores developed from endophytic mycelium and emerged through stomata. Conidiophores carried single or sometimes two conidia and were sometimes branched. Hyaline, single-celled conidia were dimorphic. Primary (terminal) conidia were lanceolate with distinct apical points and measured (58-) 67 to 78 (-81) × 14 to 22 μm. Secondary conidia were ellipsoid-cylindric and measured (56-) 58 to 72 × 17 to 22 μm. For both conidial types, length to width ratios were greater than three. Based on these characters, the pathogen was identified as Leveillula taurica (anamorph Oidiopsis taurica). Cleistothecia were not observed. To test whether the calla lily pathogen could infect another known host of L. taurica, diseased calla lily leaves were gently pressed against leaves of potted tomato (Lycopersicon esculentum) plants (2). Inoculated tomato plants were kept in a humidity chamber for 48 h and maintained in a greenhouse (24 to 26°C). After 12 days, chlorotic lesions appeared on inoculated tomato leaves, and sporulation of L. taurica was observed on the lesions. Uninoculated control tomato plants did not develop powdery mildew. To our knowledge, this is the first report of powdery mildew, caused by L. taurica, on calla lily in North America. This disease has been reported on calla lily in South Africa, Spain, Taiwan, Turkey, and Zimbabwe (1,3,4). References: (1) Y.-K. Chen et al. Ann. Phytopathol. Soc. Jpn. 62:580, 1996. (2) J. C. Correll et al. Plant Dis. 71:248, 1987. (3) K. A. Hirata. Host Range and Geographic Distribution of the Powdery Mildew Fungi. Japan Scientific Society Press, Tokyo, 1986. (4) E. Sezgin et al. J. Turkish Phytopathol. 13:111, 1984.
21
Garibaldi, A., D. Bertetti, and M. L. Gullino. "First Report of Powdery Mildew Caused by Podosphaera aphanis var. aphanis on Potentilla fruticosa in Italy." Plant Disease 89, no. 12 (December 2005): 1362. http://dx.doi.org/10.1094/pd-89-1362c.
Full textAbstract:
Potentilla fruticosa L. (bush cinquefoil), belonging to the family Rosaceae, is an ornamental plant used in parks and gardens. During the spring and summer of 2005, severe outbreaks of a previously unknown powdery mildew were observed in several private gardens located near Biella (northern Italy). The adaxial and abaxial surfaces of leaves as well as the stems were covered with white mycelium. Buds and flowers also were affected. As disease progressed, infected leaves turned yellow and dehisced. Conidia formed in chains and were hyaline, ovoid, and measured 24.0 to 36.0 × 15.8 to 24.0 μm (average 30.1 × 20.0 μm). Fibrosin bodies were present. Chasmothecia were numerous, sphaerical, amber colored, and diameters ranged from 84.0 to 98.4 μm (average 90.4 μm). Each chasmothecium contained one ascus with eight ascospores. Ascospores measured 26.5 to 27.2 × 13.2 to 15.6 μm (average 26.8 × 14.0 μm). On the basis of its morphology, the causal agent was determined to be Podosphaera aphanis (Wallr.) U. Braun & S. Takamatsu var. aphanis U. Braun (1). Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy P. fruticosa plants. Three plants were inoculated. Three noninoculated plants served as a control. Plants were maintained at temperatures ranging from 12 to 23°C. Ten days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on P. fruticosa in Italy. Erysiphe polygoni D.C. and Sphaerotheca macularis (Wallr.:Fr.) Lind were observed in the United States on P. fruticosa (2), while in Japan, the presence of S. aphanis var aphanis was reported (3). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000 (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (3) S. Tanda et al. J. Agric. Sci. 39:258, 1995.
22
Liu, Yuanzheng, Xi Feng, Ping Gao, Yanzhong Li, Michael J. Christensen, and Tingyu Duan. "Arbuscular mycorrhiza fungi increased the susceptibility of Astragalus adsurgens to powdery mildew caused by Erysiphe pisi." Mycology 9, no. 3 (May 28, 2018): 223–32. http://dx.doi.org/10.1080/21501203.2018.1477849.
Full text
23
Garibaldi, A., D. Bertetti, and M. L. Gullino. "First Report of Powdery Mildew Caused by Podosphaera fusca on Coreopsis lanceolata in Italy." Plant Disease 91, no. 9 (September 2007): 1203. http://dx.doi.org/10.1094/pdis-91-9-1203c.
Full textAbstract:
Coreopsis lanceolata L. (Asteraceae) is an ornamental species grown in parks and gardens and very much appreciated for its long-lasting flowering period. During the summer and fall of 2006, severe outbreaks of a previously unknown powdery mildew were observed on plants in several gardens near Biella (northern Italy). Both surfaces of leaves of the affected plants were covered with dense white mycelia and conidia. As the disease progressed, infected leaves turned yellow and died. Mycelia and conidia also were observed on stems and flower calyxes. Conidia were hyaline, ellipsoid, borne in short chains (5 to 6 conidia per chain) and measured 33 × 20 (27 to 35 × 17 to 22) μm. Conidiophores, 68 × 11 (62 to 76 × 10 to 12) μm, showed the foot cell measuring 50 × 11 (38 to 58 × 10 to 12) μm, followed by one shorter cell measuring 18 × 12 (13 to 19 × 12 to 13) μm. Fibrosin bodies were present. Chasmothecia were spherical and amber with a diameter of 99 (93 to 105) μm. Each chasmothecium contained one ascus with eight ascospores. On the basis of its morphology, the causal agent was determined to be a Podosphaera sp. (1). The ITS region (internal transcribed spacer) of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 531 bp obtained showed an E-value of 0.0 with Podosphaera fusca (3). The nucleotide sequence has been assigned GenBank Accession No. EF 442023. Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy C. lanceolata plants. Three plants were inoculated. Three noninoculated plants served as the control. Plants were maintained in a greenhouse at temperatures ranging from 20 to 28°C. Twelve days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on C. lanceolata in Italy. Species of Coreopsis were previously described as host to Erysiphe cichoracearum, Sphaerotheca macularis and Leveillula taurica and S. fusca (2,4). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) U. Braun. A Monograph of the Erysiphaceae (Powdery Mildews). Cramer, Berlin, GDR, 1987. (3) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000 (4) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society. St Paul, MN, 1989.
24
Xing, H. H., C. Liang, S. E. Cho, and H. D. Shin. "First Report of Powdery Mildew Caused by Podosphaera spiraeae on Japanese Spiraea in China." Plant Disease 98, no. 4 (April 2014): 571. http://dx.doi.org/10.1094/pdis-09-13-0944-pdn.
Full textAbstract:
Japanese spiraea (Spiraea japonica L.f.), belonging to Rosaceae, is widely planted for its ornamental value in China. Since July 2011, powdery mildew infections on leaves and stems of Japanese spiraea have been noticed in some parks and gardens of Chengyang District in Qingdao City, China (GPS coordinates 36°31′04.22″ N, 120°39′41.92″ E). Symptoms first appeared as white spots covered with mycelium on both side of the leaves and young stems. As the disease progressed, abundant mycelial growth covered the whole shoots and caused growth reduction and leaf distortion with or without reddening. A voucher specimen was deposited in the herbarium of Qingdao Agricultural University (Accession No. HMQAU13013). Hyphae were flexuous to straight, branched, septate, 5 to 7 μm wide, and had nipple-shaped appressoria. Conidiophores arising from the upper surface of hyphal cells produced 2 to 5 immature conidia in chains with a crenate outline. Foot-cells of conidiophores were straight, 60 to 125 × 7 to 9 μm, and followed by 1 to 2 shorter cells. Conidia were ellipsoid-ovoid to doliiform, measured 25 to 32 × 12 to 15 μm with a length/width ratio of 1.8 to 2.6, and had distinct fibrosin bodies. Chasmothecia were not found. The structures and measurements were compatible with the anamorphic state of Podosphaera spiraeae (Sawada) U. Braun & S. Takam. as described before (1). The identity of HMQAU13013 was further confirmed by analysis of nucleotide sequences of the internal transcribed spacer (ITS) regions amplified using the primers ITS1/ITS4 (4). The resulting 564-bp sequence was deposited in GenBank (Accession No. KF500426). A GenBank BLAST search of complete ITS sequence showed 100% identity with that of P. spiraeae on S. cantoniensis (AB525940). A pathogenicity test was conducted through inoculation by gently pressing a diseased leaf onto five healthy leaves of a potted Japanese spiraea. Five non-inoculated leaves served as controls. The plants were maintained in a greenhouse at 22°C. Inoculated leaves developed typical symptoms of powdery mildew after 5 days, but the non-inoculated leaves remained symptomless. The fungus presented on the inoculated plant was morphologically identical to that originally observed on diseased plants, fulfilling Koch's postulates. Powdery mildew of S. japonica caused by P. spiraeae has been recorded in Japan, Poland, and Switzerland (2,3). To our knowledge, this is the first report of powdery mildew caused by P. spiraeae on Japanese spiraea in China. References: (1) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No.11. CBS, Utrecht, 2012. (2) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ September 10, 2013. (3) T. Kobayashi. Index of Fungi Inhabiting Woody Plants in Japan. Host, Distribution and Literature. Zenkoku-Noson-Kyoiku Kyokai Publishing Co. Ltd., Tokyo, 2007. (4) S. Matsuda and S. Takamatsu. Mol. Phylogenet. Evol. 27:314, 2003.
25
Tonello, Eduardo Silvestrini, Nataliê Luíse Fabbian, Deivid Sacon, Aline Netto, Vanessa Neumann Silva, and Paola Mendes Milanesi. "Soybean seed origin effects on physiological and sanitary quality and crop yield." Semina: Ciências Agrárias 40, no. 5 (July 4, 2019): 1789. http://dx.doi.org/10.5433/1679-0359.2019v40n5p1789.
Full textAbstract:
The suitable establishment of a crop depends on seed quality, among another factors. However, with high production costs many producers use uncertified seeds, to reduce expenses with this input at sowing time. The objective was to evaluate germination, vigor and health of soybean seeds, diseases incidence in cvs. NS 5445 IPRO and BMX Ativa RR, whose seeds were of certified and uncertified origins, as well as yield components and grain yield of soybeans, with or without fungicides application. The experiments were conducted in the 2015/16 and 2016/17 crop season, in Erechim-RS. Two experiments were carried out in a completely randomized design (DIC): one in the laboratory, under a 2 x 2 factorial scheme (cultivar x origin); and another in the field in a homogeneous area, in a 2 x 2 factorial scheme (with/without fungicide application and certified/uncertified seed) for two cultivars, both with four replications. The variables evaluated were: germination and seed health, yield (kg ha-1), thousand grains weight (g), number of grains per plant, and incidence of foliar fungal diseases. The main fungi identified in seeds were Aspergillus sp., Penicillium sp. and Fusarium sp. The highest incidence percentage were obtained in uncertifed seeds, at two harvests. Both cultivars and origins presented the minimum germination required for commercialization, however, certified seeds had better performance for seed vigor. As for normal seedlings, there was a significant difference only for the 2016/17 crop season, with the highest percentage obtained in certified seeds (52.0% for NS 5445 and 73.5% for BMX Ativa). Best productivity was achieved with cultivation of certified seeds associated with fungicides in both crops and cultivars. For thousand grains weight (TGW) there was no difference in origin, but only for cultivar and fungicides apply. The number of grains per plant was higher in plants from certified seeds and that received fungicides, being cv. BMX Ativa the most responsive for the two harvests analyzed. The main diseases found in the two harvests were: Asian rust, powdery mildew, mildew, septoriosis and cercosporiosis. However, seed origin, in both crops, did not differ in the incidence of Asian rust, powdery mildew and mildew, but for septoriosis and cercosporiosis, considered soybean late season diseases, seed origin is a determining fator.
26
Minnis, A. M., A. Y. Rossman, D. L. Clement, M. K. Malinoski, and K. K. Rane. "First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America." Plant Disease 94, no. 2 (February 2010): 279. http://dx.doi.org/10.1094/pdis-94-2-0279b.
Full textAbstract:
Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.
27
Mazur, Stanisław, and Agnieszka Szczeponek. "Occurrence of fungal diseases on angelica (Archangelica officinalis Hoffm.) in the region of Małopolska." Acta Agrobotanica 58, no. 2 (2012): 137–50. http://dx.doi.org/10.5586/aa.2005.040.
Full textAbstract:
The field experiment on angelica (<i>Archangelica officinalis</i> Hoffm.) was carried out in the years 2001-2002 at the plantations situated in Małopolska (Mydlniki near Kraków and Królówka near Bochnia). The results of two years' investigations pointed out, that angelica plants during vegetation were infested by many pathogens. The most often noticed on the plants were angelica rust (<i>Puccinia anglicae</i>), powdery mildew (<i>Erysiphe umbelliferarum</i>) and Cercospora leaf spot (<i>Cercospora</i> sp.). Moreover, many various types of disease symptoms, which were described and made a diagnosis. There were mainly spots on leaves and steams, from which there were isolated most often fungi from <i>Alternaria</i> genus. The investigations on the salubrity of the seed material (angelica fruits) coming from different sources showed that fungi from genus <i>Alternaria</i> were likely to transfer by seeds and caused disease symptoms on plants during vegetation. Fungi from genus <i>Alternaria</i> were most often isolated from angelica fruits. Saprotrophic fungi (<i>Epicoccum purpurascens</i>, <i>Penicillium</i> spp., <i>Mucor hiemalis</i>) were also often isolated from angelica fruits. Disinfection on fruits reduced number of isolated fungi and bacteria.
28
Collins, N. C., R. E. Niks, and P. Schulze-Lefert. "Resistance to cereal rusts at the plant cell wall—what can we learn from other host-pathogen systems?" Australian Journal of Agricultural Research 58, no. 6 (2007): 476. http://dx.doi.org/10.1071/ar06065.
Full textAbstract:
The ability of plant cells to resist invasion by pathogenic fungi at the cell periphery (pre-invasion resistance) differs from other types of resistance that are generally triggered after parasite entry and during differentiation of specialised intracellular feeding structures. Genetic sources of pre-invasion resistance such as mlo for barley powdery mildew and Lr34 for resistance to wheat leaf rust have proven to be broad-spectrum in effect and durable in the field. Continued breeding for this type of resistance (often quantitative in effect) is therefore considered an important strategy to protect cereal crops long-term against potentially devastating fungal diseases such as rusts. Considerable progress has been made in characterising genes and processes underlying pre-invasion resistance using mutant analysis, molecular genetics, gene cloning, and the model plant Arabidopsis, as well as comparative functional analysis of genes in Arabidopsis and cereals. This review summarises the current knowledge in this field, and discusses several aspects of pre-invasion resistance potentially pertinent to use in breeding; namely, biological cost of the resistance and effectiveness of individual resistance genes against multiple pathogen types. We show that mutations in Mlo, Ror1, and Ror2 genes known to affect powdery mildew pre-invasion resistance have no detectable effect on partial resistance to barley leaf rust as measured by latency period.
29
Kaur, P., C. X. Li, M. J. Barbetti, M. P. You, H. Li, and K. Sivasithamparam. "First Report of Powdery Mildew Caused by Erysiphe cruciferarum on Brassica juncea in Australia." Plant Disease 92, no. 4 (April 2008): 650. http://dx.doi.org/10.1094/pdis-92-4-0650c.
Full textAbstract:
In Australia, Brassica juncea (L.) Czern & Coss (Indian mustard) has the potential as a more drought-tolerant oilseed crop than the B. napus L., with the first canola-quality B. juncea varieties released in Australia in 2006 and first sown for commercial production in 2007. Increased production of B. juncea is expected to result in the appearance of diseases previously unreported in Australia. In the spring of 2007 at the University of Western Australia field plots at Crawley (31.99°S, 115.82°E), Western Australia, plants of B. juncea genotypes from Australia and China had extensive stem colonization by powdery mildew at the end of the flowering period, with whitish patches ranging in size from 3 mm to 3 cm long. These patches coalesced to form a dense, white, powdery layer as they expanded. Pathogenicity was demonstrated by gently pressing infected stems containing abundant sporulation onto leaves of potted B. juncea seedlings of variety JM-18, incubating the plants in a moist chamber for 48 h, and then maintaining the plants in a controlled-environment room at 18/13°C for day/night. Signs of powdery mildew appeared at 7 days after inoculation, and by 10 days, it was well developed. Uninoculated control plants did not have powdery mildew. When symptomatic plants were examined, abundant conidia were typical of Erysiphe cruciferarum Opiz ex Junell, with cylindrical conidia borne singly or in short chains as described previously (2). Mycelia were amphigenous, in patches, and often spreading to become effused. Conidiophores were straight, foot cells were cylindrical, and conidia were mostly produced singly and measured 21.2 to 35.4 (mean 26.7 μm) × 8.8 to 15.9 μm (mean 11.9 μm) from measurements of 100 conidia. The spore size that we measured approximated what was found for E. cruciferarum (2) (30 to 40 × 12 to 16 μm), since we found 35 and 50% of spores falling within this range in terms of length and width, respectively. Conidia were, however, generally smaller in size than that reported on broccoli raab in California (1) (35 to 50 × 12 to 21 μm). We confirmed a length-to-width ratio greater than 2 as was found previously (1,2). Infected leaves showed signs of early senescence. While powdery mildew caused by E. cruciferarum is an important disease of B. juncea in India where yield losses as much as 17% have been reported (4), its potential impact in Australia is yet to be determined. To our knowledge, this is the first record of E. cruciferarum on B. juncea in Australia. In Western Australia, E. cruciferarum has been recorded on B. napus (oilseed rape) since 1986 and on B. napus L. var. napobrassica (L.) Reichenb. (swede) since 1971 (3). In other regions of Australia, it has been recorded on B. rapa in Queensland since 1913 and on B. napus (oilseed rape) in South Australia since 1973. References: (1) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (2) T. J. Purnell and A. Sivanesan. No 251 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (3) R. G. Shivas. J. R. Soc. West. Aust. 72:1, 1989. (4) A. K. Shukla et al. Manual on Management of Rapeseed-Mustard Diseases. National Research Centre on Rapeseed-Mustard, Bharatpur, India, 2003.
30
Garibaldi, A., D. Bertetti, P. Martini, L. Repetto, and M. L. Gullino. "Golovinomyces biocellatus on Oregano (Origanum vulgare ‘Compactum’) in Italy." Plant Disease 96, no. 3 (March 2012): 457. http://dx.doi.org/10.1094/pdis-09-11-0790.
Full textAbstract:
Origanum vulgare L., common name oregano, also known as pot marjoram, Lamiaceae family, is grown for its aromatic and medicinal properties and as an ornamental. In particular, O. vulgare ‘Compactum’ is becoming popular as a potted plant. During January 2011, 3-month-old plants grown on a commercial farm located near Albenga (northern Italy) showed signs and symptoms of an unknown powdery mildew. Ninety percent of the plants were affected. The adaxial leaf surfaces were covered with white mycelia and conidia, while the abaxial surfaces were less infected. As the disease progressed, infected leaves turned yellow, wilted, and eventually fell off. Mycelia were also observed on stems. Conidia were hyaline, elliptical, borne single or in short chains (three to four conidia per chain), and measured 37.9 × 19.6 (31.2 to 45.1 × 14.9 to 26.2) μm. Conidiophores were erect with a cylindrical foot cell measuring 81.1 × 9.7 (54.2 to 112.4 × 7.9 to 11.6) μm followed by two to three shorter cells measuring 26.8 × 11.8 (16.6 to 38.1 × 8.5 to 15.3) μm. Fibrosin bodies were absent. Chasmothecia were not observed in the collected samples. The internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1F/ITS4 and sequenced (3) (GenBank Accession No. JN594608). The 560-bp amplicon had 99% homology with the sequence of Golovinomyces biocellatus (GenBank Accession No. AB307675). Pathogenicity was confirmed through inoculation by spraying a conidial suspension (6 × 104 CFU/ml) prepared from diseased leaves onto leaves of healthy O. vulgare ‘Compactum’ plants. Four plants were inoculated while the same number of noninoculated plants served as a control. Plants were maintained in a glasshouse at temperatures ranging from 23 to 28°C. Ten days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. The fungus observed on inoculated plants was morphologically identical to that originally observed. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. G. biocellatus on O. vulgare has been reported in Switzerland (2) and Argentina (4) and it is present on other plant genera in Italy. In Italy, on the same host, attacks of Erysiphe galeopsis have been previously reported (1). The economic importance of this disease is currently limited due to limited planting of this species. However, in the last years, potted aromatic plants represent a steady increasing crop in Italy. Voucher specimens are available at the Agroinnova Collection, University of Torino. References: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Science Society Press, Tokyo, 1986. (2) A. Bolay. Cryptog. Helv. 20:1, 2005. (3) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990. (4) S. M. Wolcan. J. Plant Patho. 91:501, 2009.
31
Badea, Ana, François Eudes, Andre Laroche, Rob Graf, Ketan Doshi, Eric Amundsen, Denise Nilsson, and Byron Puchalski. "Antimicrobial peptides expressed in wheat reduce susceptibility to Fusarium head blight and powdery mildew." Canadian Journal of Plant Science 93, no. 2 (March 2013): 199–208. http://dx.doi.org/10.4141/cjps2012-125.
Full textAbstract:
Badea, A., Eudes, F., Laroche, A., Graf, R., Doshi, K., Amundsen, E., Nilsson, D. and Puchalski, B. 2013. Antimicrobial peptides expressed in wheat reduce susceptibility to Fusarium head blight and powdery mildew. Can. J. Plant Sci. 93: 199–208. Antimicrobial peptides (AMPs) have a broad spectrum of action against bacteria, fungi and viruses, which makes them attractive for building plant defense against a diversity of pathogens. Peptides MsrA2 and 10R were cloned in three genetic constructs for tissue-specific expressions in wheat, using either Lem1, GstA1WIR1a, or Ltp6 and LTP6 signal peptide targeting the lemma/palea, leaves and spikes, epicarp and endomembrane system, respectively. The minimal cassettes for these three genetic constructs and for Pat marker construct were co-delivered in immature wheat scutella using biolistics, and green plantlets were regenerated in presence of 5 mg L−1 glufosinate. Molecular screening confirmed one regenerated plant carried and expressed all transgenes (AMP+): one copy of 10R driven by Ltp6 promoter, one copy of msrA2 driven by GstA1Wir1a and two copies of msrA2 driven by Lem1. Its offspring and T3 generation were challenged with Fusarium graminearum and Blumeria graminis in a contained environment. A reduction of 50% in Fusarium head blight susceptibility was observed in T1, and was inherited through T3 generation. The latter, also presented a 53% reduction in Fusarium damaged kernels and 62% reduction in deoxynivalenol accumulation compared with wild cv. Fielder and sister lines AMP−. MsrA2 and 10R producing T3 lines showed an average significant reduction of 59% in powdery mildew susceptibility compared with cv. Fielder. Synthetic MsrA2 and 10R peptides were effective as in vivo antifungal peptides in wheat. The expression of antimicrobial peptides in plant cells or tissues may have great potential to limit pathogen infection or growth protecting wheat against a diversity of fungal diseases.
32
Krzyzińska, Barbara, Mariola Głazek, and Agnieszka Mączyńska. "Seed treatment for control leaf spot diseases of spring wheat." Acta Agrobotanica 58, no. 1 (2012): 37–43. http://dx.doi.org/10.5586/aa.2005.006.
Full textAbstract:
In the years 2001 and 2002 at the Institute of Plant Protection Branch in Sooenicowice research work was performed on seed treatment with fungicides against leaf diseases of spring wheat cv. Ismena caused by pathogenic fungi: <i>Blumeria graminis</i>, <i>Phaeasphaeria nodorum</i>, <i>Puccinia recondita</i> i <i>Pyrenophora tritici</i>-<i>repentis</i>. Two variants of protection were included in the experiment: seed dressing with fungicides or seed dressing and single application of foliar spray at GS 49. At early growth stages of spring wheat a very high biological activity against powdery mildew, septoria leaf spot, brown rust and tan spot was recorded for seed dressing containing triticonazole+prochloraz. In the case of triadimenol+imazalil+fuberidazole only a weak, but long-lasting effect against brown rust and septoria leaf spot was observed. Leaf infection as well as 1000 grain mass and yield, in the experimental combination with using triticonazole+prochloraz were on the same level as in the experimental variant where after seed dressing with triadimenol+imazalil+fuberidazole plots were sprayed with tridemorf+epoxykonazole at GS 49. It was concluded that seed dressing preparation containing triticonazole+prochloraz constituted a good base for protection of spring wheat against foliar diseases.
33
Reis, P., R. Pierron, P. Larignon, P. Lecomte, E. Abou-Mansour, S. Farine, C. Bertsch, et al. "Vitis Methods to Understand and Develop Strategies for Diagnosis and Sustainable Control of Grapevine Trunk Diseases." Phytopathology® 109, no. 6 (June 2019): 916–31. http://dx.doi.org/10.1094/phyto-09-18-0349-rvw.
Full textAbstract:
Vitis vinifera is affected by many diseases every year, depending on causal agents, susceptibility of cultivars, and climate region. Some are caused by a single agent, such as gray mold caused by Botrytis cinerea or powdery mildew caused by Erysiphe necator. Others result from the actions of a complex of pathogens such as grapevine trunk diseases (GTDs). GTDs are presently among the most devastating diseases in viticulture worldwide because both the economic losses and the long-term sustainability of vineyards are strongly affected. The complexity of GTDs results from the diversity of associated fungi, the undetermined period of latency within the vine (asymptomatic status), the erratic foliar symptom expression from one year to the next, and, probably correlated with all of these points, the lack of efficient strategies to control them. Distinct methods can be beneficial to improve our knowledge of GTDs. In vitro bioassays with cell suspensions, calli, foliar discs, full leaves, or plantlets, and in vivo natural bioassays with cuttings, grafted plants in the greenhouse, or artificially infected ones in the vineyard, can be applied by using progressive integrative levels of in vitro and in vivo, depending on the information searched. In this review, the methods available to understand GTDs are described in terms of experimental procedures, main obtained results, and deliverable prospects. The advantages and disadvantages of each model are also discussed.
34
Radisek, S., N. Ferant, J. Jakse, and B. Javornik. "First Report of Powdery Mildew Caused by Golovinomyces biocellatus on Common Sage (Salvia officinalis) in Slovenia." Plant Disease 96, no. 7 (July 2012): 1065. http://dx.doi.org/10.1094/pdis-01-12-0010-pdn.
Full textAbstract:
Common sage (Salvia officinalis) is a well known perennial and medicinal herb in the Lamiaceae family, which is widely planted in gardens and parks in Slovenia. In September 2007, symptoms of powdery mildew infection were observed on common sage plants grown in several gardens in the Savinja valley. White mycelium was present, principally on the upper leaf surface, but was also observed on stems. The disease progressed as spots coalesced and leaves become distorted and necrotic. Microscopic observations revealed septate and branched hyaline hyphae 4 to 7 μm wide. Conidiophores were cylindrical and septate and measured 40 to 90 × 9 to 12 μm. The foot cells of the conidiophores were straight, followed by one to three shorter cells. Conidia produced in chains (three to four conidia per chain) were hyaline and doliform in shape, measuring 27 to 35 × 14 to 20 μm and lacking fibrosin bodies. Cleistothecia were not observed in the collected samples. All of these characteristics were consistent with Golovinomyces biocellatus as described by Braun (2). For molecular identification of the pathogen, DNA was extracted from mycelia and conidia of infected plants, collected in two different gardens in the Savinja valley as representative samples (1GB-Sof and 2GB-Sof). Nuclear rDNA internal transcribed spacer (ITS) regions were amplified by PCR using the universal primers ITS4 and ITS5, and sequenced. Both samples yielded the same 532 bp sequence, which showed the highest identity (97 to 99%; E value = 0.0) to G. biocellatus ITS sequences in the NCBI GenBank (1). The nucleotide sequence has been assigned GenBank Accession No. JQ340358. Pathogenicity was confirmed by inoculation of 10 healthy plants of S. officinalis ‘Grower's Friend’ planted in pots. Plants were sprayed with a spore suspension (105 conidia/ml; 0.01% Tween 20) obtained from naturally infected leaves. Inoculated plants were covered with polyethylene bags for two days to maintain high humidity and incubated in a growing chamber at 22°C with a 12-h photoperiod. The first powdery mildew signs and symptoms developed on leaves 7 days after inoculation. Ten control plants sprayed with distilled water showed no symptoms. The fungus present on the inoculated plants was morphologically identical to that originally observed on diseased plants. Powdery mildew infections of common sage associated with G. biocellatus have been known in Argentina, Washington State (United States), and various countries in Europe (2,3,4). To the best of our knowledge, this is the first report of G. biocellatus on common sage in Slovenia. Voucher specimens are available at the culture collection of the Slovenian Institute of Hop Research and Brewing. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (3) M. G. Cabrera et al. Mycosphere 1:289, 2010. (4) F. M. Dugan. North American Fungi 6:1, 2011.
35
Gunasinghe, N., M. P. You, V. Lanoiselet, N. Eyres, and M. J. Barbetti. "First Report of Powdery Mildew Caused by Erysiphe cruciferarum on Brassica campestris var. pekinensis, B. carinata, Eruca sativa, E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia." Plant Disease 97, no. 9 (September 2013): 1256. http://dx.doi.org/10.1094/pdis-03-13-0299-pdn.
Full textAbstract:
Inspection of field plantings of diverse cruciferous species, mainly oilseed varieties sown for agronomic assessment at Crawley, (31.99°S, 115.82°E), Western Australia, in September 2012, indicated the occurrence of extensive leaf and stem colonization by powdery mildew at the late flowering stage, with whitish patches 3 to 4 cm in length on stems of Brassica campestris var. pekinensis, B. carinata, B. oleracea var. capitata, B. rapa, Eruca sativa, and E. vesicaria. These patches coalesced to form a dense, white, powdery layer. Infected leaves showed signs of early senescence. Pathogenicity was demonstrated from transferring field inoculum from the most susceptible variety by pressing diseased leaves onto leaves of the six potted plant species, and incubating plants in a moist chamber for 48 hours post-inoculation (hpi) in an air-conditioned glasshouse approximating 25°C. Signs of powdery mildew were evident by 7 days post-inoculation (dpi), and well developed symptoms by 10 dpi and as observed in the field. Uninoculated control plants did not develop powdery mildew. On all inoculated species, abundant conidia typical of those produced by Erysiphe cruciferarum were observed, matching the descriptions of conidia given by Purnell and Sivanesan (3), with cylindrical conidia typically borne singly or in short chains. Mycelia were amphigenous, in patches, often spreading to become effused. Conidiophores were 3 to 4 cells, unbranched, and foot cells cylindrical. Across all host species, conidia were mostly produced singly with overall mean measured lengths 19.7 to 35.4 μm (mean 26.9 μm), and measured widths 7.1 to 12.9 μm (mean 9.7 μm), from measurements taken on 200 conidia for each of the six different species. Spore sizes measured approximated those found for E. cruciferarum by Kaur et al. (1) on B. juncea in Western Australia (viz. 21.2 to 35.4 × 8.8 to 15.9 μm), but were smaller than those reported by Purnell and Sivanesan (3) (viz. 30 to 40 × 12 to 16 μm) or by Koike and Saenz (1) (viz. 35 to 50 × 12 to 21 μm). We confirmed a length-to-width ratio >2 (mean range 2.7 to 2.8 across all six species) as found by both Purnell and Sivanesan (3) and Koike and Saenz (2). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene was carried out with universal primers ITS1 and ITS4 and PCR products from E. cruciferarum from B. oleracea var. capitata and B. rapa sequenced. BLAST analyses to compare sequences with those in GenBank showed a >99% nucleotide identity for E. cruciferarum. In Western Australia, E. cruciferarum has been recorded on B. napus var. napobrassica since 1971 (4), B. napus since 1986 (4), and on B. juncea since 2008 (1). In other regions of Australia, E. cruciferarum has been recorded on B. campestris, B. oleracea var. capitata, B. oleracea var. acephala, B. napus, B. napus var. naprobrassica, and B. rapa var. rapa. To the best of our knowledge, this is the first record of E. cruciferarum on B. campestris var. pekinensis, B. carinata, E. sativa, and E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia. Powdery mildew epidemics on other brassicas in Western Australia are generally sporadic and it remains to be seen what the impact of this disease will be on these new host species. References: (1) P. Kaur et al. Plant Dis. 92:650, 2008. (2) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (3) T. J. Purnell and A. Sivanesan. No. 251 in IMI Descriptions of Fungi and Bacteria, 1970. (4) R. G. Shivas. J. Royal Soc. West. Aust. 72:1, 1989.
36
Ashmarina, L. Ph, A. A. Sukhorukov, A. S. Korobeinikov, and T. A. Galaktionova. "X-RAY MICROANALYSIS IN PHYTOPATHOLOGY." Bulletin of NSAU (Novosibirsk State Agrarian University), no. 4 (December 29, 2019): 7–14. http://dx.doi.org/10.31677/2072-6724-2019-53-4-7-14.
Full textAbstract:
X-ray microanalysis methods have significantly expanded the functionality of electron microscopy. X-ray microanalysis is widely applied in activities, which deal with plant physiology. The paper explores the functioning of the stomach apparatus of fodder beans (Vícia fába). The regulation of the stomatal function depends on the potassium concentration in the closing cells. The authors investigated the infestation of wheat leaves with mildew (Erysiphe graminis) (Triticum astivum) and obtained the data that reveal the changes in the elemental composition of tissues in the affected area. This has contributed to find out the role of various elements during the infectious process in case of wheat plants with powdery dew contamination. The paper summarizes the materials on the application of X-ray microanalysis in phytopathology. It stipulates the participation of calcium in the formation of the mechanism of nematode capture in different age colonies of predatory fungi Arthrobotrys oligospores Fres was revealed. The data on tissue barrier in wheat roots, where the transport of both sodium and chlorine salting elements and potassium and calcium macro elements is controlled, are obtained. The authors show that transporting of these elements is regulated by active mechanisms in the endoderm cells. The article demonstrates the results of X-ray microanalysis aimed at determining the content of elements of magnesium, phosphorus, sulfur, potassium and calcium in soybean leaves affected by various diseases. The authors observed the changes in potassium, calcium, magnesium and phosphorus concentration in leaves with bacterial burn, ascochytosis and alternative. They argue the participation of elements in formation of plant resistance to disease and the role of these elements in the physiology of the infectious process.
37
Hamada, Emília, Francislene Angelotti, Lucas Da Ressurreição Garrido, and Raquel Ghini. "Cenários futuros de epidemia do oídio da videira com as mudanças climáticas para o Brasil (Future scenarios of powdery mildew epidemic on grape under climate change for Brazil)." Revista Brasileira de Geografia Física 8 (December 1, 2015): 454. http://dx.doi.org/10.26848/rbgf.v8.0.p454-470.
Full textAbstract:
Devido à intensa relação entre o ambiente e as doenças de plantas, alterações na distribuição geográfica e temporal das doenças podem ocorrer como impacto das mudanças climáticas. A vitivinicultura tem crescido de importância nos últimos anos no Brasil e as doenças constituem um sério problema para a cultura. O oídio, causado pelo fungo Uncinula necator, é uma das principais doenças que afetam a videira. O objetivo deste estudo foi avaliar o impacto potencial das mudanças climáticas na favorabilidade do oídio da videira no país, baseado em critérios de lógica matemática, associando combinações de faixas de variáveis climáticas com classes de favorabilidade e utilizando as ferramentas de SIG - Sistema de Informações Geográfica. O estudo considerou os meses ao longo do ano dos períodos de 1961-1990 e de 2011-2040, 2041-2070 e 2071-2100, nos cenários B1 e A2 do IPCC. A temperatura média e a umidade relativa foram os dados climáticos básicos de entrada no banco de dados do SIG e foram obtidos de projeções dos modelos climáticos globais do Quarto Relatório de Avaliação do IPCC. Os mapas de distribuição geográfica de respostas favoráveis à doença mostram que haverá alteração no futuro, com aumento da área favorável à sua incidência no Brasil, em ambos os cenários. Due to the intense relationship between environment and plant diseases, changes in the geographical and temporal distribution of diseases may occur as an impact of climate change. Viticulture in Brazil has been growing in importance in recent years and disease are a serious crop issue. Powdery mildew, also known as oidium, caused by the fungus Uncinula necator, is one of the main diseases affecting this crop. The objective of this study was to assess the potential impact of climate change on the favorability of grape oidium in Brazil, based on criterions of mathematical logic associating combinations of ranges of climate variables with classes of favorability and using Geographical Information System - GIS tools. The study considered the months throughout the year of periods of 1961-1990 and 2011-2040, 2041-2070, and 2071-2100, scenarios B1 and A2 of IPCC. Mean temperature and relative humidity were the basic weather data entered in the GIS database, obtained by projections of global climate models from IPCC Fourth Assessment Report. Maps of geographic distribution of favorable responses for the disease show that in the future there will be change, increasing the favorable area for their incidence in the Brazil, in both scenarios. Keywords: Vitis spp., Uncinula necator, plant disease, Geographical Information System.
38
Majchrzak, Barbara, Tomasz P. Kurowski, and Zofia Karpińska. "The health condition of spring oilseed crops in relation to the fungi colonising their seeds." Acta Agrobotanica 55, no. 1 (2013): 199–210. http://dx.doi.org/10.5586/aa.2002.019.
Full textAbstract:
The research was conduced in the years 1999-2000. The aim of the research was to determine the health condition of overground parts and seeds of the following spring oilseed crops: crambe (<i>Crambe abbysinica</i> Hoechst.) cv. B o r o w s k i, false flax (<i>Camelina sativa</i> L.) cv. B o r o w s k a, spring rape (<i>Brassica napus</i> ssp. <i>oleifera</i> L.) cv. M a r g o and oleiferous radish (<i>Raphanus sativus</i> var. <i>oleiferus</i> L.) cv. P e g l e t t a. In all the years of the research alternaria blight was found on the leaves and siliques of spring rape and oleiferous radish and on the leaves and stems of crambe. False flax proved to be weakly infected by pathogens. On its leaves gray mould (<i>Botrytis cinerea</i>) was found in all the years of the research. The disease was found on the siliques only in 1999. In 2000 powdery mildew was found on spring rape and false flax (respectively, <i>Erysiphe crucifearum</i> and <i>E.cichoracearum</i>). The weather conditions affected the intensity of the diseases on the studied spring oilseed crops. <i>Alernaria</i> genus, especially <i>A.alternata</i> was most commonly isolated from the seeds of examined plants. It constituted from 37% (in crambe) to 63,3% (in spring rape) of all the isolates. Of the remaining pathogenic species, numerous fungi of the <i>Fusarium</i> genus (<i>F.avenaceum, F.culmorum, F.equiseti</i> and <i>F.oxysporum</i>) were isolated. They constituted from 1,0% (false flax) to 17,3% (crambe) of the isolates.
39
Kiss, L. "First Report of Powdery Mildew on Dollar-plant (Crassula ovata) Caused by an Oidium sp." Plant Disease 83, no. 2 (February 1999): 199. http://dx.doi.org/10.1094/pdis.1999.83.2.199c.
Full textAbstract:
Dollar-plant (Crassula ovata) is a perennial, succulent ornamental grown worldwide. In 1998, powdery mildew colonies were observed on the adaxial leaf surfaces of a 4-year-old specimen maintained outdoors. Symptoms included necrosis of the infected tissues and defoliation 2 months after the appearance of the first colonies. Conidia were produced in chains on unbranched conidiophores. Hyphal appressoria were lobed to multi-lobed, mostly opposite or spread. Conidia were ellipsoid to cylindrical, measured 34 to 48 μm × 17 to 26 μm, and contained no fibrosin bodies. On water agar, conidia produced a single germ tube from the end of the conidium. Germ tubes were either very short with lobed appressoria, or were two to three times longer than conidia, and terminated in lobed or unlobed appressoria. Cleistothecia were not produced. The pathogen was identified as an Oidium sp. belonging to the genus Erysiphe sect. Galeopsidis (1). To confirm pathogenicity, small, potted C. ovata plants were placed near the diseased plant in the laboratory. After 2 weeks, powdery mildew appeared on the small plants, and the pathogen was morphologically identical to the original fungus. This is the first report of a powdery mildew fungus on C. ovata, and it is different from both species of the Erysiphaceae identified on other Crassula spp. (1,2). Infected C. ovata leaves were deposited at the Department of Botany of the Hungarian Natural History Museum in Budapest under the accession number BP 91732. References: (1) U. Braun. 1995. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena. (2) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN.
40
Glawe, Dean A., Lindsey J. du Toit, and Gary Q. Pelter. "First Report of Powdery Mildew on Potato Caused by Leveillula taurica in North America." Plant Health Progress 5, no. 1 (January 2004): 15. http://dx.doi.org/10.1094/php-2004-1214-01-hn.
Full textAbstract:
In August 2004, examination of powdery mildew-infected ‘Russet Burbank’ potato leaves from a furrow-irrigated field in Grant Co., WA, revealed two powdery mildew fungi, one referable to Erysiphe orontii and the other to Leveillula taurica (Lév.) G. Arnaud. Discovery of the two species sporulating together on diseased leaves is consistent with an observation made in the Middle East. This report documents, for the first time, L. taurica on potato in N. America and provides information on distinguishing it from E. orontii. Accepted for publication 9 December 2004. Published 14 December 2004.
41
Sataraddi, Arun R., and Jitendra Kumar S. Hilli. "Management of powdery mildew of cluster bean through fungi toxicants." INTERNATIONAL JOURNAL OF PLANT PROTECTION 13, no. 2 (October 15, 2020): 207–10. http://dx.doi.org/10.15740/has/ijpp/13.2/207-210.
Full textAbstract:
Leveillula taurica causes severe powdery mildew on all aerial parts of cluster bean plant. The objective of the present work was to identify potential methods for managing cluster bean powdery mildew through fungicides. Field trials were conducted during Kharif 2019 and 2020 to evaluate the efficacy fungicides. Nine systemic fungicides were tested both under in-vitro and in-vivo conditions against cluster bean powdery mildew disease. In vitro evaluation of fungicides revealed that complete inhibition of conidial germination was observed in all systemic fungicides at 0.1 per cent concentration. However, under field conditions, penconazole at 0.05 per cent was found to be best fungicide which recorded least incidence 3.66 per cent followed by hexaconazole (5.83%) and propiconazole (6.83%).
42
Tratwal, Anna, and Jan Bocianowski. "Blumeria graminis f. sp. hordei virulence frequency and the powdery mildew incidence on spring barley in the Wielkopolska province." Journal of Plant Protection Research 54, no. 1 (January 1, 2014): 28–35. http://dx.doi.org/10.2478/jppr-2014-0005.
Full textAbstract:
Abstract Powdery mildew caused by fungi Blumeria graminis f. sp. hordei is one of the most common barley diseases in Polish meteorological conditions. The powdery mildew fungus is made up of different races and forms that are highly specialized. Barley cultivars might be resistant to a certain race of the mildew fungus, but susceptible to another race. Development of the disease is rapid in temperatures from 12 to 20°C, and in humid weather. The aim of the two-year experiment was to assess B. graminis f. sp. hordei virulence frequency and powdery mildew occurrence on five spring barley cultivars. Virulence frequency of the pathogen depended on place and term of exposition. The occurrence of powdery mildew on spring barley cultivars depended on virulence frequency of the pathogen and weather conditions.
43
Hazelrigg, Ann L., Terence L. Bradshaw, and Gabriella S. Maia. "Disease Susceptibility of Interspecific Cold-Hardy Grape Cultivars in Northeastern U.S.A." Horticulturae 7, no. 8 (July 30, 2021): 216. http://dx.doi.org/10.3390/horticulturae7080216.
Full textAbstract:
Susceptibility to diseases of economically important grapes is critical to the evaluation of germplasm recommended for commercial production and for the development of sustainable production systems. In 2018–2019, the cold-hardy grape cultivars including ‘Brianna’, ‘Crimson Pearl’, ‘Itasca’, ‘Louise Swenson’, ‘Marechal Foch’, ‘Marquette’ ‘Petite Pearl’, ‘St. Pepin’, and ‘Verona’ were evaluated on non-treated vines for susceptibility to downy mildew, powdery mildew, black rot, anthracnose, Phomopsis leaf spot and fruit rot, and Botrytis bunch rot. No cultivars were consistently disease-free, and all exhibited some degree of black rot and powdery mildew infection. Relative susceptibility to disease was not consistent across both years, but ‘Brianna’ had greater incidence of black rot and ‘Louise Swenson’ showed lower incidence of powdery mildew in both years. The relatively new cultivars ‘Crimson Pearl’ and ‘Verona’ exhibited comparatively moderate disease susceptibility overall. Growers typically manage diseases with fungicides on commercial farms, so cultivar susceptibility is just one component of a sustainable pest management and production system.
44
Baykal, Ulku. "Detection of Powdery Mildew Growth in Hazelnut Plant Using PCR." Turkish Journal of Agriculture - Food Science and Technology 8, no. 8 (August 31, 2020): 1807–10. http://dx.doi.org/10.24925/turjaf.v8i8.1807-1810.3717.
Full textAbstract:
Powdery mildew is a serious disease of economically important hazelnut crop in Turkey. Hazelnut production has been extremely affected by the disease in terms of quality and quantity. The disease is caused by two different fungi, namely Erysiphe corylacearum and Phyllactinia guttata. E. corylacearum has been shown to be the responsible one predominantly for the recent economic damage. The fungi produce a mycelium network on hazelnut plants before they sporulate and visually detected. Early detection of these pathogens is important for management as well as understanding their spread and epidemics. In this study, a PCR assay was developed for the detection of both pathogens from hazelnut plant leaves by targeting their ribosomal DNA genes in their internal transcribed spacer (ITS) regions. Two sets of specific primers were designed for the detection of E. corylacearum and P. guttata at an early stage of infection. As a result of PCR, a specific band of 578 bp was observed. The amplicon sequencing confirmed the presence of only E. corylacearum, but not P. guttata. Therefore, this PCR-based test can identify plants that are infected with powdery mildew before they show any visual signs. From there, the infected plants can be treated or removed before the fungus has a chance to produce spores that infect neighboring plants. These results would help tackle the eradication of powdery mildew.
45
Kochergina, Marina, and Evgeniya Furmenkova. "POWDERY MILDEW AT THE OBJECTS OF THE LANDSCAPE ARCHITECTURE OF VORONEZH." Forestry Engineering Journal 10, no. 4 (January 19, 2021): 171–80. http://dx.doi.org/10.34220/issn.2222-7962/2020.4/14.
Full textAbstract:
Powdery mildew is one of the pathologies of deciduous plants. In the affected plant organism, metabolic processes are disrupted. Plants lag behind in growth; lose winter hardiness and resistance to unfavorable factors. The aggressiveness of powdery mildew fungi is the basis for the study of their bioecological characteristics in various forest zones. The relevance of such studies in the conditions of the city of Voronezh is due to the dominance of deciduous plants on the objects of landscape architecture, which are more or less susceptible to powdery mildew. Studies carried out in parks have shown that the complex of pathogens (causative agents of powdery mildew) is 13 species and 2 forms of fungi. At the same time, 3 species and 1 form proved to be rare. 7 species and 1 form of pathogens were classified as common in terms of frequency of occurrence. Massive species that develop annually in parks are 3 species of powdery mildew fungi. Common barberry, English oak, ash-leaved maple and hawthorn showed weak resistance to the disease. Signs of affection were not noted on aspen, black alder, Babylonian willow, common and small-leaved elms, robinia, pear, red oak, fragrant poplar, Vangutta spirea, Buldenezh viburnum, Thunberg barberry. Measures to reduce the spread of powdery mildew in parks are monitoring, selection of planting material, the use of resistant species, agrotechnical planting care, maintaining optimal insolation and aeration regimes in plantations
46
Sholberg, Peter, Colleen Harlton, Julie Boulé, and Paula Haag. "Fungicide and Clay Treatments for Control of Powdery Mildew Influence Wine Grape Microflora." HortScience 41, no. 1 (February 2006): 176–82. http://dx.doi.org/10.21273/hortsci.41.1.176.
Full textAbstract:
There is very little information on the interaction of wine grape microflora with fungicides used to control grape diseases. The objective of this study was to determine how fungicides used in a standard grape pest management program and an experimental clay being developed for control of powdery mildew affect grape microflora. Grape leaves and fruit were surveyed for bacteria, fungi and yeast six times over the growing season in 2000 after treatment with clay or fungicides. In 2001 only clay was studied for control of powdery mildew in `Chancellor' grapes. The total number of propagules present on untreated leaf and fruit tissue were 76% bacteria, 14% yeast, and 9% fungi. Fungicides used for grape disease control significantly reduced epiphytic fungi (P < 0.0001), bacteria (P = 0.03), and yeast (P = 0.0001) on grape berries and epiphytic fungi (P < 0.0001), and yeast (P = 0.03) on leaves. The clay treatment had no detectable effect on grape microflora because no significant differences were recorded between clay or untreated grape berries or leaves on any of the sampling dates. Over the growing season the fungicide spray program reduced incidence and severity of powdery mildew better than clay. Clay controlled powdery mildew on `Chancellor' fruit in 2000 and 2001.
47
Koike, Steven T., and Dean A. Glawe. "First Report of Powdery Mildew of Fringed Willowherb (Epilobium ciliatum) Caused by Podosphaera epilobii in North America." Plant Health Progress 8, no. 1 (January 2007): 41. http://dx.doi.org/10.1094/php-2007-1112-01-br.
Full textAbstract:
Description and first report of powdery mildew caused by Podosphaera epilobii on E. ciliatum in North America are presented in this brief. The weed is commonly found in California's Salinas Valley (Monterey Co.). Confirmation of the powdery mildew disease indicates that this weed will not be a source of the powdery mildew diseases that affect nearby vegetable and ornamental crops. Accepted for publication 4 September 2007. Published 12 November 2007.
48
Shi, Ainong, and Margaret T. Mmbaga. "Perpetuation of Powdery Mildew Infection and Identification of Erysiphe australiana as the Crape Myrtle Pathogen in Mid-Tennessee." Plant Disease 90, no. 8 (August 2006): 1098–101. http://dx.doi.org/10.1094/pd-90-1098.
Full textAbstract:
The fungus Erysiphe lagerstroemiae is commonly known as the powdery mildew pathogen in crape myrtle (Lagerstroemiae indica) in the United States, and Erysiphe australiana is the powdery mildew pathogen reported in Japan, China, and Australia. The teleomorph often used to identify powdery mildew fungi rarely develops in crape myrtle, and in our observations, ascocarps never formed. Our study showed that the crape myrtle pathogen overwintered as mycelia on dormant buds. The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs ITS1 and ITS4. PCR products were analyzed by electrophoresis in a 1.5% agarose gel and sequenced, and the ITS PCR product was 666 bp from ITS1/ITS4 and 704 bp from ITS1-F/ITS4. BLAST analysis of the sequence of the PCR products showed identical similarity with E. australiana reported in Japan, China, and Australia. Comparison of ITS sequences with information in the GenBank on other powdery mildew fungi showed a closest alignment (93% similarity) to Erysiphe juglandis that infects walnut. Specific primers for E. australiana were developed and evaluated for use as diagnostic tools. Out of 12 specific primer pairs evaluated, four primer pairs and four double primer pairs were highly specific to E. australiana and did not amplify Erysiphe pulchra of dogwood, Erysiphe syringae of common lilac, Erysiphe circinata of maple, or Phyllactinia guttata of oak. The E. australiana-specific primers amplified 16 samples of crape myrtle powdery mildew collected from diverse locations in mid-Tennessee. These results clearly showed that the crape myrtle powdery mildew in mid-Tennessee was caused by E. australiana. Specific primers reported in this article provide a diagnostic tool and may be used to confirm the identity of crape myrtle powdery mildew pathogen in other areas in the United States and wherever the disease occurs.
49
Koike, S. T., and G. S. Saenz. "First Report of Powdery Mildew, Caused by an Oidium sp., on Poinsettia in California." Plant Disease 82, no. 1 (January 1998): 128. http://dx.doi.org/10.1094/pdis.1998.82.1.128a.
Full textAbstract:
In December 1996 and January 1997, powdery mildew was observed on potted poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch) plants in Monterey County, CA. Mycelia were observed on stems, petioles, mature and immature leaves, and bracts. Severely diseased leaves became twisted and bent and senesced prematurely. The white mycelia were conspicuous, epiphytic, and amphigenous; hyphae measured 4.6 to 6.9 μm in diameter. Growth initially was in patches but eventually became effused. Appressoria were slightly lobed to lobed and sometimes opposite. Conidiophore foot cells were cylindrical, sometimes bent at the base, and slightly flexuous to flexuous. Foot cells measured 30.0 to 46.2 μm × 5.8 to 6.9 μm and were followed by one to two shorter cells. Conidia were cylindrical to slightly doliform and measured 25.4 to 32.3 μm × 11.6 to 18.5 μm. The length-to-width ratios of conidia generally were greater than 2.0. Conidia were produced singly, placing the fungus in the Pseudoidium-type powdery mildew group. Conidia germinated at the ends, and no fibrosin bodies were observed. Cleistothecia were not found. The fungus was identified as an Oidium species. Pathogenicity was demonstrated by gently pressing infected leaves having abundant sporulation onto leaves of potted poinsettia plants (cvs. Freedom Red, Peter Star Marble, and Nutcracker White), incubating the plants in a moist chamber for 48 h, and then maintaining plants in a greenhouse. After 12 to 14 days, powdery mildew colonies developed on the inoculated plants, and the pathogen was morphologically identical to the original isolates. Uninoculated control plants did not develop powdery mildew. This is the first report of powdery mildew on poinsettia in California. This fungus appears similar to Microsphaera euphorbiae but has longer, slightly flexuous foot cells that do not match the description for M. euphorbiae (1,2). An alternative identification would be Erysiphe euphorbiae; however, there are no available mitosporic descriptions for morphological comparisons (1,2). In the United States, powdery mildew of poinsettia previously has been reported in various states in the Pacific Northwest, Midwest, and Northeast. References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN.
50
Koike, S. T., and G. S. Saenz. "First Report of Powdery Mildew Caused by Erysiphe heraclei on Celery in North America." Plant Disease 81, no. 2 (February 1997): 231. http://dx.doi.org/10.1094/pdis.1997.81.2.231a.
Full textAbstract:
Since 1994, a fungal disease has been affecting celery (Apium graveolens) grown for seed in the central coast region of California. White, ectophytic mycelia and conidia, characteristic of a powdery mildew, were present on compound umbels, including the involucre, rays, raylets, flowers, and fruits. Celery with powdery mildew had twisted flower petals, and the disease possibly contributed to premature senescence and drying of the fruits. Powdery mildew was not observed on leaves. Mycelial growth was effused and amphigenous and had lobed appressoria. Conidiophores were straight, and cylindrical foot cells were followed by a longer cell and one or two shorter cells. Conidia were produced singly and were 36 to 44 × 11 to 16 μm. Fibrosin bodies were not observed. Germ tubes were located at the ends of conidia and formed lobed appressoria. Cleistothecia were not present. Based on these characteristics, the fungus was identified as Erysiphe heraclei (1). In California, parsley (Petroselinum crispum) is a host of E. heraclei (4), and parsley is grown in the same region as celery seed crops. To determine if parsley was an alternative host of the celery powdery mildew, infected celery umbels were gently pressed onto adaxial surfaces of leaves on 2-month-old greenhouse grown parsley cvs. Italian Plain and Triple Curled. Inoculated plants were incubated 48 h in a moist chamber at 22°C, then transferrred to a greenhouse at 22 ± 2°C / 16 ± 2°C day/night temperatures, 75% relative humidity, and natural light. After 12 to 14 days, powdery mildew was observed on both parsley cultivars. Uninoculated control plants did not develop the disease. This is the first report of powdery mildew on celery in North America. Previous reports list E. heraclei on celery in Chile, the former Czechoslovakia, France, Iraq, Italy, and the former USSR (Georgia region). In the U.S., E. heraclei is reported on carrot (Daucus carota) (2), parsley (4), meadow parsnip (Zizia aptera and Z. aurea) (3), and now celery. References: (1) H. J. Boesewinkel. Bot. Rev. 46:167, 1980. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN. (3) K. A. Hirata. Host Range and Geographic Distribution of the Powdery Mildew Fungi. Jpn. Scientif. Soc. Press, Tokyo. (4) S. T. Koike and G. S. Saenz. Plant Dis. 78:1219, 1994.