Journal articles: 'Position coding'

1

Arnold, Derek H., Michael Thompson, and Alan Johnston. "Motion and position coding." Vision Research 47, no. 18 (August 2007): 2403–10. http://dx.doi.org/10.1016/j.visres.2007.04.025.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Sutherland, Christina J., and David K. Bilkey. "Hippocampal coding of conspecific position." Brain Research 1745 (October 2020): 146920. http://dx.doi.org/10.1016/j.brainres.2020.146920.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Carels, Nicolas, Ramon Vidal, and Diego Frías. "Universal Features for the Classification of Coding and Non-coding DNA Sequences." Bioinformatics and Biology Insights 3 (January 2009): BBI.S2236. http://dx.doi.org/10.4137/bbi.s2236.

Full text

Abstract:

In this report, we revisited simple features that allow the classification of coding sequences (CDS) from non-coding DNA. The spectrum of codon usage of our sequence sample is large and suggests that these features are universal. The features that we investigated combine (i) the stop codon distribution, (ii) the product of purine probabilities in the three positions of nucleotide triplets, (iii) the product of Cytosine, Guanine, Adenine probabilities in 1st, 2nd, 3rd position of triplets, respectively, (iv) the product of G and C probabilities in 1st and 2nd position of triplets. These features are a natural consequence of the physico-chemical properties of proteins and their combination is successful in classifying CDS and non-coding DNA (introns) with a success rate >95% above 350 bp. The coding strand and coding frame are implicitly deduced when the sequences are classified as coding.

APA, Harvard, Vancouver, ISO, and other styles

4

Snell, Joshua, Daisy Bertrand, and Jonathan Grainger. "Parafoveal letter-position coding in reading." Memory & Cognition 46, no. 4 (January 8, 2018): 589–99. http://dx.doi.org/10.3758/s13421-017-0786-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

Shalev, Lilach, Carmel Mevorach, and Glyn W. Humphreys. "Letter position coding in attentional dyslexia." Neuropsychologia 46, no. 8 (July 2008): 2145–51. http://dx.doi.org/10.1016/j.neuropsychologia.2008.02.022.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Henson, Richard N. A. "Coding Position in Short-term Memory." International Journal of Psychology 34, no. 5-6 (October 1999): 403–9. http://dx.doi.org/10.1080/002075999399756.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Harris, Laurence R., and Andrew T. Smith. "The coding of perceived eye position." Experimental Brain Research 187, no. 3 (February 23, 2008): 429–37. http://dx.doi.org/10.1007/s00221-008-1313-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Whitney, Carol, Daisy Bertrand, and Jonathan Grainger. "On Coding the Position of Letters in Words." Experimental Psychology 59, no. 2 (November 1, 2012): 109–14. http://dx.doi.org/10.1027/1618-3169/a000132.

Full text

Abstract:

Open-bigram and spatial-coding schemes provide different accounts of how letter position is encoded by the brain during visual word recognition. Open-bigram coding involves an explicit representation of order based on letter pairs, while spatial coding involves a comparison function operating over representations of individual letters. We identify a set of priming conditions (subset primes and reversed interior primes) for which the two types of coding schemes give opposing predictions, hence providing the opportunity for strong scientific inference. Experimental results are consistent with the open-bigram account, and inconsistent with the spatial-coding scheme.

APA, Harvard, Vancouver, ISO, and other styles

9

Whitney, Carol. "Position-specific effects within the SERIOL framework of letter-position coding." Connection Science 13, no. 3 (September 2001): 235–55. http://dx.doi.org/10.1080/09540090110083659.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Peressotti, Francesca, and Jonathan Grainger. "Letter-position coding in random consonant arrays." Perception & Psychophysics 57, no. 6 (January 1995): 875–90. http://dx.doi.org/10.3758/bf03206802.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Snell, Joshua, and Jonathan Grainger. "Word position coding in reading is noisy." Psychonomic Bulletin & Review 26, no. 2 (February 23, 2019): 609–15. http://dx.doi.org/10.3758/s13423-019-01574-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

12

García-Orza, Javier, and Manuel Perea. "Position Coding in Two-Digit Arabic Numbers." Experimental Psychology 58, no. 2 (November 1, 2011): 85–91. http://dx.doi.org/10.1027/1618-3169/a000071.

Full text

Abstract:

Digit position coding in two-digit Arabic numbers was examined in two masked priming experiments. In Experiment 1, participants had to decide whether the presented stimulus was a two-digit Arabic number (e.g., 67) or not (e.g., G7). Target stimuli could be preceded by a prime which (i) shared one digit in the initial position (e.g., 13-18), (ii) shared one digit but in a different position (83-18), and (iii) was a transposed number (81-18). Two unrelated control conditions, equalized in terms of the distance between primes and targets with the experimental conditions, were also included (e.g., 79-18). Results showed a priming effect only when prime and target shared digits in the same position. Experiment 2 employed a masked priming same-different matching task – a task that has been successfully employed in the literature on letter position coding. Results showed faster response times when prime and target shared digits – including the transposed-digit condition – relative to the control conditions. Thus, the identity of each digit in the early stages of visual processing is not associated with a specific position in two-digit Arabic numbers. We examine the implication of these findings for models of Arabic number processing.

APA, Harvard, Vancouver, ISO, and other styles

13

Jiang Yueyuan, Wang Wenran, Yang Nianzu, and Li Dezhong. "Combination coding control rod position-indicating system." Nuclear Engineering and Design 167, no. 2 (November 1996): 223–27. http://dx.doi.org/10.1016/s0029-5493(96)01291-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Massol, Stéphanie, Jon Andoni Duñabeitia, Manuel Carreiras, and Jonathan Grainger. "Evidence for Letter-Specific Position Coding Mechanisms." PLoS ONE 8, no. 7 (July 2, 2013): e68460. http://dx.doi.org/10.1371/journal.pone.0068460.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Saariluoma, Pertti. "Location Coding in Chess." Quarterly Journal of Experimental Psychology Section A 47, no. 3 (August 1994): 607–30. http://dx.doi.org/10.1080/14640749408401130.

Full text

Abstract:

Whether the chunks used in memorizing chess positions are general and relatively encoded schemata or very precisely coded instances is a problem that has raised some controversy within the psychology of chess skill. As chess research has had a strong impact on expertise research, this problem is important in many areas of skills research other than chess. To resolve it, four experiments were set up. In the experiments it was shown that subjects were better at recalling correctly located non-transposed chunks than transposed chunks, which were similar in structure but incorrectly located on the chessboard. The results imply that the representation of chess-specific patterns in the memory of a chess player contains not only information about the forms of chess-specific patterns, but also about their absolute locations on the chessboard. This provides an explanation for the well-known interaction between skill and type of position and its disappearance in recent experiments by Lories and Saariluoma. It can be argued that the difficulty of recalling random positions is not chiefly caused by the total absence of chunks but by their dislocation.

APA, Harvard, Vancouver, ISO, and other styles

16

Perea, Manuel, Heather Winskel, and Theeraporn Ratitamkul. "On the Flexibility of Letter Position Coding During Lexical Processing." Experimental Psychology 59, no. 2 (November 1, 2012): 68–73. http://dx.doi.org/10.1027/1618-3169/a000127.

Full text

Abstract:

In Indo-European languages, letter position coding is particularly noisy in middle positions (e.g., judge and jugde look very similar), but not in the initial letter position (e.g., judge vs. ujdge). Here we focus on a language (Thai) which, potentially, may be more flexible with respect to letter position coding than Indo-European languages: (i) Thai is an alphabetic language which is written without spaces between words (i.e., there is a degree of ambiguity in relation to which word a given letter belongs to) and (ii) some of the vowels are misaligned (e.g., [Formula: see text]/ε:bn/ is pronounced as /bε:n/), whereas others are not (e.g., [Formula: see text]/a:p/ is pronounced as /a:p/). We conducted a masked priming lexical decision experiment with 3–4 letter Thai words (with vs. without an initial misaligned vowel) in which the prime was: (i) identical to the target, (ii) a nonword generated by transposing the two initial letters of the target, or (iii) a replacement-letter control nonword. Results showed a significant masked transposed-letter priming effect in the initial letter positions, which was similar in size for words with and without an initial misaligned vowel. These findings reflect that: (i) letter position coding in Thai is very flexible and (ii) the nature of the obtained priming effects is orthographic rather than phonological.

APA, Harvard, Vancouver, ISO, and other styles

17

Yakup, Mahire, Wayit Abliz, Joan Sereno, and Manuel Perea. "How is letter position coding attained in scripts with position-dependent allography?" Psychonomic Bulletin & Review 21, no. 6 (July 15, 2014): 1600–1606. http://dx.doi.org/10.3758/s13423-014-0621-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Nguyen Thi, Hong, Yoshikazu Tanaka, Tuyen Vo Thi Minh, and Ham Le Huy. "Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line." Nuclear Science and Technology 8, no. 3 (September 1, 2021): 36–52. http://dx.doi.org/10.53747/jnst.v8i3.72.

Full text

Abstract:

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

APA, Harvard, Vancouver, ISO, and other styles

19

Montpellier, C., Z. Kherrouche, A. Begue, D. Stehelin, and J. Coll. "Rab2nucleotide coding sequence ingallus gallusand its phylogenetic position." DNA Sequence 6, no. 1 (January 1995): 37–39. http://dx.doi.org/10.3109/10425179509074697.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

Rastle, Kathleen, Clare Lally, and Chang H. Lee. "No flexibility in letter position coding in Korean." Journal of Experimental Psychology: Human Perception and Performance 45, no. 4 (April 2019): 458–73. http://dx.doi.org/10.1037/xhp0000617.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Ribot-Ciscar, Edith, Mikael Bergenheim, Frédéric Albert, and Jean-Pierre Roll. "Proprioceptive population coding of limb position in humans." Experimental Brain Research 149, no. 4 (February 7, 2003): 512–19. http://dx.doi.org/10.1007/s00221-003-1384-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

van der Graaff, Marieke C. W., Eli Brenner, and Jeroen B. J. Smeets. "Vector and position coding in goal-directed movements." Experimental Brain Research 235, no. 3 (November 17, 2016): 681–89. http://dx.doi.org/10.1007/s00221-016-4828-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Goebel, R. "Position coding in the visual word form area." Proceedings of the National Academy of Sciences 109, no. 24 (May 29, 2012): 9226–27. http://dx.doi.org/10.1073/pnas.1206648109.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Magne, Pierre, and Yann Coello. "Retinal and extra-retinal contribution to position coding." Behavioural Brain Research 136, no. 1 (October 2002): 277–87. http://dx.doi.org/10.1016/s0166-4328(02)00169-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Cullmann, G., and J. M. Labouygues. "Study of genetic coding 1st-2nd position doublets." Origins of Life and Evolution of the Biosphere 16, no. 3-4 (September 1986): 518. http://dx.doi.org/10.1007/bf02422173.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Fischer, Jason, Nicole Spotswood, and David Whitney. "The Emergence of Perceived Position in the Visual System." Journal of Cognitive Neuroscience 23, no. 1 (January 2011): 119–36. http://dx.doi.org/10.1162/jocn.2010.21417.

Full text

Abstract:

Representing object position is one of the most critical functions of the visual system, but this task is not as simple as reading off an object's retinal coordinates. A rich body of literature has demonstrated that the position in which we perceive an object depends not only on retinotopy but also on factors such as attention, eye movements, object and scene motion, and frames of reference, to name a few. Despite the distinction between perceived and retinal position, strikingly little is known about how or where perceived position is represented in the brain. In the present study, we dissociated retinal and perceived object position to test the relative precision of retina-centered versus percept-centered position coding in a number of independently defined visual areas. In an fMRI experiment, subjects performed a five-alternative forced-choice position discrimination task; our analysis focused on the trials in which subjects misperceived the positions of the stimuli. Using a multivariate pattern analysis to track the coupling of the BOLD response with incremental changes in physical and perceived position, we found that activity in higher level areas—middle temporal complex, fusiform face area, parahippocampal place area, lateral occipital cortex, and posterior fusiform gyrus—more precisely reflected the reported positions than the physical positions of the stimuli. In early visual areas, this preferential coding of perceived position was absent or reversed. Our results demonstrate a new kind of spatial topography present in higher level visual areas in which an object's position is encoded according to its perceived rather than retinal location. We term such percept-centered encoding “perceptotopy”.

APA, Harvard, Vancouver, ISO, and other styles

27

Gang-Ping, Hao, Wu Zhong-Yi, Chen Mao-Sheng, Cao Ming-Qing, Dominique Brunel, Georges Pelletier, Huang Cong-Lin, and Yang Qing. "Single nucleotide polymorphisms of CBF4 locus region of Arabidopsis thaliana correspond to drought tolerance." Chinese Journal of Agricultural Biotechnology 1, no. 3 (December 2004): 181–90. http://dx.doi.org/10.1079/cjb200440.

Full text

Abstract:

AbstractThe levels of drought tolerance and nucleotide polymorphism at the CBF4 locus were examined in a world-wide sample of 17 core accessions of Arabidopsis thaliana. The results showed that different accessions exhibited considerable differences in adaptation to drought stress. Compared with Columbia accession, the frequency of nucleotide polymorphism at the CBF4 locus of 25av, 203av and 244av accessions, including single nucleotide polymorphism (SNP) and insertion/deletion (Indel), was high, on average 1 SNP per 35.8 bp and 1 Indel per 143 bp. No significance in all regions of Tajima's D test indicated that the neutral mutation hypothesis could explain the nucleotide polymorphism in this CBF4 gene region. The higher polymorphism was the result of purification selection. Nucleotide polymorphism in the non-coding region was three times higher than in the coding region. This might indicate a recent relaxation of selection pressures on the non-coding region of CBF4 gene. In the coding region of CBF4, SNP frequency was 1 SNP per 96.4 bp and one non-synonymous mutation was detected from 25av, 203av and 244av accessions: the amino acid variation gly↔val at position 205, caused by the nucleotide variation G↔T at position 1034 (corresponding to the nucleotide at position 19 696 of GenBank accession no. AB015478 as 1). Furthermore, four differential SNPs were discovered in haplotype 6 constituted by 203av, one of them located in the 3′ non-coding region (A↔C at position 1106) and the others in the 5′ non-coding region (A↔G, A↔C and G↔A at positions 27, 129 and 171, respectively). The drought tolerance assay indicated that accession 203av was the best at tolerating water deficiency. We propose that haplotype 6 is consistent with its drought tolerance.

APA, Harvard, Vancouver, ISO, and other styles

28

Fehse, Ursula, Gerd Schmitz, Daniela Hartwig, Shashank Ghai, Heike Brock, and Alfred O. Effenberg. "Auditory Coding of Reaching Space." Applied Sciences 10, no. 2 (January 7, 2020): 429. http://dx.doi.org/10.3390/app10020429.

Full text

Abstract:

Reaching movements are usually initiated by visual events and controlled visually and kinesthetically. Lately, studies have focused on the possible benefit of auditory information for localization tasks, and also for movement control. This explorative study aimed to investigate if it is possible to code reaching space purely by auditory information. Therefore, the precision of reaching movements to merely acoustically coded target positions was analyzed. We studied the efficacy of acoustically effect-based and of additional acoustically performance-based instruction and feedback and the role of visual movement control. Twenty-four participants executed reaching movements to merely acoustically presented, invisible target positions in three mutually perpendicular planes in front of them. Effector-endpoint trajectories were tracked using inertial sensors. Kinematic data regarding the three spatial dimensions and the movement velocity were sonified. Thus, acoustic instruction and real-time feedback of the movement trajectories and the target position of the hand were provided. The subjects were able to align their reaching movements to the merely acoustically instructed targets. Reaching space can be coded merely acoustically, additional visual movement control does not enhance reaching performance. On the basis of these results, a remarkable benefit of kinematic movement acoustics for the neuromotor rehabilitation of everyday motor skills can be assumed.

APA, Harvard, Vancouver, ISO, and other styles

29

Nattkemper, Dieter, and Wolfgang Prinz. "Impact of task demands on spatial stimulis-response compatibility." Zeitschrift für Psychologie / Journal of Psychology 209, no. 3 (July 2001): 205–26. http://dx.doi.org/10.1026//0044-3409.209.3.205.

Full text

Abstract:

Summary. Two experiments explored the impact of task demands on spatial stimulus-response compatibility. Task demands were manipulated to either emphasize stationary or dynamic aspects (positions or movements) in both stimuli and responses. For matched task configurations where the same features are emphasized for stimuli and responses results indicate a strong impact of task requirements on the relative magnitude of position-based vs. direction-based compatibility effects. For unmatched tasks where different features are emphasized in stimuli and responses results suggest that information about movement direction is recoded into position information, specifying the direction of stimulus or response movements in terms of their respective endpoint positions. Further, in some task configurations, an unexpected inverted direction-based compatibility effect was observed which can be explained in terms of referential coding. Referential coding acts to specify the position of a fixed stimulus relative to a moving stimulus, presumably based on an attentional spotlight mechanism.

APA, Harvard, Vancouver, ISO, and other styles

30

Andersen, Richard A., and David Zipser. "The role of the posterior parietal cortex in coordinate transformations for visual–motor integration." Canadian Journal of Physiology and Pharmacology 66, no. 4 (April 1, 1988): 488–501. http://dx.doi.org/10.1139/y88-078.

Full text

Abstract:

Lesion to the posterior parietal cortex in monkeys and humans produces spatial deficits in movement and perception. In recording experiments from area 7a, a cortical subdivision in the posterior parietal cortex in monkeys, we have found neurons whose responses are a function of both the retinal location of visual stimuli and the position of the eyes in the orbits. By combining these signals area 7a neurons code the location of visual stimuli with respect to the head. However, these cells respond over only limited ranges of eye positions (eye-position-dependent coding). To code location in craniotopic space at all eye positions (eye-position-independent coding) an additional step in neural processing is required that uses information distributed across populations of area 7a neurons. We describe here a neural network model, based on back-propagation learning, that both demonstrates how spatial location could be derived from the population response of area 7a neurons and accurately accounts for the observed response properties of these neurons.

APA, Harvard, Vancouver, ISO, and other styles

31

Andrievsky, Boris, and Alexander L. Fradkov. "Adaptive coding for position estimation in formation flight control." IFAC Proceedings Volumes 43, no. 10 (2010): 72–76. http://dx.doi.org/10.3182/20100826-3-tr-4015.00016.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Whitney, D., and D. Bressler. "The precision of position coding in the visual cortex." Journal of Vision 6, no. 6 (March 18, 2010): 107. http://dx.doi.org/10.1167/6.6.107.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Gomez, Pablo, Roger Ratcliff, and Manuel Perea. "The overlap model: A model of letter position coding." Psychological Review 115, no. 3 (2008): 577–600. http://dx.doi.org/10.1037/a0012667.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Whitney, D., H. C. Goltz, C. G. Thomas, and M. A. Goodale. "Flexible retinotopy: Motion dependent position coding in visual cortex." Journal of Vision 3, no. 9 (March 16, 2010): 111. http://dx.doi.org/10.1167/3.9.111.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Ghosna, F. J., and M. J. N. Sibley. "Pulse position modulation coding schemes for optical intersatellite links." Electronics Letters 46, no. 4 (2010): 290. http://dx.doi.org/10.1049/el.2010.3650.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

LEVI, DENNIS M., and STANLEY A. KLEIN. "Limitations on Position Coding Imposed by Undersampling and Univariance." Vision Research 36, no. 14 (July 1996): 2111–20. http://dx.doi.org/10.1016/0042-6989(95)00264-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Yang, Huilan, Debra Jared, Manuel Perea, and Stephen J. Lupker. "Is letter position coding when reading in L2 affected by the nature of position coding used when bilinguals read in their L1?" Memory & Cognition 49, no. 4 (January 19, 2021): 771–86. http://dx.doi.org/10.3758/s13421-020-01126-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

38

Lin, Yizhu, Gemma E. May, Hunter Kready, Lauren Nazzaro, Mao Mao, Pieter Spealman, Yehuda Creeger, and C. Joel McManus. "Impacts of uORF codon identity and position on translation regulation." Nucleic Acids Research 47, no. 17 (August 8, 2019): 9358–67. http://dx.doi.org/10.1093/nar/gkz681.

Full text

Abstract:

Abstract Translation regulation plays an important role in eukaryotic gene expression. Upstream open reading frames (uORFs) are potent regulatory elements located in 5′ mRNA transcript leaders. Translation of uORFs usually inhibit the translation of downstream main open reading frames, but some enhance expression. While a minority of uORFs encode conserved functional peptides, the coding regions of most uORFs are not conserved. Thus, the importance of uORF coding sequences on their regulatory functions remains largely unknown. We investigated the impact of an uORF coding region on gene regulation by assaying the functions of thousands of variants in the yeast YAP1 uORF. Varying uORF codons resulted in a wide range of functions, including repressing and enhancing expression of the downstream ORF. The presence of rare codons resulted in the most inhibitory YAP1 uORF variants. Inhibitory functions of such uORFs were abrogated by overexpression of complementary tRNA. Finally, regression analysis of our results indicated that both codon identity and position impact uORF function. Our results support a model in which a uORF coding sequence impacts its regulatory functions by altering the speed of uORF translation.

APA, Harvard, Vancouver, ISO, and other styles

39

De Leon, Miguel Ponce, Antonio Basilio De Miranda, Fernando Alvarez-Valin, and Nicolas Carels. "The Purine Bias of Coding Sequences is Determined by Physicochemical Constraints on Proteins." Bioinformatics and Biology Insights 8 (January 2014): BBI.S13161. http://dx.doi.org/10.4137/bbi.s13161.

Full text

Abstract:

For this report, we analyzed protein secondary structures in relation to the statistics of three nucleotide codon positions. The purpose of this investigation was to find which properties of the ribosome, tRNA or protein level, could explain the purine bias (Rrr) as it is observed in coding DNA. We found that the Rrr pattern is the consequence of a regularity (the codon structure) resulting from physicochemical constraints on proteins and thermodynamic constraints on ribosomal machinery. The physicochemical constraints on proteins mainly come from the hydropathy and molecular weight (MW) of secondary structures as well as the energy cost of amino acid synthesis. These constraints appear through a network of statistical correlations, such as (i) the cost of amino acid synthesis, which is in favor of a higher level of guanine in the first codon position, (ii) the constructive contribution of hydropathy alternation in proteins, (iii) the spatial organization of secondary structure in proteins according to solvent accessibility, (iv) the spatial organization of secondary structure according to amino acid hydropathy, (v) the statistical correlation of MW with protein secondary structures and their overall hydropathy, (vi) the statistical correlation of thymine in the second codon position with hydropathy and the energy cost of amino acid synthesis, and (vii) the statistical correlation of adenine in the second codon position with amino acid complexity and the MW of secondary protein structures. Amino acid physicochemical properties and functional constraints on proteins constitute a code that is translated into a purine bias within the coding DNA via tRNAs. In that sense, the Rrr pattern within coding DNA is the effect of information transfer on nucleotide composition from protein to DNA by selection according to the codon positions. Thus, coding DNA structure and ribosomal machinery co-evolved to minimize the energy cost of protein coding given the functional constraints on proteins.

APA, Harvard, Vancouver, ISO, and other styles

40

da Silva, J. I., R. Holz, and ASB Sombra. "Soliton transmission under pulse position modulation in optical fibres." Canadian Journal of Physics 77, no. 6 (October 1, 1999): 481–90. http://dx.doi.org/10.1139/p99-042.

Full text

Abstract:

A new optical pulse train configuration that may propagate with high stability, in normal and anomalous dispersion regimes,in optical fibres is proposed and simulated using pulse position modulation (PPM) coding. The high stability is achieved by simultaneous propagation of two infinite and periodic trains of bright pulses in normal and anomalous dispersion regimes (solitons) in a single-mode optical fibre. This configuration could lead to transmission velocities around 300 Gb/s with good stability under PPM coding. PACS No.: 78.00

APA, Harvard, Vancouver, ISO, and other styles

41

Høeg Müller, Henrik. "Lexical coding vs. syntactic marking of homogeneity." Studies in Language 38, no. 4 (December 8, 2014): 896–955. http://dx.doi.org/10.1075/sl.38.4.12mul.

Full text

Abstract:

The purpose of this article is to substantiate the claim that the semantic feature of homogeneity manifests itself differently in different languages. By contrasting data from Spanish and Danish it is shown that homogeneity is lexically coded in Danish nouns, whereas Spanish nouns are lexically neutral to homogeneity. In Spanish the homogeneity interpretation of nouns is determined when they are inserted into a syntactic structure. The empirical relevance of this assumption is assessed by investigating syntactic and semantic aspects related to the occurrence of bare nominals in object position in the two languages under scrutiny. It is well-known that Spanish as a canonical pattern does not semantically license bare singular nouns with count interpretation (BNs) in object position, viz. #Juan repara coche [Juan repairs car], while in Danish the occurrence of BNs in object position is both possible and normal, viz. Ole maler hus [Ole paints house]. It is argued that this contrast is a predictable consequence of the premise that, in Spanish, transitive activity verbs impose a mass reading on any bare object noun whereas, in Danish, BNs maintain their lexically encoded denotation as inhomogeneous entities. However, contrasting with the leading pattern, the so-called HAVE-verbs (Borthen, 2003) actually license Spanish BNs in object position (cf., e.g., Espinal, 2010; Espinal & Mcnally, 2011), viz. Juan tiene perro [Juan has dog]. It is claimed that the occurrence of BNs in these cases is strongly related to the assumption that HAVE-verbs, contrary to activity verbs, are functionally non-eventive and, therefore, do not impose a specific homogeneity reading on the bare noun in object position.

APA, Harvard, Vancouver, ISO, and other styles

42

Bosbach, Simone, Wolfgang Prinz, and Dirk Kerzel. "Is Direction Position? Position- and Direction-Based Correspondence Effects in Tasks with Moving Stimuli." Quarterly Journal of Experimental Psychology Section A 58, no. 3 (April 2005): 467–506. http://dx.doi.org/10.1080/02724980443000016.

Full text

Abstract:

Five experiments were carried out to test whether (task-irrelevant) motion information provided by a stimulus changing its position over time would affect manual left–right responses. So far, some studies reported direction-based Simon effects whereas others did not. In Experiment 1a, a reliable direction-based effect occurred, which was not modulated by the response mode—that is, by whether participants responded by pressing one of two keys or more dynamically by moving a stylus in a certain direction. Experiments 1a, 1b, and 2 lend support to the idea that observers use the starting position of target motion as a reference for spatial coding. That is, observers might process object motion as a shift of position relative to the starting position and not as directional information. The dominance of relative position coding could also be shown in Experiment 3, in which relative position was pitted against motion direction by presenting a static and dynamic stimulus at the same time. Additionally, we explored the role of eye movements in stimulus–response compatibility and showed in Experiments 1b and 3a that the execution or preparation of saccadic eye movements—as proposed by an attention-shifting account—is not necessary for a Simon effect to occur.

APA, Harvard, Vancouver, ISO, and other styles

43

Gan, Ling, and Yang Xiao. "Knowledge Base Question Answering Based on Multi-head Attention Mechanism and Relative Position Coding." Journal of Physics: Conference Series 2203, no. 1 (February 1, 2022): 012056. http://dx.doi.org/10.1088/1742-6596/2203/1/012056.

Full text

Abstract:

Abstract Most current knowledge base question answering models mainly use RNN and its various derivative versions such as BiLSTM to model the problem, which limits Parallel computing capabilities of the model. In response to this problem, we try to use TransformerEncoder instead of BiLSTM to model and encode the problem, and hope to improve the parallel computing efficiency of the model. At the same time, to solve the problem of insufficient relative position information obtained by using absolute position coding in TransformerEncoder, it is proposed to use relative position coding instead of absolute position coding. According to the experimental results, our model effectively reduces a certain amount of training time and has achieved certain results on the WebQuestions benchmark data set.

APA, Harvard, Vancouver, ISO, and other styles

44

Tong, F., and D. J. Kim. "Transformation from position-specific to position-invariant coding of objects across the human visual pathway." Journal of Vision 5, no. 8 (September 1, 2005): 91. http://dx.doi.org/10.1167/5.8.91.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Kumar, Sudhir. "Patterns of Nucleotide Substitution in Mitochondrial Protein Coding Genes of Vertebrates." Genetics 143, no. 1 (May 1, 1996): 537–48. http://dx.doi.org/10.1093/genetics/143.1.537.

Full text

Abstract:

Abstract Maximum likelihood methods were used to study the differences in substitution rates among the four nucleotides and among different nucleotide sites in mitochondrial protein-coding genes of vertebrates. In the lst+2nd codon position data, the frequency of nucleotide G is negatively correlated with evolutionary rates of genes, substitution rates vary substantially among sites, and the transition / transversion rate bias (R) is two to five times larger than that expected at random. Generally, largest transition biases and greatest differences in substitution rates among sites are found in the highly conserved genes. The 3rd positions in placental mammal genes exhibit strong nucleotide composition biases and the transitional rates exceed transversional rates by one to two orders of magnitude. Tamura-Nei and Hasegawa-Kishino-Yano models with gamma distributed variable rates among sites (gamma parameter, α) adequately describe the nucleotide substitution process in 1st+2nd position data. In these data, ignoring differences in substitution rates among sites leads to largest biases while estimating substitution rates. Kimura's two-parameter model with variable-rates among sites performs satisfactorily in likelihood estimation of R, α, and overall amount of evolution for lst+2nd position data. It can also be used to estimate pairwise distances with appropriate values of α for a majority of genes.

APA, Harvard, Vancouver, ISO, and other styles

46

Carels, Nicolas, and Diego Frías. "Classifying Coding DNA with Nucleotide Statistics." Bioinformatics and Biology Insights 3 (January 2009): BBI.S3030. http://dx.doi.org/10.4137/bbi.s3030.

Full text

Abstract:

In this report, we compared the success rate of classification of coding sequences (CDS) vs. introns by Codon Structure Factor (CSF) and by a method that we called Universal Feature Method (UFM). UFM is based on the scoring of purine bias (Rrr) and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i) the stop codon distribution, (ii) the product of purine probabilities in the three positions of nucleotide triplets, (iii) the product of Cytosine (C), Guanine (G), and Adenine (A) probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv) the probabilities of G in 1st and 2nd position of triplets and (v) the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives) of Homo sapiens (>250 bp), Drosophila melanogaster (>250 bp) and Arabidopsis thaliana (>200 bp) are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

APA, Harvard, Vancouver, ISO, and other styles

47

Zhang, Fan, Hengjun Zhu, Kan Bian, Pengcheng Liu, and Jianhui Zhang. "Absolute Position Coding Method for Angular Sensor—Single-Track Gray Codes." Sensors 18, no. 8 (August 19, 2018): 2728. http://dx.doi.org/10.3390/s18082728.

Full text

Abstract:

Single-track Gray codes (STGCs) is a type of absolute position coding method for novel angular sensors, because it has single-track property over traditional Gray codes and mono-difference over linear feedback shift register codes. However, given that the coding theory of STGCs is incomplete, STGC construction is still a challenging task even though it has been defined for more than 20 years. Published coding theories and results on STGCs are about two types of STGC, namely, necklace and self-dual necklace ordering, which are collectively called as k-spaced head STGCs. To find a new code, three constraints on generating sequences are proposed to accelerate the searching algorithm, and the complete searching result of length-6 STGCs is initially obtained. Among the entire 132 length-6 STGCs, two novel types of STGCs with non-k-spaced heads are found, and the basic structures of these codes with the general length n are proposed and defined as twin-necklace and triplet-necklace ordering STGCs. Furthermore, d-plet-necklace ordering STGC, which unifies all the known STGCs by changing the value of d, is also defined. Finally, a single-track absolute encoder prototype is designed to prove that STGCs are as convenient as the traditional position coding methods.

APA, Harvard, Vancouver, ISO, and other styles

48

Yang, Jiang-feng, Zheng Ma, and Mei Xie. "Multiscale Spatial Position Coding under Locality Constraint for Action Recognition." Journal of Electrical Engineering and Technology 10, no. 4 (July 1, 2015): 1851–63. http://dx.doi.org/10.5370/jeet.2015.10.4.1851.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Janssen, P., S. Srivastava, S. Ombelet, and G. A. Orban. "Coding of Shape and Position in Macaque Lateral Intraparietal Area." Journal of Neuroscience 28, no. 26 (June 25, 2008): 6679–90. http://dx.doi.org/10.1523/jneurosci.0499-08.2008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Whitney, D. "Flexible Retinotopy: Motion-Dependent Position Coding in the Visual Cortex." Science 302, no. 5646 (October 31, 2003): 878–81. http://dx.doi.org/10.1126/science.1087839.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Position coding'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles