Academic literature on the topic 'Polyfenoles'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Polyfenoles.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Polyfenoles"
1
Supriyo, Edy, and Isti Pudjihastuti. "Konsentrasi Polyfenol pada Teh Hitam Celup Komersial Produksi Perkebunan Teh di Jawa Tengah." METANA 17, no. 2 (December 1, 2021): 55–60. http://dx.doi.org/10.14710/metana.v17i2.41776.
Full textAbstract:
Teh merupakan minuman yang dihasilkan dari pucuk daun tanaman Camellia sinensis yang tumbuh di pegunungan pada ketinggian 600–2500 m dpl. Teh hitam merupakan jenis teh yang banyak dikonsumsi masyarakat Indonesia. Teh ini diproduksi dengan cara fermentasi melalui proses oksidasi enzimatis katekin oleh polifenol oksidase. Teh hitam yang dikemas dalam bentuk the celup banyak digemari konsumen. Tujuan dari penelitian ini mengetahui konsentrasi polyfenol dalam teh hitam celup komersial. Sampel teh hitam celup komersial dengan merk dagang TP, TDT, TB, TL, TD, dan TM diproduksi oleh enam perkebunan teh di Jawa Tengah yang diperoleh secara acak dari swalayan di Kota Semarang. Kandungan polyfenol pada sampel teh hitam celup dianalisa dengan menggunakan spetrofotometer UV-Vis pada panjang gelombang 725nm. Hasil penelitian menunjukkan bahwa teh hitam celup komersial yang beredar di Kota Semarang telah memenuhi standard SNI 3753–2014, dengan rata-rata konsentrasi polyfenol 8,83-43,63 %b/b. Analisa Zscore menunjukkan tidak ada perbedaan yang sangat nyata antar konsentrasi polyfenol di enam sampel teh hitam celup komersial, hal ini dimungkinkan dengan adanya standarisasi proses produksi teh hitam di berbagai industri teh di Indonesia. Dan teh hitam celup komersial TDT mempunyai konsentrasi polyfenol diatas rata-rata yaitu 43,63 % b/b. Tea is a drink produced from the leaves of the Camellia sinensis plant that thrives in the mountains at an altitude of 600–2500 m above sea level. Black tea is a type of tea that is widely consumed by Indonesian people. Black tea is produced by fermentation, namely the process of enzymatic oxidation of catechins by polyphenol oxidase. Black tea is produced in several packages, including as black tea bags. The purpose of this study was to determine the concentration of polyphenols in commercial black tea bags. Samples of commercial black tea bags with the trademarks TP, TDT, TB, TL, TD, and TM were produced by six tea plantations in Central Java which were obtained randomly from supermarkets/stores in Semarang City. The polyphenol content in black teabag samples was analyzed using a UV-Vis spectrophotometer at a wavelength of 725nm. The results showed that the commercial black tea bags marketed in the Semarang City had met the standards of SNI 3753–2014, with an average polyphenol concentration of 8.83-43.63% w/w. The Zscore analysis showed that there was no significant difference between the concentrations of polyphenols in the six samples of commercial black tea bags, this may cause by the standardization of black tea production processes in various tea industries in Indonesia, but commercial black tea bags with the trademark TDT had polyphenol concentrations above the average is 43.63% w/w.
2
BOUŠOVÁ, P., J. ŠROGL, J. FAMĚRA, and K. KOSAŘ. "Study of Solubility of Malt Polyphenols." Kvasny Prumysl 44, no. 2 (February 1, 1998): 43–45. http://dx.doi.org/10.18832/kp1998004.
Full text
3
MIKYŠKA, Alexandr, and Marie JURKOVÁ. "Summary Evaluation of bitter acids and polyphenols content in Czech hops harvest in 2013 - I: Contents of α- and β-Bitter Acids." Kvasny Prumysl 60, no. 7-8 (July 1, 2014): 191–97. http://dx.doi.org/10.18832/kp2014019.
Full text
4
ZLOCH, Z. "Biological activity of plant polyphenols in beverages." Kvasny Prumysl 40, no. 9 (September 1, 1994): 266–70. http://dx.doi.org/10.18832/kp1994018.
Full text
5
Syukur, Sumaryati, Zozy Aneloi N, and Femilya Putri. "TRANSFORMASI Agrobakterium rhizogenese DAN INDUKSI AKAR RAMBUT PADA TANAMAN KAKAO (Theobroma cacao) UNTUK PRODUKSI SENYAWA ANTIOKSIDAN SECARA INVITRO." Jurnal Riset Kimia 2, no. 2 (February 12, 2015): 156. http://dx.doi.org/10.25077/jrk.v2i2.156.
Full textAbstract:
ABSTRACT Transformation of Ri T-DNA Plasmid Agrobacterium rhizogenese to varieties Theobroma cacao variety TSH which is growing in west Sumatra and induction of hairy roots in order to produce bioflavonoid antioxidant compounds such as, catechin, polyfenol, or monomer and oligomer flavones was successfully obtained. Three spesies of A.rhizogenese (A4,LBA 9457 and ATTCC 15834) originaly from LIPI was used to transform Ri T-DNA plasmid in MS medium via cacao embryo culture. The aim of this paper is to determine the affectivity and ability of the three species of bacterial above to produce hairy roots in cacao invitro culture. The statistical methods RAL was uses with 4 time treatments and 6 time repeated experiments. As treatment was bacterial inoculation and without inoculation as a control. The transformation result shows 2 of 3 of bacterial species have ability to induce hairy roots of.T cacao embryos counting by percentages of explants with producing hairy roots 16.66% for A4, 83.33% for LBA 9547 spesies.qualitative test of polyfenol from hairy roots transformants give (+4) as compared to non transform only (+1). Cathechin compound was determined by spectrophotometer as much as 0.1% for non transform and 0.87 % for hairy roots transformants by LBA 9547. Conformation of plasmid Ri T-DNA hairy roots from two transformants was analysis by PCR methods. The two primers rol B1 (52ATGGATCCCAAATTGCTTCCCCCACGA32) dan rol B2 (53 TTAGG CTTTCATTCGGGTTTACTGCAGC 33) was used. For TR-DNA the primes used is TRI (53 GGAAATTGTGGCGTTGTTGTGGAC 3’) and TR2 (5’ AATCGTTCAGAGAGCGTCCGA AGTT 3’) . PCR analysis of DNA electrophoresis founded the band of TL region at 780 bp and TR at 1600 bp using DNA Ledder as DNA standard. Keywords : transformation A.rhizogenese, PCR, Theobroma cacao, kultur embrio, kultur akar rambut, metabolit sekunder, cathechin
6
ŠAVEL, Jan. "Prooxidant and antioxidant role of reductones and polyphenols in beer." Kvasny Prumysl 50, no. 10 (October 1, 2004): 291–97. http://dx.doi.org/10.18832/kp2004019.
Full text
7
DVOŘÁKOVÁ, Markéta, Pavel DOSTÁLEK, and Petr HULÍN. "Analytical Methods for Determination of Polyphenols in Sweet Wort, Wort and Beer." Kvasny Prumysl 52, no. 4 (April 1, 2006): 111–14. http://dx.doi.org/10.18832/kp2006010.
Full text
8
DVOŘÁKOVÁ, Markéta, Pavel DOSTÁLEK, Zuzana SKULILOVÁ, Marie JURKOVÁ, Vladimír KELLNER, and Luis F. GUIDO. "Barley and malt polyphenols and their antioxidant properties." Kvasny Prumysl 56, no. 3 (March 1, 2010): 160–63. http://dx.doi.org/10.18832/kp2010022.
Full text
9
JELÍNEK, Lukáš, Monika DOLEČKOVÁ, Tereza HUDCOVÁ, Marcel KARABÍN, and Pavel DOSTÁLEK. "Profilling of czech hop varieties by means of analyses of α- and β-bitter acids, essential oils and polyphenols." Kvasny Prumysl 57, no. 7-8 (July 1, 2011): 272–76. http://dx.doi.org/10.18832/kp2011031.
Full text
10
LENKOV�, Marianna, Judita Bystrick�, Tom� T�th, and Miroslava HRSTKOV�. "Evaluation and comparison of the content of total polyphenols and antioxidant activity of selected species of the genus Allium." Journal of Central European Agriculture 17, no. 4 (2016): 1119–33. http://dx.doi.org/10.5513/jcea01/17.4.1820.
Full textDissertations / Theses on the topic "Polyfenoles"
1
Haidarian, Behroz, and Christina Lidborg. "Extraktion av polyfenoler från pressrester av röda vindruvor." Thesis, Högskolan i Borås, Institutionen Ingenjörshögskolan, 2011. http://urn.kb.se/resolve?urn=urn:nbn:se:hb:diva-20414.
Full textAbstract:
Antioxidanter är kemiska ämnen som är kapabla till att förhindra oxidation av andra molekyler. Dessa ämnen återfinns i djur- och växtriket och tycks ha en skyddande effekt på cellvävnad genom att motverka skadliga oxidativa reaktioner. Antioxidanter används bland annat industriellt som tillsater i livsmedel och andra produkter i syfte att förhindra oxidativ degradering och bibehålla näringsvärdet i livsmedel. I vindruvor återfinns höga koncentrationer av naturliga antioxidanter, främst i form av fenoliska ämnen. På grund av att vinindustrin bidrar till stora mänger avfall, främst i form av druvrester, är det önskevärt att hitta en effektiv metod för att återvinna fenoliska antioxidanter från avfallet.I detta arbete användes lösningsmedel-extraktion för att extrahera fenoliska ämnen från pressrester av röda vindruvor av varianten Tempranillo. Syftet var att uvärdera effekterna av extraktionsmetod, typ av lösningsmedel, extraktionstemperatur samt extraktionstid på fenol-innehåll och antioxidant aktivitet i extrakten. Två typer av extraktionsmetoder jämfördes; Soxhlet-extraktor och direkt-kontakt-extraktion (DCE), samt tre olika lösningsmedel; en blandning av etanol och vatten (1:1), ren etanol samt etyl acetat. Koncentrationen av fenoliskt innehåll i extrakten erhölls med hjälp av Folin-Ciocalteu's metod, och antioxidant aktivetet med FRAP (Ferric reducing ability of plasma) metoden.Utifrån erhållna data kunde det ses att extraktion med en blandning av etanol och vatten (1:1) som lösningsmedel gav högst fenolisk koncentration och antioxidant aktivitet för alla testade parametrar, medans etyl acetat gav de lägsta värdena. Soxhlet-extraktorn visade sig vara den bästa metoden då den gav högre värden i extrakten jämfört med DCE metoden. För DCE metoden kunde det ses att en extraktionstid på 2½ timmar vid 55 grader var mest optimalt då etanolbaserade lösningsmedel användes.Program: Högskoleingenjörsutbildning i kemiteknik
2
Critén, Sladjana. "POLYFENOLER, VITAMINER OCH PARODONTALA SJUKDOMAR - en systematisk litteraturstudie." Thesis, Malmö högskola, Odontologiska fakulteten (OD), 2012. http://urn.kb.se/resolve?urn=urn:nbn:se:mau:diva-19866.
Full textAbstract:
Syftet med denna systematiska litteraturöversikt var att utreda om det finns stöd i litteraturen avseende vilken betydelse kostens innehåll av polyfenoler och vitaminer kan ha för parodontala sjukdomar. Material och metod: En sökning i PubMed gjordes i mars 2012. Sökningen begränsades till humana studier på engelska och publicerade mellan januari 1990 och mars 2012. Kriterier för inkludering var: “randomized controlled trial”, “clinical controlled trial”, “clinical trial” och “”humans. Referenslistorna i de selekterade studierna granskades för att finna ytterligare studier som kunde inkluderas i analysen.Resultat: Femton studier identifierades som relevanta för syftet och som uppfyllde inklusionskriterierna. Fem av dessa behandlade polyfenolers effekt på parodontit och resultaten av dessa indikerar att polyfenoler kan påverka parodontal sjukdom. Till exempel rapporteras reducerad blödning vid sondering (BOP) och fickdjupsreducering. Fem studier studerade effekten av vitamin D. Man fann en förbättrad effekt på bennivån om vitamin D tillskottet kombinerades med kalcium. Två studier undersökte effekten av vitamin C och konstaterade att parodontal sjukdom var associerad med minskad nivå av total antioxidativ kapacitet samt med reducerad blödning. Tillskott av vitamin B – komplex resulterade i bättre läkning efter parodontal operation och multivitamintillskott resulterade i reducerad BOP och fickdjupsreducering.Slutsatsen av denna litteraturöversikt är att kunskapen avseende kostens innehåll av polyfenoler och vitaminers påverkan på parodontala sjukdomar och/eller effekten av kosttillskott på läkningen efter parodontal behandling är begränsad och att mycket forskning krävs för att några mera långtgående slutsatser kan dras.Objective of this systematic literature review was to investigate whether there is support in the literature regarding the role of dietary content of polyphenols and vitamins may have for periodontal diseases.Material and methods: A PubMed search was performed in March 2012 to identify appropriate studies. The search was limited to studies published in English between January 1990 and March 2012. For studies on the effects of polyphenols and vitamins on periodontal diseases the search was limited to studies in humans. The search was limited to: “randomized controlled trial”, “clinical controlled trial” “clinical trial” and “humans”. Additionally the reference lists of selected articles were hand searched for the possible inclusion of additional references.Results: Fifteen studies were identified as relevant to the purpose and fulfilling inclusion criteria. Five clinical studies treated the effects of polyphenols on periodontitis and results indicate that polyphenols can affect the periodontal disease. For example reduced bleeding on probing (BOP) and pocket depth (PPD) reduction was reported. Five studies were found evaluating the effect of vitamin D on periodontal disease. It was concluded that the best effect to reduce periodontal disease was observed if vitamin D supplementation was combined with calcium. Two studies looked at the effect of vitamin C on periodontitis and demonstrated that periodontal disease was associated with decreased level of the total antioxidant capacity (TAOC) and reduced bleeding on probing (BOP) after treatment with vitamin C. Vitamin B – complex supplementation resulted in improved healing after periodontal surgery and multivitamin supplements reduced BOP and PPD.Conclusion: Knowledge concerning dietary content of polyphenols and vitamins effect on periodontal diseases and/or the effect of supplements on the healing after periodontal treatment is limited and that much research is needed to some far-reaching conclusions can be drawn.
3
Dostálová, Blanka. "Stanovení celkového obsahu bílkovin, polyfenolů a sacharidů v pivu." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2016. http://www.nusl.cz/ntk/nusl-240548.
Full textAbstract:
This master‘s thesis deals with the analysis of 65 different beers, with a focus on finding differences between Czech tap ales, lagers Czech, Czech special beers and foreign beers. Czech beers were compared by the results of analysis among beers bearing the indication "Czech beer" and the group without this indication. The total amount of proteins, polyphenols and carbohydrates was determined using UV-VIS spectrometry. The history of brewing, the nature and types of Czech beers and protected geographical indication "Czech beer" were described. Raw materials for beer production and brewing technology have been listed and described. In the last part of the research, components of beer and the principle of the UV-VIS spectrometry have been specified. Th determination of total protein was performed using Hartree-Lowry method, which is based on two-component reagent. The first component is the biuret agent, the second component is the Folin-Ciocalteau reagent for phenols. Determination of the polyphenols has been carried out by the Folin-Ciocalteau reagent and total carbohydrates were determined spectrophotometrically according to the Analytica EBC using anthron agent. The results were statistically processed and evaluated in the final part.
4
Pařilová, Kateřina. "Studium vybraných aktivních látek v českém pivu." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2009. http://www.nusl.cz/ntk/nusl-216475.
Full textAbstract:
The aim of this work was to study phenolics and other active compounds in 22 kinds of lager beer and especially to find some differences between Czech beer and beers made in foreign countries. In theoretical part the most useful methods for phenolic and protein analysis are discussed. Further, basic steps of brewery technology are introduced and main beer components with regard to Czech beer specificity are presented. Analysis of total phenolics, total flavonoids, antioxidant activity and most of basic technological characteristics was performed spectrophotometrically. To identification and quantitative analysis of individual phenolics on-line liquid chromatography with photo-diode array (PDA) and mass spectrometry (MS) detection was used. Protein analysis was performed by vertical electrophoresis SDS-PAGE and by Experion microfluidic electrophoresis (BioRad). From the total of 22 samples, 15 Czech beers and 7 beers of foreign marks were enrolled into this study. In these samples levels of brewery characteristics, group antioxidants and individual phenolics were compared. Flask and can beers as well as alcoholic and non-alcoholic beers were compared too. As a model comparative sample the Czech hop of Sládek variety was used. Finally, usefulness of tested parameters to differentiation composition and technology of individual beer samples was evaluated and parameters suitable for Czech beer authenticity analysis were proposed.
5
Měřínská, Radana. "Analýza flavonoidů v pivu metodou LC-MS." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2010. http://www.nusl.cz/ntk/nusl-216608.
Full textAbstract:
Presented diploma thesis is focused on analysis of phenolic compounds in various types of beers. The aim of this work was to find possible differences among several types of beers and also between Czech beers and beers of foreign production. Theoretical part contains detailed description of beer technology, review of important analytical methods for determination of phenolic compounds and total antioxidant activity. The main attention is focused on instrumental technique LC/MS. In the experimental part values of total phenolics and total flavonoids and results of antioxidant status in analyzed beers were determined spectrophotometrically. Basic brewing characteristics were determined by pycnometry. On-line liquid chromatography with photo diode array detection and mass spectrometry detection was used for identification and quantification of individual phenolic compounds. Spectrophotometric analysis of phenolic and flavonoid levels seems to be less specific, that is consistent with findings in accessible literature. It was proved, that iso- bitter compounds exhibit about 65.44 – 90.93 % of the total bitter substances. These components are responsible for the main part of beer bitterness. The HPLC/PDA/ESI-MS was necessary to use for determination of characteristic phenolic compounds in individual types of beer. Within our measurement three columns were tested, the most favourable results were obtained using the column Restek C18. When compared with foreing beers, in Czech beers higher level of majority of phenolic compounds was detected and specific distribution of individual derivatives was found as well.
6
Omerdic, Nermina. "Syreupptag i öl vid filtrering med kiselgur." Thesis, Linnéuniversitetet, Institutionen för kemi och biomedicin (KOB), 2019. http://urn.kb.se/resolve?urn=urn:nbn:se:lnu:diva-82520.
Full textAbstract:
Öl är en dryck som i ökande grad framställs av mindre bryggerier. För bryggarna är ett av målen att producera öl med så lång hållbarhet och en så jämn kvalitet som det är möjligt utifrån resurser, ekonomi och engagemang. En av svårigheterna vid ölbryggning är oönskad förekomst av syre efter jäsning. Syre i produkten kan förstöra ölets karaktär och ge upphov till oönskade smakämnen. Det här projektet har handlat om att mäta koncentrationen löst syre(O2) i öl efter filtrering med kiselgur och med några olika metoder försöka minimera syreupptag under filtreringsprocessen. Detta för att säkerställa god kvalitet på Nils Oscars öl. Resultatet visar på att det finns skillnad i syrekoncentrationen i alla ölsorter när metoderna med kallt- och varmt förträngningsvatten har använts samt när koldioxidgenombubblingen tillförts i kiselgurublandaren. Det skulle behöva ses över på andra delar av bryggeriprocessen för att utesluta syrekontakt med öl genom att kontrollera ventiler, rör, ledningar för att försäkra sig om att syretillförsel inte sker. Det finns också åtgärder under filtreringen som skulle behöva förbättras. Om varmare vatten används i produktionen och koldioxid tillsätts i kiselgurblandaren kommer det att minska syrekoncentrationen i filtrerad öl.Beer is a drink that increasingly is produced in smaller brewers. For the brewers the most important is to make the beer long lasting, and that requires resources, economy and commitment. Many things can go wrong when making beer, and one concern is the oxygen levels in beer that can change its taste and character and produce off flavors that are not wanted in the product. In this project the levels of oxygen was measured in the beer after filtration with kisel- gur, and using different methods attempting to minimize oxygen uptake during the filtering process to insure a good quality of Nils Oscars beer. The results showed that there are differences in oxygen levels between all beer types when using the three methods with cold- and hot water as a narrowing water and using carbon dioxide in the kiselgur mixer. It would be necessary to lock at other parts of the brewing process to exclude oxygen contact with beer. By ensuring valves, pipes and lines, quality of the equipment, and exclude any contact with oxygen. There are workarounds during filtration that can be improved. Like using hot water for a longer time. It would also need a stable and prolonged solution for induction of carbon dioxide to bubble in the kiselgur mixer. The induction of carbon dioxide has been shown to minimize oxygen pick up in filtrated beer.
7
Jelénková, Zuzana. "Stanovení aktivních látek v medu." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2008. http://www.nusl.cz/ntk/nusl-216227.
Full textAbstract:
This diploma thesis was focused on biologically active compounds determination. 26 samples of honey, one sample of propolis and one sample of royal jelly were analyzed. Honey were harvested in year 2006 and 2007 and bought in retail chain, special shops and directly from bee-keeper. Samples were analyzed by titration, spectrofotometry, LC/MS and RP-HPLC methods. The study was focused on analysis of antioxidants. Followed groups of antioxidants were determined: flavonoids, catechins, carotenoids, vitamins E, C, A. Authenticity of quality was determined by hydroxymethylfurfural analysis. Average values of total antioxidant capacity ranged (12.75-137.49) mmol .100 g-1. Average values of total phenolic ranged (8.51-61.34) mg .100 g-1 and average values of total flavonoids ranged (0.75-6.04) mg .100 g-1. Honey samples contained (41.83-585.10) g .100 g-1 of rutin, (9.30-313.40) g .100 g-1 of myricetin, (6.5-171.90) g .100 g-1 of luteolin, (3.19-436.37) g .100 g-1 of quercetin, (2.10-242.66) g .100 g-1 of apigenin, (0.15-105.12) g .100 g-1 of caempferol and (0.07-17.52) mg .100 g-1 of naringenin. From group of catechins there were measured (5.98-310) g .100 g-1 of catechin, (17.77-486.29) g .100 g-1 of epicatechin, (0.18-64.90) g .100 g-1 of catechin gallate and (0.59-140.56) g .100 g-1 of epicatechin gallate. From lipophilic compounds the most abundant in honey samples was tocopherol, its value ranged (29.20-8531.17) g .100 g-1. Content of ascorbic acid ranged (0.65-4.65) mg .100 g-1. Content of hydroxymethyl.furfural. ranged (0.26-4.06) mg .100 g-1. By LC/MS method luteolin, naringenin, protocatechin acid, coffee acid and p-cumaric acid in honeydew were detected and, furthermore, kyanidin and pinocembrin in floral honey were found. Mono-floral honey contained biologically active compounds the most, imperceptibly less contained multi-floral honey and honeydew honey. Acacia honey contained the lowest amount of biologically active compounds.
8
Trčková, Marie. "Využití metody LC/MS k analýze vybraných přírodních fyziologicky aktivních látek." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2008. http://www.nusl.cz/ntk/nusl-216232.
Full textAbstract:
Presented work is focused on application of combined instrumental method RP-HPLC/ESI-MS in analysis of several groups of natural compounds with positive physiological activities. Especially some antioxidants were studied in commonly and abundantly consumed food. Moreover some other substances than standard compounds were observed in complex dies. In conclusion the HPLC/ESI-MS method is comparatively advantageous in phenolic analysis, while another type of ionisation would be used in case of carotenoid compound.
9
Smělá, Margita. "Stanovení některých nutričních faktorů ve vybraných druzích ovoce." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2011. http://www.nusl.cz/ntk/nusl-216776.
Full textAbstract:
Diploma thesis is concerned with determination of some nutrion factors and vitamin C in various cultivars of apples (Pirus Malus, L.) and quinces (Cydonia oblonga, Mill.). In theoretical part there are described general characterization in selected kinds of fruits, their medically significant sunstances and utilization of these fruits. Main focus is paid to vitamin C. There are described its chemical properties and effect for human health. Various methods for determination of some nutrion factors with focus on determination of vitamin C by high-performance liquid chromatography. In experimental part, total of 27 various cultivars of aplles and 16 various cultivars of quinces were analyzed. These cultivars are from grower station Faculty of garden of Mendel university. For determitation vitamin C was used by high-performance liquid chromatography. Vitamin C was determination as an ascorbic acid. Some nutrion factors were analyzed in experimental part. There were analyzed dry matter, total flavonoids, total phenolics and titratable acid in various cultivars of apples and quinces. There were compared of some various cultivars after representation and content of significant substances as result. The last part of thesis was sensory analysis of apples.
10
Kurzová, Pavlína. "Izolace antibakteriálních sloučenin z kávové sedliny." Master's thesis, Vysoké učení technické v Brně. Fakulta chemická, 2020. http://www.nusl.cz/ntk/nusl-433498.
Full textAbstract:
Coffee grounds are one of the very valuable lignocellulosic wastes that have been able to be processed and used for isolated phenolic substances. Many phenolic substances isolated from lignocellulosic wastes have antimicrobial properties. Aim of this thesis is isolation phenolic substances from spent coffee grounds extract and their available antimicrobial properties. Two isolation ways were applied to receive phenolic substances from spent coffee grounds: 1) solvent extraction (hexane, 75% ethanol, 70% acetone, diethyl ether, and ethyl acetate) and 2) release of active substances by alcoholic fermentation. All isolated materials were characterized by the viewpoint of concentration of reducing sugars, polyphenols and flavonoids. Subsequently, their antimicrobial activity was determined by using agar diffusion and broth dilution methods. Two gram-positive bacteria (Bacillus subtilis and Micrococcus luteus), one gram-negative bacteria (Serratia marcescens) and two yeasts (Candida glabrata and Saccharomyces cerevisiae) were used for antimicrobial testing. High-performance liquid chromatography (HPLC) was used to identify phenolic substances in the extracts. First, the results showed that the isolated sample with the highest antimicrobial activity was 70% acetone extract. This extract contained chlorogenic acid, gallic acid, caffeic acid and coumaric acid according to HPLC. The ethyl acetate extract showed the lowest antimicrobial activity. Second, after lyophilization, the isolated materials also revealed high antimicrobial activity. The highest antimicrobial activity displayed the materials obtained by the extraction with 70% ethanol. This sample contained chlorogenic acid, gallic acid and caffeic acids. Next, samples with phenolic compounds were obtained by the alcoholic fermentation of spent coffee grounds. These samples showed similarly to the previous solution extracts significant antimicrobial activity. Interestingly, the unfiltered samples received directly after alcoholic fermentation also showed antifungal properties. The characterization of phenolic compounds by HPLC showed similarly as in previous examples that chlorogenic, caffeic and gallic acids were present in these samples.
Conference papers on the topic "Polyfenoles"
1
Bogdan-Stefan, Negreanu-Pirjol. "ANTIOXIDATIVE ACTIVITY OF INDIGEN BITTER CHERRY FRUITS EXTRACT CORELLATED WITH POLYFENOLS AND MINERALS CONTENT." In 14th SGEM GeoConference on NANO, BIO AND GREEN � TECHNOLOGIES FOR A SUSTAINABLE FUTURE. Stef92 Technology, 2014. http://dx.doi.org/10.5593/sgem2014/b61/s25.035.
Full text