To see the other types of publications on this topic, follow the link: Platinum group. Antineoplastic agents.
Dissertations / Theses on the topic 'Platinum group. Antineoplastic agents'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 39 dissertations / theses for your research on the topic 'Platinum group. Antineoplastic agents.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse dissertations / theses on a wide variety of disciplines and organise your bibliography correctly.
1
Flynn, Allison. "Transition metals as anti-tumoral agents : some structure-function relationships of the platinum group metals /." Master's thesis, This resource online, 1994. http://scholar.lib.vt.edu/theses/available/etd-03022010-020016/.
Full text
2
Dewa, Shaliza Zaini. "Novel 3,3-dialkyldiaziridine platinum and palladium complexes." Thesis, University of Sussex, 1996. http://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.296548.
Full text
3
Oosthuizen, Lukas Marthinus. "New platinum coordination compounds : their synthesis, characterization and anticancer application." Thesis, Nelson Mandela Metropolitan University, 2009. http://hdl.handle.net/10948/d1018795.
Full textAbstract:
The aim of this thesis was to investigate the properties of novel platinum compounds with possible potential as anticancer agents, and to determine how their behaviour could lead to a better understanding of the chemistry involved. The final criteria were improvement of their anticancer behaviour. Since many questions are still unanswered as to the role of sulfur in anticancer action, studies were undertaken to synthesize novel platinum(II) complexes having non-leaving groups consisting of a combination of an aromatic nitrogen and thioetherial sulfur capable of forming a five membered ring upon coordination. The structural unit was 1-methyl-2-methylthioalkyl/aryl. Numerous complexes formed by these ligands each having chloro, bromo, iodo and oxalato leaving groups were then fully characterized. The results obtained by the various synthetic methods were compared and explained in terms of the chemistry involved. The role of the sulfur donor was indicated in both the halo- and oxalato-complexes and proved to be strongly influenced by the nature of the leaving groups. Their differences are reflected in their anticancer behaviour. The study was extended to mononitroplatinum(IV) complexes, in view of the kinetically stable platinum(IV) compounds and advantages related to this. A specific mononitroplatinum(IV) complex which proved to have good anticancer and STAT 3 properties could according to the literature not be synthesized successfully in a good yield and a high degree of purity. The results of extensive studies showed that the main problem centred around the simultaneous reactions in equilibrium during the synthesis. A number of these species formed as a result of side reactions could be identified and their close separation factors indicated chromatographically. The mechanism of these reactions and the unstable intermediate species involved could be rationalized and compared to analogues in the literature. All the complexes studied were characterized by spectral and thermal methods both in solution as well as the solid state. Their anticancer behaviour towards three anticancer cell lines (Hela, MCF 7, Ht 29) were determined and acted as a guide towards possible structural modifications for their improved capability. Three crystal structures of platinum(II) complexes were determined. The extent of the ionization of the platinum(II) complexes as well the redox potentials (Pt(II) / Pt(IV)) of the platinum(IV) complexes were particularly important factors pertaining to their anticancer action.
4
Jaganath, Yatish. "Advances in platinum-amine chemotherapeutic agents : their chemistry and applicationc." Thesis, Nelson Mandela Metropolitan University, 2009. http://hdl.handle.net/10948/d1021222.
Full textAbstract:
The research conducted in this study focussed on advancing the knowledge database of diamineplatinum complexes on two frontiers: 1) the development of novel anticancer complexes, and 2) improvements in their synthetic chemistry. Novel square-planar dichloro and oxalato platinum(II) complexes were synthesized as potential anticancer agents in accordance with a comprehensive set of factors identified as being significant in optimizing such action. The nonleaving ligands consisted of asymmetric chelating chiral diamines of the form 1- (1-R-imidazol-2yl)(R')methanamine (R representing methyl, butyl and R' methyl, phenyl). The complexes were characterized by a host of spectral, thermal and crystallographic techniques. In addition, the stabilities of the complexes were monitored in aqueous and saline solutions. Cytotoxicity screening on three cultured cancer cell lines (MCF-7, HeLa and HT29) indicated the compounds, present as their respective racemates, to have rather modest activities relative to cisplatin; with complexes having the smallest substituents, R,R' = methyl, being most active. In recognition of the limitations of traditional silver-based syntheses of oxalatoplatinum(II) complexes, innovative non-silver methods were developed using the well known cancer drug, oxaliplatin, (trans-R,R-1,2- diaminocyclohexane)oxalatoplatinum(II), as a prototype. These involved direct ligand exchange reactions of the dichloro precursor, (trans-R,R-1,2- diaminocyclohexane)dichloroplatinum(II), with tetrabutylammonium oxalate in essentially non-aqueous solvents. A 90:10 mixture of isoamyl alcohol (3-methyl- 1-butanol):water, proved to be a promising solvent, enabling the recovery of pure oxaliplatin (~98 percent) after 9 hours at 88 °C in yields of up to 86 percent. In light of the perceived unique mode of anticancer action available to mononitroplatinum(IV) complexes (i.e. their STAT3-binding potential), octahedral diamineoxalatoplatinum(IV) complexes containing axially-coordinated nitro and halo co-ligands were synthesized and extensively characterized. Electrochemical studies revealed trends in reduction potential which could be correlated to structural / chemical traits of the coordinated diamine and axial ligands. The similarities of the determined cytotoxicities of the platinum(IV) compounds and their respective platinum(II) analogues, implicated reduction as a means of activation of the platinum(IV) complexes.
5
McCandless, Stewart Grant. "The synthesis of some novel 1,2,3-benzotriazine-platinum complexes with potential antineoplastic activity." Thesis, Heriot-Watt University, 1988. http://hdl.handle.net/10399/999.
Full text
6
Wang, Xinghao, and 王星昊. "Platinum on the road: the activation and transport of novel platinum anticancer drugs by the extracellulardomain of human copper transporter I (HCTR1)." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2012. http://hub.hku.hk/bib/B48199205.
Full textAbstract:
Platinum-based anticancer drugs such as cisplatin, carboplatin and nedaplatin have
been widely used in the chemotherapy of a variety of solid tumours for several
decades. However, the development of both inherent and acquired resistance has
greatly limited the efficacy of all of these drugs. Several mechanisms were
proposed to explain the cellular resistance to these platinum drugs, including
decreased drug accumulation. Previously, it was suggested that cisplatin enters
cells via passive diffusion, followed by intracellular hydrolysis and activation
prior to targeting DNA. However, recent in vivo and in vitro studies confirmed
that transporters and carriers involved in copper homeostasis play important roles
on the transport as well as cellular resistance to the platinum drugs. CTR1, a major
plasma-membrane transporter involved in intracellular copper(I) homeostasis, was
found to facilitate the uptake of several platinum drugs although the molecular
mechanism remains unclear. The extracellular N-terminal domain of human CTR1
(hCTR1) with two methionine(Met)-rich and two histidine(His)-rich motifs has
been proved to be essential for the uptake of both copper and platinum drugs by
the transporter.
In this thesis, the extracellular domain of hCTR1 (hCTR1_N, residues 1-55) was
overexpressed and the role of the Met- and His-rich motifs on cisplatin binding
was examined by either mutagenesis or chemical modification. Cisplatin was
found to directly and rapidly bind to the Met residues of hCTR1_N by the
formation of monofunctional cisplatin-thioether adducts. The kinetics of the
binding process was found to correlate with the number of Met residues,
indicating that all Met residues are exposed to solvents and capable for cisplatin
binding. Such a non-sequence-specific binding may increase the likelihood of
capturing the anticancer drug in extracellular fluid by the N-terminus of hCTR1.
The effect of hCTR_N on the binding and activation of second-generation
platinum anticancer drugs, e.g. carboplatin and nedaplatin, were subsequently
investigated. hCTR1_N was found to significantly facilitate the activation of these
platinum drugs by the formation of ring-opened monofunctional Pt-thioether
species through Met residues. Although the activities of platinum drugs against
hCTR1_N are significantly different, their monofunctional protein-bound species
demonstrated great similarity in both structure and kinetic aspects, suggesting the
uptake of these platinum drugs by hCTR1 might follow the same mechanism. The
formation of active ring-opened species of carboplatin and nedaplatin by
chloride/bicarbonate was observed, indicating these nucleophiles may play a
critical role in the pre-activation of the drugs prior to their reaching cellular targets.
Pt-thioether species were proposed as intermediates for the platination of other
biomolecules. The monofunctional cisplatin adduct of hCTR1_N was proved to
further transfer its active platinum species to either cysteine- or guaninecontaining
biomolecules which mimic the C-ternimus of hCTR1 and DNA.
Methionine residues of hCTR1 may therefore serve as key residues for the
activation and transport of platinum anticancer drugs in the form of
monofunctional Pt-thioether species through the pole of trimeric hCTR1 and
eventually to their final target – DNA.published_or_final_version
Chemistry
Doctoral
Doctor of Philosophy
7
Yachnin, Jeffrey R. "Chemical, pharmacokinetic and biological aspects of platinum-based drugs /." Stockholm, 2005. http://diss.kib.ki.se/2005/91-7140-221-7/.
Full text
8
Phelps, Jennifer Suzanne 1960. "CISPLATIN NEPHROTOXICITY: IN VITRO STUDIES (KIDNEY, TOXICOLOGY, PLATINUM)." Thesis, The University of Arizona, 1986. http://hdl.handle.net/10150/291243.
Full text
9
Bouwer, Yolanda. "Novel aspects of platinum-amine coordination compounds: their chemistry and anticancer application." Thesis, Nelson Mandela Metropolitan University, 2008. http://hdl.handle.net/10948/d1021052.
Full textAbstract:
The aim in this thesis, was to synthesize novel platinum coordination compounds, in order to develop compounds with improved anticancer action which could lead to an improved understanding of the mechanism by which they operate and at the same time, improve synthetic methods for their products. The initial work included the development of a novel synthetic method for 1R,2R-diaminocyclohexaneoxalato-platinum(II) (oxaliplatin), by using an essentially non-aqueous solvent medium and direct ligand exchange at elevated temperatures. This was done by a study of the kinetics of the reaction in a variety of conditions; such as relative reagent concentrations and ratios as well as solvent mixtures. An effective method was developed which could be applied industrially. An international patent was taken out on this method. Various amine complexes of platinum(II) were synthesized using chloro, bromo and oxalato groups as leaving groups. The non-leaving groups were selected having certain specific characteristics in mind. Novel mononitroplatinum(IV) complexes were synthesized, mostly with oxalato leaving groups. One of these in particular, had excellent anticancer behaviour. Another trichloromononitro complex was also synthesized with very good anticancer properties. Two international patents were filed for the latter two compounds. As far as possible, all compounds were studied by spectrometric, chromatographic and thermal methods. They were also tested against 3 cancer cell lines namely cervical (Hela), Colon (HT29) and Breast (MCF7) cancer cells.
10
Myburgh, Jolanda. "Synthesis and characterization of novel platinum complexes : their anticancer behaviour." Thesis, Nelson Mandela Metropolitan University, 2009. http://hdl.handle.net/10948/d1018621.
Full textAbstract:
In this dissertation novel non-leaving groups were employed to synthesize platinum complexes which can contribute to the understanding or improvement of anticancer action. These complexes basically consist of (NS)-chelate and amineplatinum complexes. Bidentate (NS)-donor ligands were used as non-leaving ligands in the syntheses of platinum(II) complexes with iodide, chloride, bromide and oxalate anions as leaving groups. These complexes were synthesized and studied since many questions regarding the interaction of sulfur donors and platinum still exists. These relate to thermodynamic and kinetic factors and their influence on anticancer action. In this dissertation the properties of novel platinum(II) complexes of a bidentate ligand having an aromatic nitrogen-donor atom in combination with a thioethereal sulfur atom capable of forming a five membered ring with platinum(II) were studied. The general structure of the (NS) -ligands used were N-alkyl-2-methylthioalkyl imidazole. Alkyl groups used were methyl, ethyl and propyl. Although amine complexes of platinum have been extensively studied there are some new aspects of these that are worthwhile investigating. In this dissertation amines having planar attachments which will be at an angle with the coordination plane viz. benzylamine and amines having cyclic aliphatic groups namely cyclopropyl and cyclohexyl were investigated. Some of the (NS) - and amineplatinum(II) complexes were oxidised to their mononitroplatinum(IV) analogues . The motivation for the synthesis of these complexes was the greater kinetic stability of platinum(IV) and recent research has shown that a specific type of platinum(IV) compound shows suitable properties as an anticancer agent. These complexes were characterised by a variety of spectral means (IR, NMR, mass spectroscopy) as well as elemental analysis, solubility determinations, thermal analysis (TGA), ionization studies and finally their anticancer behaviour towards three different cell lines(Hela, MCF 7, Ht29) and in this process they were compared to the behaviour of cisplatin as a reference. A few have shown promising anticancer behaviour.
11
Thomas, Donald S. "Molecular modelling and NMR studies of multinuclear platinum anticancer complexes." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0009.
Full textAbstract:
[Truncated abstract] The trinuclear anti-cancer agent [(trans-Pt(NH3)3Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) is arguably the most significant development in the field of platinum anti-cancer agents since the discovery of cisplatin as a clinical agent more than 30 years ago. Professor Nicholas Farrell of Virginia Commonwealth University was responsible for the development of 1,0,1/t,t,t and an entire class of multinuclear platinum complexes. The paradigm shift that was required in the development of these compounds is based on a simple idea. In order to increase the functionality of platinum anti-cancer drugs a new way of binding to DNA must be employed. By increasing the number of platinum centres in the molecule and separating the binding sites, by locating them on the terminal platinum atoms, the result is a new binding motif that does not occur with cisplatin. The work described in this thesis involves the use of [¹H,¹5N] NMR spectroscopy combined with molecular modelling to investigate various aspects of the solution chemistry and DNA binding interactions of BBR3464 and the related dinuclear analogues [{trans-PtCl(NH3)2}2(μ- NH2(CH2)6NH2)]2+ (1,1/t,t) and [{cis-PtCl(NH3)2}2(μ-NH2(CH2)6NH2)]2+ (1,1/c,c). Chapter 2 contains detailed descriptions of the various methodologies used, including the molecular mechanics parameters that were developed for the various modelling studies described in this thesis.... The work described in Chapter 6 employed three duplexes; 5'-d(TCTCCTATTCGCTTATCTCTC)-3'·5'- d(GAGAGATAAGCGAATAGGAGA)-3' (VB12), 5'-d(TCTCCTTCTTGTTCTTCCTCC)- 3'·5'-d(GGATTAAGAACAAGAAGGAGA)-3' (VB14) and 5'- d(CTCTCTCTATTGTTATCTCTTCT)-3'·5'-d(AGAAGAGATAACTATAGAGAGAG)-3' (VB16). Two minor groove preassociated forms of 1,0,1/t,t,t with each duplex were created in which the complex was orientated in two different directions around the central guanine (labelled the 3'→3' and 5'→5' directions). The molecular dynamics simulations of these six systems indicated that each preassociated states was stable within the minor groove and could effectively support the formation of multiple interstrand cross-links. Subsequent investigations into the dynamic nature of the monofunctional adduct were conducted by the assembly of a single monofunctional adduct of the VB14 duplex with 1,0,1/t,t,t. Here it was found that the monofunctionally anchored 1,0,1/t,t,t adopted a position along the phosphate backbone of the duplex in the 5'→5' direction.
12
Du, Plessis-Stoman Debbie. "An investigation of the in vitro anticancer properties of selected platinum compounds." Thesis, Nelson Mandela Metropolitan University, 2006. http://hdl.handle.net/10948/498.
Full textAbstract:
This dissertation mainly deals with some biochemical aspects regarding the efficacy of novel platinum anticancer compounds, as part of a broader study in which both chemistry and biochemistry are involved. Various novel diamine and N-S donor chelate compounds of platinum II and IV have been developed in which factors such as stereochemistry, ligand exchange rate and biocompatibility were considered as additional parameters. In the first order testing, each of these compounds was tested with reference to their “killing” potential by comparing their rate of killing, over a period of 48 hours with those of cisplatin and oxaliplatin. Some 80 compounds were tested in this way. Although only a few could be regarded as equal to or even better than cisplatin and oxaliplatin, the testing of these compounds on cancer cells provided useful knowledge for the further development of novel compounds. Four of the better compounds, namely Y9, Y14, Y16 and Lt16.2 were selected for further studies to obtain more detailed knowledge of their anticancer action, including some flow cytometric studies. In addition to the above, cisplatin resistant cells were produced for each of the three different cell lines tested, namely, HeLa, HT29 and MCF7 cancer cell lines, by intermittent and incremental exposure to cisplatin (all the cell lines tested became resistant to cisplatin). Each of the selected compounds were exposed to the cells in the same manner, in order to attempt the induction of resistance against these compounds in the three cell lines tested (i.e. whether these cells will become resistant to the various compounds). Each of these selected platinum containing compounds were subsequently tested against the “cisplatin resistant” cell lines in order to determine their efficacy against such cells. One such compound could be singled out, since cervical cancer cells (HeLa cells) do not become resistant to it. This behaviour is similar to that of oxaliplatin against cervical cancer and colon cancer (HT29) cells (oxaliplatin is the number one treatment for colon cancer at present). This compound also proved to be more active against cisplatin resistant cell lines. It was found that all the compounds induced apoptosis in the cell lines tested as well as inhibit the DNA cycle at one or more phase. Finally, an effort was made to evaluate the different compounds by comparing them with respect to their properties relating to anticancer action.
13
Shum, Yuen-ting. "Functionalized platinum (II) and gold (I) acetylide complexes structural and spectroscopic properties and anticancer activities /." Click to view the E-thesis via HKUTO, 2007. http://sunzi.lib.hku.hk/hkuto/record/B38639865.
Full text
14
Ma, Dik-lung Edmond, and 馬迪龍. "Luminescent cyclometalated platinum (II) complexes in DNA binding studies and their cytotoxicities against carcinoma cell lines." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2003. http://hub.hku.hk/bib/B3124581X.
Full text
15
Cruz, Sanchez Fabiola A. "Synthesis and self-assembly of novel lipid platinum complexes." To access this resource online via ProQuest Dissertations and Theses @ UTEP, 2007. http://0-proquest.umi.com.lib.utep.edu/login?COPT=REJTPTU0YmImSU5UPTAmVkVSPTI=&clientId=2515.
Full text
16
Shum, Yuen-ting, and 岑婉婷. "Functionalized platinum (II) and gold (I) acetylide complexes: structural and spectroscopic properties andanticancer activities." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2007. http://hub.hku.hk/bib/B38639865.
Full text
17
Moniodis, Joseph John. "Studying the DNA binding of a non-covalent analogue of the trinuclear platinum anticancer agent BBR3464." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2006. http://theses.library.uwa.edu.au/adt-WU2007.0008.
Full textAbstract:
[Truncated abstract] The Phase II clinical candidate, [(trans-Pt(NH3)2Cl)2{μ-trans-Pt(NH3)2(H2N(CH2)6NH2)2}]4+ (BBR3464 or 1,0,1/t,t,t) shows a unique binding profile when compared to the anticancer agent cis-[Pt(NH3)2Cl2] (cisplatin) and dinuclear platinum complexes of the general formula [(trans-Pt(NH3)2Cl)2(H2N(CH2)nNH2)]2+. There is evidence that the increased efficacy of 1,0,1/t,t,t results from the presence of the charged central linker, which can alter the mode of binding to DNA. This alternate binding mode may be due to an electrostatic and hydrogen bonding association of the central platinum moiety in the minor groove that occurs prior to covalent binding (termed “pre-association”) . . . This research shows that 0,0,0/t,t,t is an adequate model to study the pre-association process of 1,0,1/t,t,t and that it binds in the minor groove of DNA. Therefore it is likely that 1,0,1/t,t,t pre-associates in the minor groove of DNA prior to covalent binding. This work supports the conclusions reached in NMR studies of the binding of 1,0,1/t,t,t with the 1,4-GG sequence (Qu et al. JBIC. 8, 19-28 (2003)), which showed simultaneous binding in the major and minor groove. The findings of the current work may also explain the observed binding mode of 1,0,1/t,t,t, which can bind to DNA in both the 3',3' and 5',5' directions (Kasparkova et al. JBC. 277, 48076-48086 (2002)). These unique binding characteristics are thought to be responsible for the increased efficacy of 1,0,1/t,t,t, and in light of the current results the observed binding mode most likely stems from the electrostatic pre-association of the central platinum moiety.
18
Keter, Frankline Kiplangat. "Pyrazole and pyrazolyl palladium(II) and platinum(II) complexes: synthesis and in vitro evaluation as anticancer agents." Thesis, University of the Western Cape, 2004. http://etd.uwc.ac.za/index.php?module=etd&.
Full textAbstract:
The use of metallo-pharmaceuticals, such as the platinum drugs, for cancer treatment illustrates the utility of metal complexes as therapeutic agents. Platinum group metal complexes therefore offer potential as anti-tumour agents to fight cancer. This study was aimed at synthesizing and evaluating the effects of palladium(II) and platinum(II) complexes as anticancer agents.
19
Du, Plessis-Stoman Debbie. "A combination of platinum anticancer drugs and mangiferin causes increased efficacy in cancer cell lines." Thesis, Nelson Mandela Metropolitan University, 2010. http://hdl.handle.net/10948/d1016160.
Full textAbstract:
This thesis mainly deals with some biochemical aspects regarding the efficacy of novel platinum anticancer compounds alone and in combination with mangiferin, as part of a broader study in which both chemistry and biochemistry are involved. Various novel diamine and N-S donor chelate compounds of platinum II and IV have been developed in which factors such as stereochemistry, ligand exchange rate and biocompatibility were considered as additional parameters. In the first order testing, each of these compounds was tested with reference to their “killing” potential by comparing their rate of killing, over a period of 48 hours with those of cisplatin and oxaliplatin. Numerous novel compounds were tested in this way, using the MTT cell viability assay and the three cancer cell lines MCF7, HT29 and HeLa. Although only a few could be regarded as equal to or even better than cisplatin, CPA7 and oxaliplatin, the testing of these compounds on cancer cells provided useful knowledge for the further development of novel compounds. Three of the better compounds, namely Yol 25, Yol 29.1 and Mar 4.1.4 were selected for further studies, together with oxaliplatin and CPA7 as positive controls, to obtain more detailed knowledge of their anticancer action, both alone and when applied in combination with mangiferin. In addition to the above, resistant cells were produced for each of the three different cell lines tested and all the selected compounds, both in the presence and absence of mangiferin. The effects of these treatments on the activation of NFĸB when applied to normal and resistant cell lines were also investigated. All the compounds induced apoptosis in the cell lines tested as well as alter the DNA cycle at one or more phase. Additionally, combination of these compounds with mangiferin enhanced the above-mentioned effects. Mangiferin decreases the IC50 values of the platinum drugs by up to 3.4 times and, although mangiferin alone did not induce cell cycle arrest, the presence of mangiferin in combination with oxaliplatin and Yol 25 shows an earlier and greatly enhanced delay in the S-phase, while cells treated with CPA7, Yol 29.1 and Mar 4.1.4 in combination with mangiferin showed a later, but greatly enhanced delay in the S-phase. It was also found that mangiferin acts as an NFĸB inhibitor when applied in combination with these drugs, which, in turn, reduces the occurrence of resistance in the cell lines. Resistance to oxaliplatin was counteracted by the combination with mangiferin in HeLa and HT29, but not in MCF7 cells, while resistance to CPA7 was only counteracted in the MCF7 cell line. Yol 25 and Mar 4.1.4 did not seem to induce resistance in HeLa and MCF7 cells, but did in HT29 cells, whereas Yol 29.1 caused resistance in HeLa and HT29 cells, but not in MCF7 cells. Finally, an effort was made to evaluate the different compounds by comparing them with respect to their properties relating to anticancer action with and without the addition of mangiferin.
20
Liu, Jia, and 刘佳. "Luminescent cyclometalated platinum (II) complexes with isocyanide ligands as nucleic acid probes, topoisomerase poisons and anti-cancers agents." Thesis, The University of Hong Kong (Pokfulam, Hong Kong), 2011. http://hdl.handle.net/10722/209595.
Full text
21
Kabolizadeh, Peyman. "Mechanisms of Accumulation and Biological Consequences of Polynuclear Platinum Compounds." VCU Scholars Compass, 2007. http://hdl.handle.net/10156/1913.
Full text
22
Chellan, Prinessa. "The synthesis and study of multimetallic Platinum Group Metal complexes as in vitro phamacological agents." Doctoral thesis, University of Cape Town, 2013. http://hdl.handle.net/11427/10259.
Full textAbstract:
Includes bibliographical references.The success of cisplatin and its analogues for the treatment of different cancers has had a profound effect on establishing the application of metal complexes in medicine. Lately, increasing drug resistance and the emergence of unwanted side effects to currently available therapies have bred a need for novel pharmacological agents. Thus, the design and study of organometallic complexes as potential chemotherapeutics may potentially identify new drug candidates. Apart from platinum based compounds, platinum-like metals such as ruthenium(II), rhodium(III) and iridium(III), have been identified as biologically relevant metals. The purpose of this study is to synthesize three classes of polynuclear complexes containing metals from the Platinum Group Metal (PGM) series and evaluate each class for pharmacological activity in vitro. Each complex class is based on a different ligand type. New mono- and polynuclear organometallic Platinum Group Metal (PGM) complexes based on three ligand classes have been synthesised and characterised using several analytical and spectroscopic techniques including 1H, 13C and 31P NMR, infrared and UV-vis spectroscopy. The first complex series is based on the thiourea containing ligand, 3,4-dichloroacetophenonethiosemicarbazone, which has demonstrated in vitro pharmacological activity. This ligand was reacted with K2[PtCl4] to afford a tetranuclear cycloplatinated thiosemicarbazone complex (2.2). Reaction of 2.2 with different mono- and diphosphanes yielded two mono- and three dinuclear Pt(II) thiosemicarbazone ligands (2.3-2.7). In all of the complexes (2.2-2.7), the thiosemicarbazone ligands act as a dinegative tridentate [C,N,S] donor to each metal centre. Single crystal X-ray analyses of three of the complexes in this series, including the tetraplatinum derivative, confirmed the structural integrity of these complexes. Reactivity studies of the mononuclear platinum(II) complexes revealed that one complex is able to undergo oxidative addition reactions with different aryl iodide substrates. In vitro pharmacological studies of a selection of these complexes as antiparasitic agents have been carried out against the P. falciparum strains, D10 (cisplatin sensitive) and Dd2 (cisplatin resistant)) and Trichomonas vaginalis T1. Their cytotoxic effects on the A2780 (cisplatin sensitive) and A2780cisR (cisplatin resistant) human ovarian carcinoma cell line has also been determined. All of the complexes demonstrated moderate cytotoxic effects as antiparasitics and antitumor agents. No correlation between the number of platinumthiosemicarbazone moieties and pharmacological activity could be discerned. Instead, the type of ancillary ligand used to prepare each complex may influence the lipophilic nature of each complex thus explaining the trend observed.
23
Tayyem, Hasan. "Studies on new tumour active compounds with one or more metal centres." zConnect to full text, 2006. http://hdl.handle.net/2123/1727.
Full textAbstract:
Thesis (Ph. D.)--University of Sydney, 2007.Title from title screen (viewed may 17, 2007). Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy to the School of Biomedical Sciences, Faculty of Health Sciences. Degree awarded 2007; thesis submitted 2006. Includes bibliographical references. Also issued in print.
24
Berger, Gilles. "Synthesis of chiral vicinal diamines and in vitro anticancer properties of their platinum(II) coordinates." Doctoral thesis, Universite Libre de Bruxelles, 2013. http://hdl.handle.net/2013/ULB-DIPOT:oai:dipot.ulb.ac.be:2013/209376.
Full textAbstract:
15N-based nuclear magnetic resonance techniques are considered very powerful to study the molecular properties of platinum-containing anticancer agents, these properties being responsible for the efficacy of the compounds, but also for the understanding of resistance mechanisms and toxicity. Therefore, the first part of the present work aimed to develop a new method for synthesizing 15N-labeled, chiral platinum compounds. A theoretical discussion on the nucleophilic ring-opening of aziridines has also been envisaged, rationalizing an interesting regiochemistry question. Indeed, a surprising inversion of regiochemistry arose during the development of the above-mentioned synthetic pathway, and density functional theory calculation brought a rational framework to the experimental findings.Infrared spectroscopy probes the global chemical composition of a sample and has been used to produce a snapshot of cancer cells contents after treatment with platinum coordinates. Indeed, in vitro studies focused here on the use of modern spectroscopic methods to fingerprint the cellular impact of platinum complexes. These drug signatures help to classify and select promising compounds. It makes no doubt that such systemic approaches for compound discovery are helpful technologies. Also, we made the use of the COMPARE algorithm from the NCI, which analyzes similarity between any active compounds previously tested by the NCI large scale in vitro screening program of anticancer agents.
The last chapter aimed to study the interactions between a series of platinum coordinates and DNA. Binding mode to telomeric-like sequences and binding kinetics to genomic-like sequences were assessed to investigate any differences between the compounds and to gain insight into structure-activity relationships.
Doctorat en Sciences biomédicales et pharmaceutiques
info:eu-repo/semantics/nonPublished
25
Wade, Parker, Miranda Green, April Weaver, Omri Coke, Ruben Torrenegra, and Victoria Palau. "Additional Hydroxyl group on CT6 (3,4-dihydroxy-5,7-dimethoxyflavone), a flavone extracted from Chromolaena Tacotana potentially confers additional activity against pancreatic cancer as compared to CT7 (4-hydroxy-5,7-dimethoxyflavone)." Digital Commons @ East Tennessee State University, 2019. https://dc.etsu.edu/asrf/2019/schedule/228.
Full textAbstract:
Additional Hydroxyl group on CT6 (3,4-dihydroxy-5,7-dimethoxyflavone), a flavone extracted from Chromolaena Tacotana potentially confers additional activity against pancreatic cancer as compared to CT7 (4-hydroxy-5,7-dimethoxyflavone)
Parker Wade1, Miranda Green1, April Weaver1, Omri Coke1, Ruben D. Torrenegra2, and Victoria Palau1
1Department of Pharmaceutical Sciences, College of Pharmacy, East Tennessee State University, Johnson City, TN.
2Department of Chemistry, Universidad de Ciencias Aplicadas y Ambientales, Bogota, Colombia and
Pancreatic cancer is one of the deadliest types of cancers, with a mortality rate of about 95%. This high mortality rate signifies there is a need for further research into finding treatment options for those affected by pancreatic cancer. Recent studies have found cytotoxic effects on cancerous cells elicited from compounds, such as flavones, in plants indigenous to Western South America, specifically Colombia. The flavones 3,4-dihydroxy-5,7-dimethoxyflavone (CT6) and 4-hydroxy-5,7-dimethoxyflavone (CT7) were isolated from Chromolaena Tacotana, member of the asteraceae family. The molecular structures of the flavones differ only by an additional hydroxyl group on CT6. Both of these compounds were tested on MIA PaCa2 and Panc28 pancreatic cancer cells at concentrations ranging from 5μM to 80μM. Cell viability after dosing of CT6 and CT7 was determined using MTT and spectrophotometry analysis. MIA PaCa2 is more poorly differentiated than Panc28. CT6 conferred greater activity on both cell lines compared to CT7. Percent cell viability of the Panc28 cell line reached a low of 35.55% (p=0.0001) with CT6, compared to 84.25% (p=0.0275) with CT7. Percent cell viability of the MIA PaCa2 cell line reached a low of 46.72% (p=0.000001)with CT6. However, CT7 showed no significant difference, with percent cell viability reaching 103.73% (p=0.5605) when compared to the control for this cell line. While CT6 exerted cytotoxic activity on both Panc28 and MIA PaCa2, CT6 had significantly more cytotoxic activity on Panc28, which could be related to the greater differentiation status of this cell line. More in depth studies will need to be conducted to determine the exact reasons for greater activity of CT6 on Panc28 cells. This could be due to the compound’s target, mitochondrial activity of the cell lines, and the minor structural differences between the two compounds.
26
Shi, Minghan. "Convection-enhanced delivery of platinum drugs and their liposomal formulations plus radiation therapy in glioblastoma treatment." Thèse, Université de Sherbrooke, 2016. http://hdl.handle.net/11143/8786.
Full textAbstract:
Abstract : Glioblastoma is the most common and aggressive brain cancer in adults. The current standard-of-care treatment includes surgical resection, radiation therapy with concomitant and adjuvant temozolomide (TMZ) chemotherapy. However, the addition of TMZ to radiation therapy only increased the median survival time (MeST) by 2.5 months. This limited improvement is partially attributable to the low accumulation of chemotherapeutic drugs in the brain tumor due to the blood-brain barrier (BBB). Thus, new delivery methods such as intra-arterial, BBB disruption and convection-enhanced delivery (CED) have been proposed to overcome this limitation. Besides, timing tumor irradiation to coincide with the maximal concentration of platinum-DNA adducts could result in improved tumor control.
In this study, CED of cisplatin and oxaliplatin, their respective liposomal formulations Lipoplatin™, Lipoxal™, and carboplatin with or without 15 Gy of radiation therapy has been carried out in F98 glioma bearing Fischer rats to assess their toxicity and MeST. The amount of platinum-DNA adducts in the tumor at 4 h and 24 h after CED was measured and irradiation was administered at these two different time periods to test the concomitant effect. In addition, four liposomal carboplatin formulations with different chemo-physical properties were prepared and their toxicity and MeST were also evaluated in this animal model.
Among the tested platinum drugs, carboplatin and Lipoxal™ demonstrated a highest maximum-tolerated dose of 25 µg and 30 µg respectively. CED of carboplatin showed the longest MeST of 38.5 days, and increased to 54.0 days with the addition of 15 Gy radiation therapy. However, radiation at 4 h after CED of either oxaliplatin or carboplatin did not show any survival improvement when compared to radiation at 24 h, although the quantity of platinum-DNA adducts at 4 h was higher than at 24 h after CED. In the four liposomal carboplatin formulations, anionic pegylated liposomal carboplatin showed the longest MeST of 49.5 days, due to its longer tumoral retention time and probably larger distribution volume in the brain.Résumé : Le glioblastome est le cancer primaire du cerveau le plus courant et agressif chez l’adulte. Le traitement standard comprend la résection chirurgicale, la radiothérapie et la chimiothérapie concomitante et adjuvante avec le témozolomide(TMZ). L'addition de TMZ combinée la radiothérapie a augmenté la survie médiane (MeST) de 2,5 mois. Cette faible amélioration est partiellement due à l'accumulation limitée de médicaments chimiothérapeutiques dans la tumeur cérébrale à cause de la barrière hémato-encéphalique (BBB). Ainsi, de nouvelles méthodes comme l’injection intraartérielle, la rupture osmotique de la barrière hémato-encéphalique, la livraison augmentée par convection (CED) ont été suggérées pour surmonter ce problème. En plus, l’optimisation de l’irradiation de la tumeur lorsque le maximum d’adduits platine-ADN est atteint pourrait aboutir à un meilleur contrôle de la tumeur. Dans cette étude, nous avons injecté par CED le cisplatine, l’oxaliplatine, avec leur formulation liposomale Lipoplatin™, Lipoxal™ ainsi que le carboplatine avec ou sans radiation de 15 Gy. La toxicité et le temps de MeST ont été mesurés chez des rats Fischer porteurs du gliome. La quantité d'adduits platine-ADN dans la tumeur a été mesurée 4 h et 24 h après CED. L’irradiation de la tumeur a été effectuée à ces deux temps pour tester l'effet concomitant. En plus, quatre formulations liposomales de carboplatine avec différentes propriétés chimiophysiques ont été préparées et leur toxicité et MeST combiné à la radiation ont également été évalués. Parmi les drogues de platine testées, le carboplatine et Lipoxal™ ont démontré respectivement la dose maximale tolérée la plus élevée, soit 25 µg et 30 µg. La MeST du carboplatine était la plus longue avec 38,5 jours qui a augmenté à 54,0 jours avec l’addition de 15 Gy de radiothérapie. Toutefois, l’irradiation à 4 h après CED effectuée avec l'oxaliplatine et le carboplatine n'a pas amélioré la MeST comparé à l’irradiation à 24 h, bien que la quantité d'adduits platine-ADN à 4 h était supérieure à celle mesurée à 24 h après CED. Pour les quatre formulations liposomales de carboplatine, celle pégylée négatif a démontré la plus longue MeST, soit 49,5 jours.
27
Zheng, Xinyu. "Evaluation of the deoxyribonucleoside kinase of Drosophila Melanogaster (Dm-dNK) as a suicide gene for treatment of solid tumors /." Stockholm : [Karolinska institutets bibl.], 2002. http://diss.kib.ki.se/2002/91-7349-159-4.
Full text
28
Ruhayel, Rasha A. "Multinuclear platinum anticancer therapeutics : insights into their solution chemistry and DNA binding interactions from NMR spectroscopy and molecular modelling." University of Western Australia. School of Biomedical, Biomolecular and Chemical Sciences, 2010. http://theses.library.uwa.edu.au/adt-WU2010.0021.
Full textAbstract:
In the 1980's, Nicholas Farrell developed a range of structurally distinct multinuclear Pt complexes that form long-range interstrand crosslinks (IXLs) in DNA. The dinuclear complex [{trans-PtCl2(NH3)}2-µ-(H2N(CH2)6NH2)]2+ (1,1/t,t) was the first of this series to show promising results, however, it was the trinuclear complex [{trans-PtCl2(NH3)}2-µ-trans-Pt(NH3)2(H2N(CH2)6NH2)2]4+ (1,0,1/t,t,t or BBR3464) that was chosen for clinical trials based on significantly increased cytotoxicity compared to 1,1/t,t and cisplatin. Molecular biology experiments have shown that 1,1/t,t exclusively forms IXLs in DNA in the 5'¿ 5' direction, whilst 1,0,1/t,t,t can form IXLs in both the 5'¿5' and 3'¿3' directions. Previously, 2D [1H,15N] HSQC NMR has been used to study the formation of 5'5' 1,4GG IXLs. The formation of 3'3' 1,4GG IXLs have been studied as part of this thesis. More recently, Pt complexes such as [{transPtCl2(NH3)}2{H2N(CH2)6(NH2(CH2)2NH2)(CH2)6NH2}]4+ (1,1/t,t6,2,6) and [{transPtCl2(NH3)}2{H2N(CH2)6(NH2)(CH2)6NH2}]3+ (1,1/t,t6,6), where the charged central Pt moiety of 1,0,1/t,t,t is replaced by a polyamine linker, have been developed in the Farrell group and show increased potency compared to 1,0,1/t,t,t. The complex 1,1/t,t 6,2,6 is a lead candidate currently undergoing Phase I clinical trials. Prior to the work presented in this thesis, little was known about the aquation chemistry or kinetics of DNA binding of these novel complexes. Reported in Chapter 3 is the study of the formation of 3'3' 1,4GG IXLs by both 1,0,1/t,t,t and 1,1/t,t in the duplex 5' {d(TATACATGTATA)2} (3314XL) (pH 5.4, 298K). A combination of 1D 1H and 2D [1H, 15N] HSQC NMR experiments was used to directly compare the results with the stepwise formation of the 5'5' 1,4GG IXL with the previously studied duplex, 5' {d(ATATGTACATAT)2} (5514XL), under the same conditions. Preassociation as well as aquation were similar, however, differences were observed at the monofunctional binding step with evidence for numerous monofunctional adducts. Both reactions did not yield a single 3'3' 1,4GG IXL, rather several adducts that could not be characterised. Molecular dynamics simulations of the 3'3' 1,4GG IXLs showed highly distorted lesions that may have implication in cellular repair processes.
29
Deutschmann, Sandra Maria. "Sinais e sintomas vestibulares em pacientes que receberam tratamento com drogas derivadas da platina." Universidade de São Paulo, 2016. http://www.teses.usp.br/teses/disponiveis/5/5143/tde-24102016-143622/.
Full textAbstract:
A toxicidade vestibular pode ser definida como danos que uma substância química causa sobre a estrutura e a função vestibular. Entre as drogas que podem causar a vestibulotoxicidade estão os agentes antineoplásicos como os derivados da platina. OBJETIVO: Identificar a frequência de ocorrência de alteração vestibular em pacientes oncológicos tratados com derivados da platina, os sinais e sintomas vestibulares nestes pacientes, e se a alteração vestibular pré-existente exacerba os sintomas eméticos durante a quimioterapia com derivados da platina. METODOLOGIA: Amostra foi composta por pacientes adultos com câncer que realizaram tratamento com drogas derivadas da platina. O protocolo para o monitoramento vestibular foi composto pelo questionário Dizziness Handicap Inventory (DHI) Brasileiro, Testes da Função Vestibular (manobra de Dix-Hallpike e vecto-eletronistagmografia) e pela descrição de sintomas eméticos e tontura durante a quimioterapia e avaliação vestibular. RESULTADOS: Quarenta e oito pacientes realizaram a avaliação vestibular pré-quimioterapia, sendo que 23 (48%) apresentaram avaliação vestibular dentro da normalidade. Dezesseis pacientes submeteram-se ao monitoramento vestibular com avaliação antes e após tratamento, sendo que após o tratamento dois pacientes (12,5%) apresentaram avaliação vestibular dentro da normalidade e 14 (87,5%) apresentaram algum tipo de alteração vestibular, evidenciada somente pela prova calórica. Nenhum paciente referiu queixas vestibulares ao DHI na avaliação pré-tratamento, assim como quase todos os pacientes, exceto um, na avaliação pós tratamento. Apenas um (6,3%) com avaliação vestibular alterada pós-tratamento apresentou grau leve no DHI. A dose de cisplatina entre os pacientes que mostraram piora do quadro vestibular variou entre 160 e 400 mg/m² e dois pacientes foram tratados com carboplatina com dose de 2306 mg/m² e 1801 mg/m². Não houve diferença de manifestação dos sintomas eméticos/tontura durante a avaliação vestibular ou após quimioterapia entre os pacientes com e sem alteração vestibular prévia. Entretanto, os pacientes que referiram sintomas eméticos durante os ciclos de quimioterapia foram aqueles que manifestaram maior desconforto na PC, independente da dose de quimioterapia ou da alteração vestibular. CONCLUSÃO: Alteração vestibular ou a modificação do quadro vestibular ocorreu em 50% dos pacientes com câncer tratados com derivados da platina. O sinal mais frequente de alteração nos testes vestibulares foi a hiporreflexia à prova calórica, sem sintomas vestibulares relatados na vida diária destes pacientes. As alterações vestibulares pré-existentes não exacerbaram os sintomas eméticos durante a quimioterapiaVestibular toxicity may be defined as a damage that chemical substances cause on the structure and the function of the vestibular system. Among the drugs that may cause vestibulotoxicity there are antineoplastic agents, such as those derived from platinum. OBJECTIVE: To identify the frequency of occurrence of vestibular alterations in cancer patients treated with platinum-based chemotherapy; the vestibular signs and symptoms in these patients, and whether the pre-existing vestibular alterations exacerbate emetic symptoms during chemotherapy with platinum-based drugs. METHODS: The sample was composed of adults who were treated of the cancer with platinum-based chemotherapy. The vestibular monitoring protocol involved the Brazilian Dizziness Handicap Inventory (DHI), Vestibular Function Tests (positioning nystagmus with Dix-Hallpike maneuver and vectoelectronystagmography) and the description of emetic symptoms and dizziness during chemotherapy and vestibular evaluation. RESULTS: Forty-eight subjects performed the pre-treatment vestibular evaluation, and 23 of them (48%) presented vestibular assessment within the normal range. Sixteen patients underwent the vestibular monitoring evaluation before and after treatment: after the treatment two patients (12.5%) showed normal vestibular assessment while 14 (87.5%) showed a vestibular disorder, basically in the caloric tests, but the alteration was considered a modification in their baseline stage in eight patients (50%). None of the patients reported complaints in the pre-treatment assessment, with a DHI scores within the normal range, as well as all the patients, except one, in the post treatment assessment (81,3%). Only one patient (6.3%) had a score above normal (mild complaint) with altered vestibular evaluation in the post treatment assessment. The dose of cisplatin among these patients who had a modification in the vestibular function varied from 160 to 400 mg/m² and two patients were treated with carboplatin with do of 2306 mg/m² and 1801 mg/m². There was no difference of emetic symptoms/dizziness during the chemotherapy or the vestibular evaluation among patients with or without previous vestibular alterations. However, patients who reported more emetic symptoms during chemotherapy cycles were those who showed greater discomfort in the caloric test, regardless of the dosage of chemotherapy or vestibular alteration. CONCLUSION: Vestibular alterations or modification of the baseline alteration were found in 50% of cancer patients treated with platinum-based chemotherapy. The most common sign of vestibular alteration in the vestibular tests was the hiporeflexia at the caloric test with no reported symptoms in their daily life. The preexisting vestibular alterations did not exacerbate emetic symptoms during chemotherapy
30
Diainabo, Kayembe Jacques. "Macromolecular platinum-based anticancer agents." Thesis, 2013. http://hdl.handle.net/10539/13020.
Full textAbstract:
A thesis submitted to the faculty of Science, University of the Witwatersrand, in fulfillment of the degree of Doctor of Philosophy in Science
Johannesburg, 2012Platinum is nowadays one of the best and widely used antitumor agents in cancer chemotherapy. The numerous performances reported by many previous researchers for this metal in the fight against several malignancies led to the synthesis of many platinum complexes. However, the clinical responses related to these complexes led to the development of non-platinum compounds with metal ions which exhibit antitumor activity. Ferrocene is one of them, owing the high consideration inter alia to its environmental oxidore-ductive behavior. Methotrexate is another clinically used anticancer drug worthy to be mentioned. With a structure very close to that of folic acid, differing from it by an amine function and a methyl group, respectively, instead of an hydrogen and an hydroxyl group on the folate, methotrexate has been considered as an antagonist of folic acid by its mechanism of action in the biological environment. It has, together with platinum and non-platinum complexes, shown notorious side-effects by fighting both normal and abnormal cells despite their antineoplastic potency. This is the reason why a drug delivery system is considered as a tool to improve metal complexes and other drugs selectivity for cancer cells. The strategy of enhancing the potency of non-polymeric chemically, physically, or biologically active compounds through the expediency of binding such compounds to a polymeric carrier has revolutioned numerous technologies. In the present thesis is demonstrated the synthesis of several water-soluble macromolecular drug carriers intended for biomedical applications, and the anchoring of platinum to ferrocene-containing antineoplastic agents on one side, then to methotrexate-containing antineoplastic agents on the other side, resulting in a co-conjugate or a conjugate bearing two different drugs on a single carrier. This multidrug anchoring offers the advantage to exploit the potency of two different drugs on a single polymeric structure, each drug having its own pharmacokinetic path. Platinum is the common drug, while ferrocene and methotrexate are the various co-drugs. This order of having the platinum imparted to the polymeric carrier after the two drugs above mentioned were adopted in obedience to the strategy of having the most synthetically demanding drug incorporated in the carrier before the least one. Anchoring of the three drugs to polymeric structures was achieved in aqueous environment. Methotrexate (MTX) and ferrocene (Fc) binding were achieved via HBTU as coupling agent. In all cases, more or less, but very close to, 100% drug loading could be achieved under careful control of experimental conditions. The water-soluble polymeric carriers used are copolyaspartamides, prepared by an aminolytic ring-opening process of polysuccinimide, and copoly(amidoamines) obtained by Michael polyaddition of methylenebisacrylamide (MBA). These polymers were designed to bear amine, hydroxyl or carboxylic acid functional groups in their structure, either as part of the main chain or side chain. The functional groups herein mentioned are important for the coupling of the chemically modified drug species. Exploratory in-vitro biological studies are discussed, as the co-conjugation of the metallic antineoplastic drug, ferrocene and the antifolate methotrexate, each with the metallic drug platinum, is performed. The results of these preliminary tests show that polymer-drug conjugates and co-conjugates can play a role in future cancer therapy.
31
Mukaya, Hembe Elie. "Macromolecular antineoplastic iron and platinum co-ordination compounds." Thesis, 2014.
Find full textAbstract:
A thesis submitted to the Faculty of Science, University of the
Witwatersrand, Johannesburg, in fulfillment of the requirements for the
degree of Doctor of Philosophy of Science.
Johannesburg, 2013Chemotherapy, while representing a vital component of cancer treatment modalities, has so far not fulfilled basic expectations with unsatisfactory cure rates and frequent relapse due to limited effectiveness of the therapeutic drugs, severe side effects and resistance problems. The platinumcontaining drugs used in present clinical practice are no exception to this generalized finding. While highly effective against a small number of malignancies, they generally share in the deficiencies of other anticancer agents. To address this issue, intense research is being undertaken to develop novel platinum-compounds offering enhanced therapeutic effectiveness. To accomplish this, several new avenues of development are being pursued world-wide, and one of these involving the binding of monomeric anticancer drug systems to water-soluble, biocompatible and biodegradable polymeric carriers, was utilized in the current research. As part of the ongoing research, this dissertation demonstrates the preparation of several water-soluble polymeric carriers bearing pre-synthesized monomers aimed to anchor the platinum drug. The monomers of interest were aspartic acid, p-aminobenzoic acid and p-aminosalicylic acid derivatives; while the water-soluble carriers were polyaspartamides, prepared by an aminolytic ring-opening process of polysuccinimide. The platination agents were conjugated to the polymer backbone both via amine and via leaving-group ligands, such as dihydroxylato, dicarboxylato and carboxylatohydroxylato. In order to demonstrate the multidrug-binding capacity of the carriers, platinum complexes were co-conjugated to polymeric conjugates containing ferrocene. The in vitro studies against a human breast cancer (MCF-7) cell line showed IC50 values ranging from 48.92 μg.mL-1 to 281.37 μg.mL-1 for the platinum conjugates, 13.18 μg.mL-1 to 149.67 μg.mL-1 for ferrocene conjugates and 6.22 μg.mL-1 to 83.86 μg.mL-1 for platinum/ferrocene co-conjugates; and these values were on average 4 fold more active than the parent drug. The results of these preliminary tests provide proof of the principle that polymer-drug conjugates can play a role in future cancer therapy.
32
"Quantitative structure activity relationship (QSAR) of platinum drugs." 2006. http://library.cuhk.edu.hk/record=b5896517.
Full textAbstract:
Leung Chung Wai.Thesis (M.Phil.)--Chinese University of Hong Kong, 2006.
Includes bibliographical references (leaves 142-146).
Abstracts in English and Chinese.
ABSTRACT (ENGISH) --- p.iii
ABSTRACT (CHINESS) --- p.v
ACHKNOWLEDGEMENTS --- p.vii
TABLE OF CONTENTS --- p.viii
Chapter CHAPTER 1 --- Introduction and Background
Chapter 1.1 --- Introduction of Platinum Drugs --- p.1
Chapter 1.2 --- Mechanism of Action of Cisplatin --- p.3
Chapter 1.3 --- Structure-Activity Relationships of the Platinum Drug 、 --- p.4
Chapter 1.4 --- QS AR Parameters --- p.9
Chapter 1.4.1 --- Chemical Hardness: Descriptor of Chemical Reactivity --- p.9
Chapter 1.4.2 --- Possible Reaction Pathway of Platinum Drugs --- p.12
Chapter 1.4.2.1 --- Proposed DNA Binding Pathway of Platinum Drugs --- p.13
Chapter 1.4.2.1.1 --- Hydrolysis Pathway --- p.13
Chapter 1.4.2.1.2 --- DNA Binding Pathway Involving the S-containing Biomolecules (Methionine Pathways) --- p.16
Chapter 1.4.2.1.3 --- Conclusion --- p.21
Chapter 1.5 --- Thesis Scope --- p.22
Chapter CHAPTER 2 --- Theory and Methodology
Chapter 2.1 --- Introduction --- p.24
Chapter 2.2 --- Density Functional Theory (DFT) --- p.24
Chapter 2.2.1 --- Kohn-Sham Theorem --- p.25
Chapter 2.2.2 --- Exchange-Correlation Energy Functional --- p.27
Chapter 2.3 --- Basis Set --- p.27
Chapter 2.3.1 --- Relativistic Effective Core Potential --- p.27
Chapter 2.3.2 --- Double-Zeta --- p.28
Chapter 2.3.3 --- Polarized Basis Set --- p.29
Chapter 2.4 --- Solvation Model --- p.30
Chapter 2.4.1 --- Continuum Model --- p.30
Chapter 2.4.1.1 --- Simple Solvation Model --- p.31
Chapter 2.4.1.1.1 --- Electrostatic Component --- p.31
Chapter 2.4.1.1.2 --- Dispersion-Repulsion Interaction --- p.33
Chapter 2.4.1.1.3 --- Cavitatoin Energy --- p.35
Chapter 2.4.1.2 --- Polarized Continuum Model --- p.36
Chapter 2.5 --- Methodology --- p.39
Chapter 2.5.1 --- Calculation of DFT Global Reactivity Index --- p.39
Chapter 2.5.1.1 --- Calculation for the Reaction Intermediates --- p.41
Chapter 2.5.2 --- Calculation of the Reaction Pathways --- p.42
Chapter CHAPTER 3 --- Results and Discussion
Chapter 3.1 --- Introduction --- p.49
Chapter 3.2 --- Optimized Structure against Experimental Geometry --- p.49
Chapter 3.3 --- Kohn-Sham Orbitals --- p.54
Chapter 3.3.1 --- Location of the HOMO and LUMO --- p.55
Chapter 3.4 --- Results of the DFT Reactivity Parameter --- p.57
Chapter 3.5 --- Chemical Structure of the Drugs in the QSAR --- p.64
Chapter 3.6 --- QSAR Analysis --- p.67
Chapter 3.6.1 --- The Overall QSAR Plot of the Platinum Drugs --- p.68
Chapter 3.6.1.1 --- Empirical Applicability of the QSAR on the Platinum(IV) Drugs --- p.70
Chapter 3.6.1.2 --- Detail QASR Study According to the Type of Platinum Drug --- p.71
Chapter 3.6.1.2.1 --- QSAR Study of the non-“trans-DACH´ح Platinum Drugs --- p.72
Chapter 3.6.1.2.1.1 --- "QSAR Equation of the non-""trαns-DACH"" Platinum Drugs" --- p.75
Chapter 3.6.1.2.2 --- QSAR Analysis for the Pt-trαns-DACH Drugs --- p.77
Chapter 3.6.1.2.2.1 --- "QSAR Study of trans-S,S-DACH Platinum Drugs" --- p.79
Chapter 3.6.1.2.2.2 --- "QSAR Study of trans-R,R-DACH Platinum Drugs" --- p.80
Chapter 3.6.1.3 --- Summary --- p.81
Chapter 3.7 --- QSAR Study of the Important Intermediates Using Chemical Hardness --- p.82
Chapter 3.7.1 --- Optimized Structure for the Intermediates --- p.84
Chapter 3.7.2 --- QSAR of the Dichloride Pt-Drugs Using Chemical Hardness of Parent Compounds --- p.90
Chapter 3.7.3 --- QSAR of the Dichloride Pt-Drugs Using Chemical Hardness of Hydrolysis Intermediates --- p.91
Chapter 3.7.4 --- QSAR of the Dichloride Pt-Drugs Using Chemical Hardness of Cyclic-Methionine Intermediates --- p.93
Chapter 3.7.5 --- Conclusion --- p.95
Chapter CHAPTER 4 --- Results and Discussion
Chapter 4.1 --- Introduction --- p.96
Chapter 4.2 --- Study Scheme --- p.97
Chapter 4.3 --- Optimized Structures --- p.98
Chapter 4.4 --- Comments on the Reliability of the Calculation Model --- p.103
Chapter 4.4.1 --- Reaction Profile in the Gas Phase --- p.104
Chapter 4.4.2 --- Reaction Profiles Using Simple Solvation Model --- p.105
Chapter 4.4.2.1 --- Defects of the Simple Solvation Model --- p.107
Chapter 4.4.3 --- Reaction Profile Using PCM-UAHF Solvation Model --- p.109
Chapter 4.4.3.1 --- Selection of the Reaction Parameters for the QSAR Study --- p.112
Chapter 4.5 --- QSAR Study of Platinum Drugs Using the Reaction Parameters (AG and ΔG+) --- p.121
Chapter 4.5.1 --- QSAR Analysis Using ΔG+(hydrolysis) --- p.121
Chapter 4.5.2 --- QSAR Analysis Using ΔG(hydrolysis) --- p.123
Chapter 4.5.3 --- QSAR Analysis Using ΔG+(guanine) --- p.125
Chapter 4.5.4 --- QSAR Analysis Using ΔG(guanine) --- p.127
Chapter 4.5.5 --- Further investigation of the Bidentate Pt-drugs DNA Binding --- p.129
Chapter 4.5.5.1 --- Calculation Model --- p.129
Chapter 4.5.5.2 --- Bidentate Pt-Drugs Reactions --- p.130
Chapter 4.5.5.3 --- Selection of the Calculated Model for the QSAR Study --- p.133
Chapter 4.5.5.4 --- QSAR Analysis Using ΔG+(guanine) for the Platinum Drugs with Bidentate Caboxylate Ligands --- p.136
Chapter 4.5.5.5 --- QSAR Analysis Using ΔG(guanine) for the Platinum Drugs with Bidentate Carboxylate Ligands --- p.137
Chapter 4.5.6 --- Conclusion --- p.138
Chapter CHAPTER 5 --- Conclusion Remarks and Future Works
Chapter 5.1 --- Conclusion --- p.140
Chapter 5.2 --- Future Works --- p.141
REFERENCES --- p.142
33
Gillham, Kate J. "A detailed kinetic and mechanistic investigation into the rate of chloride substitution from chloro terpyridine platinum (II) and analogous complexes by a series of azole nucleophiles." Thesis, 2010. http://hdl.handle.net/10413/90.
Full textAbstract:
The substitution kinetics of the complexes: [Pt(terpy)Cl]Cl?2H2O (PtL1), [Pt(tBu3terpy)Cl]ClO4 (PtL2), [Pt{4?-(2???-CH3-Ph)terpy}Cl]BF4 (PtL3), [Pt{4?-(2???-CF3-Ph)terpy}Cl]CF3SO4 (PtL4), [Pt{4?-(2???-CF3-Ph)-6-Ph-bipy}Cl] (PtL5) and [Pt{4?-(2???-CH3-Ph)-6-2??-pyrazinyl-2,2?-bipy}Cl]CF3SO3 (PtL6) with the nucleophiles: imidazole (Im), 1-methylimdazole (MIm), 1,2-dimethylimidazole (DIm), pyrazole (pyz) and 1,2,4-triazole (Trz) were investigated in a methanolic solution of constant ionic strength. Substitution of the chloride ligand from the metal complexes by the nucleophiles was investigated as a function of nucleophile concentration and temperature under pseudo first-order condition using UV/Visible and stopped-flow spectrophotometric techniques. The results obtained indicate that by either changing the substituents on the terpy backbone or by slight modification of the chelate itself leads to changes in the ?-acceptor ability of the chelate. This in turn controls the electrophilicity of the metal centre and hence its reactivity. In the case of PtL3 and PtL4, the ortho substituent on the phenyl ring at the 4?-position on the terpy backbone is either electron-donating or electron-withdrawing respectively. For an electron-donating group (CH3, PtL3) the reactivity of the metal centre is decreased whilst an electron-withdrawing group (CF3, PtL4) lead to a moderate increase in reactivity. Electron-donating groups attached directly to the terpy moiety (tBu3, PtL2) also leads to a decrease in the rate of chloride substitution. Placing a strong ?-donor cis to the leaving group (PtL5) greatly decreases the reactivity of a complex while the addition of a good ?-acceptor group (PtL6) significantly enhances the reactivity. The results obtained for PtL5 and PtL6 indicate that the group present in the cis position activates the metal centre in a different manner than when in the trans position. The experimental results obtained were supported by DFT calculations at the B3LYP/LACVP+** level of theory, with the NBO charges showing a less electrophilic Pt(II) centre when a strong ?-donor cis to the leaving group was present such as in PtL5 and a more electrophilic centre for complexes with good ?-acceptor groups such as with PtL6. Surprisingly, the results indicate that in the case of PtL5, when the metal centre was less electrophilic it also appears to be less selective.Thesis (M.Sc.)-University of KwaZulu-Natal, Pietermaritzburg, 2010.
34
Odayar, Kriya. "Active targeting of cancer cells using gemcitabine conjugated platinum nanoparticles." Thesis, 2017. http://hdl.handle.net/10321/2642.
Full textAbstract:
Submitted in fulfillment of the requirements of the Degree of Master's in Biotechnology, Durban University of Technology, 2017.Nanotechnology is explained as the science of engineered materials and systems on a molecular scale. This innovation is currently used in a wide variety of applications which include using these nanoparticles as drug delivery vehicles. Such nanocarriers are relatively smaller than 100 nm in size with the ability to convey therapeutic drugs to a number of disease sites. Platinum-based nanoparticles have been extensively used in a number of applications namely catalysts, gas sensors, glucose sensors and cancer therapy. The properties of platinum nanoparticles (PtNP’s) typically depend on characteristics such as shape, particle size, elemental composition and structure, all of which can be manipulated and controlled in the fabrication process. Their unique size in the nanometer scale makes platinum nanoparticles an ideal candidate as targeted drug delivery vehicles. To target an anticancer drug to a diseased site is a distinctive feature of most studies, which aim to transfer an adequate dosage of the drug to cancer cells. Transport systems used as carriers of anticancer drugs offer numerous advantages, which include improved efficacy and a decrease in toxicity towards healthy cells when compared to standard drugs. The aim of this study was to determine the effect of platinum nanoparticles, gemcitabine and gemcitabine conjugated platinum nanoparticles (Hybrids) against cancer cells and healthy cells and to determine the mode of cell death and cell death pathways using flow cytometry. Platinum nanoparticles were synthesized via the reduction of hexachloroplatinic acid using sodium borohydride in the presence of capping agents. Synthesized platinum nanoparticles and the hybrids were characterized by observing peaks at 301 nm and 379 nm respectively using UV-visible spectroscopy. TEM images revealed that the PtNP’s and the conjugate compounds were spherical in shape with core sizes of 1.14 nm - 1.65 nm and 1.53 - 2.66 nm respectively. The bioactivity platinum nanoparticles, gemcitabine and the hybrids were investigated using MCF7 and Melanoma cancer cells at different concentrations from 0.10 to 100 µg/ml. Results indicated that conjugated nanoparticles induced the highest cell inhibition against both cell lines compared to gemcitabine and platinum nanoparticles. Bioactivity against PBMC (peripheral blood mononuclear) cells indicated that all three compounds show little or no effect towards the healthy cell line compared to the control. Melanoma cell line was used to determine the mode of cell death. Apoptosis was detected using Annexin V-FITC to detect membrane changes, JC-1 to detect a loss in mitochondrial membrane potential and caspase-3 assay kits. Results indicated that a significant amount of cell death was caused by cleavage of caspase-3. Nanoparticle drug delivery is an area that has shown significant promise in cancer treatment. Interaction of nanoparticles with human cells is an interesting topic for understanding toxicity and developing potential drug candidates. Imagine, something that is atleast or more than 80,000 times smaller than the edge of the ridge on a fingertip and unlocks a new wilderness into cancer research. Nanotechnology, known as the science of minute, is changing the approach to cancer and especially future diagnosis and treatment. Nanotechnology permits scientists to fabricate new apparatuses that are definitely smaller than cells, giving them the chance to attack tumor diseased cells. This innovation not just empowers practitioners to recognize malignancies prior but additionally holds the guarantee of halting cancer growth before it further develops. This progressive approach is so exact, specialists will in future be able to outline a unique treatment for an individual’s own restorative and hereditary profile. Researchers are designing nanoparticles that detect and destroy diseased cells and this optimistic innovation could be personalized for targeted drug delivery, enhanced imaging and ongoing affirmation of cancer cell death. The National Cancer Institute remains hopeful that facilitated development, nanotechnology will drastically change cancer treatment.
M
35
"An investigation into the influence of bridging diamine linkers on the substitution reactions of dinuclear platinum II complexes." Thesis, 2005. http://hdl.handle.net/10413/1953.
Full text
36
Nikolayenko, Varvara I. "A kinetic and mechanistic study of dinuclear platinum (II) complexes with bis-(4'-terpyridyl)-a,w-alkyldiol ligands." Thesis, 2012. http://hdl.handle.net/10413/9224.
Full textAbstract:
A series of novel Bis 2,2':6',2″-terpyridinyl ligands, linked through a flexible alkyl chain situated at the 4' position, were synthesised and characterised by microanalysis, FTIR, NMR, UV-Visible spectroscopy, and MS-ToF. Single crystals of all the ligands were obtained, of which one has been published, one has been submitted for publication and one is in preparation for publication. These ligands were then coordinated to platinum(II) and characterised, including ¹⁹⁵Pt NMR spectroscopy. A detailed kinetic study involving the substituting the chloride co-ligand with the following nucleophiles thiourea, 1,3-dimethyl-thiourea and 1,1,3,3-tetramethyl-thiourea was conducted using stopped-flow
techniques. An associative reaction mechanism was suggested for the pendant ligand substitution and the following trend in reactivity was observed: L2-Ptα > L3-Ptβ > L1-Ptχ. UV-Visible absorption spectra were recorded on sequentially diluted solutions of the ligands (in chloroform), and the platinum complexes (in water). These spectra obeyed the Beer-Lambert law. The values of the molar absorption coefficients at the wavelengths of maximum absorption for the ligands followed the trend L1 < L2 < L3, whilst for the complexes the trend was L1-Pt < L3-Pt < L2-Pt. It has been concluded that at low concentrations L2-Pt and L3-Pt undergo intramolecular folding. Variable temperature and variable concentration NMR spectroscopic studies were performed on all three complexes. At higher complex concentrations intermolecular self-association takes place for L2-Pt and L3-Pt but not for L1-Pt. The reactivity of the complexes is predominately determined by their structural conformations in solution. At low concentrations the L1-Pt complex remains in its linear conformational state, whilst the L2-Pt and L3-Pt complexes undergo intramolecular folding with the formation of an axial Pt—Pt bonded and π—π stacked
dinuclear platinum terpyridine centre. The latter is believed to be more active in the substitution reaction than the original mononuclear centre. The reasons for the folding and self-association in the L2-Pt and L3-Pt systems are related to the steric crowding and stress
in the spacer region of the folded or self-associated complexes.Thesis (M.Sc.)-University of KwaZulu-Natal, Pietermaritzburg, 2012.
37
"Anticancer activity and mechanistic study of a series of platinum complexes integrating demethylcantharidin with isomers of 1,2-diaminocyclohexane." Thesis, 2006. http://library.cuhk.edu.hk/record=b6074234.
Full textAbstract:
Aim. The aim of this study was to synthesize and characterize novel analogues of [DACH-Pt-DMC] by using different stereoisomers of DACH; and to investigate any differences in in vitro activity of these complexes in human hepatocellular carcinoma (HCC), colorectal carcinoma (CRC) cell lines and acquired cisplatin or oxaliplatin resistant sub-lines, and to compare that of oxaliplatin and other established Pt-based anticancer agents. Mechanistic roles of DACH-Pt- and DMC components of the TCM-Pt complexes on affecting HCT 116 human CRC cell line were investigated by flow cytometry, COMET assay and cDNA microarray analysis.Background. Demethylcantharidin (DMC), a modified component of the traditional Chinese medicine (TCM), integrated with a platinum (Pt) moiety created a series of TCM-Pt complexes [Pt(C8H8O 5)(NH2R)2] 1-5 which demonstrated superior antitumor activity and circumvention of cisplatin resistance in vitro. Compound 5, derived from the 1,2-diaminocyclohexane (DACH) ligand (where R=trans-C6H10) had the most potent antitumor activity and closest structural resemblance to oxaliplatin (R,R-DACH-Pt complex) which is the first Pt-based anticancer drug to demonstrate convincing clinical activity against colorectal cancer and has a mechanism of action and resistance that is clearly different from that of cisplatin and carboplatin.
Conclusion. This study is the first to examine the mechanism of anticancer activity of new complexes that integrate DMC with different isomers of DACH. It has shown that both DACH-Pt- and DMC components contribute significantly to the compounds' potent anticancer activity, but likely with different mechanisms of action. The DACH-Pt- component appears to dictate the cell cycle distribution, whereas the DMC component appears to enhance cytotoxicity by inducing more DNA damage in HCT 116 colorectal cancer cells.
Methods. DMC was reacted with appropriate DACH-Pt-(NO3) 2 intermediates, which were prepared from treatment of K2PtCl 4 with stereoisomeric DACH (RR-, SS- & cis-), followed by reaction with silver nitrate. Proton NMR, high-resolution MS, polarimetry and circular dichroism (CD) spectroscopy were used to characterize their chemical structures and optical activities. In vitro antitumor activity (IC50 of 72hr drug exposure time) were assessed by a standard MTT assay. Cell cycle analysis by flow cytometry was determined at 0, 6, 12, 18, 24, 48 and 72 h after drug treatment (cisplatin, carboplatin, oxaliplatin, DMC, compound 1 or trans-DACH-Pt-DMC analogues) at IC50 and 5 x IC50 concentrations with three to four replicates. Comet assay was performed with a fluorescent microscope and used to examine DNA damage after drug treatments (50muM of cisplatin, carboplatin, oxaliplatin, DMC, compound 1 or R,R-DACH-Pt-DMC) for 3hr. cDNA microarray was performed on Affymetrix Human Genome U133A Set and used to analyze gene expression profiles in HCT 116 exposed to trans-(+/-)-DACH-Pt-DMC or oxaliplatin at their IC50 for 72hr.
Results. The in vitro results showed that the trans-analogues were consistently the most potent amongst all the compounds tested in both HCC and CRC cell lines: the trans-(+)(1R,2R)-DACH-Pt-DMC complex, in particular, was the most effective stereoisomer. All of the stereoisomeric DACH-Pt-DMC complexes and oxaliplatin were apparently able to circumvent cisplatin resistance in Huh-7 and SK-Hep1 sub-lines, but cross resistant with oxaliplatin in HCT 116 oxaliplatin resistant sub-line. Flow cytometric analysis revealed the novel trans-DACH-Pt-DMC analogues and oxaliplatin behaved similarly: that is, the compounds at 5 x IC50 concentrations all caused a significant decrease in the S-phase population within 18h and at the same time induced G2/M arrest, and without obvious sub-G 1 phase accumulation, but distinct from that of cisplatin, carboplatin or DMC. Comet assay showed that trans-(+)-(1R,2 R)-DACH-Pt-DMC caused the most significant DNA damage at an equivalent molar concentration. Microarray analysis suggested that the mechanistic role of the DMC ligand can induce the cell cycle to accelerate from the G 1 to S-phase and cause M-phase arrest.
Yu Chun Wing.
"July 2006."
Advisers: Yee-ping Ho; Chik Fun Steve Au-Yeung.
Source: Dissertation Abstracts International, Volume: 68-03, Section: B, page: 1586.
Thesis (Ph.D.)--Chinese University of Hong Kong, 2006.
Includes bibliographical references (p. 191-232).
Electronic reproduction. Hong Kong : Chinese University of Hong Kong, [2012] System requirements: Adobe Acrobat Reader. Available via World Wide Web.
Electronic reproduction. [Ann Arbor, MI] : ProQuest Information and Learning, [200-] System requirements: Adobe Acrobat Reader. Available via World Wide Web.
Abstracts in English and Chinese.
School code: 1307.
38
"In vitro evaluation of potential drug combination in cancer therapy: demethylcantharidin and platinum drug." 2007. http://library.cuhk.edu.hk/record=b5893106.
Full textAbstract:
Ng, Po Yan.Thesis submitted in: November 2006.
Thesis (M.Phil.)--Chinese University of Hong Kong, 2007.
Includes bibliographical references (leaves 109-120).
Abstracts in English and Chinese.
Acknowledgement --- p.i
Abstract --- p.ii
摘要 --- p.iii
Table of Contents --- p.iv
List of Figures --- p.viii
List of Tables --- p.xi
List of Abbreviation --- p.xii
Chapter Chapter 1 --- Introduction
Chapter 1.1 --- A General Introduction to the Development and Clinical Activities of Platinum Drugs --- p.1
Chapter 1.1.1 --- Platinum Drugs used in a Clinical Setting --- p.4
Chapter 1.1.2 --- Platinum Drugs under Clinical Trials --- p.5
Chapter 1.1.3 --- Platinum Compounds with Dual Mechanisms --- p.7
Chapter 1.2 --- Platinum Drug Antitumor Mechanism --- p.9
Chapter 1.3 --- Limitations of Platinum Drugs --- p.12
Chapter 1.3.1 --- Toxicity --- p.12
Chapter 1.3.2 --- Drug Resistance or Cross Resistance --- p.15
Chapter 1.3.2.1 --- Reduced Drug Accumulation or Increased Drug Efflux --- p.16
Chapter 1.3.2.2 --- Drug Inactivation --- p.18
Chapter 1.3.2.3 --- Enhanced DNA Repair --- p.19
Chapter 1.4 --- Why Combinational Therapy? --- p.21
Chapter 1.4.1 --- Antimetabolites --- p.20
Chapter 1.4.2 --- Topoisomerase Inhibitors --- p.22
Chapter 1.4.3 --- Tubulin-Active Antimitotic Agents --- p.24
Chapter 1.4.4 --- Demethylcantharidin as a potential candidate for drug combination --- p.28
Chapter 1.5 --- Study Objectives --- p.31
Chapter Chapter 2 --- Materials and Methods
Chapter 2.1 --- Cell Lines --- p.33
Chapter 2.2 --- Cancer Cell Preparation
Chapter 2.2.1 --- Chemicals and Reagents --- p.33
Chapter 2.2.2 --- Cell Culture Practice --- p.34
Chapter 2.2.2.1 --- Subcultures --- p.35
Chapter 2.2.2.2 --- Cryopreservation --- p.37
Chapter 2.2.2.3 --- Thawing Cryopreservated Cells --- p.38
Chapter 2.2.3 --- Development of Drug-Resistant Cell Lines --- p.39
Chapter 2.3 --- Growth Inhibition Assay
Chapter 2.3.1 --- Evaluation of Cytotoxicity in vitro --- p.40
Chapter 2.3.2 --- Drug Pretreatment --- p.43
Chapter 2.3.3 --- Drug Pre-sensitization with Concurrent Treatment --- p.44
Chapter 2.4 --- Calculations for Drug Combinations --- p.46
Chapter 2.5 --- Statistical Analysis --- p.49
Chapter Chapter 3 --- Results and Discussions
Chapter 3.1 --- In vitro Cytotoxicity and Evaluation of Drug Resistance --- p.50
Chapter 3.2 --- Role of Leaving Ligand in a Platinum Complex --- p.58
Chapter 3.3 --- Priority in Selecting the Most Effective Drug Combination --- p.66
Chapter 3.4 --- Drug Combination Studies
Chapter 3.4.1 --- Drug Combination Prescreening --- p.68
Chapter 3.4.1.1 --- Comparison of the effectiveness of the three Drug Combinations --- p.72
Chapter 3.4.1.2 --- Rationale for Drug Combination Studies presented in Section 3.4.2 & 3.4.3 --- p.73
Chapter 3.4.2 --- Drug Pre-sensitization Studies in Colorectal Cancer Cell Lines --- p.74
Chapter 3.4.2.1 --- Comparison of Drug Pre-sensitization Treatment in Sensitive Colorectal Cancer Cell Lines --- p.84
Chapter 3.4.2.2 --- Comparison of Drug Pre-sensitization Treatment in Sensitive and Oxaliplatin Resistant HCT116 Colorectal Cancer Cell Lines --- p.87
Chapter 3.4.3 --- Drug Pre-sensitization Studies in Liver Cancer Cell Lines --- p.89
Chapter 3.4.3.1 --- Comparison of Drug Pre-sensitization Treatment in Sensitive Liver Cancer Cell Lines --- p.99
Chapter 3.4.3.2 --- Comparison of Drug Pre-sensitization Treatment in Sensitive and Cisplatin Resistant SK-Hepl Liver Cancer Cell Line --- p.101
Chapter 3.5 --- Possible Explanation to the Observed Drug Combination Effect --- p.103
Chapter 3.6 --- General Protocols for Drug Combinations --- p.105
Chapter Chapter 4 --- Conclusions
Reference --- p.109
Appendices --- p.121
Chapter I a. --- "Raw Data of Pre-screening for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.122
Chapter I b. --- "Raw Data of Pre-screening for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.123
Chapter II a. --- "Raw Data of Pre-screening for SK-Hepl (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.124
Chapter II b. --- "Raw Data of Pre-screening for SK-Hepl ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.125
Chapter III a. i) --- "Isobolograms for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.126
Chapter III a. ii) --- "Raw Data for HCT116 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.127
Chapter III b. i) --- "Isobolograms for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.128
Chapter III b. ii) --- "Raw Data for HCT116 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.129
Chapter IV a. i) --- "Isobolograms for HCT1160xaR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.130
Chapter IV a. ii) --- "Raw Data for HCT1160xaR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.131
Chapter IV b. i) --- "Isobolograms for HCT1160xaR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.132
Chapter IV b. ii) --- "Raw Data for HCT1160xaR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.133
Chapter V a. i) --- "Isobolograms for HT29 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.134
Chapter V a. ii) --- "Raw Data for HT29 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.135
Chapter V b. i) --- "Isobolograms for HT29 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.136
Chapter V b. ii) --- "Raw Data for HT29 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.137
Chapter VI a. i) --- Isobolograms for Hep G2 (Cisplatin and [Pt(DMC)(NH3)2]) --- p.138
Chapter VI a. ii) --- Raw Data for Hep G2 (Cisplatin and [Pt(DMC)(NH3)2]) --- p.139
Chapter VI b. i) --- "Isobolograms for Hep G2 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.140
Chapter VI b. ii) --- "Raw Data for Hep G2 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.141
Chapter VII a. i) --- "isobolograms for SK Hep 1 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.142
Chapter VII a. ii) --- "Raw Data for SK Hep 1 (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.143
Chapter VII b.i) --- "Isobolograms for SK Hep 1 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.144
Chapter VII b. ii) --- "Raw Data for SK Hep 1 ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.145
Chapter VIII a. i) --- "Isobolograms for SK Hep ICisR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.146
Chapter VIII a. ii) --- "Raw Data for SK Hep ICisR (Cisplatin, [Pt(DMC)(NH3)2] and Pt(DMC)(NH2CH3)2])" --- p.147
Chapter VIII b. i) --- "Isobolograms for SK Hep ICisR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.148
Chapter VIII b. ii) --- "Raw Data for SK Hep ICisR ([Pt(DMC)(R,R-DACH)] and Oxaliplatin)" --- p.149
39
Alotaibi, Amal, P. Bhatnagar, Mojgan Najafzadeh, K. C. Gupta, and Diana Anderson. "Tea phenols in bulk and nanoparticle form modify DNA damage in human lymphocytes from colon cancer patients and healthy individuals treated in vitro with platinum-based chemotherapeutic drugs." 2012. http://hdl.handle.net/10454/9022.
Full textAbstract:
NoTea catechin epigallocatechin-3-gallate (EGCG) and other polyphenols, such as theaflavins (TFs), are increasingly proving useful as chemopreventives in a number of human cancers. They can also affect normal cells. The polyphenols in tea are known to have antioxidant properties that can quench free radical species, and pro-oxidant activities that appear to be responsible for the induction of apoptosis in tumor cells. The bioavailability of these natural compounds is an important factor that determines their efficacy. Nanoparticle (NP)-mediated delivery techniques of EGCG and TFs have been found to improve their bioavailability to a level that could benefit their effectiveness as chemopreventives. AIM: The present study was conducted to compare the effects of TFs and EGCG, when used in the bulk form and in the polymer (poly[lactic-co-glycolic acid])-based NP form, in oxaliplatin- and satraplatin-treated lymphocytes as surrogate cells from colorectal cancer patients and healthy volunteers. NPs were examined for their size distribution, surface morphology, entrapment efficiency and release profile. Lymphocytes were treated in the Comet assay with oxaliplatin and satraplatin, washed and treated with bulk or NP forms of tea phenols, washed and then treated with hydrogen peroxide to determine single-strand breaks after crosslinking. The results of DNA damage measurements by the Comet assay revealed opposite trends in bulk and NP forms of TFs, as well as EGCG. Both the compounds in the bulk form produced statistically significant concentration-dependent reductions in DNA damage in oxaliplatin- or satraplatin-treated lymphocytes. In contrast, when used in the NP form both TFs and EGCG, although initially causing a reduction, produced a concentration-dependent statistically significant increase in DNA damage in the lymphocytes. These observations support the notion that TFs and EGCG act as both antioxidants and pro-oxidants, depending on the form in which they are administered under the conditions of investigation.