Journal articles on the topic 'Phylogenetic analysis program (PAUP)'
To see the other types of publications on this topic, follow the link: Phylogenetic analysis program (PAUP).
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Phylogenetic analysis program (PAUP).'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
SEVİNDİK, Emre, Hüseyin UYSAL, and Zehra Tuğba MURATHAN. "Genetic Diversity Based on ISSR Markers of Apple Genotypes in Ardahan/Turkey." Notulae Scientia Biologicae 10, no. 4 (December 21, 2018): 554–58. http://dx.doi.org/10.15835/nsb10410347.
Full textAbstract:
Within the present study, it was conducted a genetic diversity analysis using ISSR markers for some apple genotypes grown in Ardahan region, Turkey. Total genomic DNA (gDNA) isolation from apple leaves was performed using commercial kits. Five ISSR primers were used to determine the genetic diversity among the genotypes studied. Polymerase Chain Reaction (PCR) was performed with all gDNA samples to produce bands to score. PCR products were run in agarose gel and visualized under UV light. Bands on the gels were scored as “1”, while no bands at the corresponding positions were scored as “0”, to generate the matrix file. Five ISSR primers produced a total of 35 bands, and 20 of them were polymorphic. The polymorphic bands rated approximately 57%. Phylogenetic relationships and genetic distances between the genotypes were calculated by using the PAUP [Phylogenetic Analysis Using Parsimony (and Other Methods)] program. According to the PAUP data, the closest genetic distance was 0.03704 between ‘Kaburga’ and ‘Japon Apple’ genotypes, while the furthest genetic distance was 0.48148 between ‘Karanfil Apple’ and ‘Sisli Uruset’. The phylogenetic analysis obtained using UPGMA algorithm produced a phylogenetic tree with two clades. The results suggest that ISSR markers are useful tools for determining genetic relationships among apple genotypes.
2
SEVİNDİK, Emre, Serkan CANER, and Mahmut COŞKUN. "Molecular Characterization of Vitex agnus-castus L. (Verbenaceae) Populations Grown in Aydin, Turkey." Notulae Scientia Biologicae 11, no. 2 (June 28, 2019): 218–21. http://dx.doi.org/10.15835/nsb11210418.
Full textAbstract:
In this study, we performed a genetic diversity analysis using RAPD markers for some Vitex agnus-castus populations grown in Aydin, Turkey. Total genomic DNA isolation from the leaves of Vitex agnus-castus was performed using a commercial kit. Seven RAPD primers (OPA-02, OPA-05, OPA-13, OPA-15, OPA-16, OPA-18, OPA-20) were used to determine genetic diversity among populations. Polymerase Chain Reaction (PCR) was performed with all genomic DNA samples and primers. PCR products were run in agarose gel electrophoresis and visualized under UV light. The amplified products were scored as bands (1) and no bands (0) for all gel images and their matrix files were generated. A total of 36 characters were obtained from the primers. Phylogenetic relationships and genetic distances between the cultivars were calculated by using the PAUP* (Phylogenetic Analysis Using Parsimony and other methods) program. According to PAUP analysis, the closest genetic distances were between Çine pink flower and Çakmar purple flower, and Çakmar pink flower and Çakmar purple flower populations with a value of 0.05556; and the greatest genetic distance was between Çakmar pink flower and Köşk purple flower populations with a value of 0.36111. In the phylogenetic analysis obtained using UPGMA algorithms, the phylogenetic tree consisted of four groups. The results suggest that RAPD markers are useful tools for determining genetic relationships among Vitex agnus-castus genotypes.
3
Sevġndġk, Emre, Yavuz Paksoy, Melike Aydoğan, and Feyzanur Topseçer. "Genetic variation and molecular relationships taxa of Conringia heist. ex Fabr. (Brassicaceae) based on RAPD markers in Turkey." Genetika 52, no. 1 (2020): 107–14. http://dx.doi.org/10.2298/gensr2001107s.
Full textAbstract:
In this study, genetic variation and phylogenetic analysis of 13 populations of 6 species belonging to Conringia genus spreading in Turkey were performed using RAPD markers. Genomic DNA isolation from the leaves of the Conringia plant samples was performed via using a commercial kit. Seven RAPD primers were used to identify the genetic diversity between the populations. Polymerase Chain Reaction (PCR) was performed using DNA samples and primers. PCR products were resolved using agarose gel electrophoresis and visualized under UV light. All gel images were analyzed, and the absence and presence of polymorphic bands were scored. The total of 34 DNA bands were detected by seven RAPD primers. PAUP 4.0b10 analysis program was used to calculate phylogenetic tree and genetic distances between the species. The phylogenetic tree was obtained using the UPGMA algorithm and it was composed of two clades. According to the PAUP analysis, the species having the closest distance between each other are C. planisiliqua (Ankara-Aya?) and C. planisiliqua (Ankara-Nall?han) with the value of 0.000 and those having the longest distance are C. grandiflora (Akseki ?ukurk?y) and C. orientalis (Elaz??-Baskil) with the value of 0.6000. The results suggest that the RAPD markers are useful tools to demonstrate the genetic relationships between populations of the Conringia species.
4
Hubbard, Mark, John Kelly, Sriyani Rajapakse, Robert Ballard, and Albert Abbott. "PRELIMINARY RESULTS OF PHYLOGENETIC STUDIES WITHIN THE GENUS ROSA (ROSACEAE)." HortScience 25, no. 9 (September 1990): 1159c—1159. http://dx.doi.org/10.21273/hortsci.25.9.1159c.
Full textAbstract:
We have initiated a phylogenetic study using restriction fragment length polymorphisms to examine nuclear DNA variation in a number of Rosa species. Random genomic clones were isolated from the cultivar `Confection'. To generate these clones, genomic DNA was digested with the restriction enzymes Hind III and Eco RI and the resulting fragments cloned into a pUC8 plasmid and transformed into the E. coli bacterial strain JM83. Individual clones from the DNA library were screened for polymorphism by Southern hybridization methods. Those clones displaying polymorphisms were used in combination with one, two, or three restriction enzymes to identify different size restriction fragments. Each fragment was treated as a unit character and was used to generate a phylogenetic tree using the computer program “Phylogenetic Analysis Using Parsimony” (PAUP version 3.0). Results of the studies on the amount of genetic diversity and phylogenetic affinities of Rosa species among the different sections of the subgenus Rosa will be presented.
5
Irinyi, László, György Kövics, and Erzsébet Sándor. "Phylogenetic studies of Phoma species by maximum likelihood analysis." Acta Agraria Debreceniensis, no. 30 (October 10, 2008): 37–46. http://dx.doi.org/10.34101/actaagrar/30/2989.
Full textAbstract:
The cosmopolitan Phoma genus contains mainly phytopathogenic, opportunistic parasite, and saprophyte fungal species. Up to now the characterization of Phoma species and other taxa of Phoma has so far been determined on the basis of morphology on standardized media, and gene sequence analysis was only used as a confirmative or distinctive complement.In this study we have tried to study phylogenetic relationships by maximum likelihood method in the Phoma genus. We employed a part of the gene responsible for the synthesis of translation elongation factor 1 subunit alpha protein (tef1) containing both introns and exons, a part of the gene responsible for synthesis of tubulin protein and ITS region containing the internal transcribed spacer regions 1 and 2 and the 5.8S rDNA as potential genetic markers to infer phylogenetic relationships among different Phoma taxa. Twenty-four isolates of eleven different Phoma species were firstly characterised by morphologically, and then their tef1, tubulin and ITS sequences were sequenced and analysed by maximum likelihood method carried out by PAUP*4.0b program. According to constructed phylogenetic trees, the different Phoma taxons are well separated. However these trees do not support the traditional Phoma sections based on morphological characterization.The maximum likelihood analyses of all three sequences confirmed that the Phyllosticta sojicola species is clustered with the Phoma exigua var. exigua group and the Phoma sojicola is grouped with Phoma pinodella group. The experienced molecular evidences initiate the demand of reclassification of formerly mentioned soybean pathogens.
6
Read, Helen J. "The generic composition and relationships of the Cylindroiulini - a cladistic analysis (Diplopoda, Julida: Julidae)." Insect Systematics & Evolution 21, no. 1 (1990): 97–112. http://dx.doi.org/10.1163/187631290x00085.
Full textAbstract:
AbstractAn analysis is given of the relationships between the genera of the tribe Cylindroiulini. The situation at present is reviewed first. Various characters are described which are subsequently used in the construction of a cladogram. The result is the splitting of the genus Allajulus Koch into three genera, Allajulus, Cylindroiulus Verhoeff, and Kryphioiulus gen. n., this last genus being erected for occultus C. L. Koch. Use of a computer program, PAUP (phylogenetic analysis using parsimony), in general confirms these divisions. The nominal genera Micromastigoiulus Verhoeff, Dendroiulus Verhoeff, Solaenoiulus Schubart, Olisteroiulus Lohmander are synonymized with Cylindroiulus. The position of the Cylindroiulini within the family Julidae is also discussed and a preliminary phylogeny presented. A key to the genera and species of the tribe Cylindroiulini, omitting species in the genus Cylindroiulus, is given in an appendix.
7
Alarie, Yves, and Chris H. S. Watts. "Larvae of the genus Antiporus (Coleoptera : Dytiscidae) and phylogenetic implications." Invertebrate Systematics 18, no. 5 (2004): 523. http://dx.doi.org/10.1071/is03025.
Full textAbstract:
The larvae of Antiporus blakeii (Clark), A. femoralis (Boheman), A. gilbertii (Clark), A. hollingsworthi Watts, A. jenniferae Watts, A. uncifer Sharp and A. willyamsi Watts are described with an emphasis on chaetotaxy of the head capsule, head appendages, legs, last abdominal segment and urogomphi. A parsimony analysis based on 17 informative larval characteristics was conducted using the program PAUP*. The 11 most parsimonious trees support a monophyletic origin of the genera Antiporus Sharp, Nebrioporus Régimbart, Scarodytes Gozis, and Stictotarsus Zimmermann. Unambiguous synapomorphies supporting this clade are the presence of natatory setae on the femur, tibia and tarsus and the presence of a very elongate urogomphomere 1. It is postulated that these features evolved as swimming devices. The genus Oreodytes Seidlitz is postulated to represent the sister-taxon of Antiporus + Nebrioporus + Stictotarsus + Scarodytes and this clade is characterised by the absence of the maxillary cardo and insertion of the primary seta MX1 on the maxillary stipes.
8
Trueman, John, and Warwick Nicholas. "The taxonomy of the family Xyalidae Chitwood, 1951 (Monhysterida: Nematoda): a cladistic analysis." Nematology 4, no. 4 (2002): 453–70. http://dx.doi.org/10.1163/156854102760290446.
Full textAbstract:
AbstractA cladistic analysis of the family Xyalidae has been carried out, with selected Monhysteridae and Sphaerolaimidae as presumptive outgroups. Forty nine characters, taken from published descriptions, were scored for 91 species from 33 genera. The way in which the characters were coded is illustrated by drawings and graphs. Phylogenetic analyses were conducted with the programs PAUP*4.0d65 and PAUP*4.0b2. Neighbour-joining and parsimony trees were constructed and the preferred consensus parsimony tree is presented. The tree has been divided into 15 groups for purposes of discussion. All eight species of Monhysteridae form a separate clade consistent with outgroup status, but the four species of Sphaerolaimidae are not separated from Xyalidae. Several of the Daptonema species, Pseudosteineria plus Steineria, and Rhynchonematinae form three well supported clades. Other groupings are much less well supported and are presumed to be paraphyletic. Many published descriptions do not include sufficient detail to allow relationships to be determined and suggestions are made as to data which should be included in future taxonomic descriptions of Xyalidae.
9
Báez, Diana P., Néstor Ardila, Ángel Valdés, and Arturo Acero P. "Taxonomy and phylogeny of Armina (Gastropoda: Nudibranchia: Arminidae) from the Atlantic and eastern Pacific." Journal of the Marine Biological Association of the United Kingdom 91, no. 5 (January 21, 2011): 1107–21. http://dx.doi.org/10.1017/s0025315410002109.
Full textAbstract:
Armina is the most species-rich genus of the Arminidae family with over 50 nominal species. Material of the genus Armina from the western Atlantic and the eastern Pacific was revised. Six species have been documented from the western Atlantic; however, we have determined that only four of them are valid: Armina muelleri, A. wattla, A. juliana and A. elongata. Also, only three out of seven species previously registered in the eastern Pacific were recognized in the present study: A. californica, A. cordellensis and Armina sp., an unnamed species. The phylogenetic analysis of 13 taxa and 17 characters was performed using the program PAUP (Phylogenetic Analysis Using Parsimony). The Branch-and-Bound algorithm generated a 29-step tree with the following relations: (Histiomena convolvula, (Dermatobranchus sp., ((((A. californica , (A. maculata, A. muelleri)), ((A. loveni, A. neapolitana), A. wattla)), (A. cordellensis, (Armina sp., A. juliana))), (A. tigrina, A. elongata)))). The monophyletic evidence for Armina is discussed and compared to possible speciation processes similar to those found in other Opisthobranchia groups.
10
Haas, A., and R. G. Beutel. "Phylogenetic analysis of larval and adult characters of Adephaga (Coleoptera) using cladistic computer programs." Insect Systematics & Evolution 27, no. 2 (1996): 197–205. http://dx.doi.org/10.1163/187631296x00043.
Full textAbstract:
AbstractEighty characters of larvae and adults of 35 adephagan genera, 2 polyphagan genera, and 1 cupedid genus were analyzed using the cladistic computer programs PAUP and MacClade. The analysis resulted in 1961 equally parsimonious trees of 131 steps (minimum length cladogram). The monophyly of Adephaga and of all adephagan families is confirmed. A sistergroup relationship between Gyrinidae and the remaining Adephaga, a sistergroup relationship between Spanglerogyrus and Gyrininae, the monophyly of Dytiscoidea, a sistergroup relationship between Noteridae and the remaining Dytiscoidea, a sistergroup relationship between Hygrobiidae and Dytiscidae, the monophyly of Caraboidea (Rhysodidae and Carabidae), and the monophyly of Harpalinae sensu Crowson (1955) are in agreement with earlier phylogenetic hypotheses by Beutel & Roughley (1988) and Beutel (1992a, 1993, 1995). The sistergroup relationship between Haliplidae and Dytiscoidea and the monophyly of Geadephaga (Trachypachidae + Caraboidea) are in contrast to Beutel (1992a, 1993, 1995). The high number of equally parsimonius trees is largely due to an inconsistent distribution of character states in basal carabid taxa, i.e. reversals and convergencies. Further evidence is needed for a clarification of these systematic problems.
11
Alexandre, Maria AV, Ligia ML Duarte, Alyne F. Ramos, and Ricardo Harakava. "Identification and molecular characterization of Carnation mottle virus Brazilian isolates from carnation." Horticultura Brasileira 33, no. 2 (June 2015): 257–60. http://dx.doi.org/10.1590/s0102-053620150000200019.
Full textAbstract:
Carnation mottle virus (CarMV), associated with carnation plants showing or not symptoms, was identified by host range, serology and molecular analysis of the coat protein gene. Seven samples were assayed by biological and serological tests. Two of them, one from São Paulo and another from Minas Gerais states, Brazil, which presented higher absorbance values in DAS-ELISA, were selected for molecular studies. Foliar samples were submitted to total RNA extraction, RT-PCR with specific primers, and amplicons obtained were sequenced. Phylogenetic analyses were carried out using the PAUP program after determining the nucleotide substitution model. The identity percentages between Brazilian sequences were 99%. When sequences of CP carnation isolates from other countries were compared, the identity ranged from 96-99%. CarMV isolates from São Paulo and Minas Gerais states are the first sequences obtained in Brazil, and analysis showed that they belong to the PK group and showed only two amino acids changes at positions 61 and 260. The virus presents a high genetic stability and it is readily mechanically transmitted from infected to healthy plants. This is the first report of CarMV in Minas Gerais state, of CP nucleotide sequences from Brazilian CarMV isolates, as well as molecular phylogenetic analysis in Brazil.
12
SEVİNDİK, Emre, Kemalcan OKAN, and Fadime EFE. "Analysis of Genetic Diversity Between Eriobotrya japonica (Thunb.) Lindl. (Rosaceae) Populations Growing in the Aegean Region of Turkey." Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Horticulture 77, no. 2 (November 18, 2020): 71. http://dx.doi.org/10.15835/buasvmcn-hort:2020.0012.
Full textAbstract:
In this study, we performed a genetic diversity using RAPD (Random amplified polymorphic DNA) and ISSR (Inter-simple sequence repeats) markers for some Eriobotrya japonica populations grown in the Aegean region of Turkey. PCR was performed with all DNA samples and primers with ability of scoring band. Phylogenetic analysis and pairwise genetic distance between the populations were calculated by using the PAUP analysis program. According to the RAPD data, a total of 33 bands were obtained and 21 of them were polymorphic. The closest genetic distance (0.09677) was found between Aydın and Nazilli populations, while the most distant value was found 0.44000 between Salihli and Nazilli populations. According to the ISSR data, a total of 43 bands were obtained and 18 of them were polymorphic. The closest genetic distance (0.09302) was found between İzmir and Aydın populations, while the most distant values (0.48276) were found between Denizli and Nazilli populations. As a result of this study, the rate of polymorphism obtained in ISSR technique was found to be lower than the RAPD technique.
13
Brummer, E. C., J. H. Bouton, and G. Kochert. "Analysis of annual Medicago species using RAPD markers." Genome 38, no. 2 (April 1, 1995): 362–67. http://dx.doi.org/10.1139/g95-047.
Full textAbstract:
Annual species of the genus Medicago have attracted interest as green manure and temporary forage crops. This study was conducted to determine if randomly amplified polymorphic DNA (RAPD) markers could be used to assess the variability within and among species. Several accessions of each six species (M. scutellata Mill., M. disciformis DC, M. murex Willd., M. truncatula Gaertn., M. polymorpha L., and M. rugosa Desr.) were studied. A phylogeny reconstructed with the computer program Phylogenetic Analysis Using Parsimony (PAUP) showed the same relationships as traditional taxonomy. Variation was present among accessions of all species. Several accessions were considerably different from others within the species (one of each M. scutellata and M. polymorpha) and four accessions of M. murex were differentiated by both morphology and RAPD banding patterns from the other accessions. These accessions may be useful to include in a core collection. Variation within accessions was present. Although the species are autogamous, the original seed collections may have been made from a number of plants in the same area. Also, some outcrossing or seed mixing may have occurred. Finally, at least 10 RAPD primers appear to be necessary in order to develop reliable estimates of relatedness among annual Medicago accessions.Key words: Medicago, annual medic, phylogeny reconstruction, RAPD, core collection.
14
Sevindik, Emre, Mehmet Yavuz Paksoy, and Mustafa Sevindik. "Genetic Relationship of Seven Endemic Inula L. (Asteraceae) Species Grown in Turkey." Turkish Journal of Agriculture - Food Science and Technology 10, no. 4 (May 6, 2022): 678–81. http://dx.doi.org/10.24925/turjaf.v10i4.678-681.4867.
Full textAbstract:
In this study, genetic relationship of ISSR markers of seven endemic Inula species distributed in Turkey was carried out. Plant samples were collected from different regions of Turkey in 2013 and gDNA was obtained by DNA isolation from green leaves. Genetic relationship between species was determined using 12 ISSR primers. PCR products were run on agarose gel electrophoresis and visualized under UV light. All gel images were examined and the presence and absence of polymorphic bands were scored as 0 and 1. A total of 85 bands were obtained from the primers. Of these, 74 polymorphic and 11 monomorphic bands were obtained. The total polymorphism rate was found to be approximately 87.05%. The phylogenetic tree and genetic distances between species were calculated using the PAUP 0 4.0b10 analysis program. According to the distance matrix, the genetic distance was found between the closest Inula helenium subsp. orgyalis and Inula helenium subsp. vanensis (0.29851), while the farthest between Inula sarana and Inula macrocephala (0.56000) species. The phylogenetic tree was obtained using the UPGMA algorithm, and the tree consisted of two groups. The results were compared with the morphological, palynological nrDNA and cpDNA results of the past. Our findings supported previous studies.
15
de Boer, A. J. "The phylogeny and taxonomic status of the Chlorocystini (sensu stricto) (Homoptera, Tibicinidae)." Bijdragen tot de Dierkunde 65, no. 4 (1995): 201–31. http://dx.doi.org/10.1163/26660644-06504001.
Full textAbstract:
The “Baeturia and related genera complex”, as defined earlier (De Boer, 1990) by shared aedeagal characters, is identified as the tribe Chlorocystini (sensu stricto). The Prasiini (sensu stricto) are identified as the sister group of the Chlorocystini (sensu stricto), while the genus Muda is recognized as the nearest outgroup. The phylogeny and biogeography of the sister group and outgroup is briefly discussed. Baeturia kuroiwae Matsumura is transferred to the genus Muda. A phylogenetic reconstruction of all 147 species of the Chlorocystini (sensu stricto) is presented, based on 154 characters and 409 character states. The computer program PAUP 3.1.1 (Swofford, 1993) was used for analysing the data; the genera Prasia and Muda were used as outgroups in this analysis. The results obtained from the computer analysis were slightly modified a posteriori, favouring some presumably phylogenetically important characters over strongly fluctuating ones. These final modifications were carried out with the aid of the computer program MacClade 3.0 (Maddison & Maddison, 1992). A complete data matrix and a list of characters and character states are given in an appendix; for descriptions and illustrations of these characters one is referred to previous publications.
16
SEVİNDİK, Emre, Veysel UZUN, and Fatih COŞKUN. "Sequence Analysis of the Internal Transcribed Spacer (ITS) Region of the Nuclear Ribosomal DNA (nrDNA) and Chloroplast trnL-F Region (cpDNA) of Some Lactuca L. (Asteraceae) Species in Turkey." Notulae Scientia Biologicae 8, no. 4 (December 16, 2016): 444–50. http://dx.doi.org/10.15835/nsb849884.
Full textAbstract:
In the current study, sequence analysis of some Turkish Lactuca L. species using nrITS DNA and trnL-F cpDNA sequences were performed to elucidate phylogenetic relationships among the taxa under study. Hieracium umbellatum was used as an outgroup. Different plant materials of Lactuca were collected from different parts of Turkey during excursions of summer 2013. Plant materials were either kept in silica gel or kept fresh for immediate DNA isolation. Both phenol chloroform-isoamyl alcohol method and commercial kits were used to extract genomic DNA for PCR reactions. ITS4 and ITS5A primers were utilized for ITS region, while trnLe and trnLf primers were used to amplify the trnL-F region. Obtained DNA sequences were edited both manually and by using BioEdit 7.0.4.1. Sequencing data were aligned via ClustalW program and analyzed using PAUP 4.01b10 software. nrITS sequences varied from 639 nucleotides to 735 nucleotides. Average nucleotide composition for nrITS was 22.1% (T), 27.9% (C), 23.2% (A) and 26.8% (G). It was also found that divergence values differed between 0.0000 and 0.10290. The trnL-F sequences varied from 296 nucleotides to 385 nucleotides. Average nucleotide composition of trnL-F sequences was 34.1% (T), 18.4% (C), 31.6% (A) and 16.0% (G). It was also found that divergence values differed between 0.0000 and 0.09674. Neighbour Joining (NJ) trees were constructed in order to identify the relationships among Lactuca species. Phylogenetic trees based on ITS region were found to be more useful than phylogenetic trees based on trnL-F region. After analysis of the results obtained, the data suggest that Lactuca contains 2 clades, with clade 1 having 2 subclades. These results support the prior phylogenetic studies on Lactuca and hence provide an up to date review of Turkish Lactuca species.
17
Rafidah, Nurul, Fitmawati Fitmawati, Erwina Juliantari, and Nery Sofiyanti. "VARIASI INFRASPESIES MACANG (Mangifera foetida) BERDASARKAN SEKUEN GEN rbcL." Al-Kauniyah: Jurnal Biologi 12, no. 1 (April 24, 2019): 1–7. http://dx.doi.org/10.15408/kauniyah.v12i1.5516.
Full textAbstract:
AbstrakMacang (Mangifera foetida) adalah jenis mangga kosmopolit dengan vigoritas yang kuat. Macang banyak ditemukan di perkarangan dan kebun dan bersifat semi liar. Penurunan luas lahan seperti deforestasi dapat mengakibatkan keanekaragaman kultivar macang juga mengalami penurunan secara cepat. Penelitian ini bertujuan untuk menganalisis dan merekonstruksi hubungan kekerabatan antar kultivar macang menggunakan sekuen gen rbcL. Sampel berasal dari koleksi hasil eksplorasi mangga Sumatera bagian Selatan, yaitu Provinsi Bengkulu, Lampung dan Sumatera Selatan. Ekstraksi DNA dilakukan dengan menggunakan metode CTAB yang dimodifikasi, kemudian DNA diamplifikasi dengan menggunakan primer spesifik rbcL forward dan reverse, dan dilakukan sekuensing serta analisis filogenetik. Rekontruksi pohon filogenetik menggunakan program PAUP* versi 4.0b10 dengan metode Maximum Parsimony (MP) dan Neighbor Joining (NJ). Kladogram dengan MP diperoleh dua klad, yaitu pada klad I terdiri dari kultivar Macang lonjong dan Macang lado, sedangkan klad II terdiri dari kultivar Macang bulat. Berdasarkan metode NJ, diperoleh Macang bulat memiliki jarak genetik lebih panjang sehingga dianggap sebagai individu yang lebih primitif daripada kultivar yang lain. Dengan demikian, dari penelitian ini diperoleh informasi dan bukti dari status taksonomi kultivar macang.Abstract Mangifera foetida is a species of cosmopolitan mango with strong vigor. Some M. foetida are found in some front houses and gardens and has a character of semi-wild in its cultivation. Decreases in land area, such as deforestation, can lead to a rapid decline in their diversity of cultivars. This study aimed to analyze and reconstructs the phylogenetic relationship among M. foetida cultivars using the rbcL gene sequences. Samples were collected from the exploration within the area of South Sumatra, such as Provinces of Bengkulu, Lampung and South Sumatra. The DNA extraction was carried out using the modified CTAB method, followed by DNA amplification using rbcL-specific primers, sequencing, and phylogenetic analysis. The phylogenetic trees were reconstructed using the PAUP* version 4.0b10 by using the method of Maximum Parsimony (MP) and Neighbor Joining (NJ). Cladogram of the MP tree showed two clades that the clad I consisted of M. foetida (Macang lonjong) and M. foetida (Macang lado) cultivars, whereas clad II consisted of M. foetida (Macang bulat) cultivar. The NJ tree showed that M. foetida (Macang bulat) has a longer genetic distance so it is considered as a more primitive cultivar than others. Therefore, information and evidences from the taxonomic status of the M. foetida cultivars were obtained from this study.
18
Sinaga, Nurhaidah Iriany, Zita Letviany Sarungallo, Cicilia M. E. Susanti, and Diana Irbayati. "The taxonomy, ecology, leaf anatomy and utilization of Freycinetia macrostachya, Pandanaceae in New Guinea." IOP Conference Series: Earth and Environmental Science 886, no. 1 (November 1, 2021): 012060. http://dx.doi.org/10.1088/1755-1315/886/1/012060.
Full textAbstract:
Abstract Freycinetia macrostachya is a Pandanaceae species that was first published by Martelli in 1910. The species occur majority on Coastal Forest in both northern and southern bird’s head Papua until East New Guinea. Many species of Freycinetia have only narrowest distribution and become dying on the open area, It is different to F. macrostachya. This species has ability to live both on primary and secondary forest. Purposed of the study were to obtain delimitation of species concepts, to know the phylogenetic classification of the species and relationship among other New Guinea Freycinetia species, to understanding more about ecological aspect and the ability to live on the extreme habitat, and to know about nutrient contain for developing food product from the species. Method of the study is descriptive method with revision of taxonomy as a step working and phylogenetic analysis using PAUP program with Sararanga as an out group, survey as a research technique to ecological study and it was followed by collected some specimen for anatomy leaf study. Analysis of nutrient content of F. macrostachya bracts, i.e. moisture content, ash, crude fat (soxhlet extraction), and protein (micro kjeldahl), while carbohydrates was determined using by difference method. The result showed that the species has three layers of epidermis tissue compare to other species like F. javanica that only has one layer. This is why the species could be living on the open forest. New Guinea Freycinetia have 4 groups below the genus, the first group name F. macrostachya are belonging to the imbricate leave species, now have about 40 species and the group name was given because of F. macrostachya is an older name of all species in the group. Phylogenetic analysis trees showed that this species become an old species among all New Guinea Freycinetia species. Analysis proximate of bracts show that the carbohydrate inside is about 77 %, it is meaning that we can make many food products from bracts.
19
Lavery, S. "Electrophoretic analysis of Phylogenetic relationships among Australian Carcharhinid Sharks." Marine and Freshwater Research 43, no. 1 (1992): 97. http://dx.doi.org/10.1071/mf9920097.
Full textAbstract:
The phylogenetic relationships of 17 species of carcharhinid sharks and four other closely related species were examined by allozyme electrophoresis. Genetic data from 38 loci were used in three different techniques of phylogeny reconstruction (including both phenetic and cladistic methods). The two most instructive trees were produced by using maximum parsimony (PAUP) and Distance Wagner procedures. There was evidence that both the genus Carcharhinus and the family Carcharhinidae may actually comprise paraphyletic groups. A number of proposed morphological species groups were shown to also be closely related genetically. These included C. limbatus/C. tilstoni/C. amblyrhynchoides, C. melanopterus/C. cautus, and C. amblyrhynchos/C. albimarginatus. There appears to be a distinct lineage within the Carcharhinidae that may be characterized by the absence of the interdorsal ridge.
20
Hernández-Jiménez, Carlos A., Oscar Flores-Villela, Aranzazú Aguilar-Bremauntz, and Jonathan A. Campbell. "Phylogenetic relationships based on morphological data and taxonomy of the genus Salvadora Baird & Girard, 1853 (Reptilia, Colubridae)." European Journal of Taxonomy 764 (August 25, 2021): 85–118. http://dx.doi.org/10.5852/ejt.2021.764.1473.
Full textAbstract:
The genus Salvadora has not been subjected to a modern phylogenetic analysis. Described in 1853, its taxonomic history is complex and confusing. In this study, we evaluate the monophyly of the genus and present the first phylogenetic hypothesis based on an analysis of 66 qualitative and quantitative morphological characters of over 1000 specimens representing all described taxa across their entire distribution. Morphological characters were processed in Fast Morphology for subsequent phylogenetic analysis in PAUP under the maximum parsimony criterion. We obtained a single tree in which Salvadora appears as a monophyletic group with two clearly defined geographic species groups: a southern mexicana group and a northern grahamiae group. Based on our phylogenetic hypothesis, we evaluate the taxonomic status of all described taxa. Additionally, we include a diagnosis for all species, distribution maps, and an illustrated dichotomous taxonomic key of the genus.
21
Ryss, A. Y. "Taxonomy, evolution and phylogeny of the genus Radopholus (didelphic species) according to morphological data, with a key to species (Nematoda: Tylenchida)." Zoosystematica Rossica 11, no. 2 (June 25, 2003): 243–56. http://dx.doi.org/10.31610/zsr/2002.11.2.243.
Full textAbstract:
Present taxonomic status and synonymy of the didelphic species of the genus Radopholus Thorne are considered. A monoentry polytomous key to Radopholus is presented, as well as the rows of characters and a matrix of species and characters which were used for the phylogenetic analysis in the PAUP package. Phylogenetic tree of the genus includes four main species groups (clusters); all the species of the Indo-Asian origin (not inhabiting Australia and Oceania) form a separate monophyletic branch. Basing on the frequency analysis of the character states among the species of the genus, the conclusions on the main morphological adaptations of Radopholus are drawn.
22
SOFYALIOĞLU, Erengül, Emre SEVİNDİK, and Hüseyin UYSAL. "Genetic Diversity of Elaeagnus angustifolia L. (Elaeagnaceae) Populations in İzmir (Turkey)." Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca. Agriculture 78, no. 1 (May 14, 2021): 35. http://dx.doi.org/10.15835/buasvmcn-agr:2020.0048.
Full textAbstract:
This study was performed out genetic diversity of some Elaeagnus angustifolia L. populations growing in İzmir province by using ISSR markers. In the study, PCR was performed using 15 ISSR primers. PCR products were run in agarose gel and visualized under UV light. Amplified products were scored as follows. A total of 46 bands were produced from 15 ISSR primers, of which 27 were polymorphic. The proportion of polymorphic bands was evaluated as approximately 58.7%. Genetic distances between phylogenetic trees and genotypes were calculated using the PAUP program. The phylogenetic tree consists of two large clades. The longest distance between populations was between Gümüldür-Özdere and Çeşme-Alaçatı population with a value of 0.50, while the closest distance was between Çeşme-Ayayorgi and Konak-Hatay populations with a value of 0.06. The results show that ISSR markers are useful tools for determining genetic relationships between E. angustifolia populations
23
COLLUCCI, ELIANA. "Phylogenetic analysis of the subgenus Kerteszia of Anopheles (Diptera: Culicidae: Anophelinae) based on morphological characters." Insect Systematics & Evolution 34, no. 4 (2003): iii—372. http://dx.doi.org/10.1163/187631203x00018.
Full textAbstract:
AbstractCollucci, E. & Sallum, M. A. M.: Phylogenetic analysis of the subgenus Kerteszia of Anopheles (Diptera: Culicidae: Anophelinae) based on morphological characters. Insect Syst. Evol. 34: 361-372. Copenhagen, December 2003. ISSN 1399-560X. A phylogenetic analysis was carried out for 12 species of Anopheles (Kerteszia) Theobald with Anopheles (Nyssorhynchus) oswaldoi (Peryassü), An. (Stethomyia) kompi Edwards and An. (Lophopodomyia) squamifemur Antunes as outgroup species. Sixty-six characters were coded from the external morphology of the adult male, adult female, fourth-instar larva and pupa, and analyzed under the parsimony criterion using PAUP. The results confirm that Kerteszia, and the clade Kerteszia + Nyssorhynchus, are both monophyletic. Bootstrap support was ≥ 50% for all internal nodes, except for the (An. bellator + An. homunculus) clade which was < 50%. The results of this study allow a confident estimate of the relationships of species within Kerteszia.
24
Astarini, Ida A., Julie A. Plummer, Rachel A. Lancaster, and Guijun Yan. "Fingerprinting of cauliflower cultivars using RAPD markers." Australian Journal of Agricultural Research 55, no. 2 (2004): 117. http://dx.doi.org/10.1071/ar03012.
Full textAbstract:
Randomly amplified polymorphic DNA (RAPD) was used to investigate genetic relationships among 25 cultivars of cauliflower (Brassica oleracea var. botrytis L.). Forty decamer primers were examined, among which 15 primers produced polymorphism. Twenty-five polymorphic bands were observed, ranging in size from 428 to 1646 bp. A fingerprinting key was generated using these polymorphic bands. A dendogram was constructed using neighbour-joining analysis based on phylogenetic analysis using parsimony (PAUP). Results indicate that RAPD markers can be used for the routine identification of cauliflower cultivars within B. oleracea var. botrytis L.
25
Pitkin, Linda M. "The Holarctic genus Teleiopsis: host-plants, biogeography and cladistics (Lepidoptera: Gelechiidae)." Insect Systematics & Evolution 19, no. 2 (1988): 143–91. http://dx.doi.org/10.1163/187631289x00131.
Full textAbstract:
AbstractTeleiopsis, a Holarctic though predominantly Palaearctic genus, is revised and eleven species are recognized. Three of these are newly described and one new generic combination is established. Keys to the species of Teleiopsis and figures of moths and their male and female genitalia are given. A cladistic analysis was carried out using PAUP (Phylogenetic Analysis Using Parsimony); the results are discussed and a consensus classification of the species is derived. Biological data, as far as known, are given for each species. Host-plant and biogeographical relationships within the genus are analysed and factors influencing intraspecific variation are discussed.
26
Koenemann, Stefan, and John Holsinger. "PHYLOGENETIC ANALYSIS OF THE AMPHIPOD FAMILY BOGIDIELLIDAE S. LAT., AND REVISION OF TAXA ABOVE THE SPECIES LEVEL." Crustaceana 72, no. 8 (1999): 781–816. http://dx.doi.org/10.1163/156854099503960.
Full textAbstract:
AbstractThe increasing number of world-wide discoveries of subterranean amphipods, especially during the last two decades, has led to additions of numerous new taxa in the stygobiont family Bogidiellidae s. lat. To date, the family is composed of 23 genera and 11 subgenera, and approximately 110 described species. However, given the uneven quality of generic and subgeneric diagnoses in the literature, there is considerable confusion regarding the status of some of the taxa at these levels. Even the family itself lacks a clear definition. In order to gain a better knowledge of the phylogeny of this group, a cladistic analysis, employing both PAUP 3.0s and MacClade, was performed on the genera and subgenera currently assigned to the Bogidiellidae s. lat. Supported by the results of this analysis, the taxonomic structure of this group is completely revised above the species level. The revision excludes 5 genera from the family, all remaining subgenera are elevated to generic level. Four taxa are split, resulting in 5 new genera. The family Bogidiellidae now consists of 33 genera. Die wachsende Zahl weltweiter Neuentdeckungen von Grundwasser-Amphipoden, insbesondere wahrend der letzten zwei Jahrzehnte, erweiterte die Stygobiontenfamilie Bogidiellidae s. lat., um zahlreiche neue Taxa. Bis heute sind in der Familie etwa 110 beschriebene Arten in 23 Gattungen und 11 Untergattungen zusammengefasst. Aufgrund der unterschiedlichen Qualitat diagnostischer Beschreibungen herrscht allerdings erhebliche Verwirrung hinsichtlich des taxonomischen Status einiger Gruppen. Sogar die Definition der Familie selbst ist relativ undeutlich. Um neue Einsichten in die Phylogenie der Bogidielliden s. lat., zu erhalten, fuhrten wir eine kladistische Analyse der Gattungen und Untergattungen unter Verwendung der Computerprogramme PAUP 3.0s und MacClade durch. Die Resultate dieser Analyse dienten als hilfreiche Erganzung bei der umfassenden taxonomischen Revision der Gattungen und Untergattungen. Funf Gattungen wurden aus der Familie entfernt und alle Untergattungen zu Gattungen erhoben. Das Aufspalten von vier Taxa resultierte in 5 neuen Gattungen. Die Familie Bogidiellidae besteht somit aus 33 Gattungen.
27
Almusyarofah, Munatul Khayah, Romanus Edy Prabowo, and Agus Nuryanto. "Phylogenetic analysis of ornamental Pomacentridae from the southern coast of West Java." Depik 9, no. 1 (February 22, 2020): 32–43. http://dx.doi.org/10.13170/depik.9.1.14722.
Full textAbstract:
Abstract. Pomacentridae has a wide distribution in Indonesia waters. Research on species richness of Pomacentridae has been carried out in some areas in Indonesia. However, there are no data about the relationships of Pomacentridae on the southern coast of West Java. This research aims to know the evolutionary kinship of Pomacentridae ornamental fish in Ujung Genteng and Taman Manalusu Beach, West Java. This research used a survey method with a judgment sampling technique. The parameters measured were the consistency index (CI) and character evolution of the resulting phylogenetic tree. Cladogram reconstructed based on maximum parsimony algorithm with 1000 bootstrap replicates in PAUP software. The result showed that the tree had a CI value of 0.6000 which indicated low homoplasy. Pomacentridae formed a monophyletic group when they compared with Chaetodon collare as outgroup. The Pomacentridae clade divided into two subclades. The first subclade consisted of Abudefduf indicus as a basal species, then Neoglypydodon bonang and Plectroglyphidodon lacrymatus have a closed kinship and diverged after Dascyllus trimaculatus, and then Abudefduf notatus and Abudefduf sexfaciatus have a close kinship and diverged after Abudefduf vaigiensis. The second subclade referred to as a basal group, and within this subclade, Chrysiptera brownriggii has a closely related to Chrysiptera unimaculata and diverged after Chromis opercularis.Keywords: Cladistics, damselfish, meristic, morphometric, Pomacentridae
28
Surbakti, Suriani Br. "Analisis Filogeni Thiaridae (Mollusca: Gastropoda) Papua Menggunakan Karakter Morfologi." JURNAL BIOLOGI PAPUA 4, no. 1 (October 14, 2018): 8–18. http://dx.doi.org/10.31957/jbp.530.
Full textAbstract:
The characteristics morphology and variations of shell can be used to reconstruct the sequence and phylogenetic of Thiaridae. 34 characters and 2 outgroups of Bellamya sp. from Papua and Sulawesi were used to observe 27 species Thiaridae. Phylogenetic Analysis Using Parsimony (PAUP Software Version 4.0., Swofford) and the neighbour joining cladogram were used to reconstruct the phylogenetic relationship and to group the taxa of Thiaridae based on distribution areas of genera separately. The study indicated that the taxon of Thiaridae can be groupped into 3 clades. Each clade depicts the taxon population based on their distribution areas in Batanta Island, Sorong, Manokwari, and Bintuni Gulf. All molded into one clade. Biak, Supiori, Serui, Wamena, Merauke, and Jayapura are formed one clade. Thiara, Terebia, and Melanoides are genera which formed a clade each genus. While Stenomelania molded into 3 clades. Morphology character and closed regionsof distribution tended to form ingroup clade and sister species.Key words: characters, phylogeni, Thiaridae, dan Papua.
29
hruaia, Vanlal, Lal rinmuana, J. Lalbiaknunga, and Laldinfeli Ralte. "A Study of Correlation between Morphology and Evolution of Euphorbiaceae s.l. using Taxonomic Congruence and Total Evidence." Science & Technology Journal 9, no. 1 (January 1, 2021): 49–55. http://dx.doi.org/10.22232/stj.2021.09.01.09.
Full textAbstract:
Euphorbiaceae is one of the largest family of flowering plants, in our study different species were collected from different localities of Mizoram, the collected specimens were studied and their morphological features noted. 34 genera of Euphorbiaceae s.l were used in the study. Cladistic analysis was performed in Mesquite software and Phenetic analysis was done in NTsys software. Both analyses produce a pictorial representation in a form of a tree; cladistic analysis produce phylogenetic tree (evolutionary relationship) while phenetic analysis produce phenogram (morphological relationship). The results of the aforementioned analyses were further analysed by total evidence technique and taxonomic congruence, a phylogenetic software PAUP is used for this purpose. The resultant trees were very different and comparison was done to find correlation between evolution and morphological characters. The research finds various correlation among characters like the number of locule in ovule, phyllanthoid branching and support the inclusion of genus like Breynia, Sauropus into Phyllanthus.
30
Gelder, S. R., and R. O. Brinkhurst. "An assessment of the phylogeny of the Branchiobdellida (Annelida: Clitellata), using PAUP." Canadian Journal of Zoology 68, no. 6 (June 1, 1990): 1318–26. http://dx.doi.org/10.1139/z90-197.
Full textAbstract:
Analyses using PAUP (phylogenetic analysis using parsimony) were conducted on a matrix of 24 taxa and 26 characters. The taxa included generalised descriptions of a haplotaxid and a lumbriculid oligochaete as outgroups with a hypothetical branchiobdellidan ancestor and 21 genera as ingroups. The branchiobdellidan taxon is a monophyly, and using anatomical characters only, is composed of three suprageneric assemblages. The taxonomic rank of the taxon and assemblages cannot be determined until they have been compared with cladistic analyses on other closely related clitellate groups. In the meantime the currently accepted ordinal rank of Branchiobdellida and the major branchiobdellidan families should continue to be used, with the latter reflecting the assemblages of the genera in our analyses: Branchiobdellidae (including Holtodrilus n.gen., Sinodrilus n.gen., and Xironodrilus), Bdellodrilidae (including Caridinophila and Hidejiodrilus n.gen.), and Cambarincolidae. An analysis with two zoogeographical characters in the matrix caused the genera to be divided into their respective North American and Eurasian groups; however, the North American Triannulata appeared constantly in the latter group. The genera in the Branchiobdellidae, as defined by us, are found in both geographical regions, and predictably the assemblage was split in two.
31
La Cerda, Iñigo Granzow-de. "Análisis cladístico de la familia Anomodontaceae." Bryophyte Diversity and Evolution 6, no. 1 (December 31, 1992): 95–104. http://dx.doi.org/10.11646/bde.6.1.11.
Full textAbstract:
The phylogenetic relationships of the species of Anomodon are analyzed along with those of Haplohymenium and Herpetineuron. Anomodon is known only from the northern hemisphere: there are four species in Mexico (several of which extend to Guatemala and/or the Caribbean islands), two in the United States and Canada, on in Europe, and the remaining in south and east Asia. Three species of Haplohymenium, Herpetineuron toccoae, H. acutifolium (Anomodon acutifolius, Granzow- de la Cerda 1989) and Pterogonium gracile are also included. Thirty-one characters for the 17 taxa were analyzed by using the PAUP program, version 3.0, for Macintosh (Swofford 1991). According to the resulting trees, the 11 species of Anomodon are monophyletic as long as it includes the species of Haplohymenium. Anomodon comprises two clads, one equivalent to the subgenus Pseudoanomodon Limpr., including A. longifolius, A. attenuatus, A. giraldii and A. rostratus; the other is equivalent to subgenus Anomodon and includes the species of Haplohymenium. Section Haplohymenium is proposed for the latter genus.
32
Park, Lisa E., and R. Douglas Ricketts. "Evolutionary History of the Ostracoda and the Origin of Nonmarine Faunas." Paleontological Society Papers 9 (November 2003): 11–36. http://dx.doi.org/10.1017/s1089332600002138.
Full textAbstract:
The Ostracoda are one of the most diverse arthropod groups alive today; they also have a tremendous fossil record. Because of their widespread environmental distributions, small size and carbonate shell, they have become extremely useful biostratigraphic and paleoenvironmental proxy indicators, particularly in nonmarine environments. Despite this utility, little is known about the phylogenetic history of this important group. We reconstructed a phylogenetic history of the major orders and suborders of Ostracoda in order to test the legitimacy of current classification schemes, determine if it is possible for ostracodes to have a Precambrian origin, and test the fidelity of some of the major morphological characters that have documented trends of either increased complexity, such as the hinge and marginal pore canals, or reduction in segments, such as the adductor muscle scar.In our phylogenetic analysis to test taxonomic fidelity, we coded seven morphological hard part characters for nine taxa from the orders Archaeocopida, Leperditicopida, Palaeocopida, Podocopida, and Myodocopida. A parsimony analysis was performed using PAUP (v. 4.0) yielding 4 trees of 17 steps with low levels of homoplasy and a strong phylogenetic signal. A majority rule consensus tree indicates there is not complete agreement between the standard classification scheme and the phylogeny produced by the characters used to establish the classification. In our complete analysis of Ostracoda, we coded 28 morphological characters that included 14 hard part and 14 soft part characters for twelve taxa that include the Archaeocopida, Leperditicopida, Podocopida, and Myodocopida. A parsimony analysis was completed using PAUP (v. 4.0) yielding 1 tree of 125 steps with low levels of homoplasy and a strong phylogenetic signal. An unrooted analysis of this character set has the Cambrian Archaeopodocopida and the Ordovician-Devonian Leperditicopida in an unresolved polytomy with much younger groups such as the Myodocopina, suggesting a much deeper split in the lineage and a possible Precambrian origin for the Ostracoda. Testing the various character state acquisitions over the tree indicates that the hinge does not show an increase in complexity within a phylogenetic context, while the adductor muscle scars do show a significant trend of decrease in complexity across the tree topology. The marginal pore canals, which are functionally tied to osmoregulation as well as carapace secretion, are extremely homoplastic, indicating that this character, which is related to nonmarine invasions and tolerances, was acquired many times throughout the evolutionary history of Ostracoda.By creating an evolutionary framework for the Ostracoda such as is presented here, we can further assess character state acquisition, and how it functionally and evolutionarily relates to ostracode paleoenvironmental tolerances. The framework will not only allow us to understand the overall evolution ofthis group but will also allow us to compare the history of the ostracode clade with other groups that also have a history ofmarine and nonmarine transitions.
33
Goloboff, Pablo A., James S. Farris, and Kevin C. Nixon. "TNT, a free program for phylogenetic analysis." Cladistics 24, no. 5 (October 2008): 774–86. http://dx.doi.org/10.1111/j.1096-0031.2008.00217.x.
Full text
34
Sanders, Jon G. "Program note: Cladescan, a program for automated phylogenetic sensitivity analysis." Cladistics 26, no. 1 (February 2010): 114–16. http://dx.doi.org/10.1111/j.1096-0031.2009.00280.x.
Full text
35
Scharninghausen, Jerrold J., Michael Faulde, and Semra Cavaljuga. "Hantavirus host/virus interactions within Southeast Europe." Bosnian Journal of Basic Medical Sciences 4, no. 4 (November 20, 2004): 13–18. http://dx.doi.org/10.17305/bjbms.2004.3353.
Full textAbstract:
Viral studies have historically approached their phylogenetic analysis without consideration of the impact of the role the host plays in evolution. Our study examines host/viral interactions through analysis of the phylogenetic relationship between hantavirus genetic sequences and host cytochrome B sequences. Phylogenetic analysis of known Hantavirus genetic sequences were performed using PAUP 3.1.1 (vers. 4.0.0d64). Only sequences available through GENBANK were analyzed. Phylogenetic analysis of hantavirus sequences revealed distinct patterns based upon geographic area. These patterns coincided with the known ranges of reservoir hosts. Multiple hosts for individual viruses and multiple viruses in a single host species for hantaviruses have been described. This may be due to accidental exposure, host-switching, co-speciation, or broad co-accommodation. Since the host is the actual environment that the virus survives in, changes in the host over time could potentially directly influence changes in the virus. Multiple viruses and hosts collide in Southeastern Europe increasing the prospect of finding distinct viral/host relationships. Rodent Cytochrome B is very well conserved and can be used to tract host lineage. By tracking the relationship of infected hosts, we theorize that patterns in host DNA will emerge that will mirror patterns in viral sequences. This analysis of the host DNA could provide an understanding into the causes of variation in hantaviral sequences, pathogenicity, transmissibility, infectivity, viral range and expand our knowledge of viral/host interactions. Surveillance for viruses in the field should include analysis of the host DNA in combination with the viral analysis.
36
Radiastuti, N., M. J. Suryani, D. N. Susilowati, R. Purnamaningsih, and K. Mulya. "The diversity of endophitic fungi on Annua mutant plantation (Artemisia annua L.) based on ITS rDNA marker." IOP Conference Series: Earth and Environmental Science 976, no. 1 (February 1, 2022): 012038. http://dx.doi.org/10.1088/1755-1315/976/1/012038.
Full textAbstract:
Abstract Artemisia annua is a plant that produces artemisinin which is an antimalarial compound. The production of artemisinin compounds is influenced by the interaction of endophytic molds with their host plants. This study was conducted to identify endophytic molds found in plant tissues of A. annua which previously had been treated by mutations with Ethyl metahnesulfonate (EMS) to increase artemisinin production levels. Identification was carried out by using BLAST analysis, while the phylogenetic tree analysis used the minimum evolution (ME) method on MEGA 7 and the maximum parsimony (MP) method on PAUP 4.0b10. Phylogenetic analysis used noncoding sequences of the Internal Transcribe Spacer (ITS) rDNA region. Twelve endophytic molds (8 isolates from leaves, 2 isolates from stems, 1 isolate from petioles, and 1 isolate from flowers) in the Biogen Culture collection. This study identified to the species level phylogenetically. The endophytic molds identified were dominated by the Sordariomycetes group. It consist of 4 species, such as Clonostachys rosea, Fusarium oxysporum, Microascus gracillis, and Scopulariopsis brevicaulis, and another species belonging to the Eurotiomycetes group, is Aspergillus sydowii. A total of 4 families were obtained, such as Nectriaceae, Bionectriaceae, Microascaceae, and Aspergillaceae. All acquired classes belong to the Ascomycota division.
37
Arup, Ulf, and Martin Grube. "Where does Lecanora Demissa (Ascomycota, Lecanorales) Belong?" Lichenologist 31, no. 5 (September 1999): 419–30. http://dx.doi.org/10.1006/lich.1999.0227.
Full textAbstract:
AbstractLecanora demissa (Körb.) Zahlbr. is a crustose, lobate lichen that produces soredia and conidiomata but no apothecia. Its placement in Lecanora has long been questioned but nothing better has been proposed. We have studied the nuclear rDNA of the ITS regions and the SSU of L. demissa. In an alignment of the ITS regions of several representatives of Lecanora s. lat. it could clearly be shown by a PAUP analysis, using Aspicilia caesiocinerea as outgroup, that L. demissa does not belong to Lecanora. In a PAUP analysis of sequences of the SSU from representatives of the order Lecanorales, using members of Saccharomycetales as outgroup, L. demissa clustered on a well-supported branch with Caloplaca chlorina. In a further analysis of the ITS sequences of L. demissa together with representatives of Caloplaca and Xanthoria using Protoparmelia as outgroup two most parsimonious trees were found. In these trees the L. demissa branch was well within a strongly supported clade with C. cerina, the type species of the genus Caloplaca. The sister taxon to L. demissa in this analysis was C. variabilis. Chemical data and characters of the conidiomata support the affinity with Caloplaca and the new combination C. demissa (Körb.) Arup & Grube is therefore proposed. A lectotype for Imbricaria demissa has been designated. The phylogenetic analysis of several representatives of the genera Caloplaca and Xanthoria suggests that these genera are not monophyletic as presently circumscribed. Two large, monophyletic groups of species could be recognized, one with Xanthoria species mixed with lobate and crustose members of Caloplaca, and one with mainly crustose Caloplaca, including both species with orange or black apothecia.
38
MANTILLERI, ANTOINE. "A taxonomic review and phylogeny of the genera Hoplopisthius Senna, 1892 and Carcinopisthius Kolbe, 1892 (Coleoptera: Brentidae, Hoplopisthiini)." Zootaxa 2516, no. 1 (June 23, 2010): 1. http://dx.doi.org/10.11646/zootaxa.2516.1.1.
Full textAbstract:
The genera Hoplopisthius and Carcinopisthius are reviewed. All the species are redescribed and illustrated and an updated identification key and distributional maps are provided. One new species from New Guinea is described (Hoplopisthius maximus n. sp.) and two new synonymies are proposed: Hoplopisthius celebensis Kolbe, 1892 = H. trichemerus Senna, 1892, n. syn. and Carcinopisthius lamingtoni Damoiseau, 1987 = C. forcipitiger Damoiseau, 1987, n. syn. Phylogenetic analysis using PAUP (maximum parsimony) was performed using 25 morphological characters of adults. This analysis shows the group Hoplopisthius + Carcinopisthius is monophyletic, but Carcinopisthius alone is paraphyletic. Nomenclatural changes at the generic level are made to reconcile nomenclature and phylogeny: Hoplopisthius is preserved; Carcinopisthius is downgraded to the rank of subgenus for the two oriental species H. oberthueri and H. fruhstorferi; and Pseudotaphroderes is resurrected as a third subgenus and includes all New-Guinean and Australian species.
39
Lingafelter, S. W., and A. S. Konstantinov. "The monophyly and relative rank of alticine and galerucine leaf beetles: A cladistic analysis using adult morphological characters (Coleoptera: Chrysomelidae)." Insect Systematics & Evolution 30, no. 4 (1999): 397–416. http://dx.doi.org/10.1163/187631200x00525.
Full textAbstract:
AbstractThe first cladistic analysis to determine the monophyletic status of alticine and galerucine leaf beetles and their relationship to one another is provided. A classification based on their hypothesized relationships is proposed. Fifty morphological characters of adults were analyzed from twenty-nine taxa representing six traditionally recognized subfamilies (Orsodacninae, Aulacoscelidinae, Eumolpinae [including Synetini], Chrysomelinae, Galerucinae, and Alticinae), with an emphasis on thorough exemplar representation from galerucines and alticines. Cladistic analyses of these characters using the heuristic analysis of PAUP resulted in 444 equally most parsimonious cladograms, a consensus of which was mostly unresolved. Successive approximations weighting of these trees produced a nearly fully resolved hypothesis of relationships among the taxa. This hypothesis indicates the monophyly of chrysomelines + eumolpines + orsodacnines and monophyly of galerucines + alticines. Importantly, the alticines are a highly derived, strongly supported monophyletic group, nested within galerucines. Therefore, alticines must have a lower relative taxonomic rank (such as tribe) to Galerucinae in order to reflect this phylogenetic hypothesis.
40
Seong, Chuntaek, Younbin Sung, and Donghee Chong. "Morphological Variability and Evolution of Chipped Stone Arrowheads from Gosan-ri, Jeju: A Phylogenetic Approach." Korean Ancient Historical Society 116 (May 30, 2022): 5–33. http://dx.doi.org/10.18040/sgs.2022.116.5.
Full textAbstract:
Phylogenetic analyses have been successfully applied to establishing lineages and trajectories of changes of archaeological materials. The present study attempts to apply principles and techniques of phylogenetics to archaeology and produce phylogenetic trees of a large collection of chipped stone arrowheads from Gosan-ri, Jeju. Recent excavations provided new lights on human occupations at Gosan-ri: radiocarbon dates and artifacts suggest that the site was formed by repeated visits of hunter-gatherers spanning almost 5000 years of the Neolithic. More than 1300 arrowheads, or points, were collected and they were made by the same chipped stone technology based on essentially same hunting and gathering way of subsistence economy with no evidence of external migration or notable diffusion. This is why we believe that a phylogenetic tree can adequately depict the persistence and change of artifact lineages. Based on paradigmatic classification using attributes and attribute states such as maximum length, morphology of haft elements, and angle of base and stem, we use PAUP* to produce workable phylogenetic trees of stone arrowhead classes. The result shows that stemmed arrowheads and those with no stem are the two most prominent classes that were likely diverged early and many varieties evolved subsequently in the branches. We also discuss the issue of homology and analogy (homoplasy) and how to distinguish the two from archaeological situations. We expect that the present endeavor will encourage future studies of reconstructing and discussing lineages based on archaeological cases by applying phylogenetic analysis.
41
Revell, L. J., and A. S. Harrison. "PCCA: a program for phylogenetic canonical correlation analysis." Bioinformatics 24, no. 7 (February 21, 2008): 1018–20. http://dx.doi.org/10.1093/bioinformatics/btn065.
Full text
42
Ihya, Silma Safira, Agus Nuryanto, Romanus Edy Prabowo, Dian Bhagawati, and Kusbiyanto Kusbiyanto. "Phylogenetic Relationships of Ornamental Chaetodontidae in The South Coastal of West Java, Indonesia." Jurnal Biodjati 5, no. 1 (May 30, 2020): 82–89. http://dx.doi.org/10.15575/biodjati.v5i1.5759.
Full textAbstract:
Marine ornamental trade has been developing for several years with Indonesia as one of the major exporter countries. Among the popular marine ornamental fish in the local and international markets belong to the family of Chaetodontidae. The existence of this family has been reported from several areas in Indonesia. However, no information is available in terms of their phylogenetic relationships of the fish from the south coast of West Java. The aim of this research was to asses the phylogenetic relationships among ornamental fish members of Chaetodontidae in the South Coast of West Java. Fish samples were collected from two trading sites Ujung Genteng and Taman Manalusu. Collected fish were identified using a previously published study. The evolutionary relationships among species were analyzed statistically through phylogenetic analysis based on maximum parsimony algorithm and Kimura 2- Parameter substitution model as implemented in PAUP 4.0 software. Tree branching pattern supported by 1000 bootstraps pseudo-replicates and out-group comparison. Daschyllus trimaculatus used as outgroup species. Based on the study, Chaetodontidae from the South Coast of West Java formed one monophyletic group compared to Dascylus trimaculatus with Chelmon rostratus was the basal species. All the remaining species were the derived species. There are CI and RI value gained. The consistency index (CI) value of this family is 0.5833, and the retention index (RI) is 0.5082.
43
Wedin, Mats, Heidi DÖring, and Stefan Ekman. "Molecular Phylogeny of the Lichen Families Cladoniaceae, Sphaerophoraceae, and Stereocaulaceae (Lecanorales, Ascomycotina)." Lichenologist 32, no. 2 (March 2000): 171–87. http://dx.doi.org/10.1006/lich.1999.0236.
Full textAbstract:
AbstractMaximum parsimony analysis of nuclear SSU rDNA sequences was utilized to infer the phylogenetic relationships of representatives of the macrolichen families Cladoniaceae, Sphaerophoraceae, and Stereocaulaceae (Lecanorales subord. Cladoniineae, Ascomycotina). Farris’ parsimony jackknifing, and a similar jackknife strategy with branch-swapping and multiple addition sequences in PAUP*, were performed to assess branch support. The results indicate that the Sphaerophoraceae should be emended to include Neophyllis (formerly Cladoniaceae or Stereocaulaceae) and Austropeltum (formerly Stereocaulaceae), and it is suggested that the type of boundary tissue present is a synapomorphy for the family. The families Sphaerophoraceae and Bacidiaceae form a clade, together with Psora decipiens, Tephromela atra and Scoliciosporum umbrinum. The Cladoniaceae should be emended to include Pilophorus, and the genera Metus, Cladia and Heterodea should also be included in the family. The sometimes-recognized families Cladiaceae and Heterodeaceae are shown to be derived from within Cladoniaceae. The Stereocaulaceae is recircumscribed to accommodate Stereocaulon only. Neither the possession of podetia/ pseudopodetia, a dimorphic, cladoniiform thallus, nor the presence of cephalodia, is a morphological synapomorphy for a monophyletic group in our analysis. Optimising ascus structures onto one of the most parsimonious trees suggest that tube-like apical structures may well be primitive characteristics within the Lecanorales. The two lecanoralean suborders Lecanorineae and Cladonineae are both paraphyletic groups in the present analysis. It is pointed out that if further studies confirm that Stereocaulon is the sister-group to the Cladoniaceae, as circumscribed here, then there may be no reason to accept the two families Cladoniaceae and Stereocaulaceae as distinct. Branch-swapping and several random-addition sequencesimprove resolution, adding several supported groups in the topology, and improve support values for groups already supported by parsimony jackkniring analyses, and we suggest a procedure for implementing this by using PAUP*
44
Resmi, Denia Dwi Citra, Topik Hidayat, and Siti Sriyati. "Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes." Jurnal Biodjati 6, no. 2 (November 29, 2021): 295–302. http://dx.doi.org/10.15575/biodjati.v6i2.13991.
Full textAbstract:
Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.
45
Cerny, Teresa A., and Terri W. Starman. "Molecular Phylogeny and DNA Amplification Fingerprinting of Petunia." HortScience 30, no. 4 (July 1995): 777F—778. http://dx.doi.org/10.21273/hortsci.30.4.777f.
Full textAbstract:
Seed of five species of petunia and 10 cultivars of Petunia xhybrida were obtained from several sources and plants were fingerprinted using DNA amplification fingerprinting (DAF). Within some species, variable fingerprints were generated between individual plants from the same seed source and/or different sources. Consistencies were found among DAF profiles by bulking the leaf tissue from 10 different plants, but not five plants. Each of 10 octamer primers used during the study revealed polymorphic loci between the species and cultivars. Among the 201 bands produced, 146 (73%) loci were polymorphic and these could be used to distinguish between each of the species and cultivars. Scoring for presence and absence of the amplified bands was used to generate a phylogenetic tree and to calculate the pairwise distances between each of the taxa using parsimony (PAUP) analysis. The tree generated using DAF molecular markers separated P. axillaris from P. parodii (two white-flowered species), and distinguished between the violet-flowered species, P, inflata, P. integrifolia, and P. violacea.
46
Heidrich, Petra, Claus König, and Michael Wink. "Molecular Phylogeny of South American Screech Owls of the Otus atricapillus Complex (Aves: Strigidae) Inferred from Nucleotide Sequences of the Mitochondrial Cytochrome b Gene." Zeitschrift für Naturforschung C 50, no. 3-4 (April 1, 1995): 294–302. http://dx.doi.org/10.1515/znc-1995-3-420.
Full textAbstract:
The cytochrome b gene of 6 South American screech owls of the genus Otus (O. choliba, O. atricapillus, O. usta, O. sanctaecatarinae, O. guatemalae, and O. hoyi) and two Old World species (Otus scops and Otus leucotis) was amplified by polymerase chain reaction (PCR) and partially sequenced (300 nucleotides). Otus atricapillus, O. guatemalae, O. hoyi and O. sanctaecatarinae which are morphologically very similar, have been treated as belonging to a single species, A. atricapillus (Sibley and Monroe, 1990). Nucleotide sequences differ substantially between these taxa (6.3 to 8.8% nucleotide substitutions) indicating that they represent well established and distinct species which had been implicated already from ecological and bioacoustical analyses (König, 1991, 1994). The importance of vocal and ecological characters for the taxonomy of nocturnal birds is thus confirmed by our molecular analysis. Phylogenetic relationships were reconstructed between Old and New World owls using character state (“maximum parsimony”; PAUP 3.1.1) and distance matrix methods (neighbour- joining; MEGA).
47
Reeves, Peter R., Leslie Farnell, and Ruiting Lan. "MULTICOMP: a program for preparing sequence data for phylogenetic analysis." Bioinformatics 10, no. 3 (1994): 281–84. http://dx.doi.org/10.1093/bioinformatics/10.3.281.
Full text
48
Yang, Ziheng. "PAML: a program package for phylogenetic analysis by maximum likelihood." Bioinformatics 13, no. 5 (1997): 555–56. http://dx.doi.org/10.1093/bioinformatics/13.5.555.
Full text
49
MD-ZAIN, BADRUL MUNIR, and SHAHIDATINA AISHAH ABDUL-MUTALIB. "Molecular phylogenetic inference of White-Spotted Guitarfish (Rhynchobatus australiae) collected from local Malaysian fish markets." Biodiversitas Journal of Biological Diversity 19, no. 4 (July 1, 2018): 1382–86. http://dx.doi.org/10.13057/biodiv/d190426.
Full textAbstract:
Md-Zain BM, Abdul-Mutalib SA, Aifat NR, Masstor NH, Mohd-Yusof NS, Mohd-Hashim A, Abdul-Latiff MAB, Yaakop S,Samat A. 2018. Molecular phylogenetic inference of White-Spotted Guitarfish (Rhynchobatus australiae) collected from local Malaysianfish markets. Biodiversitas 19: 1382-1386. The white-spotted guitarfish (Rhynchobatus australiae) is in high demand at local Malaysianfish markets because its fins are a valuable food source. To date, few molecular studies have characterized their genetic identity. Wehave conducted a molecular study to infer the phylogenetic relationships of white-spotted guitarfish, which portray a similarmorphology to sharks and rays. The main objective of this study was to determine the phylogenetic position of R. australiae usingcytochrome oxidase I (COI) sequences of mitochondrial DNA based on fish samples collected from local Malaysian fish markets. Thisstudy included nine genetic samples of R. australiae and fourteen samples from other members of the shark and ray families, includingSphyrna lewini (Sphyrnidae), Rhizoprionodon oligolinx and Carcharhinus sorrah (Carcharhinidae), Dasyatis zugei, Himantura walga,Himantura gerradi, Himantura jenkinsii and Neotrygon kuhlii (Dasyatidae). Chimaera fulva, a member of the Chimaera family, wasused as the outgroup. Sequences in size of ~701 base pairs were successfully obtained from all fish samples. The phylogenetic treetopology was reconstructed using distance-based (neighbor-joining) and character-based (maximum parsimony) methods using MEGAand PAUP software. Results indicated that R. australiae formed monophyletic clade and is closely related to sharks (Sphyrnidae andCarcharhinidae). This conclusion was also supported by genetic distance analysis which indicated that Rhynchobatidae and sharks(Carcharhinidae and Sphyrnidae) were closer to each other than to rays (Dasyatidae). This study has proven the efficiency of the COImitochondrial locus in revealing the phylogenetic position of R. australiae. Research findings from this study have increased ourunderstanding of the phylogenetic relationships among guitarfish, sharks, and rays, and their respective taxonomic positions are giventheir shared morphological characters. This will benefit us in identifying these fish species before consumption from local fish markets.
50
Westrop, Stephen R., and Rolf Ludvigsen. "The Late Cambrian (Marjuman) trilobite genus Hysteropleura Raymond from the Cow Head Group, western Newfoundland." Journal of Paleontology 74, no. 6 (November 2000): 1020–30. http://dx.doi.org/10.1017/s0022336000017583.
Full textAbstract:
Although known previously from only two specimens from northern Greenland, new material from Marjuman boulders in debris flows of the Cow Head Group of western Newfoundland demonstrate that Verditerrina Robison is a menomoniid trilobite that is closely related to Hysteropleura Raymond. Following a parsimony analysis using the PAUP program, Verditerrina is used at the subgeneric level to label a distinctive monophyletic group within Hysteropleura. Three new species are established for the Newfoundland material: Hysteropleura (Verditerrina) adraini, H. (V.) edgecombei and H. (V.) ramskoldi. All three species undergo substantial modification of the anterior border of the cranidium during holaspid ontogeny. Two of the species, H. (V.) adraini and H. (V.) edgecombei, develop elongate, tongue-like borders that are reminiscent of those of calymenids such as Spathocalymene Tillman.