Journal articles on the topic 'Perth sand soil'

Applying ultrasound energy to soil-water suspensions (sonication) is an established method of determining the size distributions of soil primary mineral particles and associated organic matter. The size distributions may vary, however, with sonication input energy and soil type. The objective of this study was to determine the effects of sonication input energy on the size distributions of soil mineral particles and organic matter for a range of soil textures and carbon contents typical of agricultural soils in southwestern Ontario. The soils included a Brookston clay loam, a Brookston clay, a Huron silt loam, a Perth silt loam and a Harrow sandy loam. All soils were under no-tillage management. Nine sonication energies ranging from 50 to 1500 J mL–1 were applied to soil-water suspensions (1:4 mass ratio), and the soil particle size distribution results were compared with those obtained using the standard chemical dispersion (pipette) method. The three medium- and coarse-textured soils (Huron, Perth, Harrow) required about 250 J mL–1 for complete dissociation of soil aggregates, while the two fine-textured soils (Brookston) required sonication energies of 600-750 J mL–1. Increasing sonication energy increased the amount of soil organic carbon (SOC) measured in the clay-size fraction and decreased the amounts in the sand and silt fractions. Therefore, accurate determinations of particle size distribution and SOC contents require an initial assessment of the amount of sonication energy required for the complete dispersion of the particle size fractions. For the Brookston clay loam and Brookston clay soils, 40–52% less particulate SOC was found in the sand fraction at 750 J mL–1 sonication energy than that obtained using the standard pipette method, indicating particle size reduction by sonication of particle organic matter. It should be noted that the sand-size SOC typically represents a small fraction. Furthermore, sonication had a minor effect on the SOC content of the clay fraction. It was concluded that sonication is a viable technique for determining the size distribution of soil primary mineral particles, as well as the amount of SOC associated with the silt and clay fractions. Key words: Sonication, ultrasound energy, particle size distribution, organic carbon fractionation, clay soil

On sandy soil near Esperance, W.A., prevention of burr burial compared with covering developing burrs with sand drastically reduced the seed production of three subspp. of Trifolium subterraneum (brachycalycinum, subterraneum and yanninicum) and of T. israeliticum by reducing burr production and seed weight. However, T. globosum produced similar amounts of seed from unburied and buried burrs. On sandy soil at Shenton Park, Perth, W.A., prevention of burr burial also reduced seed production of T. subterraneum subspp. brachycalycinum and subterraneum, this being due to fewer burrs, fewer seeds per burr and lighter seed. For subsp. brachycalycinum, seed yields were two to five times greater from burrs which developed within loose gravel than from those developed over sand (in which fewer burrs were able to bury) as a result of increased production of burrs, more seeds per burr and heavier seed. However, for subsp. subterraneum seed yields were similar from burrs whether developed over gravel or sand.

In general, water repellency by soil increases with the increase of total organic matter and decreases as the clay and silt contents of the soil increase. The prediction of water repellency from soil organic carbon (OC) content may be improved by examining the types of carbon associated with water repellency. This paper examines the hypothesis that measurement of aliphatic C can provide a better prediction of water repellency than measurement of total OC and also looks at the effects of soil texture on water repellency and the amount of aliphatic C in the soil. DRIFT (diffuse reflectance infrared fourier transform) spectra were measured on sandy soils from the West Midland Sandplains north of Perth in Western Australia. The areas of the aliphatic CH stretching signal (3000–2800/cm) and the OH stretching signal due to kaolin (3750–3570/cm) were used as relative measures of aliphatic carbon and kaolin contents. The relationships of aliphatic C and kaolin to water repellency have been examined and compared with the relationships of water repellency to total OC and clay contents of soil.Hydrophobic organic C as measured by DRIFT gave a better prediction of soil water repellency (r2 = 0.45) than did the total OC (r2 = 0.36). The specific hydrophobicity of organic matter (aliphatic C/OC ratio) increased as sand content increased. However, the direct influence of soil texture on water repellency was of more significance than its indirect influence on the amounts and forms of soil organic matter. A multivariate model including aliphatic C and clay + silt content was the best model for describing water repellency (r2 = 0.58). DRIFT is an effective, rapid method for screening soils for water repellent properties.For individual sand grains there was a weak positive relationship (r2 = 0.26) between the size of the aliphatic CH peak measured from surfaces of sand grains and the water repellency of the grains. A discontinuous aliphatic surface layer was present on the surface of individual sand grains.

Abstract Stable fly (Stomoxys calcitrans L.) remain a significant pest affecting livestock and rural communities on the Swan Coastal Plain around Perth, Western Australia. Vegetable crop residues remaining after harvest enable stable fly development. Left untreated they can produce from several hundred to >1,000 stable fly/m2 of post-harvest residues. We studied the effect of burial and compaction of sandy soils on adult emergence of stable fly and house fly (Musca domestica L.) (Diptera: Muscidae). Adults of both fly species can move up through 50 cm of loose, dry sand, however at depths greater than 60 cm, emergence rapidly declines with <5% of adults surviving under 100 cm of soil. Burial of stable fly larvae and pupae under 15 cm of soil followed by compaction using a static weight dramatically reduced adult emergence. Moist soil compacted at ≥3 t/m2 completely prevented stable fly emergence whereas house fly emergence was not affected. One t/m2 of compaction resulted in <5% emergence of stable fly buried as pupae. Soil that was easily compactible (i.e., high silt, fine sand and clay content) reduced stable fly emergence more than soil with more coarse sand and low clay content. This study demonstrates the potential for a novel and chemical-free option for controlling stable fly development from vegetable crop post-harvest residue. Field trials are needed to confirm that burial and compaction of vegetable post-harvest residues using agricultural machinery can dramatically reduce the subsequent emergence of adult stable fly on a large scale.

The natural hybrid Drosera × sidjamesii Lowrie & Conran from Lake Gnangarra north of Perth, Western Australia is described and defined as a cross between D. nitidula Planch. subsp. omissa Marchant & Lowrie auct. non Diels and D. pulchella Lehm., between which it shows a high degree of intermediacy for almost all characters. Cytological examination of the hybrid and its parents confirms that the former at 2n = 46 is a combination of the 2n = 28 in D. nitidula subsp. omissa and 2n = 18 in D. pulchella. The hybrid grows along a narrow ecotone between the parental species, largely on sandy peat and along a presumed soil moisture/elevation gradient caused by the nearby lake. Nevertheless, within this ecotone the hybrid is significantly more frequent than either parental species, with D. pulchella mainly growing in peat soils closer to the lake and D. nitidula subsp. omissa on white sand further from the water. Field observations of morphotypes also suggest that the hybrid has arisen several times at the site, and that a limited number of plants at the site are becoming fertile and setting seed.

The natural hybrid Drosera � sidjamesii Lowrie & Conran from Lake Gnangarra north of Perth, Western Australia is described and defined as a cross between D. nitidula Planch. subsp. omissa Marchant & Lowrie auct. non Diels and D. pulchella Lehm., between which it shows a high degree of intermediacy for almost all characters. Cytological examination of the hybrid and its parents confirms that the former at 2n = 46 is a combination of the 2n = 28 in D. nitidula subsp. omissa and 2n = 18 in D. pulchella. The hybrid grows along a narrow ecotone between the parental species, largely on sandy peat and along a presumed soil moisture/elevation gradient caused by the nearby lake. Nevertheless, within this ecotone the hybrid is significantly more frequent than either parental species, with D. pulchella mainly growing in peat soils closer to the lake and D. nitidula subsp. omissa on white sand further from the water. Field observations of morphotypes also suggest that the hybrid has arisen several times at the site, and that a limited number of plants at the site are becoming fertile and setting seed.

Abstract. The groundwater resource contained within the sandy aquifers of the Swan Coastal Plain, south-west Western Australia, provides approximately 60 percent of the drinking water for the metropolitan population of Perth. Rainfall decline over the past three decades coupled with increasing water demand from a growing population has resulted in falling dam storage and groundwater levels. Projected future changes in climate across south-west Western Australia consistently show a decline in annual rainfall of between 5 and 15 percent. There is expected to be a reduction of diffuse recharge across the Swan Coastal Plain. This study aims to quantify the change in groundwater recharge in response to a range of future climate and land cover patterns across south-west Western Australia. Modelling the impact on the groundwater resource of potential climate change was achieved with a dynamically linked unsaturated/saturated groundwater model. A vertical flux manager was used in the unsaturated zone to estimate groundwater recharge using a variety of simple and complex models based on climate, land cover type (e.g. native trees, plantation, cropping, urban, wetland), soil type, and taking into account the groundwater depth. In the area centred on the city of Perth, Western Australia, the patterns of recharge change and groundwater level change are not consistent spatially, or consistently downward. In areas with land-use change, recharge rates have increased. Where rainfall has declined sufficiently, recharge rates are decreasing, and where compensating factors combine, there is little change to recharge. In the southwestern part of the study area, the patterns of groundwater recharge are dictated primarily by soil, geology and land cover. In the sand-dominated areas, there is little response to future climate change, because groundwater levels are shallow and much rainfall is rejected recharge. Where the combination of native vegetation and clayey surface soils restricts possible infiltration, recharge rates are very sensitive to reductions in rainfall. In the northern part of the study area, both climate and land cover strongly influence recharge rates. Recharge under native vegetation is minimal and is relatively higher where grazing and pasture systems have been introduced after clearing of native vegetation. In some areas, the recharge values can be reduced to almost zero, even under dryland agriculture, if the future climate becomes very dry.

The Gnangara Mound is an area of elevated sandy soil on the Swan Coastal Plain to the north of Perth. It constitutes a major groundwater resource for metropolitan Perth. Sixteen wetlands on the Mound had total phosphorus concentrations of 12-462�g L-1, the high values being attributed to agricultural and urban activity. Sediment concentrations of total phosphorus and total nitrogen were 61-954 and 1212-16739 �g g-1, respectively. Conductivities were 505-10270 �S cm-1, and pH values were 3.3-9.3. Only one wetland was highly coloured (79.9 8440 m-1), with an E4/E6 ratio of 4.6. Chlorophyll a concentrations were 0.01-130.8�g L-1; in wetlands with low gilvin concentrations, Myxophyceae dominated, whereas wetlands with higher gilvin concentrations had large numbers of diatoms and Chlorophyceae. The highly coloured wetland had the lowest chlorophyll a concentration despite high nutrient concentrations, supporting the hypothesis that the consequent reduction in light or other associated factors are important in maintaining low phytoplankton biomass in dystrophic wetlands of the region, particularly those on Bassendean sands.

The objective of this work was to study the degradation kinetics of a nitrification inhibitor (NI), dicyandiamide (DCD), and evaluate its effectiveness in reducing nitrous oxide (N2O) emissions in different types of soils. Three soils contrasting in texture, mineralogy, and organic carbon (C) content were incubated alone (control) or with urine at 600 mg N/kg soil with 3 levels of DCD (0, 10, and 20 mg/kg). Emissions of N2O and carbon dioxide (CO2) were measured during the 58-day incubation. Simultaneously, subsamples were collected periodically from the incubating soils (40-day incubation) and the amounts of DCD, NH4+, and NO3− were determined. Our results showed that the half-life of DCD in these laboratory incubating soils at 25°C was 6–15 days and was longer at the higher rate of DCD application. Of the 3 soils studied, DCD degradation was fastest in the brown loam allophanic soil (Typic orthic allophanic) and slowest in the silt loam non-allophanic soil (Argillic-fragic Perch-gley Pallic). The differences in DCD degradation among these soils can be attributed to the differences in the adsorption of DCD and in the microbial activities of the soils. Among the 3 soils the highest reduction in N2O emissions with DCD from the urine application was measured in the non-allophanic silt loam soil followed by non-allophanic sandy loam soil and allophanic brown loam soil. There was no adverse impact of DCD application on soil respiratory activity or microbial biomass.

Many sandy soils of the Swan Coastal Plain, Western Australia, are poor in Fe and P retention. A novel concept proposes to relocate Fe from groundwater to surface soils via watering, which should consequently improve P retention. To test the viability of this concept we examined several soils in Perth suburbs that had been watered for 3–27 years with groundwater containing high Fe. Energy dispersive X-ray microanalysis indicated that ‘Fe-watered’ soils had significantly higher Fe materials on the surface of soil particles. Oxalate-extractable Fe (Feo) increased by 52 times and citrate/dithionite-extractable Fe (Fed) increased by 6.6 times. Unusually high Feo/d ratios (average Feo/d = 0.71) in ‘Fe-watered’ soils strongly suggest that the accumulated Fe materials are predominantly amorphous and secondary Fe oxides, probably ferrihydrite. There was a substantial increase in P retention in top-soils, to a magnitude of 45–128 times, demonstrating that increasing Fe oxides in severely leached soils, caused by groundwater irrigation, increases P retention. This approach could be applied to other areas with similar physical characteristics and the present study demonstrates that watering with Fe rich groundwater might have strategic significance not only in the control of water pollution, but also in the rational use of water resources and the amelioration of soil salinisation associated with rising watertables.

Abstract. The groundwater resource contained within the sandy aquifers of the Swan Coastal Plain, south west Western Australia, provides approximately 60% of the drinking water for the metropolitan population of Perth. Rainfall decline over the past three decades coupled with increasing water demand from a growing population has resulted in falling dam storage and groundwater levels. Projected future changes in climate across south-west Western Australia consistently show a decline in annual rainfall of between 5 and 15%. There is expected to be a continuing reduction of diffuse recharge across the Swan Coastal Plain. This study aims to quantify the change in groundwater recharge in response to a range of future climate and land cover patterns across south-west Western Australia. Modelling the impact on the groundwater resource of potential climate change was achieved with a dynamically linked unsaturated/saturated groundwater model. A Vertical Flux Manager was used in the unsaturated zone to estimate groundwater recharge using a variety of simple and complex models based on land cover type (e.g. native trees, plantation, cropping, urban, wetland), soil type, and taking into account the groundwater depth. These recharge estimates were accumulated on a daily basis for both observed and projected climate scenarios and used in a MODFLOW simulation with monthly stress periods. In the area centred on the city of Perth, Western Australia, the patterns of recharge change and groundwater level change are not consistent spatially, or consistently downward. In the Dandaragan Plateau to the north-east of Perth there has been groundwater level rise since the 1970s associated with land clearing, and with rainfall projected to reduce the least in this area the groundwater levels are estimated to continue to rise. Along the coastal zone north of Perth there is an interaction between projected rainfall decline and legislated removal to pine forests. This results in areas of increasing recharge and rising water levels into the future despite a drying climate signal. To the south of Perth city there are large areas where groundwater levels are close to the land surface and not expected to change more than 1m upward or downward over the next two decades; it is beyond the accuracy of the model to conclude any definite trend. In the south western part of the study area, the patterns of groundwater recharge are dictated primarily by soil, geology and land cover. In the sandy Swan (northern boundary) and Scott Coastal Plains (southern boundary) there is little response to future climates, because groundwater levels are shallow and much rainfall is rejected recharge. The profile dries out more in summer but this allows more rainfall to infiltrate in winter. Until winter recharge is insufficient to refill the aquifers these areas will not experience significant falls in groundwater levels. On the Blackwood Plateau however, the combination of native vegetation and clayey surface soils that restrict possible infiltration and recharge mean the area is very sensitive to climate change. With low capacity for recharge and low storage in the aquifers, small reductions in recharge can lead to large reductions in groundwater levels. In the northern part of the study area both climate and land cover strongly influence recharge rates. Recharge under native vegetation is minimal and is relatively higher where grazing and pasture systems have been introduced after clearing of native vegetation. In some areas the low recharge values can be reduced to almost zero, even under dryland agriculture, if the future climate becomes very dry. In the Albany Area the groundwater resource is already over allocated, and the combination of existing permanent native vegetation with decreasing annual rainfall indicate reduced recharge. The area requires a reduction in groundwater abstraction to maintain the sustainability of the existing resource.

The results of research on the content and distribution of trace elements in alluvial soils of various elements of the floodplain landscape, and their relationship with fertility indicators are presented. It has been found that the maximum concentrations of most trace elements (Ni, Zn, Mn, Cr, Co, Mo, As) are characteristic of the alluvial overhanging-marsh heavy-coal pristine subsystem of the floodplain landscape. In the riverine and perish subsystems of the floodplain landscape in individual layers of the corresponding soils, an excess of clark was found: in the alluvial sour acid layered primitive shortened sandy loam Cu by 1.5; Zn in 1.1; Cd 9.2 times, in alluvial chilli-marsh heavy-coal Cu 1.05; Zn in 1.4; Mn in 1.01; Cr in 1,2; Cd 3.2 times. For the riverine and perch subsystems, the excess of Cu, Mn and Cr was observed in the soil layer 0-5 cm, the remaining exceedances are characteristic of deeper layers. Decreasing rows of trace elements in alluvial soils have a similar structure. The microelements in question, in the soils of the floodplain landscape of the Iput River, in terms of clark concentration, belong to the group of dispersing. There is no significant correlation between micronutrient content and fertility of the alluvial soils under consideration.

To determine the influence of reduced irrigation input, carrot (Daucus carota L. cv. Ivor) plants were grown on a coarse-textured, sandy soil during summer near Perth, Western Australia. Irrigation was applied daily with sprinklers at 5 rates ranging from 47 to 151% replacement of daily pan evaporation (Ep). A reduction in irrigation from the industry standard of 151% Ep to 124 or 97% Ep resulted in a 17% increase in water use efficiency (WUE) when calculated as total root yield/water applied. However, the percentage of total roots that were marketable declined with reduction in irrigation, being 73, 56, and 63% at 151, 124, and 97% Ep, respectively. This minimised any increase in WUE when calculated on a marketable yield basis. Further reductions in irrigation to 47 and 73% Ep resulted in large reductions in yield, WUE, and the percentage of marketable roots. Leaf biomass was not significantly different between the 151 and 124% Ep treatments and was reduced by 55 and 85% at 73 and 47% Ep, respectively. Soil water tension (ψs) varied from 4 to 80 kPa among the irrigation treatments. Pre-dawn leaf water potential (ψl) was most sensitive to ψs over a ψs range of 0–20 kPa and the influence of ψs on ψl was small (400 kPa) compared with the diurnal variations in ψl of up to 1400 kPa, which occurred independently of significant changes in bulk soil ψs. There was no significant effect of irrigation on the osmotic potential of leaf sap and there was no evidence of osmotic adjustment. For all irrigation treatments, photosynthesis (Pn) peaked in the early morning (0830 hours) at rates of 17–20 μmol CO2/m2.s, after which Pn decreased to a transient minimum value at midday. The diurnal decline in Pn was positively correlated with ψl for all treatments, and minimum values of Pn varied from 12.5 to 7.8 μmol CO2/m2.s for plants grown with 151 and 47% of Ep, respectively. When grown under frequently applied, suboptimal irrigation, carrot productivity is predominately limited by a reduction in leaf growth rates that limits leaf area and matches transpiration requirements with water availability. Furthermore, even under conditions of water deficit, the aerial environment imposes a greater constraint to Pn than soil water availability.

Assessment of areas suitable for inclusion in a comprehensive, adequate and representative (CAR) reserve system has been based primarily on distribution of original native vegetation and occurrence of vertebrates, particularly birds and mammals. However, reliable predictors of vertebrate and floristic diversity are not necessarily adequate predictors of invertebrate diversity. We sampled the earthworm fauna of the Perth metropolitan Swan Coastal Plain (SCP) to examine whether vegetation-based criteria are sufficient for identifying a conservation estate for native earthworms. Twenty-one native species were collected from 136 sample localities. All five previously described native species from the region and three native species previously collected but not formally described were again collected, while 13 previously uncollected species were found. Species abundances of native earthworms were uneven, in common with species-abundance relationships for many other invertebrate assemblages, with 10 singleton occurrences of species and few common species. Species diversity increased away from the coast across the sandy geomorphic units Quindalup, Spearwood and Bassendean. Our study did not resolve whether dlifferences in earthworm faunas reflect the gradient in soil qualities across these units, gradients in species-area effects, habitat diversity effects or a combination of these. Blocks of remnant vegetation identified in the Western Australian Government's Bush Forever plan as containing natural areas of regional conservation value are also likely to support at least one native earthworm species. However, many of the blocks of remnant vegetation so identified are not within the formal conservation estate. Two species identified in this survey fortuitously persist only in remnant vegetation patches not considered regionally significant. Actual regional diversity was estimated to be 38 native species, indicating many uncollected relatively rare species. Although earthworms are a low diversity group compared with other invertebrates, the localized distributions of most species indicate that the formal conservation estate does not provide adequate protection. Ongoing degradation of unprotected remnant vegetation will result in extinctions of localized invertebrate species.

In 2016, the Architectural and archaeological expedition of the IA NAS of Ukraine under the guidance of G. Yu. Iwakin conducted scientific and rescue excavations at the foot of the Yurkovitsa Hill on the Kyiv Podil. During this work, the dwelling of the Prague culture was discovered (fig. 1; 2). Only a part of semi-dugout dwelling was found within the dig. Its shape was probably close to square. It was oriented northwest — southeast. In the northern corner, a furnace of clay and stone on sandy bedding was found. Two broken hand-made pots and separate fragments of ceramics were in its filling. (fig. 3; 4). Impurities of burnt organic matter were clearly visible in the clay solution. According to microsection of the ceramic fragment, a red clay with a high content of ore minerals fragments was used for the manufacture of vessels. A furnace has similar mineral characteristics. Such clays are common on the for the right-bank part of the Kyiv region. The most likely dating of this type of vessels is from the end of the sixth to the beginning of the seventh century AD. A selective soil filtering from filling the object was conducted. As a result, paleobotanical and ichthyological materials were obtained. A wood is represented by pine-tree (Pinus sylvestris) and oak (Quercus sp.). These species were generally preferred in the Middle Dnipro region both as a working wood and as a fuel. (table 1). Paleoethnobotanical samples (table 2) are represented by one grain of yellow foxtail (Setaria glauca). Given the safety of other small biological residues, the absence of agricultural products is not accidental. Ichthyological materials (fig. 5; table 3) are represented by the remains of a common roach (Rutilus rutilus), wels catfish (Silurus glanis), northern pike (Esox lucius) and common perch (Perca fluviatilis). These species are known from previous ichthyological studies of the Slavic sites in this part of the Dnipro River basin. They are still typical representatives of the local ichthyofauna always actively used for fishing. According to the relief analysis (fig. 6), we can conclude that there were no plots attractive for farming near the place where the object of the Prague culture was discovered. Around predominantly uneven terrain lay, unsuitable for plowing. The largest part was the floodplain of the Dnieper, which was flooded. The absence of birch, as a typical representative of anthropochores, can serve as a «proof of the opposite», that in the immediate environment of the object there were no such sites. The absence of finds of grains of cultivated plants is also indirect evidence that a resident of this dwelling was not engaged in farming. The remains of fish belong to species common for this region both in archaeological materials of earlier and later times and in the modern ichthyofauna of the Dnipro. Four identified species; such as roach, wels catfish, pike and perch are typical fishing objects, so we can assume that the remains found in the dwelling belonged to fish caught nearby. Thus, based on a set of obvious and indirect evidence, we can reconstruct occupation of the ancient inhabitant of a semi-dugout dwelling as a fisher, who lived mainly due to fishing.

Special Care Notice This article contains images of deceased people that might cause sadness or distress to Aboriginal and Torres Strait Islander readers. Introduction Like many cities, Perth was founded on wetlands that have been integral to its history and culture (Seddon 226–32). However, in order to promote a settlement agenda, early mapmakers sought to erase the city’s wetlands from cartographic depictions (Giblett, Cities). Since the colonial era, inner-Perth’s swamps and lakes have been drained, filled, significantly reduced in size, or otherwise reclaimed for urban expansion (Bekle). Not only have the swamps and lakes physically disappeared, the memories of their presence and influence on the city’s development over time are also largely forgotten. What was the site of Perth, specifically its wetlands, like before British settlement? In 2014, an interdisciplinary team at Edith Cowan University developed a digital visualisation process to re-imagine Perth prior to colonisation. This was based on early maps of the Swan River Colony and a range of archival information. The images depicted the city’s topography, hydrology, and vegetation and became the centerpiece of a physical exhibition entitled Re-imagining Perth’s Lost Wetlands and a virtual exhibition hosted by the Western Australian Museum. Alongside historic maps, paintings, photographs, and writings, the visual reconstruction of Perth aimed to foster appreciation of the pre-settlement environment—the homeland of the Whadjuck Nyoongar, or Bibbulmun, people (Carter and Nutter). The exhibition included the narrative of Fanny Balbuk, a Nyoongar woman who voiced her indignation over the “usurping of her beloved home ground” (Bates, The Passing 69) by flouting property lines and walking through private residences to reach places of cultural significance. Beginning with Balbuk’s story and the digital tracing of her walking route through colonial Perth, this article discusses the project in the context of contemporary pressures on the city’s extant wetlands. The re-imagining of Perth through historically, culturally, and geographically-grounded digital visualisation approaches can inspire the conservation of its wetlands heritage. Balbuk’s Walk through the City For many who grew up in Perth, Fanny Balbuk’s perambulations have achieved legendary status in the collective cultural imagination. In his memoir, David Whish-Wilson mentions Balbuk’s defiant walks and the lighting up of the city for astronaut John Glenn in 1962 as the two stories that had the most impact on his Perth childhood. From Gordon Stephenson House, Whish-Wilson visualises her journey in his mind’s eye, past Government House on St Georges Terrace (the main thoroughfare through the city centre), then north on Barrack Street towards the railway station, the site of Lake Kingsford where Balbuk once gathered bush tucker (4). He considers the footpaths “beneath the geometric frame of the modern city […] worn smooth over millennia that snake up through the sheoak and marri woodland and into the city’s heart” (Whish-Wilson 4). Balbuk’s story embodies the intertwined culture and nature of Perth—a city of wetlands. Born in 1840 on Heirisson Island, Balbuk (also known as Yooreel) (Figure 1) had ancestral bonds to the urban landscape. According to Daisy Bates, writing in the early 1900s, the Nyoongar term Matagarup, or “leg deep,” denotes the passage of shallow water near Heirisson Island where Balbuk would have forded the Swan River (“Oldest” 16). Yoonderup was recorded as the Nyoongar name for Heirisson Island (Bates, “Oldest” 16) and the birthplace of Balbuk’s mother (Bates, “Aboriginal”). In the suburb of Shenton Park near present-day Lake Jualbup, her father bequeathed to her a red ochre (or wilgi) pit that she guarded fervently throughout her life (Bates, “Aboriginal”).Figure 1. Group of Aboriginal Women at Perth, including Fanny Balbuk (far right) (c. 1900). Image Credit: State Library of Western Australia (Image Number: 44c). Balbuk’s grandparents were culturally linked to the site. At his favourite camp beside the freshwater spring near Kings Park on Mounts Bay Road, her grandfather witnessed the arrival of Lieutenant-Colonel Frederick Irwin, cousin of James Stirling (Bates, “Fanny”). In 1879, colonial entrepreneurs established the Swan Brewery at this significant locale (Welborn). Her grandmother’s gravesite later became Government House (Bates, “Fanny”) and she protested vociferously outside “the stone gates guarded by a sentry [that] enclosed her grandmother’s burial ground” (Bates, The Passing 70). Balbuk’s other grandmother was buried beneath Bishop’s Grove, the residence of the city’s first archibishop, now Terrace Hotel (Bates, “Aboriginal”). Historian Bob Reece observes that Balbuk was “the last full-descent woman of Kar’gatta (Karrakatta), the Bibbulmun name for the Mount Eliza [Kings Park] area of Perth” (134). According to accounts drawn from Bates, her home ground traversed the area between Heirisson Island and Perth’s north-western limits. In Kings Park, one of her relatives was buried near a large, hollow tree used by Nyoongar people like a cistern to capture water and which later became the site of the Queen Victoria Statue (Bates, “Aboriginal”). On the slopes of Mount Eliza, the highest point of Kings Park, at the western end of St Georges Terrace, she harvested plant foods, including zamia fruits (Macrozamia riedlei) (Bates, “Fanny”). Fanny Balbuk’s knowledge contributed to the native title claim lodged by Nyoongar people in 2006 as Bennell v. State of Western Australia—the first of its kind to acknowledge Aboriginal land rights in a capital city and part of the larger Single Nyoongar Claim (South West Aboriginal Land and Sea Council et al.). Perth’s colonial administration perceived the city’s wetlands as impediments to progress and as insalubrious environments to be eradicated through reclamation practices. For Balbuk and other Nyoongar people, however, wetlands were “nourishing terrains” (Rose) that afforded sustenance seasonally and meaning perpetually (O’Connor, Quartermaine, and Bodney). Mary Graham, a Kombu-merri elder from Queensland, articulates the connection between land and culture, “because land is sacred and must be looked after, the relation between people and land becomes the template for society and social relations. Therefore all meaning comes from land.” Traditional, embodied reliance on Perth’s wetlands is evident in Bates’ documentation. For instance, Boojoormeup was a “big swamp full of all kinds of food, now turned into Palmerston and Lake streets” (Bates, “Aboriginal”). Considering her cultural values, Balbuk’s determination to maintain pathways through the increasingly colonial Perth environment is unsurprising (Figure 2). From Heirisson Island: a straight track had led to the place where once she had gathered jilgies [crayfish] and vegetable food with the women, in the swamp where Perth railway station now stands. Through fences and over them, Balbuk took the straight track to the end. When a house was built in the way, she broke its fence-palings with her digging stick and charged up the steps and through the rooms. (Bates, The Passing 70) One obstacle was Hooper’s Fence, which Balbuk broke repeatedly on her trips to areas between Kings Park and the railway station (Bates, “Hooper’s”). Her tenacious commitment to walking ancestral routes signifies the friction between settlement infrastructure and traditional Nyoongar livelihood during an era of rapid change. Figure 2. Determination of Fanny Balbuk’s Journey between Yoonderup (Heirisson Island) and Lake Kingsford, traversing what is now the central business district of Perth on the Swan River (2014). Image background prepared by Dimitri Fotev. Track interpolation by Jeff Murray. Project Background and Approach Inspired by Fanny Balbuk’s story, Re-imagining Perth’s Lost Wetlands began as an Australian response to the Mannahatta Project. Founded in 1999, that project used spatial analysis techniques and mapping software to visualise New York’s urbanised Manhattan Island—or Mannahatta as it was called by indigenous people—in the early 1600s (Sanderson). Based on research into the island’s original biogeography and the ecological practices of Native Americans, Mannahatta enabled the public to “peel back” the city’s strata, revealing the original composition of the New York site. The layers of visuals included rich details about the island’s landforms, water systems, and vegetation. Mannahatta compelled Rod Giblett, a cultural researcher at Edith Cowan University, to develop an analogous model for visualising Perth circa 1829. The idea attracted support from the City of Perth, Landgate, and the University. Using stories, artefacts, and maps, the team—comprising a cartographer, designer, three-dimensional modelling expert, and historical researchers—set out to generate visualisations of the landscape at the time of British colonisation. Nyoongar elder Noel Nannup approved culturally sensitive material and contributed his perspective on Aboriginal content to include in the exhibition. The initiative’s context remains pressing. In many ways, Perth has become a template for development in the metropolitan area (Weller). While not unusual for a capital, the rate of transformation is perhaps unexpected in a city less than 200 years old (Forster). There also remains a persistent view of existing wetlands as obstructions to progress that, once removed, are soon forgotten (Urban Bushland Council). Digital visualisation can contribute to appreciating environments prior to colonisation but also to re-imagining possibilities for future human interactions with land, water, and space. Despite the rapid pace of change, many Perth area residents have memories of wetlands lost during their lifetimes (for example, Giblett, Forrestdale). However, as the clearing and drainage of the inner city occurred early in settlement, recollections of urban wetlands exist exclusively in historical records. In 1935, a local correspondent using the name “Sandgroper” reminisced about swamps, connecting them to Perth’s colonial heritage: But the Swamps were very real in fact, and in name in the [eighteen-] Nineties, and the Perth of my youth cannot be visualised without them. They were, of course, drying up apace, but they were swamps for all that, and they linked us directly with the earliest days of the Colony when our great-grandparents had founded this City of Perth on a sort of hog's-back, of which Hay-street was the ridge, and from which a succession of streamlets ran down its southern slope to the river, while land locked to the north of it lay a series of lakes which have long since been filled to and built over so that the only evidence that they have ever existed lies in the original street plans of Perth prepared by Roe and Hillman in the early eighteen-thirties. A salient consequence of the loss of ecological memory is the tendency to repeat the miscues of the past, especially the blatant disregard for natural and cultural heritage, as suburbanisation engulfs the area. While the swamps of inner Perth remain only in the names of streets, existing wetlands in the metropolitan area are still being threatened, as the Roe Highway (Roe 8) Campaign demonstrates. To re-imagine Perth’s lost landscape, we used several colonial survey maps to plot the location of the original lakes and swamps. At this time, a series of interconnecting waterbodies, known as the Perth Great Lakes, spread across the north of the city (Bekle and Gentilli). This phase required the earliest cartographic sources (Figure 3) because, by 1855, city maps no longer depicted wetlands. We synthesised contextual information, such as well depths, geological and botanical maps, settlers’ accounts, Nyoongar oral histories, and colonial-era artists’ impressions, to produce renderings of Perth. This diverse collection of primary and secondary materials served as the basis for creating new images of the city. Team member Jeff Murray interpolated Balbuk’s route using historical mappings and accounts, topographical data, court records, and cartographic common sense. He determined that Balbuk would have camped on the high ground of the southern part of Lake Kingsford rather than the more inundated northern part (Figure 2). Furthermore, she would have followed a reasonably direct course north of St Georges Terrace (contrary to David Whish-Wilson’s imaginings) because she was barred from Government House for protesting. This easier route would have also avoided the springs and gullies that appear on early maps of Perth. Figure 3. Townsite of Perth in Western Australia by Colonial Draftsman A. Hillman and John Septimus Roe (1838). This map of Perth depicts the wetlands that existed overlaid by the geomentric grid of the new city. Image Credit: State Library of Western Australia (Image Number: BA1961/14). Additionally, we produced an animated display based on aerial photographs to show the historical extent of change. Prompted by the build up to World War II, the earliest aerial photography of Perth dates from the late 1930s (Dixon 148–54). As “Sandgroper” noted, by this time, most of the urban wetlands had been drained or substantially modified. The animation revealed considerable alterations to the formerly swampy Swan River shoreline. Most prominent was the transformation of the Matagarup shallows across the Swan River, originally consisting of small islands. Now traversed by a causeway, this area was transformed into a single island, Heirisson—the general site of Balbuk’s birth. The animation and accompanying materials (maps, images, and writings) enabled viewers to apprehend the changes in real time and to imagine what the city was once like. Re-imagining Perth’s Urban Heart The physical environment of inner Perth includes virtually no trace of its wetland origins. Consequently, we considered whether a representation of Perth, as it existed previously, could enhance public understanding of natural heritage and thereby increase its value. For this reason, interpretive materials were exhibited centrally at Perth Town Hall. Built partly by convicts between 1867 and 1870, the venue is close to the site of the 1829 Foundation of Perth, depicted in George Pitt Morrison’s painting. Balbuk’s grandfather “camped somewhere in the city of Perth, not far from the Town Hall” (Bates, “Fanny”). The building lies one block from the site of the railway station on the site of Lake Kingsford, the subsistence grounds of Balbuk and her forebears: The old swamp which is now the Perth railway yards had been a favourite jilgi ground; a spring near the Town Hall had been a camping place of Maiago […] and others of her fathers' folk; and all around and about city and suburbs she had gathered roots and fished for crayfish in the days gone by. (Bates, “Derelicts” 55) Beginning in 1848, the draining of Lake Kingsford reached completion during the construction of the Town Hall. While the swamps of the city were not appreciated by many residents, some organisations, such as the Perth Town Trust, vigorously opposed the reclamation of the lake, alluding to its hydrological role: That, the soil being sand, it is not to be supposed that Lake Kingsford has in itself any material effect on the wells of Perth; but that, from this same reason of the sandy soil, it would be impossible to keep the lake dry without, by so doing, withdrawing the water from at least the adjacent parts of the townsite to the same depth. (Independent Journal of Politics and News 3) At the time of our exhibition, the Lake Kingsford site was again being reworked to sink the railway line and build Yagan Square, a public space named after a colonial-era Nyoongar leader. The project required specialised construction techniques due to the high water table—the remnants of the lake. People travelling to the exhibition by train in October 2014 could have seen the lake reasserting itself in partly-filled depressions, flush with winter rain (Figure 4).Figure 4. Rise of the Repressed (2014). Water Rising in the former site of Lake Kingsford/Irwin during construction, corner of Roe and Fitzgerald Streets, Northbridge, WA. Image Credit: Nandi Chinna (2014). The exhibition was situated in the Town Hall’s enclosed undercroft designed for markets and more recently for shops. While some visited after peering curiously through the glass walls of the undercroft, others hailed from local and state government organisations. Guest comments applauded the alternative view of Perth we presented. The content invited the public to re-imagine Perth as a city of wetlands that were both environmentally and culturally important. A display panel described how the city’s infrastructure presented a hindrance for Balbuk as she attempted to negotiate the once-familiar route between Yoonderup and Lake Kingsford (Figure 2). Perth’s growth “restricted Balbuk’s wanderings; towns, trains, and farms came through her ‘line of march’; old landmarks were thus swept away, and year after year saw her less confident of the locality of one-time familiar spots” (Bates, “Fanny”). Conserving Wetlands: From Re-Claiming to Re-Valuing? Imagination, for philosopher Roger Scruton, involves “thinking of, and attending to, a present object (by thinking of it, or perceiving it, in terms of something absent)” (155). According to Scruton, the feelings aroused through imagination can prompt creative, transformative experiences. While environmental conservation tends to rely on data-driven empirical approaches, it appeals to imagination less commonly. We have found, however, that attending to the present object (the city) in terms of something absent (its wetlands) through evocative visual material can complement traditional conservation agendas focused on habitats and species. The actual extent of wetlands loss in the Swan Coastal Plain—the flat and sandy region extending from Jurien Bay south to Cape Naturaliste, including Perth—is contested. However, estimates suggest that 80 per cent of wetlands have been lost, with remaining habitats threatened by climate change, suburban development, agriculture, and industry (Department of Environment and Conservation). As with the swamps and lakes of the inner city, many regional wetlands were cleared, drained, or filled before they could be properly documented. Additionally, the seasonal fluctuations of swampy places have never been easily translatable to two-dimensional records. As Giblett notes, the creation of cartographic representations and the assignment of English names were attempts to fix the dynamic boundaries of wetlands, at least in the minds of settlers and administrators (Postmodern 72–73). Moreover, European colonists found the Western Australian landscape, including its wetlands, generally discomfiting. In a letter from 1833, metaphors failed George Fletcher Moore, the effusive colonial commentator, “I cannot compare these swamps to any marshes with which you are familiar” (220). The intermediate nature of wetlands—as neither land nor lake—is perhaps one reason for their cultural marginalisation (Giblett, Postmodern 39). The conviction that unsanitary, miasmic wetlands should be converted to more useful purposes largely prevailed (Giblett, Black 105–22). Felicity Morel-EdnieBrown’s research into land ownership records in colonial Perth demonstrated that town lots on swampland were often preferred. By layering records using geographic information systems (GIS), she revealed modifications to town plans to accommodate swampland frontages. The decline of wetlands in the region appears to have been driven initially by their exploitation for water and later for fertile soil. Northern market gardens supplied the needs of the early city. It is likely that the depletion of Nyoongar bush foods predated the flourishing of these gardens (Carter and Nutter). Engaging with the history of Perth’s swamps raises questions about the appreciation of wetlands today. In an era where numerous conservation strategies and alternatives have been developed (for example, Bobbink et al. 93–220), the exploitation of wetlands in service to population growth persists. On Perth’s north side, wetlands have long been subdued by controlling their water levels and landscaping their boundaries, as the suburban examples of Lake Monger and Hyde Park (formerly Third Swamp Reserve) reveal. Largely unmodified wetlands, such as Forrestdale Lake, exist south of Perth, but they too are in danger (Giblett, Black Swan). The Beeliar Wetlands near the suburb of Bibra Lake comprise an interconnected series of lakes and swamps that are vulnerable to a highway extension project first proposed in the 1950s. Just as the Perth Town Trust debated Lake Kingsford’s draining, local councils and the public are fiercely contesting the construction of the Roe Highway, which will bisect Beeliar Wetlands, destroying Roe Swamp (Chinna). The conservation value of wetlands still struggles to compete with traffic planning underpinned by a modernist ideology that associates cars and freeways with progress (Gregory). Outside of archives, the debate about Lake Kingsford is almost entirely forgotten and its physical presence has been erased. Despite the magnitude of loss, re-imagining the city’s swamplands, in the way that we have, calls attention to past indiscretions while invigorating future possibilities. We hope that the re-imagining of Perth’s wetlands stimulates public respect for ancestral tracks and songlines like Balbuk’s. Despite the accretions of settler history and colonial discourse, songlines endure as a fundamental cultural heritage. Nyoongar elder Noel Nannup states, “as people, if we can get out there on our songlines, even though there may be farms or roads overlaying them, fences, whatever it is that might impede us from travelling directly upon them, if we can get close proximity, we can still keep our culture alive. That is why it is so important for us to have our songlines.” Just as Fanny Balbuk plied her songlines between Yoonderup and Lake Kingsford, the traditional custodians of Beeliar and other wetlands around Perth walk the landscape as an act of resistance and solidarity, keeping the stories of place alive. Acknowledgments The authors wish to acknowledge Rod Giblett (ECU), Nandi Chinna (ECU), Susanna Iuliano (ECU), Jeff Murray (Kareff Consulting), Dimitri Fotev (City of Perth), and Brendan McAtee (Landgate) for their contributions to this project. The authors also acknowledge the traditional custodians of the lands upon which this paper was researched and written. References Bates, Daisy. “Fanny Balbuk-Yooreel: The Last Swan River (Female) Native.” The Western Mail 1 Jun. 1907: 45.———. “Oldest Perth: The Days before the White Men Won.” The Western Mail 25 Dec. 1909: 16–17.———. “Derelicts: The Passing of the Bibbulmun.” The Western Mail 25 Dec. 1924: 55–56. ———. “Aboriginal Perth.” The Western Mail 4 Jul. 1929: 70.———. “Hooper’s Fence: A Query.” The Western Mail 18 Apr. 1935: 9.———. The Passing of the Aborigines: A Lifetime Spent among the Natives of Australia. London: John Murray, 1966.Bekle, Hugo. “The Wetlands Lost: Drainage of the Perth Lake Systems.” Western Geographer 5.1–2 (1981): 21–41.Bekle, Hugo, and Joseph Gentilli. “History of the Perth Lakes.” Early Days 10.5 (1993): 442–60.Bobbink, Roland, Boudewijn Beltman, Jos Verhoeven, and Dennis Whigham, eds. Wetlands: Functioning, Biodiversity Conservation, and Restoration. Berlin: Springer-Verlag, 2006. Carter, Bevan, and Lynda Nutter. Nyungah Land: Records of Invasion and Theft of Aboriginal Land on the Swan River 1829–1850. Guildford: Swan Valley Nyungah Community, 2005.Chinna, Nandi. “Swamp.” Griffith Review 47 (2015). 29 Sep. 2015 ‹https://griffithreview.com/articles/swamp›.Department of Environment and Conservation. Geomorphic Wetlands Swan Coastal Plain Dataset. Perth: Department of Environment and Conservation, 2008.Dixon, Robert. Photography, Early Cinema, and Colonial Modernity: Frank Hurley’s Synchronized Lecture Entertainments. London: Anthem Press, 2011. Forster, Clive. Australian Cities: Continuity and Change. Oxford: Oxford UP, 2004.Giblett, Rod. Postmodern Wetlands: Culture, History, Ecology. Edinburgh: Edinburgh UP, 1996. ———. Forrestdale: People and Place. Bassendean: Access Press, 2006.———. Black Swan Lake: Life of a Wetland. Bristol: Intellect, 2013.———. Cities and Wetlands: The Return of the Repressed in Nature and Culture. London: Bloomsbury, 2016. Chapter 2.Graham, Mary. “Some Thoughts about the Philosophical Underpinnings of Aboriginal Worldviews.” Australian Humanities Review 45 (2008). 29 Sep. 2015 ‹http://www.australianhumanitiesreview.org/archive/Issue-November-2008/graham.html›.Gregory, Jenny. “Remembering Mounts Bay: The Narrows Scheme and the Internationalization of Perth Planning.” Studies in Western Australian History 27 (2011): 145–66.Independent Journal of Politics and News. “Perth Town Trust.” The Perth Gazette and Independent Journal of Politics and News 8 Jul. 1848: 2–3.Moore, George Fletcher. Extracts from the Letters of George Fletcher Moore. Ed. Martin Doyle. London: Orr and Smith, 1834.Morel-EdnieBrown, Felicity. “Layered Landscape: The Swamps of Colonial Northbridge.” Social Science Computer Review 27 (2009): 390–419. Nannup, Noel. Songlines with Dr Noel Nannup. Dir. Faculty of Regional Professional Studies, Edith Cowan University (2015). 29 Sep. 2015 ‹https://vimeo.com/129198094›. (Quoted material transcribed from 3.08–3.39 of the video.) O’Connor, Rory, Gary Quartermaine, and Corrie Bodney. Report on an Investigation into Aboriginal Significance of Wetlands and Rivers in the Perth-Bunbury Region. Perth: Western Australian Water Resources Council, 1989.Reece, Bob. “‘Killing with Kindness’: Daisy Bates and New Norcia.” Aboriginal History 32 (2008): 128–45.Rose, Deborah Bird. Nourishing Terrains: Australian Aboriginal Views of Landscape and Wilderness. Canberra: Australian Heritage Commission, 1996.Sanderson, Eric. Mannahatta: A Natural History of New York City. New York: Harry N. Abrams, 2009.Sandgroper. “Gilgies: The Swamps of Perth.” The West Australian 4 May 1935: 7.Scruton, Roger. Art and Imagination. London: Methuen, 1974.Seddon, George. Sense of Place: A Response to an Environment, the Swan Coastal Plain, Western Australia. Melbourne: Bloomings Books, 2004.South West Aboriginal Land and Sea Council and John Host with Chris Owen. “It’s Still in My Heart, This is My Country:” The Single Noongar Claim History. Crawley: U of Western Australia P, 2009.Urban Bushland Council. “Bushland Issues.” 2015. 29 Sep. 2015 ‹http://www.bushlandperth.org.au/bushland-issues›.Welborn, Suzanne. Swan: The History of a Brewery. Crawley: U of Western Australia P, 1987.Weller, Richard. Boomtown 2050: Scenarios for a Rapidly Growing City. Crawley: U of Western Australia P, 2009. Whish-Wilson, David. Perth. Sydney: NewSouth Publishing, 2013.

Soil properties are strongly influenced by the composition of the surrounding vegetation. We investigated soil properties of three ecosystems; a coniferous forest, a deciduous forest and an agricultural grassland, to determine the impact of land use change on soil properties. Disturbances such as deforestation followed by cultivation can severely alter soil properties, including losses of soil carbon. We collected nine 40 cm cores from three ecosystem types on the Roebuck Farm, north of Perth Village, Ontario, Canada. Dominant species in each ecosystem included hemlock and white pine in the coniferous forest; sugar maple, birch and beech in the deciduous forest; grasses, legumes and herbs in the grassland. Soil pH varied little between the three ecosystems and over depth. Soils under grassland vegetation had the highest bulk density, especially near the surface. The forest sites showed higher cation exchange capacity and soil moisture than the grassland; these differences largely resulted from higher organic matter levels in the surface forest soils. Vertical distribution of organic matter varied greatly amongst the three ecosystems. In the forest, more of the organic matter was located near the surface, while in the grassland organic matter concentrations varied little with depth. The results suggest that changes in land cover and land use alters litter inputs and nutrient cycling rates, modifying soil physical and chemical properties. Our results further suggest that conversion of forest into agricultural land in this area can lead to a decline in soil carbon storage.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using ‘root dip inoculation’ and ‘soil inoculation’ technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Geology may appear remote from human health. However, rocks are the fundamental building blocks of the Earth’s surface, full of important minerals and chemical elements. Rock weathering and alteration products not only form our soils to support our crops but provide essential elements to build biology. Some heavy metals are carcinogenic, and some only affect the body’s ability to produce red and white cells. In fact, any heavy metal affects any part of the body due to our geological behavior (GBR). For example, a heavy metal may not cause any side effects by contact with the skin, even when swallowed, and may not cause serious harm, but inhaling the vapor of that heavy, toxic metal can cause severe damage to the lungs. Some heavy and quasi metals are more toxic, and some forms of heavy metal compounds are even more dangerous than other forms. Toxic and hazardous heavy metals like arsenic, lead, mercury, zinc, chromium and iron are found in a variety of personal care products, e.g., lipstick, whitening toothpaste, eyeliner and nail color. We use the Anodic Stripping voltammetry (ASV) method for arsenic detection, utilizing the PDV6000 + analyzer (Manufactured B3 Electronics, Perth Australia) configured with a solid gold electrode for total as analyses. Sample Preparation: Spot urine samples were collected from most of the participants from 1 January 2018 to 30 March 2020 after face to face interviews. Women with missing information on adjustment variable(s) were included in the analysis in a separate category for adjustment. Results: Our studies were focus in describing the mean Urinary Arsenic levels (u As) residents of in the central zones of Shiraz, Fasa, Abadeh, Jahrom and Marvdasht to compare the effect of diet such as consuming canned or frozen foods, Consume rice daily, smoking habits and lifestyle on the incidence of Breast. Conclusion: Cancer with arsenic compounds has been reported in many parts of the world. The disease affects all organs of the body, and every year many victims of cancer suffer from severe symptoms and even death. Arsenic compounds are present in the human body and environment in an inorganic and organic form. Inorganic arsenic includes arsenite and arsenic, can also be presented in the environment in the form of methyl (monthly arsenic acid and dimethyl arsenic acid). Arsenic, especially inorganic arsenic, is well absorbed through the gastrointestinal tract rivers (80% -90%) and will be scattered throughout the body. It is often metabolized by methylation and excreted mainly in the urine. Methylation of inorganic arsenic compounds is said to undergo a detoxification process.

Contemporary culinary discourse in Australia has been dominated by the notion that migration and the increased mobility of Australians is responsible for filling a culinary void, as though, because we have had no peasantry we have no affinity with either the land or its produce. This argument serves to alienate Australians of British descent and its validity is open to questioning. It's an argument in urgent need of debate because cuisine stands out as the signifier of a 'multicultural' nation. Despite all the political posturing, food has 'long been the acceptable face of multiculturalism' (Gunew 13). We argue that the rhetoric of multiculturalism serves to widen the chasm between Australians of British descent and other migrants by encouraging the 'us' and 'them' mentality. We have examined the common links in the food stories of three women from disparate backgrounds. The sample is small in quantitative terms but we felt that if the culinary histories of just three women ran counter to the dominant discourse, then they would provide a new point of departure. In doing this we hope to question the precept driving culinary discourse which gives more weight to what men have said and done, than what women have cooked and how; and propagates mythologies about the eating habits of 'ethnic' migrants. Multiculturalism The terminology surrounding policies that seek to manage difference and diversity is culturally loaded and tends to perpetuate binaries. "Multiculturalism, circulates in Australia as a series of discursive formations serving a variety of institutional interests" (Gunew 256). In Australia multicultural policy seeks to "manage our cultural diversity so that the social cohesion of our nation is preserved" (Advisory Council on Multicultural Affairs 4). The result is to allow diversity that is sanctioned and is to some extent homogenised, while difference is not understood and is contained (see Newman). Multicultural? Who does it include and exclude? Gunew points out that official formulations of multiculturalism exclude people of 'Anglo-Celtic' origin, as though they had no 'ethnicity'. Multiculturalism, while addressing some of the social problems of immigration, is propelled at government level by our need for national cultural policy (see Stratton and Ang). To have a national cultural policy you need, it would seem, a film industry, a music industry, and a cuisine. In his history of Australian cuisine, Symons has only briefly alluded to women's role in the development of Australia's 'industrial cuisine'. One Continuous Picnic presents an essentially masculinist history, a pessimistic derogatory view giving little value to domestic traditions passed from mother to daughter. Women are mentioned only as authors of cookbooks produced throughout the 19th century and as the housewives whose role in the 1950s changed due to the introduction of labour-saving devices. Scant reference is made to the pre-eminent icon of Australian rural culinary history, the Country Women's Association1 and their recipe books. These books have gone through numerous editions from the 1920s, but Symons refers to them dismissively as a 'plain text' arising from the 'store-shelf of processed ingredients' (Symons 201). What of the 'vegie' patch, the afternoon tea? These traditions are mentioned, but only in passing. The products of arduous and loving baking are belittled as 'pretty things'. Is this because they are too difficult to document or because they are women's business? Female writers Barbara Santich and Marion Halligan have both written on the importance of these traditions in the lives of Australian women. Symons's discourse concentrates on 'industrial cuisine', but who is to say that its imperatives were not transgressed. The available data derives from recipe books, sales figures and advertising, but we don't actually know how much food came from other sources. Did your grandmother keep chickens? Did your grandfather fish? Terra Australis Culinae Nullius2 Michael Symons's precept is: This is the only continent which has not supported an agrarian society ... . Our land missed that fertile period when agriculture and cooking were created. There has never been the creative interplay between society and the soil. Almost no food has ever been grown by the person who eats it, almost no food has been preserved in the home and indeed, very little preparation is now done by a family cook. This is the uncultivated continent. Our history is without peasants. (10, our emphasis) This notion of terra Australis culinae nullius is problematic on two levels. The use of the word indigenous implies both Aboriginal and British settler culinary tradition. This statement consequently denies both traditional Aboriginal knowledge and the British traditions. The importance of Aboriginal foodways, their modern exploitation and their impact on the future of Australian cuisine needs recognition, but the complexity of the issue places it beyond the bounds of this paper. Symons's view of peasantry is a romanticised one, and says less about food and more about nostalgia for a more permanent, less changing environment. Advertising of 'ethnic' food routinely exploits this nostalgia by appropriating the image of the cheerful peasant. These advertisements perpetuate the mythologies that link pastoral images with 'family values'. These myths, or what Barthes describes as 'cultural truths', hold that migrant families all have harmonious relationships, are benevolently patriarchal and they all sit down to eat together. 'Ethnic' families are at one with the land and use recipes made from fresher, more natural produce, that are handed down through the female line and have had the benefit of generations of culinary wisdom. (See Gallegos & Mansfield.) So are the culinary traditions of Australians of British descent so different from those of migrant families? Joan, born near her home in Cunderdin in the Western Australian wheatbelt, grew up on a farm in reasonably prosperous circumstances with her six siblings. After marrying, she remained in the Cunderdin area to continue farming. Giovanna was born in 1915 on a farm four kilometres outside Vasto, in the Italian region of Abruzzi. One of seven children, her father died when she was young and at the age of twenty, she came to Australia to marry a Vastese man 12 years her senior. Maria was born in Madeira in 1946, in a coastal village near the capital Funchal. Like Giovanna she is the fifth of seven children and arrived in Australia at the age of twenty to marry. We used the information elicited from these three women to scrutinise some of the mythology surrounding ethnic families. Myth 1: 'Ethnic' families all eat together. All three women said their families had eaten together in the past and it was Joan who commented that what was missing in Australia today was people sitting down together to share a meal. Joan's farming community all came in for an extended midday meal from necessity, as the horses needed to be rested. Both women described radio, television, increasing work hours and different shifts as responsible for the demise of the family meal. Commensality is one of the common boundary markers for all groups 'indicating a kind of equality, peership, and the promise of further kinship links stemming from the intimate acts of dining together' (Nash 11). It is not only migrant families who eat together, and the demise of the family meal is more widely felt. Myth 2: Recipes in 'ethnic' families are passed down from generation to generation. Handing recipes down from generation to generation is not limited to just 'ethnic' families. All three women describe learning to cook from their mothers. Giovanna and Maria had hands-on experiences at very young ages, cooking for the family out of necessity. Joan did not have to cook for her family but her mother still taught her basic cookery as well as the finer points. The fluidity of the mother-daughter identity is expressed and documented by the handing on of recipes. Joan's community thought the recipes important enough to document in a written form, and so the West Australian version of the CWA cookbook became a reality. Joan, when asked about why the CWA developed a cookbook, replied that they wanted to record the recipes that were all well tried by women who spent the bulk of their days in the kitchen, cooking. Being taught to cook, teaching your children to cook and passing on recipes crosses borders, and does not serve to create or maintain boundaries. Myth 3: 'Ethnic' food is never prepared from processed products but always from homegrown produce. During their childhoods the range of food items purchased by the families was remarkably similar for all three women. All described buying tinned fish, rice and sugar, while the range of items produced from what was grown reflected common practices for the use and preservation of fresh produce. The major difference was the items that were in abundance, so while Joan describes pickling meat in addition to preserving fruits, Maria talks about preserving fish and Giovanna vegetables. The traditions developed around what was available. Joan and her family grew the food that they ate, preserved the food in their own home, and the family cook did all the preparation. To suggest they did not have a creative interplay with the soil is suggesting that they were unskilled in making a harsh landscape profitable. Joan's family could afford to buy more food items than the other families. Given the choice both Giovanna's and Maria's families would have only been too eager to make their lives easier. For example, on special occasions when the choice was available Giovanna's family chose store-bought pasta. The perception of the freshness and tastiness of peasant cuisine and affinity with the land obscures the issue, which for much of the world is still quantity, not quality. It would seem that these women's stories have points of reference. All three women describe the sense of community food engendered. They all remember sharing and swapping recipes. This sense of community was expressed by the sharing of food -- regardless of how little there was or what it was. The legacy lives on, while no longer feeling obliged to provide an elaborate afternoon tea as she did in her married life, visitors to Joan's home arrive to the smell of freshly baked biscuits shared over a cup of tea or coffee. Giovanna is only too eager to share her Vastese cakes with a cup of espresso coffee, and as new acquaintances we are obliged to taste each of the five different varieties of cakes and take some home. Maria, on the other hand, offered instant coffee and store-bought biscuits; having worked outside the home all her life and being thirty years younger than the other women, is this perhaps the face of modernity? The widespread anticipation of the divisions between these women has more to do with power relationships and the politics of east, west, north, south than with the realities of everyday life. The development of a style of eating will depend on your knowledge both as an individual and as a collective, the ingredients that are available at any one time, the conditions under which food has to be grown, and your own history. For the newly-arrived Southern Europeans meat was consumed in higher quantities because its availability was restricted in their countries of origin, to eat meat regularly was to increase your status in society. Interest in 'ethnic' food and its hybridisation is a global phenomenon and the creolisation of eating has been described both in America (see Garbaccia) and in Britain (James 81). The current obsession with the 'ethnic' has more to do with nostalgia than tolerance. The interviews which were conducted highlight the similarities between three women from different backgrounds despite differences in age and socioeconomic status. Our cuisine is in the process of hybridisation, but let us not forget who is manipulating this process and the agendas under which it is encouraged. To lay claim that one tradition is wonderful, while the other either does not exist or has nothing to offer, perpetuates divisive binaries. By focussing on what these women have in common rather than their differences we begin to critically interrogate the "culinary binary". It is our intention to stimulate debate that we hope will eventually lead to the encouragement of difference rather than the futile pursuit of authenticity. Footnotes 1. The Country Women's Association is an organisation that began in Australia in the 1920s. It is still operational and has as one of its primary aims the improvement of the welfare and conditions of women and children, especially those living in the country. 2. The term terra australis nullius is used to describe Australia at the point of colonisation. The continent was regarded as "empty" because the native people had neither improved nor settled on the land. We have extended this concept to incorporate cuisine. This notion of emptiness has influenced readings of Australian history which overlook the indigenous population and their relationship with the land. References Advisory Council on Multicultural Affairs. Towards A National Agenda for a Multicultural Australia. Canberra, 1988. Barthes, Roland. Mythologies. Trans. A. Lavers. London: Vintage, 1993. Belasco, Warren. "Ethnic Fast Foods: The Corporate Melting Pot". Food and Foodways 2.1 (1987): 1-30. Gallegos, Danielle, and Alan Mansfield. "Eclectic Gastronomes or Conservative Eaters: What Does Advertising Say?" Nutrition Unplugged, Proceedings of the 16th Dietitians Association of Australia National Conference. Hobart: Dietitians Association of Australia, 1997. Gallegos, Danielle, and Alan Mansfield. "Screen Cuisine: The Pastes, Powders and Potions of the Mediterranean Diet". Celebrate Food, Proceedings of the 17th Dietitians Association of Australia National Conference. Sydney: Dietitians Association of Australia, 1998. Garbaccia, D.R. We Are What We Eat: Ethnic Food and the Making of Americans. Boston: Harvard UP, 1998. Gunew, Sneja. "Denaturalising Cultural Nationalisms; Multicultural Readings of 'Australia'." Nation and Narration. Ed. Homi Bhabha. London: Routledge, 1990. 245-66. Gunew, Sneja. Introduction. Feminism and the Politics of Difference. Eds. S. Gunew and A. Yeatman. Sydney: Allen and Unwin, 1993. xiii-xxv. Halligan, Marion. Eat My Words. Melbourne: Angus & Robertson, 1990. Harvey, D. The Condition of Postmodernity. Oxford: Basil Blackwell, 1989. James, Alison. "How British Is British Food". Food, Health and Identity. Ed. P. Caplan. London: Routledge, 1997. 71-86. Mennell, Stephen. All Manners of Food: Eating and Taste in England and France from the Middle Ages to the Present. Oxford: Basil Blackwell, 1996. Nash, Manning. The Cauldron of Ethnicity in the Modern World. Chicago: U of Chicago P, 1989. Newman, Felicity. Didn't Your Mother Teach You Not to Talk with Your Mouth Full? Food, Families and Friction. Unpublished Masters Thesis, Murdoch University, Perth, Western Australia, 1997. Santich, Barbara. Looking for Flavour. Adelaide: Wakefield, 1996. Stratton, Jon, and Ien Ang. "Multicultural Imagined Communities: Cultural Difference and National Identity in Australia and the USA". Continuum 8.2 (1994): 124-58. Symons, Michael. One Continuous Picnic. Adelaide: Duck, 1992. Citation reference for this article MLA style: Danielle Gallegos, Felicity Newman. "What about the Women? Food, Migration and Mythology." M/C: A Journal of Media and Culture 2.7 (1999). [your date of access] <http://www.uq.edu.au/mc/9910/women.php>. Chicago style: Danielle Gallegos, Felicity Newman, "What about the Women? Food, Migration and Mythology," M/C: A Journal of Media and Culture 2, no. 7 (1999), <http://www.uq.edu.au/mc/9910/women.php> ([your date of access]). APA style: Danielle Gallegos, Felicity Newman. (1999) What about the women? Food, migration and mythology. M/C: A Journal of Media and Culture 2(7). <http://www.uq.edu.au/mc/9910/women.php> ([your date of access]).