Journal articles: 'Personalized gene therapy'

1

Schaly, Sabrina, Merry Ghebretatios, and Satya Prakash. "Baculoviruses in Gene Therapy and Personalized Medicine." Biologics: Targets and Therapy Volume 15 (April 2021): 115–32. http://dx.doi.org/10.2147/btt.s292692.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Harris, Tim. "Gene and drug matrix for personalized cancer therapy." Nature Reviews Drug Discovery 9, no. 8 (August 2010): 660. http://dx.doi.org/10.1038/nrd3181-c1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Kohno, Takashi, Koji Tsuta, Katsuya Tsuchihara, Takashi Nakaoku, Kiyotaka Yoh, and Koichi Goto. "RETfusion gene: Translation to personalized lung cancer therapy." Cancer Science 104, no. 11 (October 1, 2013): 1396–400. http://dx.doi.org/10.1111/cas.12275.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Iacobas, Sanda, and Dumitru Andrei Iacobas. "Personalized 3-Gene Panel for Prostate Cancer Target Therapy." Current Issues in Molecular Biology 44, no. 1 (January 15, 2022): 360–82. http://dx.doi.org/10.3390/cimb44010027.

Full text

Abstract:

Many years and billions spent for research did not yet produce an effective answer to prostate cancer (PCa). Not only each human, but even each cancer nodule in the same tumor, has unique transcriptome topology. The differences go beyond the expression level to the expression control and networking of individual genes. The unrepeatable heterogeneous transcriptomic organization among men makes the quest for universal biomarkers and “fit-for-all” treatments unrealistic. We present a bioinformatics procedure to identify each patient’s unique triplet of PCa Gene Master Regulators (GMRs) and predict consequences of their experimental manipulation. The procedure is based on the Genomic Fabric Paradigm (GFP), which characterizes each individual gene by the independent expression level, expression variability and expression coordination with each other gene. GFP can identify the GMRs whose controlled alteration would selectively kill the cancer cells with little consequence on the normal tissue. The method was applied to microarray data on surgically removed prostates from two men with metastatic PCas (each with three distinct cancer nodules), and DU145 and LNCaP PCa cell lines. The applications verified that each PCa case is unique and predicted the consequences of the GMRs’ manipulation. The predictions are theoretical and need further experimental validation.

APA, Harvard, Vancouver, ISO, and other styles

5

Barthélémy, Florian, and Nicolas Wein. "Personalized gene and cell therapy for Duchenne Muscular Dystrophy." Neuromuscular Disorders 28, no. 10 (October 2018): 803–24. http://dx.doi.org/10.1016/j.nmd.2018.06.009.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Sahoo, Firoj Kumar. "Enalapril and the VEGFA gene: Personalized medicine in hypertension therapy." European Journal of Clinical Pharmacology 72, no. 1 (November 23, 2015): 125. http://dx.doi.org/10.1007/s00228-015-1984-y.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

BERTOLOTTI, ROGER. "EDITORIAL: "AUTOLOGOUS STEM CELL GENE THERAPY: TOWARD A UNIVERSAL PLATFORM FOR PERSONALIZED THERAPY"." Gene Therapy and Regulation 03, no. 01 (March 2007): 1–14. http://dx.doi.org/10.1142/s1568558607000022.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Dugo, Ketty, Francesca Bruno, Valentina Sturiale, Desiree Brancato, Salvatore Saccone, and Concetta Federico. "Hereditary Transthyretin-Related Amyloidosis: Genetic Heterogeneity and Early Personalized Gene Therapy." Biomedicines 10, no. 10 (September 25, 2022): 2394. http://dx.doi.org/10.3390/biomedicines10102394.

Full text

Abstract:

Point mutations of the transthyretin (TTR) gene are related with hereditary amyloidosis (hATTR). The number of people affected by this rare disease is only partially estimated. The real impact of somatic mosaicism and other genetic factors on expressivity, complexity, progression, and transmission of the disease should be better investigated. The relevance of this rare disease is increasing and many efforts have been made to improve the time to diagnosis and to estimate the real number of cases in endemic and non-endemic areas. In this context, somatic mosaicism should be better investigated to explain the complexity of the heterogeneity of the hATTR clinical features, to better estimate the number of new cases, and to focus on early and personalized gene therapy. Gene therapy can potentially improve the living conditions of affected individuals and is one of the central goals in research on amyloidosis related to the TTR gene, with the advantage of overcoming liver transplantation as the sole treatment for hATTR disease.

APA, Harvard, Vancouver, ISO, and other styles

9

M, Mavroudi, Zarogoulidis P, Porpodis K, Kioumis I, Lampaki S, Yarmus L, Malecki R, Zarogoulidis K, and Malecki M. "Stem cells’ guided gene therapy of cancer: New frontier in personalized and targeted therapy." Journal of Cancer Research & Therapy 2, no. 1 (January 1, 2014): 22–33. http://dx.doi.org/10.14312/2052-4994.2014-4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

NAKAMURA, Tomonori, and Koujirou YAMAMOTO. "2. Application of Gene Analysis and TDM in Personalized Drug Therapy." Rinsho yakuri/Japanese Journal of Clinical Pharmacology and Therapeutics 44, no. 4 (2013): 361–62. http://dx.doi.org/10.3999/jscpt.44.361.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

Varin, Juliette, Clément Morival, Noémien Maillard, Oumeya Adjali, and Therese Cronin. "Risk Mitigation of Immunogenicity: A Key to Personalized Retinal Gene Therapy." International Journal of Molecular Sciences 22, no. 23 (November 26, 2021): 12818. http://dx.doi.org/10.3390/ijms222312818.

Full text

Abstract:

Gene therapy (GT) for ocular disorders has advanced the most among adeno-associated virus (AAV)-mediated therapies, with one product already approved in the market. The bank of retinal gene mutations carefully compiled over 30 years, the small retinal surface that does not require high clinical vector stocks, and the relatively immune-privileged environment of the eye explain such success. However, adverse effects due to AAV-delivery, though rare in the retina have led to the interruption of clinical trials. Risk mitigation, as the key to safe and efficient GT, has become the focus of ‘bedside-back-to-bench’ studies. Herein, we overview the inflammatory adverse events described in retinal GT trials and analyze which components of the retinal immunological environment might be the most involved in these immune responses, with a focus on the innate immune system composed of microglial surveillance. We consider the factors that can influence inflammation in the retina after GT such as viral sensors in the retinal tissue and CpG content in promoters or transgene sequences. Finally, we consider options to reduce the immunological risk, including dose, modified capsids or exclusion criteria for clinical trials. A better understanding and mitigation of immune risk factors inducing host immunity in AAV-mediated retinal GT is the key to achieving safe and efficient GT.

APA, Harvard, Vancouver, ISO, and other styles

12

Kohno, Takashi, Koji Tsuta, Katsuya Tsuchihara, Tatsuji Mizukami, Kiyotaka Yoh, and Koichi Goto. "Abstract A32: RET fusion gene: Translation to personalized lung cancer therapy." Clinical Cancer Research 20, no. 2 Supplement (January 15, 2014): A32. http://dx.doi.org/10.1158/1078-0432.14aacriaslc-a32.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Vasireddy, Vidyullatha, Jason A. Mills, Rajashekhar Gaddameedi, Etiena Basner-Tschakarjan, Monika Kohnke, Aaron D. Black, Krill Alexandrov, et al. "AAV-Mediated Gene Therapy for Choroideremia: Preclinical Studies in Personalized Models." PLoS ONE 8, no. 5 (May 7, 2013): e61396. http://dx.doi.org/10.1371/journal.pone.0061396.

Full text

APA, Harvard, Vancouver, ISO, and other styles

14

Abrahams, Edward. "Market access in the era of personalized cell & gene therapy." Cell and Gene Therapy Insights 5, no. 8 (September 4, 2019): 971–74. http://dx.doi.org/10.18609/cgti.2019.105.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Gambardella, Valentina, Noelia Tarazona, Juan Miguel Cejalvo, Pasquale Lombardi, Marisol Huerta, Susana Roselló, Tania Fleitas, Desamparados Roda, and Andres Cervantes. "Personalized Medicine: Recent Progress in Cancer Therapy." Cancers 12, no. 4 (April 19, 2020): 1009. http://dx.doi.org/10.3390/cancers12041009.

Full text

Abstract:

Translational research has revolutionized how we develop new treatments for cancer patients. The change from an organ-centric concept guiding treatment choice towards deep molecular analysis, driving a personalized approach, is one of the most important advances of modern oncology. Several tools such as next generation sequencing and RNA sequencing have greatly improved the capacity to detect predictive and prognostic molecular alterations. Detection of gene mutations, amplifications, and fusions has therefore altered the history of several diseases in both a localized and metastatic setting. This shift in perspective, in which attention is focused on the specific molecular alterations of the tumor, has opened the door to personalized treatment. This situation is reflected in the increasing number of basket trials selecting specific molecular targets. Nonetheless, some weaknesses need to be addressed. The complexity of cancer cells enriched with concomitant molecular alterations complicates identification of the driver. Moreover, tumor heterogeneity could be responsible for the lack of benefit when targeted agents are used. In light of this, there is growing interest in the role of multidisciplinary committees or molecular tumor boards to try to enhance selection. The aim of this review is to critically analyze the evolution of cancer treatment towards a precision approach, underlining some recent successes and unexpected failures.

APA, Harvard, Vancouver, ISO, and other styles

16

Szekanecz, Zoltán. "Personalized medicine in rheumatology." Orvosi Hetilap 154, no. 13 (March 2013): 483–96. http://dx.doi.org/10.1556/oh.2013.29580.

Full text

Abstract:

In rheumatology, especially in arthritides, early diagnosis and aggressive therapy may open up new dimensions of expectations, such as improvement of pain, prevention of structural, functional damage and better quality of life. Targeted (biological) therapy has brought new horizons in rheumatology. As it is a rather expensive treatment modality, it has been urgent to develop tools suitable for the prediction of therapeutic responses. Several clinical, immunological and genetic biomarkers have been established for this purpose. Among clinical markers, male sex, younger age, lower or even higher disease activity at baseline, combination treatment and quitting smoking may lead to better treatment outcome. Immunological biomarkers, such as C-reactive protein, seropositivity, peripheral blood or synovial cellular content have been associated with therapeutic responses. Finally, numerous genes or gene signatures may also predict the efficacy or safety of immunosuppressive drugs. Although sometimes there have been only few studies conducted that led to some controversy, some biomarkers have also been validated. This may lead us to optimism in terms of wider acceptance of personalized medicine in rheumatology. Orv. Hetil., 2013, 154, 483–496.

APA, Harvard, Vancouver, ISO, and other styles

17

Meinl, Hanna, Marcus Zeitlhöfler, Samet Kocabey, Tim Liedl, Wolfgang Hiddemann, Marion Subklewe, Stefan Endres, Simon Rothenfußer, and Felix S. Lichtenegger. "Bifunctional Immunoactive siRNAs as an Approach to Personalized AML Therapy." Blood 122, no. 21 (November 15, 2013): 5036. http://dx.doi.org/10.1182/blood.v122.21.5036.5036.

Full text

Abstract:

Abstract The prognosis of acute myeloid leukemia (AML) is poor due to frequent relapse after initial remission. The development of new approaches to postremission therapy for elimination of minimal residual disease remains a major scientific and clinical challenge. We strive to combine two different innovative therapeutic concepts to develop a new specific and personalized treatment for AML. siRNAs are used to knock down either a gene that drives leukemogenesis due to genetic alterations in specific cases of AML (e.g., FLT3, NPM1) or a gene that is essential for the survival of the leukemic cells (e.g., BRD4, MCL1, PLK1). By adding a triphosphate modification to the 5’ end, the siRNA molecules additionally become ligands for the cytosolic pattern recognition receptor RIG-I (retinoic acid inducible gene I). Its activation mimics viral infection and leads to the production of inflammatory cytokines and induction of apoptosis in the target cell. We expect these bifunctional molecules to result in a decrease of viable AML cells and in the induction of an immune response similar to an active immunization. This concept was successfully tested in vitro for several target genes in AML cell lines. We could demonstrate that the specific gene knockdown leads to inhibited proliferation, increased apoptosis and higher sensitivity to chemotherapeutic agents. Activation of RIG-I by triphosphate-modified RNA additionally stimulated an inflammatory response by the leukemic cells and increased the apoptosis rate. A major hurdle for all siRNA-based anti-cancer strategies is the specific delivery of the RNA into tumor cells. In vivo liposomal transfection of siRNA molecules has been used in various tumor models, but generally results in ineffective and unspecific delivery. We are testing DNA-based nanoparticles coupled with molecules that target receptors specific for or overexpressed on AML cells. By coupling bifunctional siRNA molecules to these nanoparticles, they should be efficiently and selectively transported into the cytosol of AML cells. Proof-of-concept in vivo studies in AML mouse models are in preparation. The long-term goal of this project is the development of a set of bifunctional siRNA molecules for the individualized treatment of AML. Disclosures: No relevant conflicts of interest to declare.

APA, Harvard, Vancouver, ISO, and other styles

18

Xu, Jun, Hee-Jin Lee, Jia Zeng, Yonghui Wu, Yaoyun Zhang, Liang-Chin Huang, Amber Johnson, et al. "Extracting genetic alteration information for personalized cancer therapy from ClinicalTrials.gov." Journal of the American Medical Informatics Association 23, no. 4 (March 24, 2016): 750–57. http://dx.doi.org/10.1093/jamia/ocw009.

Full text

Abstract:

Abstract Objective: Clinical trials investigating drugs that target specific genetic alterations in tumors are important for promoting personalized cancer therapy. The goal of this project is to create a knowledge base of cancer treatment trials with annotations about genetic alterations from ClinicalTrials.gov. Methods: We developed a semi-automatic framework that combines advanced text-processing techniques with manual review to curate genetic alteration information in cancer trials. The framework consists of a document classification system to identify cancer treatment trials from ClinicalTrials.gov and an information extraction system to extract gene and alteration pairs from the Title and Eligibility Criteria sections of clinical trials. By applying the framework to trials at ClinicalTrials.gov, we created a knowledge base of cancer treatment trials with genetic alteration annotations. We then evaluated each component of the framework against manually reviewed sets of clinical trials and generated descriptive statistics of the knowledge base. Results and Discussion: The automated cancer treatment trial identification system achieved a high precision of 0.9944. Together with the manual review process, it identified 20 193 cancer treatment trials from ClinicalTrials.gov. The automated gene-alteration extraction system achieved a precision of 0.8300 and a recall of 0.6803. After validation by manual review, we generated a knowledge base of 2024 cancer trials that are labeled with specific genetic alteration information. Analysis of the knowledge base revealed the trend of increased use of targeted therapy for cancer, as well as top frequent gene-alteration pairs of interest. We expect this knowledge base to be a valuable resource for physicians and patients who are seeking information about personalized cancer therapy.

APA, Harvard, Vancouver, ISO, and other styles

19

Chetina, E. V., and G. A. Markova. "Upcoming value of gene expression analysis in rheumatology." Biomeditsinskaya Khimiya 64, no. 3 (2018): 221–32. http://dx.doi.org/10.18097/pbmc20186403221.

Full text

Abstract:

Rheumatoid arthritis (RA) is a chronic inflammatory disease of unknown etiology, which involves disturbance in immune system signaling pathway functions, damage of other tissues, pain and joint destruction. Modern treatment attempts to improve pathophysiological and biochemical mechanisms damaged by the disease. However, due to the RA patient heterogeneity personalized approach to treatment is required; the choice of personalized treatment is complicated by the variability of patient's response to treatment. Gene expression analysis might serve a tool for the disease control and therapy personification for inhibition of inflammation and pain as well as for prevention of joint destruction.

APA, Harvard, Vancouver, ISO, and other styles

20

Khan, Sikandar Hayat. "Type-2 Diabetes and Gene Therapy: The Promise of CRISPR Gene Therapy in type-2 Diabetes Mellitus." Journal Of Obesity Management 1, no. 3 (September 23, 2019): 1–5. http://dx.doi.org/10.14302/issn.2574-450x.jom-19-3001.

Full text

Abstract:

Gene therapy has entered a new era with the dawn of CRISPR/Cas9 technology which though were always available in nature but rediscovered to tame into a real-tlife genome editing tool. With the modernization upsurge and changes in ways the “homo sapiens” survived on this planet from hunger to current era of exuberance has led to multiple metabolic issues like type-2 diabetes. Notwithstanding the rapid emergence of medication to suppress the hyperglycemia and insulin resistance associated with this menace, need has definitely emerge to find more personalized and curative dimensions to therapeutics of type-2 diabetes mellitus. Gene therapy is one more addition to Type-2 Diabetes Mellitus (T2DM) therapy, where multiple options have emerged in the shape of microRNA, direct knocking out of cellular structures like proteins and enzymes and very recently the precision nucleases associated with CRISPR technologies. This mini-review attempt to summarize some of the recent examples of gene therapy with major focus on CRISPR/Cas technologies.

APA, Harvard, Vancouver, ISO, and other styles

21

Davies, Stella M. "Pharmacogenetics, Pharmacogenomics and Personalized Medicine: Are We There Yet?" Hematology 2006, no. 1 (January 1, 2006): 111–17. http://dx.doi.org/10.1182/asheducation-2006.1.111.

Full text

Abstract:

Abstract The genetic basis of a differential response to drugs has been understood for a limited number of agents for over 30 years. This knowledge has generated hope that the individual basis for response to a wide range of drugs would be quickly known, and individualized drug selection and dosing would be possible for many or all disorders. Understanding the variable response to drugs seems particularly pressing in the field of oncology, in which the stakes are high (failure to cure cancer usually leads to death), drugs commonly have a narrow therapeutic index, and toxicities can be severe (a significant frequency of toxic death is a feature of most acute myeloid leukemia protocols, for example). However, in common with many new technologies, the generalizability and clinical application of pharmacogenetics has proved more challenging than expected. Difficulties include, in many examples, a modest clinical effect relative to genotype, therapy-specific, not broad, applicability and the very major challenge of unraveling the complexity of gene-gene interactions. In addition, ethical and economic challenges to the application of pharmacogenetics have moved to the fore in recent years, particularly in the context of racial differences in outcome of therapy. Genomic, rather than candidate gene approaches to identification of relevant loci are increasingly being explored, and significant progress is being made. However, greater understanding of the complexities of multiple gene modifiers of outcome, and the statistical challenge of understanding such data, will be needed before individualized therapy can be applied on a routine basis.

APA, Harvard, Vancouver, ISO, and other styles

22

Udayaraja, G. K., and I. Arnold Emerson. "Oncogenomics and CYP450 Implications in Personalized Cancer Therapy." Current Pharmacogenomics and Personalized Medicine 17, no. 2 (October 28, 2020): 104–13. http://dx.doi.org/10.2174/1875692117999200517122652.

Full text

Abstract:

Background: The Human Genome Project has unleashed the power of genomics in clinical practice as a choice of individualized therapy, particularly in cancer treatment. Pharmacogenomics is an interdisciplinary field of genomics that deals with drug response, based on individual genetic makeup. Objective: The main genetic events associated with carcinogenesis activate oncogenes or inactivate tumor-suppressor genes. Therefore, drugs should be specific to inactivate or regulate these mutant genes and their protein products for effective cancer treatment. In this review, we summarize how polymedication decisions in cancer treatments based on the evaluation of cytochrome P450 (CYP450) polymorphisms are applied for pharmacogenetic assessment of anticancer therapy outcomes. Results: However, multiple genetic events linked, inactivating a single mutant gene product, may be insufficient to inhibit tumor progress. Thus, genomics and pharmacogenetics directly influence a patient’s response and aid in guiding clinicians to select the safest and most effective combination of medications for a cancer patient from the initial prescription. Conclusion: This review outlines the roles of oncogenes, the importance of cytochrome P450 (CYP450) in cancer susceptibility, and its impact on drug metabolism, proposing combined approaches to achieve precision therapy.

APA, Harvard, Vancouver, ISO, and other styles

23

Cai, Xiaochen, and Xiaoming Zhu. "Anorectal melanoma and gene analysis of personalized adjuvant therapy: a case report." Annals of Palliative Medicine 10, no. 10 (October 2021): 11216–20. http://dx.doi.org/10.21037/apm-21-2240.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Vasireddy, Vidyullatha, Jason A. Mills, Rajashekhar Gaddameedi, Etiena Basner-Tschakarjan, Monika Kohnke, Aaron D. Black, Krill Alexandrov, et al. "Correction: AAV-Mediated Gene Therapy for Choroideremia: Preclinical Studies in Personalized Models." PLOS ONE 10, no. 6 (June 19, 2015): e0129982. http://dx.doi.org/10.1371/journal.pone.0129982.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Sureda, Manuel, Ramon Gonzalez Manzano, Elena Ma Martínez, Francisco J. Fernández-Morejón, Joseba Rebollo, Aurora Crespo, Belen Valenzuela, Josep Farre, and Antonio Brugarolas. "Personalized gene expression profiling-guided (MAGE) therapy in resistant sarcomas. Preliminary data." Journal of Clinical Oncology 34, no. 15_suppl (May 20, 2016): e14028-e14028. http://dx.doi.org/10.1200/jco.2016.34.15_suppl.e14028.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Patsali, Petros, Claudio Mussolino, Constantinos Loucari, Coralea Stephanou, Michael Antoniou, Toni Cathomen, Carsten W. Lederer, and Marina Kleanthous. "692. Genome Editing for Personalized Gene Therapy of IVSI-110 Beta-Thalassemia." Molecular Therapy 24 (May 2016): S274. http://dx.doi.org/10.1016/s1525-0016(16)33500-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Raghuram, Anjali, Aspinder Singh, Daniel K. Chang, Mervin Nunez, Edward M. Reece, and Brent E. Schultz. "The Evolving Landscape of Gene Therapy in Plastic Surgery." Seminars in Plastic Surgery 33, no. 03 (August 2019): 167–72. http://dx.doi.org/10.1055/s-0039-1693131.

Full text

Abstract:

AbstractWith the rapid rise of personalized genomic sequencing and clustered regularly interspaced short palindromic repeat (CRISPR) technology, previous gaps in gene therapy are beginning to be bridged, paving the way for increasing clinical applicability. This article aims to provide an overview of the fundamentals of gene therapy and discuss future potential interventions relevant to plastic surgeons. These interventions include enhancing tissue regeneration and healing, as well as modifying disease processes in congenital anomalies. Though clinical applications are still on the horizon, a deeper understanding of these new advances will help plastic surgeons understand the current landscape of gene therapy and stay abreast of future opportunities.

APA, Harvard, Vancouver, ISO, and other styles

28

Iacobas, Sanda, Nneka Ede, and Dumitru A. Iacobas. "The Gene Master Regulators (GMR) Approach Provides Legitimate Targets for Personalized, Time-Sensitive Cancer Gene Therapy." Genes 10, no. 8 (July 25, 2019): 560. http://dx.doi.org/10.3390/genes10080560.

Full text

Abstract:

The dynamic and never exactly repeatable tumor transcriptomic profile of people affected by the same form of cancer requires a personalized and time-sensitive approach of the gene therapy. The Gene Master Regulators (GMRs) were defined as genes whose highly controlled expression by the homeostatic mechanisms commands the cell phenotype by modulating major functional pathways through expression correlation with their genes. The Gene Commanding Height (GCH), a measure that combines the expression control and expression correlation with all other genes, is used to establish the gene hierarchy in each cell phenotype. We developed the experimental protocol, the mathematical algorithm and the computer software to identify the GMRs from transcriptomic data in surgically removed tumors, biopsies or blood from cancer patients. The GMR approach is illustrated with applications to our microarray data on human kidney, thyroid and prostate cancer samples, and on thyroid, prostate and blood cancer cell lines. We proved experimentally that each patient has his/her own GMRs, that cancer nuclei and surrounding normal tissue are governed by different GMRs, and that manipulating the expression has larger consequences for genes with higher GCH. Therefore, we launch the hypothesis that silencing the GMR may selectively kill the cancer cells from a tissue.

APA, Harvard, Vancouver, ISO, and other styles

29

Suwanmanee, Thipparat, Martin T. Ferris, Peirong Hu, Tong Gui, Stephanie A. Montgomery, Fernando Pardo-Manuel de Villena, and Tal Kafri. "Toward Personalized Gene Therapy: Characterizing the Host Genetic Control of Lentiviral-Vector-Mediated Hepatic Gene Delivery." Molecular Therapy - Methods & Clinical Development 5 (June 2017): 83–92. http://dx.doi.org/10.1016/j.omtm.2017.03.009.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Kirsanov, Kirill I., Ekaterina A. Lesovaya, Timur I. Fetisov, Beniamin Yu Bokhyan, Gennady A. Belitsky, and Marianna G. Yakubovskaya. "Current Approaches for Personalized Therapy of Soft Tissue Sarcomas." Sarcoma 2020 (April 1, 2020): 1–15. http://dx.doi.org/10.1155/2020/6716742.

Full text

Abstract:

Soft tissue sarcomas (STS) are a highly heterogeneous group of cancers of mesenchymal origin with diverse morphologies and clinical behaviors. While surgical resection is the standard treatment for primary STS, advanced and metastatic STS patients are not eligible for surgery. Systemic treatments, including standard chemotherapy and newer chemical agents, still play the most relevant role in the management of the disease. Discovery of specific genetic alterations in distinct STS subtypes allowed better understanding of mechanisms driving their pathogenesis and treatment optimization. This review focuses on the available targeted drugs or drug combinations based on genetic aberration involved in STS development including chromosomal translocations, oncogenic mutations, gene amplifications, and their perspectives in STS treatment. Furthermore, in this review, we discuss the possible use of chemotherapy sensitivity and resistance assays (CSRA) for the adjustment of treatment for individual patients. In summary, current trends in personalized management of advanced and metastatic STS are based on combination of both genetic testing and CSRA.

APA, Harvard, Vancouver, ISO, and other styles

31

Radhakrishnan, Arun, and Gowthamarajan Kuppusamy. "Theoretical Formulation Strategies towards Neutralizing Inter-individual Variability Associated with Tacrolimus Immunosuppressant Therapy: A Case Study on Nextgeneration Personalized Medicine." Current Drug Metabolism 22, no. 12 (October 2021): 939–56. http://dx.doi.org/10.2174/1389200222666211015153317.

Full text

Abstract:

: Individualizing drug therapy and attaining maximum benefits of a drug devoid of adverse reactions is the benefit of personalized medicine. One of the important factors contributing to inter-individual variability is genetic polymorphism. As of now, dose titration is the only followed golden standard for implementing personalized medicine. Converting the genotypic data into an optimized dose has become easier now due to technology development. However, for many drugs, finding an individualized dose may not be successful, which further leads to a trial and error approach. These dose titration strategies are generally followed at the clinical level, and so industrial involvement and further standardizations are not feasible. On the other side, technologically driven pharmaceutical industries have multiple smart drug delivery systems which are underutilized towards personalized medicine. Transdisciplinary research with drug delivery science can additionally support the personalization by converting the traditional concept of “dose titration towards personalization” with novel “dose-cum-dosage form modification towards next-generation personalized medicine”; the latter approach is useful to overcome gene-based inter-individual variability by either blocking, to downregulate, or bypassing the biological protein generated by the polymorphic gene. This article elaborates an advanced approach to implementing personalized medicine with the support of novel drug delivery systems. As a case study, we further reviewed the genetic polymorphisms associated with tacrolimus and customized novel drug delivery systems to overcome these challenges factored towards personalized medicine for better clinical outcomes, thereby paving a new strategy for implementing personalized medicine for all other drug candidates.

APA, Harvard, Vancouver, ISO, and other styles

32

Zhang, Qun, Lei Cheng, Jing Hu, Li Li, Mi Yang, Linghui Kong, Lixia Yu, Jia Wei, Baorui Liu, and Xiaoping Qian. "SLAMF8, a novel biomarker for personalized immune checkpoint blockade therapy in gastrointestinal cancer." Journal of Clinical Oncology 37, no. 15_suppl (May 20, 2019): e14078-e14078. http://dx.doi.org/10.1200/jco.2019.37.15_suppl.e14078.

Full text

Abstract:

e14078 Background: Immune checkpoint inhibitors have brought great breakthroughs in cancer therapy. Activated immune response is known to be the prerequisite for exerting immunotherapy efficacy. Epstein-Barr virus (EBV) infection is associated with longer survival in gastric cancer (GC) patients due to enhanced anti-tumor immune response, and therefore it was reportedly played an important role in modulating immune checkpoint blockade therapy efficacy. However, molecular dimensions underlying the good response to immune checkpoint inhibitors in presence of EBV infection are still unclear. The aim of this study is to identify a gene signature related to EBV induced anti-tumor immune response, and select a tag gene from this signature to predict which patients are most likely to benefit from immune checkpoint blockade therapy. Methods: Two large transcriptome datasets from Gene Expression Omnibus(GEO) database (GSE51575 and GSE62254) were used to screen gene signature for EBV infected gastric cancer tissues. We further selected genes that showed a trend towards differential co-expression independent of EBV infection status. The tag gene of this differential co-expression signature was finally identified by bioinformatics analysis. To make an external validation, we performed RNA sequencing in 20 colorectal caner (CRC) tissues and 20 GC tissues, respectively. Meanwhile, tissue microarrays of CRC cohort (36 paired tumor and normal tissues) and GC cohort (75 paired tumor and normal tissues) were used to analyze the association of SLAMF8 with CD8 protein expression by immunohistochemistry (IHC). Results: Analysis of GEO datasets indicated 788 genes as feature gene cluster for EBV-positive gastric cancer, from which 290 genes were selected to be characterized by differential co-expression in either EBV-positive or EBV-negative gastric cancers. SLAMF8 was identified as the tag gene for this differential co-expression signature. This signature, tagged by SLAMF8, was successfully validated by our RNA sequencing data in presence of its good performance in dividing CRC and GC patients into two subsets. Moreover, we observed a significant association between SLAMF8 and CD8 expression in our CRC and GC tissue samples, in terms of either mRNA or protein level. Conclusions: SLAMF8, a potential indicator for T cell‐mediated immune response induced by EBV infection, may be served as a biomarker for individualized immune checkpoint blockade therapy in gastrointestinal cancer. Further SLAMF8 guided drug sensitivity tests are warranted to validate our results.

APA, Harvard, Vancouver, ISO, and other styles

33

Oliveira-Paula, G. H., R. Lacchini, and J. E. Tanus-Santos. "In reply to: Enalapril and the VEGFA gene: personalized medicine in hypertension therapy." European Journal of Clinical Pharmacology 72, no. 1 (November 20, 2015): 127–28. http://dx.doi.org/10.1007/s00228-015-1985-x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Shalaby, Karim E., and Omar M. A. El-Agnaf. "Gene-Based Therapeutics for Parkinson’s Disease." Biomedicines 10, no. 8 (July 26, 2022): 1790. http://dx.doi.org/10.3390/biomedicines10081790.

Full text

Abstract:

Parkinson’s disease (PD) is a complex multifactorial disorder that is not yet fully surmised, and it is only when such a disease is tackled on multiple levels simultaneously that we should expect to see fruitful results. Gene therapy is a modern medical practice that theoretically and, so far, practically, has demonstrated its capability in joining the battle against PD and other complex disorders on most if not all fronts. This review discusses how gene therapy can efficiently replace current forms of therapy such as drugs, personalized medicine or invasive surgery. Furthermore, we discuss the importance of enhancing delivery techniques to increase the level of transduction and control of gene expression or tissue specificity. Importantly, the results of current trials establish the safety, efficacy and applicability of gene therapy for PD. Gene therapy’s variety of potential in interfering with PD’s pathology by improving basal ganglial circuitry, enhancing dopamine synthesis, delivering neuroprotection or preventing neurodegeneration may one day achieve symptomatic benefit, disease modification and eradication.

APA, Harvard, Vancouver, ISO, and other styles

35

Terzic, M., M. Jakimovska, S. Fustik, T. Jakovska, E. Sukarova-Stefanovska, and D. Plaseska-Karanfilska. "Cystic fibrosis mutation spectrum in north macedonia: A step toward personalized therapy." Balkan Journal of Medical Genetics 22, no. 1 (August 28, 2019): 35–40. http://dx.doi.org/10.2478/bjmg-2019-0009.

Full text

Abstract:

AbstractThe most prevalent "rare" disease worldwide, cystic fibrosis (CF), is an autosomal recessive multisystem disease, caused by mutations in the CFTR gene. The knowledge of CFTR mutations present in certain population is important for designing a simple, fast and cost-effective genetic testing approach, also for better management of CF patients, including the administration of novel targeted therapies. Here, we present genetic results of 158 unrelated CF patients from the National CF Registry of the Republic of North Macedonia. Initially, patients were screened for the 11 most common CF mutations. Additional CF mutations and large deletions/duplications in the CFTR gene were analyzed using commercial kits. If the genotype was undetermined, all CFTR exons were analyzed using Sanger DNA sequencing or next generation sequencing (NGS) (since 2014). The most common CF mutation, c.l521_ 1523del (legacy name F508del), was found with an overall incidence of 75.9%. Additionally, 26 other pathogenic variants and three large deletions were identified in the CFTR gene as a genetic cause of CF. Two of these, c.1070 C>T (p.Ala357Val) and c.2779_2788dup CTTGCTATGG (p.Gly930AlafsTer48), were novel. According to the distribution and prevalence of the pathogenic variants detected in our patients, a fast and cost-effective method, based on a single base extension was designed as a first-line CF genetic test with a 90.0% detection rate within our population. Furthermore, the knowledge of CFTR mutation classes in our CF patients represents the first step toward personalized therapy for CF in our country.

APA, Harvard, Vancouver, ISO, and other styles

36

Kalmykov, Vladislav, Pavel Kusov, Maria Yablonskaia, Evgeniy Korshunov, Diana Korshunova, Marina Kubekina, Yuliya Silaeva, Alexey Deykin, and Nikolay Lukyanov. "New personalized genetic mouse model of Lesch-Nyhan syndrome for pharmacology and gene therapy." Research Results in Pharmacology 4, no. 4 (December 25, 2018): 115–22. http://dx.doi.org/10.3897/rrpharmacology.4.32209.

Full text

Abstract:

Introduction: Lesch-Nyhan syndrome is a clinical and laboratory disorder caused by X-linked disruption of the purine metabolism. The deletion in the HPRT1 gene leads to the disappearance of valine in the eighth position of the protein amino acid sequence. The disease occurs in males and is accompanied by an excess of uric acid, urate nephropathy and neurologic impairment. Objective of the Study: Generation of the new personalized genetic mouse model of Lesch-Nyhan syndrome for preclinical study of new approaches to the pharmacological and gene therapy Materials and Methods: For genomic editing, the sequence was synthesized the sequence of the matrix GACCGGTCCCGTCATGCCGACACGCAGTCCCAGCGTGGTGAGCCAAGGGGACTCCAGCAGAGCCCCACAG was synthesized. For the cultivation of viable mouse embryos after microinjection, KSOM media was used. Amplification and sequencing was performed by the standard methods. Results: A boy with not previously described hemizygous variant in the HPRT1 gene, was observed in our clinic. The mutation was the deletion of 8Val in the first exon of the HPRT1 gene. To introduce this mutation, we used the CRISPR-Cas9 genomic editing system. The genetic construct for microinjections included a mixture of the vector for the expression of Cas9 and sgRNA (px330), as well as the matrix for homologous recombination (ssODN), in a ratio of 1 part Cas9 to 3 parts of the ssODN matrix. Four of the 12 obtained animals were mosaic transgenes. One of 4 mice mated with a male from the hybrid strain CBA x C57BL/6, and descendants of F2 have already been received from this mating. Discussion: During the creation of HPRT1 genetically modified mice, we encountered certain difficulties. First, from 615 transplanted embryos, only 12 were able to complete full embryonic development. 9 recipients we observed abortions in the later stages. These data may indicate possible violations of embryonic development in animals carrying a mutant copy of the HPRT1 gene. Conclusion: In the current study, we present the results of the generation of a genetically modified mouse strain carrying a deletion in the HPRT1 gene. These mice can be effectively used for the preclinical testing of new drugs aimed at the treatment of Lesch-Nyhan syndrome.

APA, Harvard, Vancouver, ISO, and other styles

37

Potemina, T. E., and E. V. Guzikov. "Mitochondrial changes in carcinogenesis as a goal of antitumor therapy (review)." Bulletin of the Medical Institute "REAVIZ" (REHABILITATION, DOCTOR AND HEALTH), no. 4 (December 31, 2020): 65–73. http://dx.doi.org/10.20340/vmi-rvz.2020.4.8.

Full text

Abstract:

Causes and mechanisms of cancer development are currently one of the urgent problems of medicine. The main variant for today is the mutation theory. Identification of the system of gene mutations, including in mitochondria, leading to this or that type of tumors, made it possible to develop a personalized, so-called targeting, the therapy of malignant tumors.

APA, Harvard, Vancouver, ISO, and other styles

38

Poddubskaya, Elena, Maxim Sorokin, Marianna Zolotovskaya, Maria Suntsova, Andrew Garazha, Alexey Moisseev, Alexey Bondarenko, et al. "Gene expression-based personalized prescription of targeted drugs in colorectal cancer." Journal of Clinical Oncology 40, no. 4_suppl (February 1, 2022): 151. http://dx.doi.org/10.1200/jco.2022.40.4_suppl.151.

Full text

Abstract:

151 Background: Colorectal cancer (CRC) is the fourth most common cancer worldwide with relatively poor patient survival. Transcriptome assay could be used to personalize CRC treatment thus complementing standard mutation analysis. Methods: We performed retrospective hybrid experimental and meta-analysis of CRC patient gene expression data with available progression-free survival (PFS) information and/or targeted drug response status. In total we analyzed 243 gene expression profiles from four publicly available (TCGA and three datasets from Gene Expression Omnibus GSE19860, GSE19862, GSE104645), and one experimental (PRJNA663280) patient cohorts. Each gene expression profile was analyzed using bioinformatic second-opinion platform Oncobox to calculate balanced drug efficiency scores (BES) to build personalized ratings of potentially effective targeted drugs. Area under the ROC curve (AUC) metric and Cox regression analysis were used to assess Oncobox capacity to predict tumor response and PFS, respectively. Results: Patients from GSE19860 (n = 12), GSE19862 (n = 14), GSE104645 (n = 81) received bevacizumab as monotherapy or in combination with chemotherapy as the nearest line of treatment after biopsy collection. Oncobox correctly classified treatment responders vs non-responders with AUC 0.94, 0.90 and 0.84, respectively. BES value was strongly associated with PFS (HR = 0.53, CI 0.33-0.84, log-rank test p-value 0.0057) in the GSE104645 cohort. However, BES was ineffective for predicting response and PFS after second-line (after biopsy collection) treatment with cetuximab. BES also predicted treatment response with AUC 0.74 in the TCGA cohort (n = 17) treated with 4 different targeted drugs. Thirty clinical outcomes were collected for 14 patients from our experimental cohort PRJNA663280. Patients were treated with 10 different targeted drugs. BES was an effective biomarker that could predict treatment outcomes with AUC 0.74 for all lines of therapy and 0.94 for the first line therapy (after biopsy), and could predict PFS after first-line treatment (HR 0.14, CI 0.027-0.73, log-rank test p-value 0.0091). Conclusions: Our results suggest that RNA profiling in tumor samples may be helpful for personalizing prescriptions of targeted therapeutics in CRC. Using recent biopsies is essential to obtain robust estimates of targeted drugs efficacy.

APA, Harvard, Vancouver, ISO, and other styles

39

Bořilová Linhartová, Petra, Ladislava Bartošová, Adam Křenek, Ladislav Bartoš, Jiří Dolina, Filip Marek, Zdeněk Kala, and Lýdie Izakovičová Hollá. "Personalized therapy in patients with gastroesophageal reflux disease – methodology of CYP2C19 gene profile‘s determination." Gastroenterologie a hepatologie 72, no. 4 (August 30, 2018): 320–28. http://dx.doi.org/10.14735/amgh2018320.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Odenike, Olatoyosi, Michael J. Thirman, Andrew S. Artz, Lucy A. Godley, Richard A. Larson, and Wendy Stock. "Gene Mutations, Epigenetic Dysregulation, and Personalized Therapy in Myeloid Neoplasia: Are We There Yet?" Seminars in Oncology 38, no. 2 (April 2011): 196–214. http://dx.doi.org/10.1053/j.seminoncol.2011.01.010.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Iacobas, Dumitru Andrei, and Sanda Iacobas. "Towards a Personalized Cancer Gene Therapy: A Case of Clear Cell Renal Cell Carcinoma." Cancer and Oncology Research 5, no. 3 (August 2017): 45–52. http://dx.doi.org/10.13189/cor.2017.050301.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Poddubskaya, Elena, Maxim Sorokin, Andrew Garazha, Alex Glusker, Alexey Moisseev, Marina Sekacheva, Maria Suntsova, et al. "Clinical use of RNA sequencing and oncobox analytics to predict personalized targeted therapeutic efficacy." Journal of Clinical Oncology 38, no. 15_suppl (May 20, 2020): e13676-e13676. http://dx.doi.org/10.1200/jco.2020.38.15_suppl.e13676.

Full text

Abstract:

e13676 Background: Analysis of mutation profiles in cancer patients does not provide clinical benefits in 80-90% of cases in the US (Marquart et al., 2018). Gene expression analysis potentially complements standard detection of clinically relevant mutations. Methods: 239 adult late-stage cancer patients. RNA gene expression sequencing completed on solid tumor samples using FFPE blocks. Patient mRNA profiles were analyzed using Oncobox bioinformatics, prioritizing target drugs according to their personalized predicted efficacy. Summary reports were provided to oncologists and resulting treatment selection and outcomes were assessed. Results: As of February 2020, feedback was received from participating doctors for 224 patients; 34 patients died before therapy prescription, 52 patients received treatment other than targeted therapy (chemo, surgery, radiation, or palliative care), 75 patients received at least one targeted therapy (single or combination therapy) predicted to be effective based on Oncobox analysis (“RNAseq cohort”). 63 patients received chemo or other drug therapy predicted to be potentially ineffective from Oncobox analysis (“other cohort”). Therapeutic response was obtained on 46 patients with biopsies collected no longer than 6 months prior to analysis who had no further surgery (30 in the RNAseq cohort and 16 in the other cohort). 63% of the RNAseq cohort obtained either partial response or stable disease using Oncobox guided therapies, compared to 44% of the other cohort (19% increase of disease control). The RNAseq cohort had higher mean prior therapies (1.3) compared to the other cohort (0.8) indicating more advanced disease. The similarly designed WINTHER trial reported ~8% increase of disease control using gene expression-guided vs mutation-guided therapeutics in a cohort of advanced cancer patients averaging three prior therapies (Rodon et al., 2019). Conclusions: Collectively these data suggest that gene expression profiling provides a more clinically relevant therapeutic match, and better response rates, than mutation guided therapeutic treatments. This potentially results in improved clinical outcomes for cancer patients. Clinical trial information: NCT03724097.

APA, Harvard, Vancouver, ISO, and other styles

43

Gorbunova, Viktoriya Nikolayevna. "Molecular genetics — a way to the individual personalized medicine." Pediatrician (St. Petersburg) 4, no. 1 (January 15, 2013): 115–21. http://dx.doi.org/10.17816/ped41115-121.

Full text

Abstract:

Review of modern technologies that are used for identification and mapping of genetic risk factors associated with different multifactorial diseases. The principles of the wide genomic association scan (GWAS) are accounted. A significance of this method is considered on the example of hereditary predisposition to autoimmune diseases. The role of MCH complex gene polymorphism and specific genetic risk factors in the autoimmunity forming and a possibility of multifactorial diseases personalized therapy with taking into account of the patient hereditary constitution are discussed.

APA, Harvard, Vancouver, ISO, and other styles

44

Oganezova, Zh G., V. V. Kadyshev, and E. A. Egorov. "Hereditary glaucoma: clinical and genetic characteristics." National Journal glaucoma 21, no. 4 (November 25, 2022): 65–78. http://dx.doi.org/10.53432/2078-4104-2022-21-4-65-78.

Full text

Abstract:

The review is devoted to the genetic nature of congenital glaucoma (CG) and presents clinical and genetic forms of hereditary glaucoma and single nucleotide polymorphisms identified by genome-wide association studies (GWAS). Glaucoma is a genetically heterogeneous disease, and patients with the same clinical diagnosis often have different molecular causes. The role of mutations in the CYP1B1 gene has been proven in the pathogenesis of hydrophthalmos; the MYOC gene — in juvenile open-angle glaucoma; the PAX6 gene — in aniridia; mutations in the PITX2, FOXC1 genes have been identified in Axenfeld-Rieger anomaly/syndrome. It has been established that 4–43% of patients with open-angle glaucoma have a family history of a mutation in the MYOC, OPTN or TBK1 genes. Genetic studies of glaucoma are the first steps to developing a new generation of personalized treatments. The article describes the key features of the pathogenesis of various genetic forms of glaucoma and the possible course of its therapy. However, gene therapy requires further study of both long-term effects and efficacy. Molecular genetic diagnosis of glaucoma allows for personalized genetic counseling of family members with consideration of the genetic risks.

APA, Harvard, Vancouver, ISO, and other styles

45

Wójcicka, Anna, Monika Kolanowska, and Krystian Jażdżewski. "MECHANISMS IN ENDOCRINOLOGY: MicroRNA in diagnostics and therapy of thyroid cancer." European Journal of Endocrinology 174, no. 3 (March 2016): R89—R98. http://dx.doi.org/10.1530/eje-15-0647.

Full text

Abstract:

MicroRNAs, short non-coding regulators of the gene expression, are subjects of numerous investigations assessing their potential use in the diagnostics and management of human diseases. In this review, we focus on studies that analyze the utility of microRNAs as novel diagnostic and therapeutic tools in follicular cell-derived thyroid carcinomas. This very interesting and promising field brings new insight into future strategies for personalized medicine.

APA, Harvard, Vancouver, ISO, and other styles

46

Su, Kang-Yi, and Sung-Liang Yu. "Personalized molecular testing for therapeutic guidance in Taiwan." Journal of Clinical Oncology 31, no. 15_suppl (May 20, 2013): e22067-e22067. http://dx.doi.org/10.1200/jco.2013.31.15_suppl.e22067.

Full text

Abstract:

e22067 Background: Personalized cancer therapy is based on the precept that detail molecular characterization of tumors as well as tumor microenvironment will enable tailored therapies to improve outcomes and decrease toxicity. The goal of personalized therapy is to target aberrations driving tumor growth and prolongs survival, by administering the right drug combination for the right person. However, several practical and technological challenges including tumor heterogeneity, molecular evolution, costs and morbidity of biopsies as well as technical limitation critical for molecular testing. In addition, development of biomarkers should be considered all aspects of drug development, from discovery through to clinical trials. Methods: In Taiwan, we have established a well-qualified reference laboratory with ISO15189 certification for molecular testing of personalized therapy in clinical practice. Based on our innovation, we utilized DNA mass spectrometry platform to develop high sensitive EGFR mutation identification system. Recently, KRAS, BRAF, HER2 together with EGFR were also combined into multiplex gene testing for biomarker-assessed therapeutic decision. To this end, the National Science Council of Taiwan government had supported this project through NRPB (National Research Program of Biopharmaceutical) at the middle of 2011. This facility performed selected molecular tests for cancer patients from medical centers and regional hospitals. Results: A specific program had also been implemented to anticipate the launch of molecular targeting therapy (MTT) and reduce time-to-assess to MTT drugs and experimental therapies. From Jane 2011 to Dec 2012, more than 2,500 patients with lung cancer in Taiwan benefited from this facility. Conclusions: The Taiwan nationwide initiative for tumor molecular profiling is a tool to fight inequalities in access to molecular testing and target therapy, and demonstrates that molecular stratification of tumor for therapeutic decisions is a cost-effective strategy that can be integrated into the national health-care system.

APA, Harvard, Vancouver, ISO, and other styles

47

Pavlović, Sonja, Branka Zukić, and Maja Stojiljković Petrović. "Molecular Genetic Markers as a Basis for Personalized Medicine / MOLEKULARNO-GENETIČKI MARKERI KAO OSNOV ZA PERSONALIZOVANU MEDICINU." Journal of Medical Biochemistry 33, no. 1 (January 1, 2014): 8–21. http://dx.doi.org/10.2478/jomb-2013-0035.

Full text

Abstract:

Summary Nowadays, genetics and genomics are fully integrated into medical practice. Personalized medicine, also called genome-based medicine, uses the knowledge of the genetic basis of disease to individualize treatment for each patient. A number of genetic variants, molecular genetic markers, are already in use in medical practice for the diagnosis, prognosis and follow-up of diseases (monogenic hereditary disorders, fusion genes and rearrangements in pediatric and adult leukemia) and presymptomatic risk assessment (BRCA 1/2 for breast cancer). Additionally, the application of pharmacogenomics in clinical practice has significantly contributed to the individualization of therapy in accordance with the patient’s genotype and gene expression profile. Genetic testing for several pharmacogenomic markers (TPMT, UGT1A1, CYP2C9, VKORC1) is mandatory or recommended prior to the initiation of therapy. The most important achievement of genome-based medicine is molecular-targeted therapy, tailored to the genetic profile of a disease. Testing for gene variants in cancer (BCR-ABL, PML/RARa, RAS, BCL-2) is part of the recommended evaluation for different cancers, in order to achieve better management of the disease. The ultimate goal of medical science is to develop gene therapy which will fight or prevent a disease by targeting the disease causing genetic defect. Gene therapy technology is rapidly developing, and has already been used with success. Although medicine has always been essentially »personal« to each patient, personalized medicine today uses modern technology and knowledge in the field of molecular genetics and genomics, enabling a level of personalization which leads to significant improvement in health care.

APA, Harvard, Vancouver, ISO, and other styles

48

Rahman, Md Mizanur. "Personalized Medicine in Cancer." Journal of Bangladesh College of Physicians and Surgeons 32, no. 3 (December 23, 2015): 153–63. http://dx.doi.org/10.3329/jbcps.v32i3.26054.

Full text

Abstract:

Current and emerging biomedical science efforts are driven by determining how to improve clini-cal outcomes for patients. High-throughput tech-nology has revolutionized the area of transla-tional research, confirming the high complexity and heterogeneity of common diseases, partic-ularly cancer. Therefore, moving from classic single-gene-based molecular investigation to molecular network research might result in dis-covering clinical implications faster and more efficiently .Molecular characterization of tumour cells enables refinement of classifications for many cancers and can sometimes guide treatment. Malignant diseases are no longer classified only by tumour site and histology but are separated into various homogenous molecular subtypes, distinguished by a presumed key molecular alteration. Therapies for patients with cancer have changed gradually over the past decade, moving away from the administration of broadly acting cytotoxic drugs towards the use of more-specific therapies that are targeted to each tumour. To facilitate this shift, tests need to be developed to identify those individuals who require therapy and those who are most likely to benefit from certain therapies. In particular, tests that predict the clinical outcome for patients on the basis of the genes expressed by their tumours are likely to increasingly affect patient management, heralding a new era of personalized medicine. In this review a brief discussion on definition and molecular aspects of personalized medicine and its practical application for the management of common solid cancers are highlighted.J Bangladesh Coll Phys Surg 2014; 32: 153-163

APA, Harvard, Vancouver, ISO, and other styles

49

Malandrino, Noemi, and Robert J. Smith. "Personalized Medicine in Diabetes." Clinical Chemistry 57, no. 2 (February 1, 2011): 231–40. http://dx.doi.org/10.1373/clinchem.2010.156901.

Full text

Abstract:

BACKGROUND Multiple genes that are associated with the risk of developing diabetes or the risk of diabetes complications have been identified by candidate gene analysis and genomewide scanning. These molecular markers, together with clinical data and findings from proteomics, metabolomics, pharmacogenetics, and other methods, lead to a consideration of the extent to which personalized approaches can be applied to the treatment of diabetes mellitus. CONTENT Known genes that cause monogenic subtypes of diabetes are reviewed, and several examples are discussed in which the genotype of an individual with diabetes can direct considerations of preferred choices for glycemic therapy. The extent of characterization of polygenic determinants of type 1 and type 2 diabetes is summarized, and the potential for using this information in personalized management of glycemia and complications in diabetes is discussed. The application and current limitations of proteomic and metabolomic methods in elucidating diabetes heterogeneity is reviewed. SUMMARY There is established heterogeneity in the determinants of diabetes and the risk of diabetes complications. Understanding the basis of this heterogeneity provides an opportunity for personalizing prevention and treatment strategies according to individual patient clinical and molecular characteristics. There is evidence-based support for benefits from a personalized approach to diabetes care in patients with certain monogenic forms of diabetes. It is anticipated that strategies for individualized treatment decisions in the more common forms of diabetes will emerge with expanding knowledge of polygenic factors and other molecular determinants of disease.

APA, Harvard, Vancouver, ISO, and other styles

50

Babkin, A. P., and V. V. Gladkikh. "Personalized approach to the treatment of patients with high risk hypertension." Glavvrač (Chief Medical Officer), no. 8 (July 25, 2022): 39–40. http://dx.doi.org/10.33920/med-03-2208-11.

Full text

Abstract:

The attributive contribution of uncontrolled arterial hypertension (AH) to the development of cardiovascular complications (myocardial infarction, cerebral stroke, etc.) is up to 40 %. One of the factors affecting the clinical efficacy of antihypertensive therapy is the salt-dependent nature of blood pressure. It has recently been shown that a variant of the GNAI2 gene increases the risk of developing a salt-dependent pattern of increased blood pressure by 3 times (Xiaoling Zhang, 2018). The authors aim to study the features of the daily dynamics of blood pressure in patients with arterial hypertension who have had myocardial infarction with different blood pressure salt sensitivity to individualize the choice of drug therapy.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Personalized gene therapy'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles