Journal articles on the topic 'Peptidase inhibitor 16'
To see the other types of publications on this topic, follow the link: Peptidase inhibitor 16.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Peptidase inhibitor 16.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Cwiklinski, Krystyna, Orla Drysdale, Jesús López Corrales, Yolanda Corripio-Miyar, Carolina De Marco Verissimo, Heather Jewhurst, David Smith, Richard Lalor, Tom N. McNeilly, and John P. Dalton. "Targeting Secreted Protease/Anti-Protease Balance as a Vaccine Strategy against the Helminth Fasciola hepatica." Vaccines 10, no. 2 (January 20, 2022): 155. http://dx.doi.org/10.3390/vaccines10020155.
Full textAbstract:
The liver fluke Fasciola hepatica is an economically important global pathogen of humans and their livestock. To facilitate host invasion and migration, F. hepatica secretes an abundance of cathepsin peptidases but prevents excessive damage to both parasite and host tissues by co-secreting regulatory peptidase inhibitors, cystatins/stefins and Kunitz-type inhibitors. Here, we report a vaccine strategy aimed at disrupting the parasite’s protease/anti-protease balance by targeting these key inhibitors. Our vaccine cocktail containing three recombinant stefins (rFhStf-1, rFhStf-2, rFhStf-3) and a Kunitz-type inhibitor (rFhKT1) formulated in adjuvant Montanide 61VG was assessed in two independent sheep trials. While fluke burden was not reduced in either trial, in Trial 1 the vaccinated animals showed significantly greater weight gain (p < 0.05) relative to the non-vaccinated control group. In both trials we observed a significant reduction in egg viability (36–42%). Multivariate regression analyses showed vaccination and increased levels of IgG2 antibodies specific for the F. hepatica peptidase inhibitors were positive indicators for increased weight gain and levels of haemoglobin within the normal range at 16 weeks post-infection (wpi; p < 0.05). These studies point to the potential of targeting peptidase inhibitors as vaccine cocktails for fasciolosis control in sheep.
2
Bai, T. R., and A. M. Bramley. "Effect of an inhibitor of nitric oxide synthase on neural relaxation of human bronchi." American Journal of Physiology-Lung Cellular and Molecular Physiology 264, no. 5 (May 1, 1993): L425—L430. http://dx.doi.org/10.1152/ajplung.1993.264.5.l425.
Full textAbstract:
This study examines the roles of peptides and nitric oxide (NO) as mediators of inhibitory nonadrenergic, noncholinergic (NANCi) neurons in human and guinea pig airways in vitro. Tissues were contracted with 0.3 microM methacholine (MCh) and relaxation studied before and after the addition of the peptidase alpha-chymotrypsin (alpha-CT) (2 U/ml) and NG-nitro-L-arginine methyl ester (L-NAME 0.1-1.1 mM), an inhibitor of NO synthase, the enzyme catalyzing the formation of NO. alpha-CT alone, in comparison to parallel time controls, inhibited control relaxation to electrical field stimulation (EFS) by 29.2 +/- 8.6% in guinea pig tracheae (n = 9), whereas a small augmentation of relaxation was observed in human bronchi (n = 7). L-NAME inhibited the NANCi response in both guinea pig tracheae and human bronchi: in guinea pig tracheae, maximal inhibition of the alpha-CT-insensitive relaxation was 59.3 +/- 11.5% (SE, P = 0.003) at low frequencies (4-16 Hz) and 28.6 +/- 8.9% (P = 0.08) at 32 Hz; in human bronchi, the maximal inhibition was 37.7 +/- 9.3% (P = 0.008) at 8 or 16 Hz, and 37.9 +/- 5.9% (P = 0.005) at 32 Hz. Inhibition was greater after repeated baseline EFS for 90 min before initiation of contraction with MCh and addition of L-NAME (59.8 +/- 13.9% after repeated baseline EFS, n = 4; vs. 34.9 +/- 6.2% without repeated baseline EFS, n = 9, P = 0.025). Relaxant responses to sodium nitroprusside, vasoactive intestinal peptide, and isoproterenol were not affected by L-NAME. L-Arginine (10 mM), a precursor of NO, partially reversed the effect of L-NAME.(ABSTRACT TRUNCATED AT 250 WORDS)
3
Martínez-Guitián, Marta, Juan C. Vázquez-Ucha, Joshua Odingo, Tanya Parish, Margarita Poza, Richard D. Waite, German Bou, David W. Wareham, and Alejandro Beceiro. "Synergy between Colistin and the Signal Peptidase Inhibitor MD3 Is Dependent on the Mechanism of Colistin Resistance in Acinetobacter baumannii." Antimicrobial Agents and Chemotherapy 60, no. 7 (May 2, 2016): 4375–79. http://dx.doi.org/10.1128/aac.00510-16.
Full textAbstract:
ABSTRACTSynergy between colistin and the signal peptidase inhibitor MD3 was tested against isogenic mutants and clinical pairs ofAcinetobacter baumanniiisolates. Checkerboard assays and growth curves showed synergy against both colistin-susceptible strains (fractional inhibitory concentration index [FICindex] = 0.13 to 0.24) and colistin-resistant strains with mutations inpmrBand phosphoethanolamine modification of lipid A (FICindex= 0.14 to 0.25) but not against colistin-resistant Δlpxstrains with loss of lipopolysaccharide (FICindex= 0.75 to 1). A colistin/MD3 combination would need to be targeted to strains with specific colistin resistance mechanisms.
4
Lupsa, Nikolett, Barbara Érsek, Andor Horváth, András Bencsik, Eszter Lajkó, Pálma Silló, Ádám Oszvald, et al. "Skin‐homing CD8 + T cells preferentially express GPI‐anchored peptidase inhibitor 16, an inhibitor of cathepsin K." European Journal of Immunology 48, no. 12 (November 9, 2018): 1944–57. http://dx.doi.org/10.1002/eji.201847552.
Full text
5
Lin, Kun-Der, Chao-Hung Chen, Hsing-Yi Lin, Mei-Yueh Lee, Yu-Li Lee, Wei-Wen Hung, He-Jiun Jiang, Pi-Jung Hsiao, and Shyi-Jang Shin. "Dipeptidyl peptidase-4 inhibitor prevents diabetic nephropathy through STRA6 signaling." Diabetes Research and Clinical Practice 120 (October 2016): S61. http://dx.doi.org/10.1016/s0168-8227(16)31050-6.
Full text
6
Apaijai, Nattayaporn, Tharnwimol Inthachai, Suree Lekawanvijit, Siriporn C. Chattipakorn, and Nipon Chattipakorn. "Effects of dipeptidyl peptidase-4 inhibitor in insulin-resistant rats with myocardial infarction." Journal of Endocrinology 229, no. 3 (June 2016): 245–58. http://dx.doi.org/10.1530/joe-16-0096.
Full textAbstract:
Adverse cardiac remodeling after myocardial infarction (MI) leads to progressive heart failure. Obese-insulin resistance increases risks of MI and heart failure. Although dipeptidyl peptidase-4 (DPP4) inhibitor is known to exert cardioprotection, its effects on adverse remodeling after MI in obese-insulin-resistant rats are unclear. We hypothesized that DPP4 inhibitor reduces adverse left ventricular (LV) remodeling and LV dysfunction in obese-insulin-resistant rats with MI. Rats were fed either normal diet (ND) or high-fat diet (HFD) for 12 weeks to induce obese-insulin resistance, followed by left anterior descending coronary artery ligation to induce MI. Then, rats in each dietary group were divided into five subgroups to receive vehicle, enalapril (10mg/kg/day), metformin (30mg/kg/day), DPP4 inhibitor vildagliptin (3mg/kg/day), or combined metformin and vildagliptin for 8 weeks. Heart rate variability (HRV), LV function, pathological and biochemical studies for LV remodeling, and cardiomyocyte apoptosis were determined. Obese-insulin-resistant rats had severe insulin resistance and LV dysfunction. HFD rats had a higher mortality rate than ND rats, and all treatments reduced the mortality rate in obese-insulin-resistant rats. Although all drugs improved insulin resistance, HRV, LV function as well as reduced cardiac hypertrophy and fibrosis, vildagliptin effectively reduced cardiomyocyte cross-sectional areas more than enalapril and was related to markedly decreased ERK1/2 phosphorylation. In ND rats with MI, metformin neither improved LV ejection fraction nor reduced cardiac fibrosis. The infarct size and transforming growth factor-β expression were not different among groups. In obese-insulin-resistant rats with chronic MI, DPP4 inhibitor vildagliptin exerts better cardioprotection than enalapril in attenuating adverse LV remodeling.
7
Regn, Michael, Bernhard Laggerbauer, Claudia Jentzsch, Deepak Ramanujam, Andrea Ahles, Sonja Sichler, Julia Calzada-Wack, et al. "Peptidase inhibitor 16 is a membrane-tethered regulator of chemerin processing in the myocardium." Journal of Molecular and Cellular Cardiology 99 (October 2016): 57–64. http://dx.doi.org/10.1016/j.yjmcc.2016.08.010.
Full text
8
DIN, KHUZMA, AMIZA MAT AMIN, FISAL AHMAD, AMIN ISMAIL, and ADAWIYAH SURIZA SHUIB. "IN SILICO ANALYSIS OF EDIBLE BIRD’S NEST PROTEINS AS POTENTIAL PRECURSORS FOR BIOACTIVE PEPTIDES." Malaysian Applied Biology 51, no. 2 (June 29, 2022): 53–62. http://dx.doi.org/10.55230/mabjournal.v51i2.1997.
Full textAbstract:
The present study aimed to perform an in silico evaluation of edible bird’s nest protein as potential precursors of bioactive peptides, as well as to determine whether such peptides can be released by selected proteolytic enzymes. Six edible bird’s nest (EBN) protein sequences from a previous study were chosen as potential precursors to produce bioactive peptides via in silico method using the BIOPEP database. AMCase protein sequences gave the highest number of bioactivities (16 to 18) and nucleobindin-2 protein gave the lowest number of bioactivities (9) among the other protein sequences. It was found that the most potential bioactive peptides from EBN proteins are angiotensin-converting enzyme (ACE) inhibitors and dipeptidyl peptidase-IV (DPPIV) inhibitors. Furthermore, in silico proteolysis using six selected enzymes was employed to release both dominant bioactivities in EBN proteins, which were ACE and DPP-IV inhibitors. This study shows that a combination of enzymes, chymotrypsin, and papain, produced the highest number of activities for both ACE and DPP-IV inhibitor peptides with the frequency of occurrence of bioactive peptides of 0.0968 and 0.1104, respectively. The toxic prediction tool, ToxinPred, found that all EBN peptides derived by in silico analysis were non-toxic. The current study proposed that EBN can serve as a potential source of bioactive peptides.
9
Chen, Q., Y. Miao, and K. Jiang. "Peptidase Inhibitor 16 Promote Proliferation and Metastasis in Pancreatic Ductal Adenocarcinoma via Oligoadenylate Synthetase L." HPB 24 (2022): S258. http://dx.doi.org/10.1016/j.hpb.2022.05.542.
Full text
10
Danilov, Alexey V., Olga V. Danilova, Andreas K. Klein, and Brigitte T. Huber. "Dipeptidyl Peptidase 2 - A Pro-Survival Molecule in Chronic Lymphocytic Leukemia." Blood 108, no. 11 (November 16, 2006): 4964. http://dx.doi.org/10.1182/blood.v108.11.4964.4964.
Full textAbstract:
Abstract Chronic lymphocytic leukemia (CLL) is a unique malignancy characterized by persistent accumulation of quiescent B-cells. Disruption of survival pathways leads to apoptosis and renders CLL cells sensitive to chemotherapeutic agents. As clinical outcomes in CLL are heterogeneous, it is important to better predict prognosis in each individual case of the disease. In this respect, detection of somatic mutations in the immunoglobulin variable heavy chain (IgVH) genes has become the gold standard. Overexpression of ZAP-70 (Zeta-chain associated protein kinase - 70 kDa) by CLL cells correlates with unmutated IgVH genes and predicts poor outcome in B-CLL. Dipeptidyl Peptidase 2 (DPP2) is a newly discovered serine protease which maintains lymphocytes in a quiescent state (G0). In this study we investigated whether DPP2 is involved in cell cycle control in B-CLL. 38 patients with B-CLL and 20 healthy controls were included in the study. Median age of CLL patients was 67 years. Median time from diagnosis to enrollment in the study was 102 months. 21 patients (55.3%) received treatment before enrollment in the study. Standard Ficoll-Hypaque techniques were used to isolate peripheral blood mononuclear cells (PBMC) from healthy donors and CLL patients. CLL cells were isolated to >98% purity by means of a MoFlo using CD19−specific antibodies. Cells were treated with Val-boro-Pro, a pan-inhibitor of DPP, or with DPP2-specific inhibitor (DSI), incubated for 16 hours and stained with propidium iodide and Annexin V. Expression of CD38 was assessed by flow cytometry, DPP2 and ZAP-70 - by real-time reverse-transcription polymerase chain reaction, Bcl-2 and p27 - by western blot analysis. We report that CLL B-cells expressed higher levels of DPP2 mRNA than normal B-cells. Inhibition of DPP2 in PBMC with VbP or DSI resulted in caspase-dependent apoptosis. In individuals with CLL, death of B-lymphocytes (and rescue by caspase inhibitors) was observed in 22 cases (57.9%). In the remaining 16 cases (42.1%) malignant B-cells did not undergo apoptosis upon inhibition of DPP2 with either VbP or DSI. We found that CLL cells resistant to DPP2 inhibition-induced apoptosis expressed higher levels of ZAP-70. Meanwhile, protein levels of p27 (cell cycle inhibitor) were decreased in resistant CLL. These patients exhibited worse disease prognosis such as shorter treatment-free period (p<0.001), frequent episodes of treatment failure and faster disease progression. Between the two groups, we identified no differences in expression of Bcl-2. CLL B-cells express higher levels of DPP2, a serine protease involved in maintenance of G0 which may serve as a survival factor in CLL B-cells. Resistance vs. susceptibility to DPP2 inhibition-induced apoptosis can be employed as a prognostic factor in CLL.
11
Deng, Mengqing, Shuo Yang, Yue Ji, Yan Lu, Ming Qiu, Yanhui Sheng, Wei Sun, and Xiangqing Kong. "Overexpression of peptidase inhibitor 16 attenuates angiotensin II–induced cardiac fibrosis via regulating HDAC1 of cardiac fibroblasts." Journal of Cellular and Molecular Medicine 24, no. 9 (March 30, 2020): 5249–59. http://dx.doi.org/10.1111/jcmm.15178.
Full text
12
Papazafiropoulou, Athanasia, Nikolaos Papanas, Aikaterini Trikkalinou, Evaggelos Fousteris, and Andreas Melidonis. "The Oral Dipeptidyl-Peptidase-4 Inhibitor Sitagliptin Increases Circulating Levels Of Stromal-Derived Factor-1 Alpha." Experimental and Clinical Endocrinology & Diabetes 126, no. 06 (September 20, 2017): 367–70. http://dx.doi.org/10.1055/s-0043-118748.
Full textAbstract:
AbstractRecent studies have demonstrated that stromal derived factor-1α (SDF-1α) is a substrate of dipeptidyl-peptidase-4 (DPP-4) inhibitors. It has also been shown that SDF-1α shares anti-apoptotic as well as nephroprotective properties and exerts a beneficial effect in the cardiovascular system. Therefore, the aim of this study was to estimate the effect of treatment with the DDP-4 inhibitor sitagliptin on SDF-1α levels in subjects with type 2 diabetes mellitus (T2D). Overall, 32 patients (16 males) with T2D, mean age (±SD) 67.2±8.3 years, HbA1c 6.4±0.5%, body-mass index (BMI) 29.1±4.9 Kg/m2, T2D duration 8.5±4.0 years receiving metformin monotherapy (17 participants) or metformin plus sitagliptin (15 participants) without known cardiovascular disease were enrolled. Patients on metformin plus sitagliptin exhibited higher plasma levels of SDF-1α compared with those on metformin monotherapy (19.6±4.1 versus 6.9±1.3 pg/ml, respectively, p=0.01). Multivariate regression analysis after controlling for age, sex, body-mass index, smoking, arterial hypertension, dyslipidaemia and other confounders showed that SDF-1α levels were positively correlated with DPP-4 inhibitor treatment (beta=0.91, p=0.001), and negatively with T2D duration (beta=− 0.42, p=0.05), ΗDL-cholesterol levels (beta=− 0.46, p=0.02) and HbA1c (beta=− 0.41, p=0.05). In conclusion, these results suggest that sitagliptin treatment may exert a favourable effect on SDF-1α levels.
13
Gibbs, Gerard M., Kim Roelants, and Moira K. O'Bryan. "The CAP Superfamily: Cysteine-Rich Secretory Proteins, Antigen 5, and Pathogenesis-Related 1 Proteins—Roles in Reproduction, Cancer, and Immune Defense." Endocrine Reviews 29, no. 7 (December 1, 2008): 865–97. http://dx.doi.org/10.1210/er.2008-0032.
Full textAbstract:
Abstract The cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins (CAP) superfamily members are found in a remarkable range of organisms spanning each of the animal kingdoms. Within humans and mice, there are 31 and 33 individual family members, respectively, and although many are poorly characterized, the majority show a notable expression bias to the reproductive tract and immune tissues or are deregulated in cancers. CAP superfamily proteins are most often secreted and have an extracellular endocrine or paracrine function and are involved in processes including the regulation of extracellular matrix and branching morphogenesis, potentially as either proteases or protease inhibitors; in ion channel regulation in fertility; as tumor suppressor or prooncogenic genes in tissues including the prostate; and in cell-cell adhesion during fertilization. This review describes mammalian CAP superfamily gene expression profiles, phylogenetic relationships, protein structural properties, and biological functions, and it draws into focus their potential role in health and disease. The nine subfamilies of the mammalian CAP superfamily include: the human glioma pathogenesis-related 1 (GLIPR1), Golgi associated pathogenesis related-1 (GAPR1) proteins, peptidase inhibitor 15 (PI15), peptidase inhibitor 16 (PI16), cysteine-rich secretory proteins (CRISPs), CRISP LCCL domain containing 1 (CRISPLD1), CRISP LCCL domain containing 2 (CRISPLD2), mannose receptor like and the R3H domain containing like proteins. We conclude that overall protein structural conservation within the CAP superfamily results in fundamentally similar functions for the CAP domain in all members, yet the diversity outside of this core region dramatically alters target specificity and, therefore, the biological consequences.
14
Fukunishi, Shinya, Akira Asai, Yasuhiro Tsuda, and Kazuhide Higuchi. "Su1966 Sitagliptin, a Dipeptidyl Peptidase-4 (DPP-4) Inhibitor, Can Be Effective Drug for Hepatic Iron Metabolism." Gastroenterology 150, no. 4 (April 2016): S601. http://dx.doi.org/10.1016/s0016-5085(16)32065-0.
Full text
15
Lamango, N. S., and R. E. Isaac. "Identification and properties of a peptidyl dipeptidase in the housefly, Musca domestica, that resembles mammalian angiotensin-converting enzyme." Biochemical Journal 299, no. 3 (May 1, 1994): 651–57. http://dx.doi.org/10.1042/bj2990651.
Full textAbstract:
[D-Ala2,Leu5]Enkephalin was readily metabolized by membranes (40,000 g pellet) prepared from heads of the housefly, Musca domestica, with Gly3-Phe4 being the major site of cleavage. This hydrolysis was only partially inhibited (40%) by 10 microM phosphoramidon, an inhibitor of endopeptidase-24.11, but was almost totally abolished in the presence of a mixture of 10 microM phosphoramidon and 10 microM captopril, a potent inhibitor of mammalian angiotensin-converting enzyme (ACE). An assay for ACE employing Bz-Gly-His-Leu as the substrate was used to confirm the presence of an ACE-like peptidyl dipeptidase activity in fly head membranes. The peptidase had a Km of 1.91 mM for Bz-Gly-His-Leu and a pH optimum of 8.2. The activity was inhibited by 100 microM EDTA and was greatly activated by ZnCl2 but not other bivalent metal ions. Captopril, lisinopril, fosinoprilat and enalaprilat, all selective inhibitors of mammalian ACE, were also good inhibitors of the insect enzyme with IC50 values of 400 nM, 130 nM, 16 nM and 290 nM respectively. An M(r) value of around 87,000 was obtained for this enzyme from gel-filtration chromatography, indicating that the insect enzyme is similar in size to mammalian testicular ACE (M(r) = 90,000-110,000) and not the larger form of the enzyme (M(r) = 150,000-180,000) found in mammalian somatic tissues. The fly peptidyl dipeptidase was released from membranes into a soluble fraction by incubating the head membranes at 37 degrees C but not at 0 degree C, suggesting that the insect ACE-like enzyme can be solubilized from cell surfaces through the activity of a membrane-bound enzyme activity. In conclusion, we have shown the existence of a peptidyl dipeptidase in membranes from the heads of M. domestica, which has similar properties to those of mammalian ACE.
16
GROSE, RANDALL H., DEBORAH J. MILLARD, CHRIS MAVRANGELOS, SIMON C. BARRY, HEDDY ZOLA, IAN C. NICHOLSON, WENG TARNG CHAM, CHRISTINA A. BOROS, and DOREEN KRUMBIEGEL. "Comparison of Blood and Synovial Fluid Th17 and Novel Peptidase Inhibitor 16 Treg Cell Subsets in Juvenile Idiopathic Arthritis." Journal of Rheumatology 39, no. 10 (August 15, 2012): 2021–31. http://dx.doi.org/10.3899/jrheum.111421.
Full textAbstract:
Objective.Early recognition and treatment of juvenile idiopathic arthritis (JIA) can prevent joint damage and minimize side effects of medication. The balance between proinflammatory and antiinflammatory mechanisms is known to be important in JIA, and we therefore investigated T cell subsets including Th cells, autoaggressive Th17 cells, and regulatory T cells (Treg), including a novel Treg subset in peripheral blood (PB) and synovial fluid (SF) of patients with JIA.Methods.Fifty children with JIA were enrolled in our study. Frequency, phenotype, and function of T lymphocytes in PB and SF were characterized using flow cytometry. Migration capabilities of PB and SF cells were compared.Results.Synovial T cells showed different phenotype and function compared with PB T cells, with an increased proportion of memory T cells, expression of CCR4, CCR5, CXCR3, interleukin 23R, and an increased ratio of Th17 to Treg. Although Treg were increased in SF compared with the PB, we found a significant decrease in the numbers of peptidase inhibitor 16 (PI16)+ Treg in active joints compared with peripheral blood. Coexpression of CCR4 and CCR6 was reduced on PI16+ Treg in PB and SF of patients with JIA compared with healthy children, however the ability of these cells to migrate toward their ligands was unaffected.Conclusion.This is a comprehensive characterization of novel PI16+ Treg and Th17 cells in matched blood and synovial fluid samples of patients with JIA. Despite an increased number of Treg within the inflamed joint, lower numbers of PI16+ Treg but high numbers of Th17 cells might contribute to the inability to control disease.
17
Hazell, Georgina, Jack E. Teasdale, Graciela Sala-Newby, Andrew C. Newby, and Stephen J. White. "Shear stress and inflammation modulate the expression of Peptidase Inhibitor 16 (PI16) in human coronary artery endothelial cells (HCAECs)." Atherosclerosis 237, no. 2 (December 2014): e8-e9. http://dx.doi.org/10.1016/j.atherosclerosis.2014.10.056.
Full text
18
Mohandas, Arunesh, Heddy Zola, Simon Barry, and Doreen Krumbiegel. "Peptidase inhibitor 16 identifies a unique subset of memory T helper cells with hyperproliferative and proinflammatory properties (IRC8P.477)." Journal of Immunology 192, no. 1_Supplement (May 1, 2014): 190.5. http://dx.doi.org/10.4049/jimmunol.192.supp.190.5.
Full textAbstract:
Abstract T helper (Th) cells play a major role in protecting the body against pathogens. Any imbalance in Th cell subsets could lead to autoimmune and inflammatory diseases. Peptidase inhibitor 16 (PI16), also known as prostate secretory protein of 94 amino acid - binding protein, was recently discovered to be expressed on memory regulatory T cells. This study investigates the expression and function of PI16 on Th cells. In healthy adults, 5-25% of CD4+ Th cells express PI16 with over 90% showing a memory phenotype. PI16+ Th cells have an increased expression of chemokine receptors CCR4 and CCR6 compared with PI16- Th cells. Transwell migration assays showed that more PI16+ Th cells migrated towards the CCR4 and CCR6 ligands (CCL17 and CCL20) compared with PI16- Th cells. After 7 day stimulation using CD3 / CD28 beads, PI16+ Th cells produce more IL-17A and less IFN-g compared with PI16- Th cells. PI16+ Th cells also have a higher expression of ROR-gt compared to PI16- Th cells. Furthermore, in comparison to PI16- Th cells, PI16+ Th cells have an increased proliferative potential and are less responsive to suppression by Treg. The memory phenotype of PI16+ Th cells, the high expression of Th17-like chemokine receptors, increased ROR-gt expression and high production of IL-17A suggest an active role of PI16+ Th cells at the site of infection or inflammation. Further studies are ongoing to understand the functional role of PI16 on Th cells in autoimmune and inflammatory diseases.
19
Хлебникова, Н. Н., С. Д. Ширенова, and Н. А. Крупина. "Neonatal action of the dipeptidyl peptidase iv inhibitor diprotin A leads to a hyperactive phenotype formation and a prolonged increase in aggressiveness in rats." Zhurnal «Patologicheskaia fiziologiia i eksperimental`naia terapiia», no. 4 (December 28, 2021): 4–16. http://dx.doi.org/10.25557/0031-2991.2021.04.4-16.
Full textAbstract:
Введение. Ингибиторы пролинспецифической сериновой протеазы дипептидилпептидазы IV (ДПП-IV, CD26, EC 3.4.14.5), способные модулировать широкий спектр физиологических процессов, находят применение в клинике. В наших работах получены свидетельства влияния ингибиторов ДПП-IV при их введении в раннем постнатальном периоде на эмоционально-мотивационное поведение взрослых крыс. Более сильные изменения в поведении отмечались у крыс при действии ингибитора ДПП-IV дипротина А. Однако не ясно, как долго сохраняются такие изменения. Цель работы - изучение отсроченных эффектов ингибитора ДПП-IV дипротина А на выраженность эмоционально-мотивационных расстройств, индуцированных действием ингибитора в раннем постнатальном периоде, в динамике взросления крыс от 2 до 7 мес. Методика. Дипротин А вводили крысятам ежедневно в 5-18-й постнатальные дни внутрибрюшинно (2 мг/кг), в объеме 0.1 мл на 10 г массы тела. Крысята контрольной группы получали инъекции физиологического раствора. Поведение взрослых крыс оценивали в возрасте 2 и 7 мес в тестах автоматизированного «открытого поля», «Приподнятый крестообразный лабиринт» (ПКЛ), принудительного плавания и социального взаимодействия. Уровень кортикостерона в сыворотке крови определяли методом твердофазного иммуноферментного анализа ELISA. Для статистической обработки результатов использовали двухфакторный дисперсионный анализ Two Way ANOVA и непараметрический U-критерий Манна-Уитни с поправкой на множественность сравнений. Результаты. У крыс опытной группы по сравнению с контрольной группой в возрасте 2 и 7 мес была повышена двигательная активность и скорость перемещения в тесте ПКЛ. В возрасте 7 мес у них также была увеличена вертикальная исследовательская активность. Признаков повышения тревожности не выявлено. У крыс опытной группы выявлены признаки депрессивно-подобного поведения по нарушению биоритмологической структуры плавания, более выраженные в возрасте 7 мес. Неагрессивное социальное взаимодействие у крыс, получавших неонатально дипротин А, было снижено по сравнению с контролем в возрасте 2 мес, а в возрасте 7 мес, напротив, увеличено. У этих животных число и длительность агрессивных социальных контактов были увеличены по сравнению с контролем как в возрасте 2, так и в возрасте 7 мес. Уровень кортикостерона в сыворотке крови у крыс опытной группы в возрасте 7.5 мес был выше, чем в контроле. Заключение. Данные настоящего исследования свидетельствуют о развитии гиперактивного фенотипа и длительных психоэмоциональных нарушений в виде повышенной агрессивности наряду с активацией гипоталамо-гипофизарно-адреналовой оси у взрослых крыс, подвергнутых действию дипротина А в 5-18-й постнатальные дни, и поддерживают представления об участии дипептидилпептидазы-IV в генезе психоэмоциональных расстройств. Background. Inhibitors of the proline-specific serine protease dipeptidyl peptidase IV (DPP-IV, CD26, EC 3.4.14.5) may modulate a wide range of physiological processes and are used in the clinic. In our studies, we obtained evidence for the impact of DPP-IV inhibitors on adult rats’ emotional and motivational behavior when administered in the early postnatal period. Diprotin A exhibited the most significant impact on the animals’ behaviors. However, it is not clear how long the changes persist. Aim. To study the delayed effects of the DPP-IV inhibitor diprotin A on the severity of emotional and motivational disorders induced by the inhibitor action in the early postnatal period, in the dynamics of rats maturation from 2 to 7 months. Methods. Diprotin A was administered to rat pups daily on postnatal days 5-18, intraperitoneally, at a dose of 2 mg/kg, in a volume of 0.1 ml per 10 g of body weight. The rat pups of the control group received saline. The behavior of adult rats was assessed at the age of 2 and 7 months in the automated “open field,” “Elevated Plus Maze” (EPM), forced swimming, and social interaction tests. Serum corticosterone levels were determined by ELISA. The results were statistically processed using Two Way ANOVA and nonparametric Mann-Whitney U-test adjusted for multiple comparisons. Results. Experimental rats increased motor activity and travel speed in the EPM test compared with the control group at 2 and 7 months of age. At the age of 7 months, experimental rats also increased vertical (rearing) activity. There were no signs of increased anxiety. Experimental rats demonstrated depression-like behavior judged by the biorhythmologic structure of swimming, more pronounced at 7 months. Non-aggressive social interaction in rats treated neonatally with diprotin A was reduced compared with controls at the age of 2 months and, on the contrary, increased at the age of 7 months. In these animals, the number and duration of aggressive social contacts were increased compared with controls at the ages of 2 and 7 months. Serum corticosterone levels in experimental rats at the age of 7.5 months were higher than in control. Conclusion. The present study results testify to the development of a hyperactive phenotype and prolonged psychoemotional disorders as increased aggressiveness along with hypothalamic-pituitary-adrenal axis activation in adult rats exposed to the action of diprotin A on postnatal days 5-18. The data support the dipeptidyl peptidase IV involvement in the genesis of psychoemotional disorders.
20
El-Ouaghlidi, Andrea, Erika Rehring, Jens J. Holst, Anja Schweizer, James Foley, David Holmes, and Michael A. Nauck. "The Dipeptidyl Peptidase 4 Inhibitor Vildagliptin Does Not Accentuate Glibenclamide-Induced Hypoglycemia but Reduces Glucose-Induced Glucagon-Like Peptide 1 and Gastric Inhibitory Polypeptide Secretion." Journal of Clinical Endocrinology & Metabolism 92, no. 11 (November 1, 2007): 4165–71. http://dx.doi.org/10.1210/jc.2006-1932.
Full textAbstract:
Abstract Background/Aims: Inhibition of dipeptidyl peptidase 4 by vildagliptin enhances the concentrations of the active form of the incretin hormones glucagon-like peptide 1 (GLP-1) and gastric inhibitory polypeptide (GIP). The present study asked whether vildagliptin accentuates glibenclamide-induced hypoglycemia or affects endogenous secretion of GLP-1 and GIP after an oral glucose tolerance test. Methods: There were 16 healthy male subjects studied on four occasions after an overnight fast in a double-blind, four-way crossover study. In random order, vildagliptin (100 mg) or placebo, with and without glibenclamide (5 mg), was administered 30 min before 75 g oral glucose. Blood was sampled to measure glucose, and total (sum of active and inactive) GLP-1 and GIP. Statistical evaluation was done using repeated-measures ANOVA. Results: Glibenclamide provoked hypoglycemia (≤1.9 mm), but this was not accentuated by the simultaneous administration of vildagliptin (P = 0.25). The integrated incremental responses of total GLP-1 were reduced by vildagliptin by 72% (with glibenclamide) and 48% (without glibenclamide) (effect of vildagliptin: P < 0.0001; glibenclamide: P = 0.31; interaction: P = 0.26). Similarly, integrated incremental responses of total GIP were reduced by vildagliptin by 26 and 21%, with and without glibenclamide, respectively (vildagliptin: P = 0.017; glibenclamide: P = 0.44; interaction: P = 0.69). Conclusions: Sulfonylurea-induced hypoglycemia after the oral administration of glibenclamide is not accentuated by the coadministration of vildagliptin. This may be explained by a negative feedback regulation of GLP-1 and GIP secretion that limits the degree to which the active incretin levels are enhanced.
21
Harada, Masaru, Akitoshi Yoneda, Sanehito Haruyama, Kei Yabuki, Yuichi Honma, Masaaki Hiura, Michihiko Shibata, Hidehiko Matsuoka, and Yasuhiro Uchiwa. "Bullous Pemphigoid Associated with the Dipeptidyl Peptidase-4 Inhibitor Sitagliptin in a Patient with Liver Cirrhosis Complicated with Rapidly Progressive Hepatocellular Carcinoma." Internal Medicine 56, no. 18 (2017): 2471–74. http://dx.doi.org/10.2169/internalmedicine.8703-16.
Full text
22
Wu, Tongzhi, Xiang Zhang, Laurence G. Trahair, Michelle J. Bound, Tanya J. Little, Carolyn F. Deacon, Michael Horowitz, Karen L. Jones, and Christopher K. Rayner. "Small Intestinal Glucose Delivery Affects the Lowering of Blood Glucose by Acute Vildagliptin in Type 2 Diabetes." Journal of Clinical Endocrinology & Metabolism 101, no. 12 (September 6, 2016): 4769–78. http://dx.doi.org/10.1210/jc.2016-2813.
Full textAbstract:
Context: The rate of gastric emptying is an important determinant of glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1) secretion and may influence the magnitude of glucose lowering by dipeptidyl peptidase-4 (DPP-4) inhibitors. Objective: To evaluate the effects of the DPP-4 inhibitor, vildagliptin (VILD), during intraduodenal (ID) glucose infusion at 2 different rates within the physiological range of gastric emptying, in type 2 diabetes. Participants and Design: A total of 16 diet-controlled type 2 diabetic patients were studied on 4 separate days in double-blind, randomized, fashion. On each day, either 5-mg VILD or placebo (PLBO) was given 60 minutes before a 120-minute ID glucose infusion at 2 or 4 kcal/min (ID2 or ID4). Plasma glucose and hormones were measured frequently. Results: Plasma glucose, insulin, C-peptide, glucagon, total GIP, and total and intact GLP-1 concentrations were higher during ID4 than ID2 (P < .01 for each). Compared with PLBO, VILD was associated with higher intact GLP-1, insulin, and C-peptide and lower glucose and total GIP and GLP-1 (P < .01 for each), without affecting glucagon. There were significant interactions between the rate of ID glucose and VILD treatment on plasma glucose, intact and total GLP-1, and GIP (P < .05 for each) but not insulin, C-peptide, or glucagon. The reduction in glucose and the increment in intact GLP-1 after VILD vs PLBO were 3.3- and 3.8-fold greater, respectively, during ID4 compared with ID2. Conclusions/Interpretation: These observations warrant further study to clarify whether type 2 diabetic patients with relatively more rapid gastric emptying have greater glucose lowering during treatment with DPP-4 inhibitors.
23
Fujiwara, Kaori, Naoki Yorifuji, Sadaharu Nouda, Kazuki Kakimoto, Toshihiko Okada, Ken Kawakami, Toshihisa Takeuchi, Takuya Inoue, and Kazuhide Higuchi. "Su1926 Long-Term Treatment With a Dipeptidyl Peptidase-4 Inhibitor, Sitagliptin, Suppresses Intestinal Tumors in Models of Diabetes and Obesity." Gastroenterology 150, no. 4 (April 2016): S591. http://dx.doi.org/10.1016/s0016-5085(16)32025-x.
Full text
24
Andres, Julia, Jia Xuan Yeo, and Chin Meng Khoo. "To investigate the efficacy of dipeptidyl peptidase-IV (DPP-IV) inhibitor therapy in multiethnic Asian patients with type 2 diabetes mellitus." Diabetes Research and Clinical Practice 120 (October 2016): S123—S124. http://dx.doi.org/10.1016/s0168-8227(16)31232-3.
Full text
25
Van Raalte, Daniël H., Renate E. van Genugten, Björn Eliasson, Diane L. Möller-Goede, Andrea Mari, Andrea Tura, Craig Wilson, et al. "The effect of alogliptin and pioglitazone combination therapy on various aspects of β-cell function in patients with recent-onset type 2 diabetes." European Journal of Endocrinology 170, no. 4 (April 2014): 565–74. http://dx.doi.org/10.1530/eje-13-0639.
Full textAbstract:
ObjectiveType 2 diabetes mellitus (T2DM) management requires continuous treatment intensification due to progressive decline in β-cell function in insulin resistant individuals. Initial combination therapy of a dipeptidyl peptidase (DPP)-4 inhibitor with a thiazolidinedione (TZD) may be rational. We assessed the effects of the DPP4 inhibitor alogliptin (ALO) combined with the TZD pioglitazone (PIO), vs ALO monotherapy or placebo (PBO), on β-cell function and glycemic control in T2DM.Material and methodsA 16-week, two-center, randomized, double-blind, PBO-controlled, parallel-arm intervention study in 71 patients with well-controlled T2DM (age 59.1±6.3 years; A1C 6.7±0.1%) treated with metformin, sulfonylurea, or glinide monotherapy was conducted. Patients were treated with combined ALO 25 mg and PIO 30 mg daily or ALO 25 mg daily monotherapy or PBO. Main outcome measures included change in A1C and fasting plasma glucose (FPG) from baseline to week 16. In addition, change in β-cell function parameters obtained from standardized meal tests at baseline and at week 16 was measured.ResultsALO/PIO and ALO decreased A1C from baseline by 0.9±0.1 and 0.4±0.2% respectively (both P<0.001 vs PBO). FPG was decreased to a greater extent by ALO/PIO compared with ALO monotherapy (P<0.01). ALO/PIO treatment improved β-cell glucose sensitivity (vs PBO; P<0.001) and fasting secretory tone (vs PBO; P=0.001), while ALO monotherapy did not change β-cell function parameters. All treatments were well tolerated.ConclusionShort-term treatment with ALO/PIO or ALO improved glycemic control in well-controlled T2DM patients, but only combined ALO/PIO improved β-cell function. These data support that initial combination therapy with a DPP4 inhibitor and TZD to address multiple core defects in T2DM may be a sensible approach.
26
Dubé, Michael P., Ellen S. Chan, Jordan E. Lake, Brett Williams, Jennifer Kinslow, Alan Landay, Robert W. Coombs, Michelle Floris-Moore, Heather J. Ribaudo, and Kevin E. Yarasheski. "A Randomized, Double-blinded, Placebo-controlled Trial of Sitagliptin for Reducing Inflammation and Immune Activation in Treated and Suppressed Human Immunodeficiency Virus Infection." Clinical Infectious Diseases 69, no. 7 (December 10, 2018): 1165–72. http://dx.doi.org/10.1093/cid/ciy1051.
Full textAbstract:
Abstract Background Dipeptidyl peptidase-4 (DPP-4) inhibitors have pleotropic anti-inflammatory and immune regulatory effects in addition to glucoregulation. We evaluated inflammation and immune markers in suppressed human immunodeficiency virus (HIV) infection during treatment with the DPP-4 inhibitor sitagliptin. Methods Virologically suppressed adults with HIV without diabetes on stable antiretroviral therapy (ART) with ≥100/μL CD4 cells were randomized to 16 weeks of sitagliptin 100 mg/day vs placebo in a multicenter trial. The primary endpoint was the change in plasma soluble CD14 (sCD14) from baseline to week 15–16. Results Ninety participants were randomized, and 42 from each arm were included in per-protocol analyses. Participants were 45% non-Hispanic white, 38% non-Hispanic black, and 15% Hispanic, with a median age of 51 years; 83% were male; and the median CD4 count was 602 cells/μL. At week 15–16, there was no difference in sCD14 change between the 2 arms (P = .69). Relative to placebo, the sitagliptin arm had 47% greater decline in CXCL10 (95% confidence interval, –57% to –35%) at week 15 (P < .001). There were no significant between-arm differences in other soluble biomarkers, total CD4 and CD8 counts, or markers of lymphocyte or monocyte activation. Sitagliptin was well tolerated. Conclusions Sixteen weeks of sitagliptin had no effect on sCD14 levels in virologically suppressed participants with HIV. CXCL10, a chemokine involved in atherogenesis that predicts non-AIDS events during ART, declined markedly with sitagliptin. This suggests that DPP-4 inhibition has the potential to reduce cardiovascular morbidity in treated HIV infection. Clinical Trials Registration NCT01426438.
27
Ervinna, Nasib, Tomoya Mita, Eisuke Yasunari, Kosuke Azuma, Rica Tanaka, Satoshi Fujimura, Dewi Sukmawati, et al. "Anagliptin, a DPP-4 Inhibitor, Suppresses Proliferation of Vascular Smooth Muscles and Monocyte Inflammatory Reaction and Attenuates Atherosclerosis in Male apo E-Deficient Mice." Endocrinology 154, no. 3 (March 1, 2013): 1260–70. http://dx.doi.org/10.1210/en.2012-1855.
Full textAbstract:
Abstract Dipeptyl peptidase-4 (DPP-4) inhibitors modulate the progression of atherosclerosis. To gain insights into their mechanism of action, 9-wk-old male apolipoprotein E (apoE)-deficient mice were fed a DPP-4 inhibitor, anagliptin-containing diet. The effects of anagliptin were investigated in, a monocyte cell line, human THP-1 cells, and rat smooth muscle cells (SMCs). Treatment with anagliptin for 16 wk significantly reduced accumulation of monocytes and macrophages in the vascular wall, SMC content in plaque areas, and oil red O-stained area around the aortic valve without affecting glucose tolerance or body weight. Serum DPP-4 concentrations were significantly higher in apoE-deficient mice than control mice, and the levels increased with aging, suggesting the involvement of DPP-4 in the progression of atherosclerosis. Indeed, soluble DPP-4 augmented cultured SMC proliferation, and anagliptin suppressed the proliferation by inhibiting ERK phosphorylation. In THP-1 cells, anagliptin reduced lipopolysaccharide-induced TNF-α production with inhibiting ERK phosphorylation and nuclear translocation of nuclear factor-κB. Quantitative analysis also showed that anagliptin reduced the area of atherosclerotic lesion in apoE-deficient mice. These results indicated that the anti-atherosclerotic effect of anagliptin is mediated, at least in part, through its direct inhibition of SMC proliferation and inflammatory reaction of monocytes.
28
Oe, Yuki, Hiroshi Nomoto, Akinobu Nakamura, Saki Kuwabara, Yuka Takahashi, Ayano Yasui, Rimi Izumihara, et al. "Switching from Insulin Degludec plus Dipeptidyl Peptidase-4 Inhibitor to Insulin Degludec/Liraglutide Improves Glycemic Variability in Patients with Type 2 Diabetes: A Preliminary Prospective Observation Study." Journal of Diabetes Research 2022 (January 19, 2022): 1–9. http://dx.doi.org/10.1155/2022/5603864.
Full textAbstract:
Incretins reduce glycemic variability (GV) in patients with type 2 diabetes, but it is unknown whether switching from a combination of basal insulin and a DPP-4 inhibitor to insulin degludec/liraglutide (IDegLira) improves GV. We performed an exploratory prospective observational study to compare the effect of IDegLira and the combination on GV. We recruited hospitalized patients with type 2 diabetes who had stable glycemic control with insulin degludec (≤16 units/day) and taking a DPP-4 inhibitor. GV was analyzed using continuous glucose monitoring (CGM) before and after switching the medication to IDegLira. The principal endpoint was the change in mean amplitude of glycemic excursions (MAGE). Other indices of GV and CGM parameters were analyzed as the secondary endpoints. Fifteen participants were enrolled and 12 completed the study. In these participants, the DPP-4 inhibitor and insulin degludec were discontinued, and the equivalent dose of IDegLira was commenced. Switching to IDegLira significantly improved MAGE from 74.9 (60.3, 97.7) mg/dL to 64.8 (52.0, 78.2) mg/dL ( P < 0.05 ), as well as other indices of GV and 24-hour mean blood glucose concentration. Analysis of the ambulatory glucose profile showed marked reductions in postprandial glucose concentration. Nocturnal glucose concentration was similar under the two treatment regimens. IDegLira improved GV as well as the mean and the postprandial glucose concentration by switching from insulin degludec plus DPP-4 inhibitor combination. IDegLira might be beneficial for patients being treated with low-dose basal insulin.
29
Bouchkouj, Najat, Shannon Larabee, Haying Qin, Joanna Louise Meadors, Crystal L. Mackall, and Terry J. Fry. "Dipeptidyl Peptidase Inhibition Alters Myeloid Derived Suppressor Cell Phenotype and Induces Regression of Pediatric Sarcomas." Blood 116, no. 21 (November 19, 2010): 3792. http://dx.doi.org/10.1182/blood.v116.21.3792.3792.
Full textAbstract:
Abstract Abstract 3792 Introduction: Tumor associated macrophages and myeloid derived suppressor cells (MDSCs) are increasingly recognized to play an important role in cancer immune escape, suppression of adaptive immunity, promotion or tumor progression, and are associated with poor prognosis in adult cancers. Recently, it has been reported that pediatric solid tumors are characterized by marked infiltration of macrophages. Little is known about the presence and the role of these cells in the pathobiology of pediatric cancers. We sought to characterize tumor infiltrating myeloid cells in a murine model of embryonal rhabdomyosarcoma (ERMS). Methods: C57BL/6 mice were injected with 1×106 RMS M3-9-M murine ERMS cells intramuscularly into the gastrocnemius muscle. Tumors and spleens were excised on days 7, 12, 16 and 19 post injection and myeloid cell were analyzed by Fluorescence Activated Cell Sorting (FACS) for CD11b, CD11c, Gr-1 and IL-4Ralpha expression. Cells were sorted and were analyzed for gene expression of iNOS, Arg1, IDO, S100A8 and S100A9 using quantitative RT-PCR. ERMS bearing mice were treated with the Dipeptidyl peptidase inhibitors PT-100 (20 mcg/day) and 4175 (100 mcg/day) by gavage for 10 days. Results: Murine ERMS show substantial numbers of MDSCs both in the tumor and spleen of tumor bearing mice, with increasing numbers as tumor burden increased (P=0.006). Substantial numbers of these cells express IL-4Ra, a marker that has been associated with a suppressive phenotype; with a frequency of 16% and 9% of total cells respectively in tumors and spleens from ERMS bearing mice when compared to 3% in naïve spleen. Comparisons of sort-purified myeloid cell subsets by relative quantitation of gene expression revealed the presence of an expanded population of cells that bear the hallmarks of MDSCs with high expression of IDO, iNOS, Arg1, S100A8 and A100A9. Treatment with DPP inhibitors induced tumor regression that is T cell dependent and occurs despite cessation of therapy when tumors are still measurable. No recurrences were observed during a 50 day follow-up and mice were protected in a tumor-specific manner from tumor rechallenge. DPP inhibitor treatment was associated with decrease MDSC infiltration, 17% in the control group vs. 7% in the treated group (P=0.02). Interestingly, when comparing MDSCs to non-MDSC myeloid cells, PT-100 altered MDSC gene expression by reducing IDO expression (The fold change was 17000 in controls vs. 1800 in the treated mice) and iNOS expression (73000 vs. 4400). Conversely, Arg1 expression increased in the treated group from 10 fold change to 700. Similarly, S100A8 and S100A9 expression increased with DPP inhibition (22 vs. 380 fold change and 15 vs. 1550) respectively. Conclusion: Murine ERMS contain large numbers of MDSCs characterized by cell surface markers and gene expression profile that is associated with a suppressive phenotype. Tumor progression is associated with increasing numbers of MDSCs. Treatment with the DPP inhibitors induced tumor regression and was associated with decrease frequency of MDSCs with alteration of gene expression. Immunomodulation of MDSCs might be a strategy to enhance the effectiveness of immune-based therapies for pediatric solid tumors. Disclosures: No relevant conflicts of interest to declare.
30
Batchu, Sri Nagarjun, Veera Ganesh Yerra, Youan Liu, Suzanne L. Advani, Thomas Klein, and Andrew Advani. "The Dipeptidyl Peptidase-4 Inhibitor Linagliptin Directly Enhances the Contractile Recovery of Mouse Hearts at a Concentration Equivalent to that Achieved with Standard Dosing in Humans." International Journal of Molecular Sciences 21, no. 16 (August 11, 2020): 5756. http://dx.doi.org/10.3390/ijms21165756.
Full textAbstract:
Despite a similar mechanism of action underlying their glucose-lowering effects in type 2 diabetes, dipeptidyl peptidase-4 (DPP-4) inhibitors have diverse molecular structures, raising the prospect of agent-specific, glucose-independent actions. To explore the issue of possible DPP-4 inhibitor cardiac heterogeneity, we perfused different DPP-4 inhibitors to beating mouse hearts ex vivo, at concentrations equivalent to peak plasma levels achieved in humans with standard dosing. We studied male and female mice, young non-diabetic mice, and aged diabetic high fat diet-fed mice and observed that linagliptin enhanced recovery after ischemia-reperfusion, whereas sitagliptin, alogliptin, and saxagliptin did not. DPP-4 transcripts were not detected in adult mouse cardiomyocytes by RNA sequencing and the addition of linagliptin caused ≤0.2% of cardiomyocyte genes to be differentially expressed. In contrast, incubation of C166 endothelial cells with linagliptin induced cell signaling characterized by phosphorylation of Akt and endothelial nitric oxide synthase, whereas the nitric oxide (NO) donor, S-nitroso-N-acetylpenicillamine increased serine 16 phosphorylation of the calcium regulatory protein, phospholamban in cardiomyocytes. Furthermore, linagliptin increased cardiomyocyte cGMP when cells were co-cultured with C166 endothelial cells, but not when cardiomyocytes were cultured alone. Thus, at a concentration comparable to that achieved in patients, linagliptin has direct effects on mouse hearts. The effects of linagliptin on cardiomyocytes are likely to be either off-target or indirect, mediated through NO generation by the adjacent cardiac endothelium.
31
Liu, Lili, Zhuo Shao, Ying Xia, Jiabi Qin, Yang Xiao, Zhiguang Zhou, and Zubing Mei. "Incretin-based therapies for patients with type 1 diabetes: a meta-analysis." Endocrine Connections 8, no. 3 (March 2019): 277–88. http://dx.doi.org/10.1530/ec-18-0546.
Full textAbstract:
Objective Combined treatment with an incretin-based drug, such as a glucagon-like peptide 1 receptor agonist (GLP-1 RA) or a dipeptidyl peptidase-4 (DPP-4) inhibitor, and basal insulin is a new strategy for improving glucose control in type 1 diabetes mellitus (T1DM). We performed a meta-analysis to assess the effect of this combined treatment on glycaemic control, insulin dose, severe hypoglycaemia, weight gain and gastrointestinal side effects in T1DM patients. Methods We searched PubMed, EMBASE and the Cochrane Library for relevant studies published before July 16, 2018. The primary outcome was glycosylated haemoglobin (HbA1c). Secondary outcomes included total daily insulin dose, body weight, severe hypoglycaemia and gastrointestinal side effects. Results Nine randomized controlled trials (RCTs) involving 2389 patients were ultimately included in the meta-analysis. The pooled data suggested that incretin-based therapy was associated with a reduction in HbA1c levels (weighted mean difference (WMD) −0.17%, 95% confidence interval (CI) −0.24 to −0.11, P < 0.001), total daily insulin dose (WMD −5.53 IU/day, 95% CI −8.89 to −2.17, P = 0.001) and body weight (WMD −3.24 kg, 95% CI −4.43 to −2.04, P < 0.001). Incretins did not increase the risk of severe hypoglycaemia (odds ratio (OR) 0.83, 95% CI 0.60–1.16, P = 0.287) but increased the occurrence of gastrointestinal side effects (OR 3.46, 95% CI 2.20–5.45, P < 0.001). Conclusions In T1DM patients, GLP-1 RAs, but not DPP-4 inhibitors, combined with insulin appear to be an effective therapy but may increase the occurrence of gastrointestinal side effects.
32
Tan, Xin, Na Liu, Min Yang, Mojie Duan, and Jun Zeng. "Design of peptide inhibitors of human papillomavirus 16 (HPV16) transcriptional regulator E1–E2 formation." Journal of Theoretical and Computational Chemistry 16, no. 03 (April 4, 2017): 1750026. http://dx.doi.org/10.1142/s0219633617500262.
Full textAbstract:
Here, we have proposed a new scheme of the computational combinatorial design approach to identify potential inhibitor peptides. It consists of four steps: (i) using “multiple copy simultaneous search” (MCSS) procedure to locate specific functional groups on the protein surface; (ii) the peptide main chain is constructed based on the location of favored N-methylacetamide (NMA) groups; (iii) molecular dynamics simulations of the complex formed between the constructed peptides with the target protein in explicit water molecules are carried to select the peptides with strong binding to the protein and (iv) the sequences of the stable peptides selected from (iii) are aligned and the frequencies of the amino acids at each position of peptide are calculated. Sequence patterns of potential inhibitors are determined based on the frequency of amino acids at each position. It was applied to design peptide inhibitors that bind to the E2 protein of HPV16 so as to disrupt its transcriptional regulator of E1–E2 complex formation. The sequence pattern of these potential inhibitors is in agreement with known inhibitors obtained from phage display, and the MCSS calculations indicate that a hydrophobic pocket on HPV16 E2 plays a significant role in E1–E2 formation and inhibitor-E2 binding.
33
Huang, Po-Kai, Shi-Xiang Lin, May-Jywan Tsai, Max Leong, Shian-Ren Lin, Ranjith Kankala, Chia-Hung Lee, and Ching-Feng Weng. "Encapsulation of 16-Hydroxycleroda-3,13-Dine-16,15-Olide in Mesoporous Silica Nanoparticles as a Natural Dipeptidyl Peptidase-4 Inhibitor Potentiated Hypoglycemia in Diabetic Mice." Nanomaterials 7, no. 5 (May 12, 2017): 112. http://dx.doi.org/10.3390/nano7050112.
Full text
34
Okura, Y., T. Namisaki, R. Noguchi, K. Takeda, K. Moriya, M. Kitade, N. Nishimura, et al. "Impact of the Combination of Dipeptidyl Peptidase IV Inhibitor and Angiotensin-II Type 1 Receptor Blocker on Hepatocarcinogenesis in a Rat Model of Nonalcoholic Steatohepatitis." Journal of Hepatology 64, no. 2 (2016): S582. http://dx.doi.org/10.1016/s0168-8278(16)01066-7.
Full text
35
Glorie, Lorenzo, Geert J. Behets, Lesley Baerts, Ingrid De Meester, Patrick C. D'Haese, and Anja Verhulst. "DPP IV inhibitor treatment attenuates bone loss and improves mechanical bone strength in male diabetic rats." American Journal of Physiology-Endocrinology and Metabolism 307, no. 5 (September 1, 2014): E447—E455. http://dx.doi.org/10.1152/ajpendo.00217.2014.
Full textAbstract:
Dipeptidyl peptidase IV (DPP IV) modulates protein activity by removing dipeptides. DPP IV inhibitors are currently used to improve glucose tolerance in type 2 diabetes patients. DPP IV substrates not only increase insulin secretion but also affect bone metabolism. In this study, the effect of DPP IV inhibitor sitagliptin on bone was evaluated in normal and streptozotocin-induced diabetic rats. This study included 64 male Wistar rats divided into four groups ( n = 16): two diabetic and two control groups. One diabetic and one control group received sitagliptin through drinking water. Tibiae were scanned every 3 wk using an in vivo μCT scanner. After 6 and 12 wk, rats were euthanized for histomorphometric analysis of bone parameters. The mechanical resistance of femora to fracture was assessed using a three-point bending test, and serum levels of bone metabolic markers were measured. Efficient DPP IV inhibition was achieved in sitagliptin-treated groups. Trabecular bone loss, the decrease in trabecular number, and the increase in trabecular spacing was attenuated through sitagliptin treatment in diabetic rats, as shown by in vivo μCT. Bone histomorphometry was in line with these results. μCT analysis furthermore showed that sitagliptin prevented cortical bone growth stagnation in diabetic rats, resulting in stronger femora during three-point bending. Finally, the serum levels of the resorption marker CTX-I were significantly lower in sitagliptin-treated diabetic animals compared with untreated diabetic animals. In conclusion, sitagliptin treatment attenuates bone loss and increases bone strength in diabetic rats probably through the reduction of bone resorption and independent of glycemic management.
36
Danilov, Alexey V., Olga Danilova, Andreas Klein, Jennifer Brown, Arthur P. Rabinowitz, Kenneth B. Miller, and Brigitte T. Huber. "ZAP-70 Disrupts Dipeptidyl Peptidase 2 (DPP2)-Regulated Quiescence in Chronic Lymphocytic Leukemia (CLL)." Blood 114, no. 22 (November 20, 2009): 1251. http://dx.doi.org/10.1182/blood.v114.22.1251.1251.
Full textAbstract:
Abstract Abstract 1251 Poster Board I-273 CLL is a common hematologic malignancy with heterogeneous outcomes. Overexpression of ZAP-70 and unmutated B-cell receptor (BCR) heavy chain gene (IgVH) confer an adverse prognosis. While it is accepted that ZAP-70 augments BCR signaling in CLL B-cells, it remains unclear how ZAP-70 contributes to disease propagation. Peripheral blood CLL B-cells accumulate in G0. We have previously shown that CLL B-cells express DPP2, a serine protease involved in maintenance of quiescence of resting but not activated lymphocytes. We identified two subsets of CLL: sensitive CLL (S-CLL), where CLL B-cells undergo apoptosis upon inhibition of DPP2, and resistant CLL (R-CLL), where inhibition of DPP2 does not cause cell death. Here we sought to validate our preliminary observation and establish the role of ZAP-70 and BCR signaling in resistance to apoptosis in CLL. The patient cohort included 152 subjects with B-CLL from the Hematology clinics at Tufts Medical Center, Dana-Farber Cancer Institute (both in Boston, MA), and the Lahey Clinic (Burlington, MA). IgVH mutational status, ZAP-70 expression and history of treatment were analyzed. CLL B-cells were isolated from peripheral blood with standard Ficoll-Hypaque technique. Cells were treated with ValboroPro (VbP, Point Therapeutics), a non-specific inhibitor of DPPs, or AX8819 (ActivX), a DPP2-specific inhibitor. To interfere with ZAP-70, cells were treated with 17-Allylaminodemethoxygeldanamycin (17-AAG, Calbiochem), an inhibitor of hsp90, a protein involved in stabilization of ZAP-70. For apoptosis analysis cells were stained with propidium iodide and Annexin V at 16 h of incubation and assayed by flow cytometry. A CBA assay was used to measure tyrosine-phosphorylated p72Syk and ZAP-70. Expression of p27 and p130 proteins was assessed by western blot analysis. Of 152 CLL patients 99 were males (65.1%). Median age was 63 years. Median follow up was 6 years. When the study samples were obtained, 107 patients (70.4%) were untreated. In apoptosis assays, 97 (63.8%) samples were categorized as S-CLL and 55 (36.2%) as R-CLL. The small molecule inhibitor data correlated with DPP2 anti-sense experiments. Patients with R-CLL were more likely to receive treatment of their disease and had a shorter treatment-free interval from disease diagnosis compared with S-CLL (HR=4.79, 95% CI, 4.7 to 15.2; p<0.0001). In the R-CLL subgroup, B-CLL cells also exhibited unmutated IgVH and expressed high level of ZAP-70 (p<0.001). R-CLL B-cells exhibited higher level of p72Syk phosphorylation compared with S-CLL (p<0.05), suggesting that those cells are partially activated. Meanwhile, S-CLL B-cells had high p27 and p130 protein level, characteristic of a quiescent state. ZAP-70 was phosphorylated at a similar level between the two subsets, consistent with earlier observations that ZAP-70 does not depend on its phosphorylation to enhance BCR signaling. Upon inhibition of DPP2, S-CLL B-cells became activated as evidenced by dramatic phosphorylation of p72Syk. Concomitantly, p27 and p130 protein levels decreased indicating inappropriate cell cycle entry. Co-inhibition of DPP2 and hsp90 in R-CLL B-cells increased apoptosis by a mean of 8.1%, indicating that their survival is dependent on ZAP-70. CLL can be categorized into two prognostic groups based on the susceptibility of B-cells to DPP2 inhibition-induced apoptosis. Resistance to apoptosis correlates with unmutated IgVH and high ZAP-70 and is associated with an unfavorable disease course. The distinction between the two subsets of CLL stems from the aberration in the quiescence program. While S-CLL B-cells rest in true G0, R-CLL B-cells are partially activated due to ZAP-70 co-stimulatory signal and escape apoptosis. Destabilization of ZAP-70 reverses the resistant phenotype. DPP2 inhibition alone or with concomitant inhibition of ZAP-70 warrants investigation as a therapeutic modality in CLL. Disclosures No relevant conflicts of interest to declare.
37
Tanajak, Pongpan, Hiranya Pintana, Natthaphat Siri-Angkul, Juthamas Khamseekaew, Nattayaporn Apaijai, Siriporn C. Chattipakorn, and Nipon Chattipakorn. "Vildagliptin and caloric restriction for cardioprotection in pre-diabetic rats." Journal of Endocrinology 232, no. 2 (February 2017): 189–204. http://dx.doi.org/10.1530/joe-16-0406.
Full textAbstract:
Long-term high-fat diet (HFD) consumption causes cardiac dysfunction. Although calorie restriction (CR) has been shown to be useful in obesity, we hypothesized that combined CR with dipeptidyl peptidase-4 (DPP-4) inhibitor provides greater efficacy than monotherapy in attenuating cardiac dysfunction and metabolic impairment in HFD-induced obese-insulin resistant rats. Thirty male Wistar rats were divided into 2 groups to be fed on either a normal diet (ND, n = 6) or a HFD (n = 24) for 12 weeks. Then, HFD rats were divided into 4 subgroups (n = 6/subgroup) to receive just the vehicle, CR diet (60% of mean energy intake and changed to ND), vildagliptin (3 mg/kg/day) or combined CR and vildagliptin for 4 weeks. Metabolic parameters, heart rate variability (HRV), cardiac mitochondrial function, left ventricular (LV) and fibroblast growth factor (FGF) 21 signaling pathway were determined. Rats on a HFD developed insulin and FGF21 resistance, oxidative stress, cardiac mitochondrial dysfunction and impaired LV function. Rats on CR alone showed both decreased body weight and visceral fat accumulation, whereas vildagliptin did not alter these parameters. Rats in CR, vildagliptin and CR plus vildagliptin subgroups had improved insulin sensitivity and oxidative stress. However, vildagliptin improved heart rate variability (HRV), cardiac mitochondrial function and LV function better than the CR. Chronic HFD consumption leads to obese-insulin resistance and FGF21 resistance. Although CR is effective in improving metabolic regulation, vildagliptin provides greater efficacy in preventing cardiac dysfunction by improving anti-apoptosis and FGF21 signaling pathways and attenuating cardiac mitochondrial dysfunction in obese-insulin-resistant rats.
38
Angwin, Catherine, Caroline Jenkinson, Angus Jones, Christopher Jennison, William Henley, Andrew Farmer, Naveed Sattar, et al. "TriMaster: randomised double-blind crossover study of a DPP4 inhibitor, SGLT2 inhibitor and thiazolidinedione as second-line or third-line therapy in patients with type 2 diabetes who have suboptimal glycaemic control on metformin treatment with or without a sulfonylurea—a MASTERMIND study protocol." BMJ Open 10, no. 12 (December 2020): e042784. http://dx.doi.org/10.1136/bmjopen-2020-042784.
Full textAbstract:
IntroductionPharmaceutical treatment options for patients with type 2 diabetes mellitus (T2DM) have increased to include multiple classes of oral glucose-lowering agents but without accompanying guidance on which of these may most benefit individual patients. Clinicians lack information for treatment intensification after first-line metformin therapy. Stratifying patients by simple clinical characteristics may improve care by targeting treatment options to those in whom they are most effective. This academically designed and run three-way crossover trial aims to test a stratification approach using three standard oral glucose-lowering agents.Methods and analysisTriMaster is a randomised, double-blind, crossover trial taking place at up to 25 clinical sites across England, Scotland and Wales. 520 patients with T2DM treated with either metformin alone, or metformin and a sulfonylurea who have glycated haemoglobin (HbA1c) >58 mmol/mol will be randomised to receive 16 weeks each of a dipeptidyl peptidase‐4 inhibitor, sodium-glucose co-transporter-2 inhibitor and thiazolidinedione in random order. Participants will be assessed at the end of each treatment period, providing clinical and biochemical data, and their experience of side effects. Participant preference will be assessed on completion of all three treatments. The primary endpoint is HbA1c after 4 months of therapy (allowing a range of 12–18 weeks for analysis). Secondary endpoints include participant-reported preference between the three treatments, tolerability and prevalence of side effects.Ethical approvalThis study was approved by National Health Service Health Research Authority Research Ethics Committee South Central—Oxford A, study 16/SC/0147. Written informed consent will be obtained from all participants. Results will be submitted to a peer-reviewed journal and presented at relevant scientific meetings. A lay summary of results will be made available to all participants.Trial registration numbers12039221; 2015-002790-38 and NCT02653209.
39
Xiaoying, Liu, Shawndeep Tung, Tetsuro Setoyama, Lucilla D’Abundo, Robinson Simon, Hui Yang, Eric Yvon, et al. "FOXP3 Is a Direct Target Of miR15a/16 in Umbilical Cord Blood Regulatory T Cells." Blood 122, no. 21 (November 15, 2013): 3261. http://dx.doi.org/10.1182/blood.v122.21.3261.3261.
Full textAbstract:
Abstract The exact mechanism of action of Umbilical cord blood (CB) derived regulatory T cells (Tregs) in the prevention of graft versus host disease (GVHD) remains unclear. Based on the selective overexpression of peptidase inhibitor 16 in CB Tregs we explored the related p53 pathway that has been shown to negatively regulate microRNA 15a and 16 (Fabbri, JAMA, 2011). We systematically evaluated the expression of miR15a/16 in CB Tregs (CD4+25+127lo) and compared it to CB derived conventional T cells (Tcons) (CD4+25-127hi). CB Tregs and Tcons were isolated using CD25 based magnetic selection and were ex-vivo expanded for 14 days in the presence of IL-2. Total RNA was reverse transcribed with microRNA-specific primers using a TaqMan® microRNA reverse transcription kit. Differences in miRNA levels were compared with the Student’s T-test. Fisher exact and χ2 tests were applied to categorical variables. Lentivirus based transduction was performed in CB Tregs and CB Tcons for the purpose of miR15a overexpression (OE) and knockdown (KO), respectively. Firefly and Renilla dual luciferase report system were employed to investigate the interaction between miR15a/16 and FOXP3. In order to generate the 3′ UTR mutant construct (3′UTR-del), seed regions were deleted using the QuikChange site-directed mutagenesis kit according to the manufacturer’s protocols (Agilent) and designated as FOXP3 del. We found significantly lower levels of miR15a and miR16 in CB Tregs when compared to CB Tcons (p=0.002 and p<0.001, respectively). As a positive control, miR21 was overexpressed in CB Tregs when compared to CB Tcons (p=0.005). No difference was seen in the miR15a/16 expression between CB Tregs and peripheral Blood Tregs. In a xenogeneic GVHD mouse model, lower levels of miR15a/16 were also found in the circulating CD4+ cells of Treg recipients which correlated with their preservation of phenotype, better GVHD score and overall survival. OE of miR15a/16 in CB Tregs inhibited FOXP3 and CTLA4 expression and led to partial reversal of Treg mediated suppression in an allogeneic mixed lymphocyte reaction (MLR) (p=0.005 and p=0.00001, respectively). OE miR15a/16 also led to reversal of FOXP3 demethylation in CB Tregs. Furthermore, KD of miR15a/16 in CB Tcons led to increased expression of FOXP3 and CTLA4. miR15a/16 KD CB Tcons were able to suppress the proliferation reaction in an alloMLR. Using luciferase based mutagenesis assay, FOXP3 was determined to be a target of miR15a/16 at binding site 1: GTGGTTCTAGACACCCCCTCCCCCATCATA (forward) and GTGGTTCTAGAGGC TCTCTGTGTTTTGGGGT (reverse) and binding site 2: GTGGTTCTAGACCTACAC AGAAGCAGCGTCA (forward) and GTGGTTCTAGAGATCAGGGCTCAGGGAATGG (reverse). This is the first report of identification of FOXP3 as a direct target of miR15a/16 and we propose miR15a/16 as a mechanism involved in the checkpoint of CB Tregs and Tcons (Figure 1). Further study of miR15a/16 pathway can be helpful in better understanding of Treg function. Disclosures: Shah: Celgene: Membership on an entity’s Board of Directors or advisory committees, Research Funding. McNiece:Proteonomix Inc: Consultancy.
40
Kasukawa, Hiroaki, Peter M. Howley, and John D. Benson. "A Fifteen-Amino-Acid Peptide Inhibits Human Papillomavirus E1-E2 Interaction and Human Papillomavirus DNA Replication In Vitro." Journal of Virology 72, no. 10 (October 1, 1998): 8166–73. http://dx.doi.org/10.1128/jvi.72.10.8166-8173.1998.
Full textAbstract:
ABSTRACT Mutation of the conserved glutamic acid residue at position 39 of human papillomavirus type 16 (HPV-16) E2 to alanine (E39A) disrupts its E1 interaction activity and its replication function in transient replication assays but does not affect E2 transcriptional activation. This E39A mutation also disrupts replication activity of HPV-16 E2 in HPV-16 in vitro DNA replication. On this basis, we designed 23- and 15-amino-acid peptides derived from HPV-16 E2 sequences flanking the E39 residue and tested the ability of these peptides to inhibit interaction between HPV-16 E1 and E2 in vitro. The inhibitory activity of these peptides was specific, since analogous peptides in which alanine was substituted for the E39 residue did not inhibit interaction. The 15-amino-acid peptide E2N-WP15 was the smallest peptide tested that effectively inhibited HPV-16 E1-E2 interaction. This peptide also inhibited in vitro replication of HPV-16 DNA. The efficacy of E2N-WP15 was not exclusive to HPV-16: this peptide also inhibited interaction of HPV-11 E1 with the E2 proteins of both HPV-11 and HPV-16 and inhibited in vitro replication with these same combinations of E1 and E2 proteins. These results provide further evidence that E1-E2 interaction is required for papillomavirus DNA replication and constitute the first demonstration that inhibition of this interaction is sufficient to prevent HPV DNA replication in vitro.
41
Lin, S., X. Gu, F. Wang, and W. Tan. "POS0002 PI16 REPRESSES FOXP3 EXPRESSION IN T REGULATORY CELLS AND EXACERBATES AUTOIMMUNE ARTHRITIS VIA INHIBITING THE K48-LINKED POLYUBIQUITIN DEGRADATION OF BMI-1." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 203.2–203. http://dx.doi.org/10.1136/annrheumdis-2021-eular.2756.
Full textAbstract:
Background:Regulatory T cells (Tregs) play an essential role in maintaining self-tolerance and immune homeostasis. Abnormalities in the quantity or function of Treg cells are believed in RA patients, contributing to the inability to suppress autoimmunity and proinflammatory cytokines. Forkhead box P3 (Foxp3) is a crucial transcription factor for the development and differentiation of Tregs. How Tregs lose Foxp3 expression under inflammatory milieu remains largely unknown. Peptidase inhibitor 16 (PI16) is a member of the CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1) protein family and its function are largely poor understood. In a genome-wide expression profiling study for identifying human Foxp3 target genes revealed PI16 was expressed on the cell surface of >80% of resting human CD25+ Foxp3+ Tregs. In the inflamed joint of juvenile idiopathic arthritis revealed a low number of PI16+ Tregs but high number of Th17 cells. However, little is known the function role of PI16 on Tregs or on RA development.Objectives:To investigate the role of peptidase inhibitor 16 (PI16) on the key T regulatory (Tregs) cells transcription factor Foxp3 expression and on the development of autoimmune arthritis.Methods:The expression of PI16 in blood, synovial fluid, inflamed joints were examined in Rheumatoid arthritis (RA) patients and in arthritic mice. Arthritis symptom, histological features and Foxp3 expression in PI16 transgenic (PI16Tg) arthritic mice were examined. Posttranslational mechanisms on PI16-mediated Foxp3 expression were analyzed. The specific role PI16 on Foxp3 expression was validated in conditional knockout (KO) mice.Results:The expression of PI16 was significantly increased in PBMC, serum, synovial tissue from RA patients or arthritic mice compared with controls. PI16Tg arthritic mice exhibited obvious inflammation, synovial hyperplasia and articular cartilage destruction in the joints compared with those in wild-type mice (WT) arthritic mice.Foxp3 is downregulated in splenic T cells and synovial tissue from PI16Tg arthritic mice. Naïve T cells derived from PI16Tg arthritic mice showed the decreased capacity to differentiate into Tregs. Polycomb-group (PcG) proteins complex molecule of Bmi-1 was significant increase in Tregs and joint tissue from PI16Tg arthritic mice. A direct interaction between 1-95AA domains of PI16 and 169 and 436 domains of Bmi-1 in Tregs promoter was observed. The binding of PI16 with Bmi-1 in the Foxp3 promoter inhibit the K48-linked polyubiquitin degradation of Bmi-1 at lysine site 72 and 153 region, which prompts the repressive histone modification of H3K27me3 and H2AK119ub, and inhibits the active histone modification of H3K4me3. Furthermore, conditional knockout of PI16 in Tregs retarded Foxp3 loss and blunted disease progression in experimental arthritis.Conclusion:PI16 represses Foxp3 expression by mediating histone modification via inhibiting K48-linked polyubiquitin degradation of Bmi-1 in Foxp3 promoter, contributing to disease progression in arthritic mice.Disclosure of Interests:None declared.
42
Plamboeck, Astrid, Simon Veedfald, Carolyn F. Deacon, Bolette Hartmann, André Wettergren, Lars B. Svendsen, Søren Meisner, et al. "Characterisation of oral and i.v. glucose handling in truncally vagotomised subjects with pyloroplasty." European Journal of Endocrinology 169, no. 2 (August 2013): 187–201. http://dx.doi.org/10.1530/eje-13-0264.
Full textAbstract:
ObjectiveGlucagon-like peptide 1 (GLP1) is rapidly inactivated by dipeptidyl peptidase 4 (DPP4), but may interact with vagal neurons at its site of secretion. We investigated the role of vagal innervation for handling of oral and i.v. glucose.Design and methodsTruncally vagotomised subjects (n=16) and matched controls (n=10) underwent 50 g-oral glucose tolerance test (OGTT)±vildagliptin, a DPP4 inhibitor (DPP4i) and isoglycaemic i.v. glucose infusion (IIGI), copying the OGTT without DPP4i.ResultsIsoglycaemia was obtained with 25±2 g glucose in vagotomised subjects and 18±2 g in controls (P<0.03); thus, gastrointestinal-mediated glucose disposal (GIGD) – a measure of glucose handling (100%×(glucoseOGTT−glucoseIIGI/glucoseOGTT)) – was reduced in the vagotomised compared with the control group. Peak intact GLP1 concentrations were higher in the vagotomised group. Gastric emptying was faster in vagotomised subjects after OGTT and was unaffected by DPP4i. The early glucose-dependent insulinotropic polypeptide response was higher in vagotomised subjects. Despite this, the incretin effect was equal in both groups. DPP4i enhanced insulin secretion in controls, but had no effect in the vagotomised subjects. Controls suppressed glucagon concentrations similarly, irrespective of the route of glucose administration, whereas vagotomised subjects showed suppression only during IIGI and exhibited hyperglucagonaemia following OGTT. DPP4i further suppressed glucagon secretion in controls and tended to normalise glucagon responses in vagotomised subjects.ConclusionsGIGD is diminished, but the incretin effect is unaffected in vagotomised subjects despite higher GLP1 levels. This, together with the small effect of DPP4i, is compatible with the notion that part of the physiological effects of GLP1 involves vagal transmission.
43
Majithia, Amit R., David M. Erani, Coco M. Kusiak, Jennifer E. Layne, Amy Armento Lee, Francis R. Colangelo, Robert J. Romanelli, et al. "Medication Optimization Among People With Type 2 Diabetes Participating in a Continuous Glucose Monitoring–Driven Virtual Care Program: Prospective Study." JMIR Formative Research 6, no. 4 (April 5, 2022): e31629. http://dx.doi.org/10.2196/31629.
Full textAbstract:
Background The Onduo virtual care program for people with type 2 diabetes (T2D) includes a mobile app, remote lifestyle coaching, connected devices, and telemedicine consultations with endocrinologists for medication management and prescription of real-time continuous glucose monitoring (RT-CGM) devices. In a previously described 4-month prospective study of this program, adults with T2D and baseline glycated hemoglobin (HbA1c) ≥8.0% to ≤12.0% experienced a mean HbA1c decrease of 1.6% with no significant increase in hypoglycemia. Objective The objective of this analysis was to evaluate medication optimization and management in the 4-month prospective T2D study. Methods Study participants received at least 1 telemedicine consultation with an Onduo endocrinologist for diabetes medication management and used RT-CGM intermittently to guide therapy and dosing. Medication changes were analyzed. Results Of 55 participants, 48 (87%) had a medication change consisting of a dose change, addition, or discontinuation. Of these, 15 (31%) participants had a net increase in number of diabetes medication classes from baseline. Mean time to first medication change for these participants was 36 days. The percentage of participants taking a glucagon-like peptide-1 receptor agonist increased from 25% (12/48) to 56% (n=27), while the percentages of participants taking a sulfonylurea or dipeptidyl peptidase 4 inhibitor decreased from 56% (n=27) to 33% (n=16) and 17% (n=8) to 6% (n=3), respectively. Prescriptions of other antidiabetic medication classes including insulin did not change significantly. Conclusions The Onduo virtual care program can play an important role in providing timely access to guideline-based diabetes management medications and technologies for people with T2D. Trial Registration ClinicalTrials.gov NCT03865381; https://clinicaltrials.gov/ct2/show/NCT03865381
44
Frank, Robin, Sucheta Jagan, Lydia Luy Tan, Laura A. Paganessi, and Kent W. Christopherson. "Use of the CD26 Inhibitor Diprotin A (Ile-Pro-Ile) to Increase Mobilized Peripheral Blood Mononuclear Cell Adhesion and Migration." Blood 114, no. 22 (November 20, 2009): 372. http://dx.doi.org/10.1182/blood.v114.22.372.372.
Full textAbstract:
Abstract Abstract 372 A firm understanding of the biology of hematopoietic stem and progenitor cell (HSC/HPC) trafficking is believed to be critical for the development of methodologies to improve transplant efficiency and subsequent immune reconstitution during hematopoietic stem cell transplantation (HSCT) in the clinical setting. We have previously reported that suppression of the peptidase CD26/DPPIV (dipeptidylpeptidase IV) on mouse HSC/HPC as a method of increasing transplant efficiency (Christopherson, KW 2nd, et al. Science 2004. 305:1000-3). We have also described that inhibition of CD26 on CD34+ or lin- cord blood (CB) cells improves engraftment into immunodeficient mice (Christopherson, KW 2nd, et al. Stem Cells and Dev 2007. 16:355-60). However, it has been reported that inhibition of CD26 on CD34+ G-CSF mobilized peripheral blood (PB) cells does not improve migration in response to SDF-1 or engraftment into NOD/SCID mice (Kawai K, et al, et al. Stem Cells and Dev 2007. 16:361-70). Given the widespread usage of un-fractionated mobilized PB as a source of cells for transplantation in both the autologous and allogeneic setting, the implications of also studying un-fractionated mobilized PB should not to be overlooked. We therefore investigated whether inhibition of CD26 activity on mobilized PB (mobPB) mononuclear cells (MNC) would have an effect on CXCL12/SDF-1 mediated adhesion and migration. These results were compared directly with data from CB MNC. Non-adherent MNCs from mobPB and CB were obtained by density centrifugation followed by adhesion to plastic for 90 minutes. By flow cytometry, CD26 expression was approximately 48% and 20% of the CD45+ cell population with Mean Fluorescent Intensity (MFI) of 1,200 and 1,000 for mobPB and CB MNCs respectively. Expression of CD26 was confirmed by Western Blot in total cell lysates from mobPB and CB MNCs. CD26 activity, as determined using the substrate Gly-Pro P-nitroanilide (Gly-Pro-pNA), was 36.7±2.8 pmol pNA/minute for mobPB MNCs and 30.9±2.8 pmol pNA/minute for CB MNCs (n=16). Prior to use in functional in vitro assays, cells were first cultured with or without a 5mM concentration of the CD26 inhibitor Diprotin A (DpA) for 15 minutes in DPBS+0.2%BSA at 37oC, 5% CO2. To perform static adhesion assay, cells were treated with SDF-1α (0-800 ng/mL) for 30 minutes, loaded onto human fibronectin coated plates, and then allowed to incubate an additional 30 minutes at 37oC, 5% CO2. DpA pre-treatment of mobPB and CB MNC was observed to result in an increase in adhesion as compared to untreated cells. Specifically, the percent adherence to fibronectin in response to 400ng/mL SDF-1α increased from 50.1±4.5% for untreated to 70.1±2.3% for DpA treated mobPB MNCs (p≤0.05, n=6). The percent adherence for CB MNCs increased from 48.2%±5.1 for untreated to 65.4±5.9% for DpA treated cells in response to 400ng/mL SDF-1α (p≤0.05, n=6). To assess migration, chemotaxis assays were performed by loading 2×105 cells into the upper chamber of a transwell plate, adding SDF-1α (0-400 ng/mL) in the lower chamber, and incubating for 2 hours at 37oC, 5% CO2. DpA pre-treatment of mobPB and CB cells was observed to result in an increased migration as compared to untreated cells. Specifically, the percent migration at 400ng/mL SDF-1α was 20.0±1.7% and 27.8±1.9% for untreated and DpA treated mobPB MNCs respectively (p≤0.01, n=7). The percent migration in response to 400ng/mL SDF-1α was 58.8±1.4% for untreated CB MNCs and 70.6 ± 2.9% for DpA treated CB MNCs (p≤0.01, n=4). These data indicate that a substantial portion of G-CSF mobPB cells express CD26 and exhibit CD26 peptidase activity similar to that seen on CB cells. In addition, CD26 inhibition on these cells results in an increase in functional response to SDF-1 as quantitated by adhesion and migration. Taken in the context of other studies examining sorted CD34+ mobPB our data suggest that un-fractionated mobPB may have inherently different regulatory properties due to the presence of accessory cells. Additionally, our data suggest that suppression of functional response of HSC/HPC to the chemokines SDF-1 by CD26 activity may be an endogenous regulatory mechanism that extends beyond CB to also include mobPB. Future studies are needed to pursue whether inhibition of CD26 activity can serve as a technique by which the trafficking of hematopoietic stem and progenitor cells from un-fractionated mobilized peripheral blood can be manipulated for possible clinical benefit. Disclosures: No relevant conflicts of interest to declare.
45
Sidelmann Christensen, Alexander, Heidi Storgaard, Sofie Hædersdal, Torben Hansen, Filip Krag Knop, and Tina Vilsbøll. "Glimepiride monotherapy versus combination of glimepiride and linagliptin therapy in patients with HNF1A-diabetes: a protocol for a randomised, double-blinded, placebo-controlled trial." BMJ Open 8, no. 10 (October 2018): e022517. http://dx.doi.org/10.1136/bmjopen-2018-022517.
Full textAbstract:
IntroductionHepatocyte nuclear factor 1α (HNF1A)-diabetes is the most common monogenetic subtype of diabetes. Strict glycaemic control is crucial for a good prognosis for patients with HNF1A-diabetes. Sulfonylurea (SU) is used as a first-line therapy in HNF1A-diabetes. However, SU therapy may be problematic as it confers a high risk of hypoglycaemia. We hypothesise that low dose of SU in combination with a dipeptidyl peptidase 4 inhibitor provides a safer and more efficacious treatment in patients with HNF1A-diabetes compared with SU as monotherapy.Methods and analysisIn a randomised, double-blinded, crossover study, patients with HNF1A-diabetes will randomly be assigned to 16 weeks of treatment with glimepiride+linagliptin, 4 weeks of washout and 16 weeks of treatment with glimepiride+placebo (or vice versa). Treatment will be evaluated with continuous glucose monitoring and combined meal and bicycle tests conducted at baseline and at the end of each of the two treatment periods. The primary end point is the absolute difference in the mean amplitude of glycaemic excursions between the two treatments (glimepiride+linagliptin vs glimepiride+placebo) at the end of each treatment period.Ethics and disseminationThe study protocol is approved by the Danish Medicines Agency, The Scientific-Ethical Committee of the Capital Region of Denmark (H-17014518) and the Danish Data Protection Agency. The trial will be carried out and monitored in compliance with Good Clinical Practice guidelines and in accordance with the latest version of the Declaration of Helsinki. Positive, negative and inconclusive results will be published at scientific conferences and as one or more scientific manuscripts in peer-reviewed journals with authorship in accordance with the International Committee of Medical Journal Editors’ recommendations.Trial registration number2017-000204-15.
46
McFadden, Karyn, Patricia Fletcher, Fiorella Rossi, Kantharaju, Muddagowda Umashankara, Vanessa Pirrone, Srivats Rajagopal, et al. "Antiviral Breadth and Combination Potential of Peptide Triazole HIV-1 Entry Inhibitors." Antimicrobial Agents and Chemotherapy 56, no. 2 (November 14, 2011): 1073–80. http://dx.doi.org/10.1128/aac.05555-11.
Full textAbstract:
ABSTRACTThe first stage of human immunodeficiency virus type 1 (HIV-1) infection involves the fusion of viral and host cellular membranes mediated by viral envelope glycoprotein gp120. Inhibitors that specifically target gp120 are gaining increased attention as therapeutics or preventatives to prevent the spread of HIV-1. One promising new group of inhibitors is the peptide triazoles, which bind to gp120 and simultaneously block its interaction with both CD4 and the coreceptor. In this study, we assessed the most potent peptide triazole, HNG-156, for inhibitory breadth, cytotoxicity, and efficacy, both alone and in combination with other antiviral compounds, against HIV-1. HNG-156 inhibited a panel of 16 subtype B and C isolates of HIV-1 in a single-round infection assay. Inhibition of cell infection by replication-competent clinical isolates of HIV-1 was also observed with HNG-156. We found that HNG-156 had a greater than predicted effect when combined with several other entry inhibitors or the reverse transcriptase inhibitor tenofovir. Overall, we find that HNG-156 is noncytotoxic, has a broad inhibition profile, and provides a positive combination with several inhibitors of the HIV-1 life cycle. These results support the pursuit of efficacy and toxicity analyses in more advanced cell and animal models to develop peptide triazole family inhibitors of HIV-1 into antagonists of HIV-1 infection.
47
Kadarmideen, H. N., and G. Mazzoni. "Transcriptomics–genomics data integration and expression quantitative trait loci analyses in oocyte donors and embryo recipients for improving invitro production of dairy cattle embryos." Reproduction, Fertility and Development 31, no. 1 (2019): 55. http://dx.doi.org/10.1071/rd18338.
Full textAbstract:
In this paper we first provide a brief review of main results from our previously published studies on genome-wide gene expression (transcriptomics) in donor and recipient cattle used in invitro production (IVP) of embryos and embryo transfer (ET). Then, we present novel results from applying integrative systems genomics and biological analyses where transcriptomics data are combined with genomic data in both donor and recipient cattle to map expression quantitative trait loci (eQTLs). The eQTLs are genetic markers that can regulate or control the expression of genes in the entire genome, via complex molecular mechanisms, and thus can act as a powerful tool for genomic and gene-assisted selection. We identified significant eQTLs potentially controlling the expression of 13 candidate genes for donor cow quality (IVP parameters; e.g. cyclin B1 (CCNB1), outer dense fiber of sperm tails 2 like (ODF2L)) and 19 candidate genes for recipient cows quality (endometrial receptivity; e.g. ER membrane protein complex subunit 9 (EMC9), mannosidase beta (MANBA), peptidase inhibitor 16 (PI16)). Annotation and colocation of detected eQTLs show that some of the eQTLs are in the same genomic regions previously reported as QTLs for reproduction-related traits. However, eQTLs and the candidate genes identified should be further validated in larger populations before implementation as genetic markers or used in genomic selection for improving IVP and ET performance.
48
Danilov, Alexey V., Olga V. Danilova, Andreas K. Klein, and Brigitte T. Huber. "Apoptosis in Response to Inhibition of Dipeptidyl Peptidase 2 (DPP2) Defines Low Risk Chronic Lymphocytic Leukemia (CLL)." Blood 110, no. 11 (November 16, 2007): 3094. http://dx.doi.org/10.1182/blood.v110.11.3094.3094.
Full textAbstract:
Abstract Maintenance of the G0 state is a key to survival of CLL B-cells. Heterogeneity of prognosis suggests that CLL is not a uniform disease. Molecules expressed in CLL with unfavorable prognosis, such as ZAP-70, Lyn, CD38 and others, provide stimuli which, coupled with B-cell receptor signaling, may alter cell cycle progression and delay apoptosis. We studied mechanisms of apoptosis in CLL B-cells via inhibition of Dipeptidyl Peptidase 2 (DPP2). DPP2 is a serine protease cloned in our lab, which is involved in the maintenance of the G0 (quiescent) state. Inhibition of DPP2 triggers apoptosis in healthy B-cells. 50 patients with B-CLL were recruited from the Hematology clinics at Tufts-NEMC (Boston, MA). Median time from diagnosis of CLL to enrollment in the study was 7 years with median follow up of 10.5 years. 24 patients (48%) have received treatment in the course of their disease. CLL B-cells were isolated from peripheral blood with standard Ficoll-Hypaque technique, treated with ValboroPro (Point Therapeutics), a non-specific inhibitor of DPPs, and/or AX8819 (ActivX), a DPP2-specific inhibitor, incubated for 16 hours and stained with anti-CD19 antibodies, propidium iodide and Annexin V. Expression of DPP2 and ZAP-70 mRNA was assessed by RT-qPCR, p27 protein - by western blot analysis. By blocking DPP2 protease activity, we distinguished two subsets of CLL - sensitive (S-CLL) and resistant (R-CLL) to DP-P2 inhibition-induced apoptosis. In 30 cases (60%), inhibition of DPP2 resulted in caspase-dependent apoptosis of CLL B-cells (S-CLL). 70–90% of B-cells stained Annexin V-positive after incubation with AX8819. Pre-incubation with Rituximab (Biogen Idec) did not enhance cell death. In the remaining 20 cases (40%) inhibition of DPP2 did not cause cell death (R-CLL). R-CLL demonstrated higher expression of ZAP-70 mRNA (p<0.001) and lower levels of p27 protein (p<0.01) than S-CLL. ZAP-70 mRNA levels strongly correlated with resistance to apoptosis (χ2=26.7, p<0.0001). Inhibition of DPP2 resulted in a decrease in p27 protein levels in S-CLL, but not in R-CLL. Both groups expressed higher DPP2 mRNA levels than B-cells derived from healthy donors. In the R-CLL subgroup, 18 patients (84%) required treatment for their disease, 14 received more than one treatment regimen, 2 underwent allogeneic transplant and 2 died of complications of CLL. Among the S-CLL cohort, 10 patients (33%) initiated treatment, 4 received more than one treatment regimen. R-CLL cohort required treatment earlier than S-CLL (3.5 vs. 9.9 years from diagnosis). Thus, DPP2 inhibition discriminates two subsets of CLL based on their ability to undergo apoptosis upon disruption of the quiescent program. We postulate that DPP2 is critical for the maintenance of G0 in S-CLL. Its inhibition leads to inappropriate cell cycle entry, as evidenced by a decrease in p27 protein levels and cell death. The R-CLL subgroup expresses high ZAP-70 mRNA levels which portends a worse clinical course. In this subgroup, ZAP-70 kinase activity may provide an additional tonic signal that pushes CLL B-cells into late G0/early G1. At this stage, DPP2 protease activity is no longer required for survival. DPP2 inhibition may serve as an easy-to-perform prognostic test, as well as a novel therapeutic approach.
49
Toya, Yoshiyuki, Carsten Schwencke, Jacques Couet, Michael P. Lisanti, and Yoshihiro Ishikawa. "Inhibition of Adenylyl Cyclase by Caveolin Peptides*." Endocrinology 139, no. 4 (April 1, 1998): 2025–31. http://dx.doi.org/10.1210/endo.139.4.5957.
Full textAbstract:
Abstract Caveolae and their principal component caveolin have been implicated in playing a major role in G protein-mediated transmembrane signaling. We examined whether caveolin interacts with adenylyl cyclase, an effector of G protein signaling, using a 20-mer peptide derived from the N-terminus scaffolding domain of caveolin-1. When tissue adenylyl cyclases were examined, cardiac adenylyl cyclase was inhibited more potently than other tissue adenylyl cyclases. The caveolin-1 peptide inhibited type V, as well as type III adenylyl cyclase, overexpressed in insect cells, whereas the same peptide had no effect on type II. The caveolin-3 scaffolding domain peptide similarly inhibited type V adenylyl cyclase. In contrast, peptides derived from the caveolin-2 scaffolding domain and a caveolin-1 nonscaffolding domain had no effect. Kinetic studies showed that the caveolin-1 peptide decreased the maximal rate (Vmax) value of type V without changing the Michaelis constant (Km) value for the substrate ATP. Studies with various truncations and point mutations of this peptide revealed that a minimum of 16 amino acid residues and intact aromatic residues are important for the inhibitory effect. The potency of inhibition was greater when adenylyl cyclase was in stimulated condition vs. basal condition. Thus, caveolin may be another cellular component that regulates adenylyl cyclase catalytic activity. Our results also suggest that the caveolin peptide may be used as an isoform-selective inhibitor of adenylyl cyclase.
50
Chintala, Sreenivasulu, Kevin Quist, and Rachel Katzenellenbogen. "Abstract 5919: Regulation of SLPI secretion by NFX1-123 and HPV 16 E6 in cervical cancer." Cancer Research 82, no. 12_Supplement (June 15, 2022): 5919. http://dx.doi.org/10.1158/1538-7445.am2022-5919.
Full textAbstract:
Abstract Background: Secretory Leukocyte Peptidase Inhibitor (SLPI) functions in cancer progression, cellular invasion, metastasis, immune evasion, and chemoresistance. Our previous studies showed increased SLPI with overexpressed NFX1-123 and co-expressed high-risk (HR) human papillomavirus type 16 E6 oncogene (16E6) in primary keratinocytes (HFKs) as well as high SPLI levels in cervical cancers. The HR viral oncogenes E6 and E7 partner with host cell proteins to regulate cell cycle regulation and immortalization pathways. Understanding the mechanisms of SLPI upregulation in HPV-associated cancers is critical to validating SLPI as a non-invasive biomarker as well as to test its utility in future cancer treatments. This study was designed to quantify intracellular and secreted SLPI protein in cervical cancer and to determine the roles NFX1-123 and 16E6 have on SLPI expression and secretion. Methods: Using HPV- and HPV+ cervical cancer cell lines and HFKs transduced with overexpressed NFX1-123 and 16E6, or vector controls, we measured intracellular and secreted SLPI by Western blot and ELISA, respectively. In HPV+ cervical cancer cell lines, NFX1-123 was knocked down or out by shRNA or CRISPR-Cas9, respectively, and 16E6 and 16E7 were knocked down by siRNA. In those cells, intracellular and secreted SLPI was quantified and the relative role of NFX1-123, 16E6, and 16E7 were studied. Selected classical and non-classical secretory pathways markers were also measured to assess their effects on SLPI secretion. Finally, SLPI’s concentration was measured by ELISA in cervical cancer patient sera and compared to healthy controls. Results: Our results showed increased intracellular as well as secreted SLPI in HFKs with overexpressed NFX1-123 and 16E6. Similarly, we found increased SLPI secretion in HPV+ cervical cancer cell lines (SiHa, Caski and HeLa) when compared to HPV- C33A cells. A reduction in NFX1-123 and 16E6 led to decreased SLPI secretion, pointing to a regulation of SLPI by NFX1-123 and 16E6 on SLPI secretion. Analysis of classical and non-classical secretory pathway markers suggested that NFX1-123 regulated non-classical pathways, which may drive greater secretion of SLPI in HPV+ cervical cancers. Higher SLPI protein amounts were found cervical cancer patient sera when compared to healthy controls. Conclusions: Our results suggest a functional role for NFX1-123 and 16E6 in SLPI secretion in cervical cancer and that SLPI may be a potential biomarker in cervical cancer. Citation Format: Sreenivasulu Chintala, Kevin Quist, Rachel Katzenellenbogen. Regulation of SLPI secretion by NFX1-123 and HPV 16 E6 in cervical cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 5919.