Journal articles on the topic 'NAP SG'

The role of the liver in the disposition of circulating mercapturic acids was examined in anesthetized rats and in the isolated perfused rat liver using S-2,4-dinitrophenyl- N-acetylcysteine (DNP-NAC) as the model compound. When DNP-NAC was infused into the jugular vein (150 or 600 nmol over 60 min) it was rapidly and nearly quantitatively excreted as DNP-NAC into bile (42–36% of the dose) and urine (48–62% of dose). Some minor metabolites were detected in bile (<4%), with the major metabolite coeluting on HPLC with the DNP conjugate of glutathione (DNP-SG). Isolated rat livers perfused single pass with 3 μM DNP-NAC removed 72 ± 9% of this mercapturic acid from perfusate. This rapid DNP-NAC uptake was unaffected by sodium omission, or byl-cysteine,l-glutamate,l-cystine, or N-acetylated amino acids, but was decreased by inhibitors of hepatic sinusoidal organic anion transporters (oatp), indicating that DNP-NAC is a substrate for these transporters. The DNP-NAC removed from perfusate was promptly excreted into bile, eliciting a dose-dependent choleresis. DNP-NAC itself constituted ∼75% of the total dose recovered in bile, reaching a concentration of 9 mM when livers were perfused in a recirculating mode with an initial DNP-NAC concentration of 250 μM. Other biliary metabolites included DNP-SG, DNP-cysteinylglycine, and DNP-cysteine. DNP-SG was likely formed by a spontaneous retro-Michael reaction between glutathione and DNP-NAC. Subsequent degradation of DNP-SG by biliary γ-glutamyltranspeptidase and dipeptidase activities accounts for the cysteinylglycine and cysteine conjugates, respectively. These findings indicate the presence of efficient hepatic mechanisms for sinusoidal uptake and biliary excretion of circulating mercapturic acids in rat liver and demonstrate that the liver plays a role in their whole body elimination.

Glucuronides and mercapturates were examined as possible high-affinity substrates for a low-affinity ATP-dependent transport system for 2,4-dinitrophenyl S-glutathione (DNP-SG) in mouse L1210 cells. Initial inhibitor studies with inside-out vesicles revealed that the low-affinity transport of [3H]DNP-SG (Km 450 µM) exhibits a high sensitivity to N-acetyl 2,4-dinitrophenyl cysteine (NAc-DNP-Cys) (Ki 5.0 µM) and α-naphthyl β-D-glucuronide (naphthyl glucuronide) (Ki 8.5 µM). Direct transport measurements showed the presence of ATP-dependent uptake activities for NAc-DNP-[35S]Cys and naphthyl [14C] glucuronide, and Km values for half-maximal transport were comparable to the Ki values of these compounds for inhibition of [3H]DNP-SG transport. Transport of [3H]DNP-SG, NAc-DNP-[35S]Cys and naphthyl [14 C]glucuronide each showed the same sensitivity to various anions and anion conjugates. Inhibition was competitive and was most potent for bilirubin ditaurate, indoprofen, 4-biphenylacetic acid, 4-acridine 4β-D-glucuronide, N-acetyl leukotriene E4, 17β-oestradiol 3β-D-glucuronide and taurolithocholate 3-sulphate. Inside-out vesicles from human erythrocytes contain a comparable ATP-dependent transport system. These results show that NAc-DNP-Cys and naphthyl glucuronide are high-affinity substrates for a single system identified previously as a low-affinity transporter of DNP-SG. Substrate and inhibitor studies identify this system as a novel multispecific organic-anion transport system (MOAT4) that accommodates glucuronides and mercapturates and is distinct from other MOAT transporters. Human erythrocytes contain an additional ATP-dependent system for NAc-DNP-Cys (Km 33 µM) that does not transport monoglucuronides.

Abstract Distinct from intermolecular split G-quadruplex (Inter-SG), intramolecular split G-quadruplex (Intra-SG) which could be generated in a DNA spacer-inserted G-quadruplex strand has not been systematically explored. Not only is it essential for the purpose of simplicity of DNA-based bioanalytical applications, but also it will give us hints how to design split G-quadruplex-based system. Herein, comprehensive information is provided about influences of spacer length and split mode on the formation of Intra-SG, how to adjust its thermodynamic stability, and selection of optimal Intra-SG for bioanalysis. For instances, non-classical Intra-SG (e.g. 2:10, 4:8 and 5:7) displays lower stability than classical split strands (3:9, 6:6 and 9:3), which is closely related to integrity of consecutive guanine tract; as compared to regular Intra-SG structures, single-thymine capped ones have reduced melting temperature, providing an effective approach to adjustment of stability. It is believed that the disclosed rules in this study will contribute to the effective application of split G-quadruplex in the field of DNA technology in the future.

Skin is a major target of oxidative stress. Increasing evidence suggests that oxidative stress is the cause of melanocyte disappearance in vitiligo, which is an acquired pigmentary skin disorder characterized by patches of skin that have lost pigmentation. New herbal extracts with antioxidant activity are therefore being studied. 6-Shogaol (6-SG), an active compound from ginger, is capable of attenuating oxidative stress-induced ageing and neurotoxicity. Subsequently, to investigate whether 6-SG could protect melanocytes from oxidative stress, cultured human primary epidermal melanocytes (HEMn-MPs) were treated with hydrogen peroxide (H2O2) in the presence or absence of 6-SG. The 6-SG exhibited protective effects against H2O2-induced cell death by reducing oxidative stress. In addition, the 6-SG treatment activated the Nrf2-antioxidant response element signaling pathway by upregulating the mRNA expression of the antioxidant enzyme heme oxygenase 1 (HO-1), and protein expression of Nrf2, NAD(P)H: quinine oxidoreductase 1 (Nqo1), and HO-1. Furthermore, the 6-SG also displayed protective effects on melanocytes against Rhododendrol-induced oxidative stress. We concluded that 6-SG protects melanocytes against oxidative stress in vitro, and its protective effect is associated with the activation of the Nrf2-antioxidant response element signaling pathway. 6-SG, therefore, has potential for use in the prevention of melanocyte loss in the early stages of vitiligo or other pigmentary disorders.

Introduction: Nonalcoholic fatty liver disease (NAFLD) has an increasing incidence worldwide, reflecting the epidemics of obesity and metabolic syndrome. Data on knowledge, attitude and management by the Romanian gastroenterologists with regard to NAFLD are lacking. Methods: We assessed current diagnostic and treatment patterns of the management of NAFLD among 102 Romanian board certified gastroenterologists using a survey developed to collect information regarding participants’ clinical practice, diagnostic tools and usage of medication in patients with NAFLD. Results: 71.6% of the surveyed gastroenterologists (SG) had more than 5 years of gastroenterology practice, were university affiliated and 37.3% had predominant activity in hepatology (>60%). In Romania, 60.8% of the SG would diagnose NAFLD only if all other causes of liver disease were absent. All practitioners use a noninvasive tool for staging NAFLD, 45.1% use both serum markers and transient elastography. Liver biopsy is performed by 61.8% of the SG in the presence of a discordant result in two noninvasive methods of fibrosis evaluation. The most frequently prescribed drugs are: silymarin (88.2%), vitamin E (78.4%) and ursodeoxycholic acid (77.4%). Conclusion: The results of this survey suggest that clinical practice patterns among Romanian gastroenterologists for the diagnosis (mainly liver biopsy) and management of NAFLD frequently diverge from published practice guidelines. Nonalcoholic steatohepatitis is probably underdiagnosed, especially in patients with normal transaminase levels and is also overtreated with drugs that are not recommended in the guidelines. Abbreviations: ALT: alanine aminotransferase; BMI: body mass index; CLD: chronic liver disease; CAP: controlled attenuation parameter; ESLD: end-stage liver disease; HBV: hepatitis B virus; HCV: hepatitis C virus; HDV: hepatitis delta virus; HCC: hepatocellular carcinoma; HOMA: Homeostasis Model Assessment of Insulin Resistance; LC: liver cirrhosis; LT: liver transplantation; NAFLD: nonalcoholic fatty liver disease; NASH: non-alcoholic steatohepatitis; PCP: primary care practitioners: SG: surveyed gastroenterologists; UDCA: Ursodeoxycholic acid.

Disulfiram (DSF), an irreversible aldehyde dehydrogenase inhibitor, is being used in anticancer therapy, as its effects in humans are known and less adverse than conventional chemotherapy. We explored the potential mechanism behind the cytotoxicity of DSF-Cu+/Cu2+ complexes in oral epidermoid carcinoma meng-1 (OECM-1) and human gingival epithelial Smulow-Glickman (SG) cells. Exposure to CuCl2 or CuCl slightly but concentration-dependently decreased cell viability, while DSF-Cu+/Cu2+ induced cell death in OECM-1 cells, but not SG cells. DSF-Cu+/Cu2+ also increased the subG1 population and decreased the G1, S, and G2/M populations in OECM-1 cells, but not SG cells, and suppressed cell proliferation in both OECM-1 and SG cells. ALDH enzyme activity was inhibited by CuCl and DSF-Cu+/Cu2+ in SG cells, but not OECM-1 cells. ROS levels and cellular senescence were increased in DSF-Cu+/Cu2+-treated OECM-1 cells, whereas they were suppressed in SG cells. DSF-Cu+/Cu2+ induced mitochondrial fission in OECM-1 cells and reduced mitochondrial membrane potential. CuCl2 increased but DSF- Cu2+ impaired oxygen consumption rates and extracellular acidification rates in OECM-1 cells. CuCl2 stabilized HIF-1α expression under normoxia in OECM-1 cells, and complex with DSF enhanced that effect. Levels of c-Myc protein and its phosphorylation at Tyr58 and Ser62 were increased, while levels of the N-terminal truncated form (Myc-nick) were decreased in DSF-Cu+/Cu2-treated OECM-1 cells. These effects were all suppressed by pretreatment with the ROS scavenger NAC. Overexpression of c-Myc failed to induce HIF-1α expression. These findings provide novel insight into the potential application of DSF-CuCl2 complex as a repurposed agent for OSCC cancer therapy.

e11516 Background: Gene expression profiling identifies several breast cancer subtypes with different chemosensitivity and outcome. We used immunohistochemistry surrogate markers to classify tumors according to known breast cancer subtypes and examined the relationship between neoadjuvant chemotherapy (NAC) response and long-term end points, including distant disease-free survival (DDFS) and overall survival (OS). Methods: Review of clinical and pathological data from 271 breast cancer patients treated in our institution with NAC between 1991–2008. Breast cancer subtypes were defined as follows: Luminal A: Estrogen receptor positive (ER+) and/or progesterone peceptor positive (PR+), human epidermal growth factor receptor 2-positive (Her-2+); Luminal B: ER+ and/or PR+,Her-2+; Basal: ER-,PR-,Her-2-;HER2: ER-,PR-,Her-2 +. ER and PR positive scored as positive if tumor cell nuclear staining was at least 2+. Her-2 scored as positive if test DAKO scored 3+ or FISH ratio Her-2/CEP-17>2.2. Results: 121 (45.8%) patients were classifed as Luminal A; 22 (8.1%) as Luminal B; 75 (27.7%) as Basal, and 50 (18.5%) as HER2. Most patients (63%) received NAC based on anthracyclines and taxanes. 36% Her-2+ patients were treated with NAC based on trastuzumab, and 43% received trastuzumab as adjuvant treatment. Response and outcome results are shown below (Table). Independently from subtype, only four patients out of 58 with pCR relapsed. Among patients who didn´t achieved pathologic complete response (pCR), basal and HER2 subtypes have the worst outcome (4 years SG 80% and 72% respectevely) compared with Luminal A (4 years SG: 94.7%), (log-rank p=0.009). Conclusions: Basal and HER2 tumor despite high chemosensitivity have worst long term outcome, particularly if pCR is not achieved after NAC. [Table: see text] No significant financial relationships to disclose.

SaiGon –DongNai (SG-DN) river system plays a vital role in developing the southern key economic triangle including Ho Chi Minh City, DongNai and BinhDuong provinces. Saltwater intrusion results from many factors and complex movements in SG–DN river system, in the midst of which are sea level rise and water regulation of upstream reservoirs. Theses causes have gradually changed the hydraulic regimes of the river system. As a result, saltwater intrusion has become seriously. In this article, the authors used mathematical models to investigate the change of saltwater boundary of the river system before and after the impact of sea level rise and the regulatory regime of the reservoirs. The findings contributed to the predicted scenarios where sea level rise and salinity boundary could be controlled through the regulation of upstream reservoirs.

The aim of this study is to assess the biological accumulation of pesticide residues in aquatic organisms in Sai Gon - Dong Nai (SG-DN) estuary. Fish and mollusks were collected directly at the Soai Rap and Long Tau estuary of the SG-DN river system, washed and separated for taking the tissue. The organochlorine compounds from the tissue were then extracted and analyzed by gas chromatography system. The results showed that, the concentration of OCPs in Tegillarca granosa, Meretrix lyrata, Margaritifera auricularia and Bostrychus sinensis varied from 6.4 to 59.9 μg/kg, 7.2 to 322 μg/kg, 4.5 to 62.1 μg/kg and 2.9 to 114.3 μg/kg fresh weight, respectively. In general, molluscs species that accumulate more heptachlor, aldrin, endrin or dieldrin tend to accumulate less DDT (dichlorodiphenyltrichloroethane). Endosulfan was the most commonly found in three bivalve mollusks while DDTs (1.5–75.2 μg/kg, averaging 8.7 μg/kg weight) was the most popular OCPs in the fish (Bostrychus sinensis) samples. In DDT group, the p,p’-DDT metabolite accounted for the largest percentage, reaching 50% of total DDTs. In HCH (Hexachlorocyclohexane) group, β-HCH isomer was predominant in almost samples. Mgr đích ccc nghiên cch này là đánh giá tích lũy sinh hhn ccn thuu trr sâu trong các sinh vvn ssnh dưưh nưưh ttư khu vvu ccu sông Sài Gòn - ĐĐn Nai (SG-DN). Cá và nhuyyu thh đưưy llư trry tiiy iicửa sông Soài RRà và Lòng Tàu thuu hh thhu sông SG-DN, đư-D rư- ss-D và tách llc phhh mô thht. Các hhc chh clo hho cơ sau đó đưưđ tách chii và phân tích bbch hh thhh ssh ký khí. Kết quả nghiên cứu cho thấy, dư lượng OCPs tích tụ trong sò điệp (Tegillarca granosa), ngao (Meretrix lyrata), trai nước ngọt (Margaritifera auricularia) và cá bớp (Bostrychus sinensis) dao động tương ứng từ 6,4 đến 59,9 μg/kg, 7,2 đến 322 μg/kg, 4,5 đến 62,1 μg/kg và 2,9 đến 114,3 μg/kg trọng lượng tươi. Nhìn chung, loài nhuyễn thể nào tích lũy nhiều heptachlor, aldrin, endrin hoăc dieldrin có xu hướng tích lũy ít DDT (Dichlorodiphenyltrichloroethane). Endosunfan là nhóm thuốc được tìm thấy nhiều nhất trong các loài nhuyễn thể nghiên cứu. Ngược lại, nhóm DDT lại phổ biến ở cá Bostrychus sinensis (1,5–75,2 μg/kg, trung bình 8,7 μg/kg trọng lượng). Dạng p.p’-DDT trong nhóm DDT chiếm tỷ lệ cao nhất, tới 50% DDT tổng. Trong khi đó, đồng dạng β-HCH của nhóm HCH (Hexachlorocyclohexane) chiếm đa số trong hầu hết các mẫu.

Artykuł prezentuje refleksję nad potrzebą utrwalania pamięci społecznej o żołnierzach formacji granicznych Drugiej Rzeczypospolitej, którzy podczas kampanii polskiej w 1939 r. toczyli bohaterską walkę z wojskami niemieckimi i sowieckimi. Żołnierze oddziałów Korpusu Ochrony Pogranicza (KOP) i Straży Granicznej (SG), wchodząc do związków taktycznych, walczyli w obronie Wielunia, Helu, Węgierskiej Górki, Szacka i Wytyczna. Po wojnie historia wydarzeń z Września i pamięć o żołnierzach KOP i SG była ukrywana. Ważne fakty dotyczące zmagań i bojów żołnierzy zostały wyparte ze zbiorowej świadomości Polaków czy też celowo były pomijane. Dopiero po 1989 r., w nowej rzeczywistości polityczno-gospodarczej pojawiło się w społeczeństwie zainteresowanie pamięcią o żołnierzach KOP i SG, którzy w wojnie obronnej zginęli bądź przeżyli gehennę obozów jenieckich. Głównym celem poszukiwań badawczych było ukazanie miejsc walk obronnych żołnierzy formacji granicznych we wrześniu 1939 r. oraz przedstawienie w czasach obecnych działań jednostek samorządu, organizacji społecznych i organów Straży Granicznej Rzeczypospolitej Polskiej w przywracaniu i utrwalaniu pamięci w społeczeństwie polskim. Rozważania w artykule konkretyzują się na postawionej tezie, która brzmi: Utrwalanie i upamiętnianie w społeczeństwie polskim miejsc walk żołnierzy formacji granicznych we wrześniu 1939 r. stanowią trwałe wartości dla dziedzictwa narodu i państwa polskiego, które należy popularyzować w procesie wychowania i kształcenia w szczególności młodego pokolenia.

Abstract The composition of secondary cell wall determines the indust­rially relevant wood properties in tree species. Hence, its bioge­nesis is one of the most extensively studied developmental processes during wood formation. Presently, systems genetics approach is being applied to understand the biological net­works and their interactions operational during secondary development. Genome-scale analyses of secondary cell wall formation were documented and gene regulatory networks were reported in Arabidopsis, poplar, pine, spruce, rice and sug­arcane. In the present study, the expression patterns of 2651 transcripts representing different pathways governing secon­dary development was documented across four genotypes of E. tereticornis. A co-expression network was constructed with 330 nodes and 4512 edges and the degree ranged from 11 to 53. The network documented 75 (22 %) transcription factors with high degree of interaction. Secondary wall associated NAC domain transcription factor (SND2) was identified as the top hub transcript with 53 interactions. The present study revealed that functional homologs regulating secondary cell wall formation are conserved among angiosperms and gym­nosperms.

Abstract Cellular non-membranous RNA-granules, P-bodies (RNA processing bodies, PB) and stress granules (SG), are important components of the innate immune response to virus invasion. Mechanisms governing how a virus modulates PB formation remain elusive. Here, we report the important roles of GW182 and DDX6, but not Dicer, Ago2 and DCP1A, in PB formation, and that Kaposi’s sarcoma-associated herpesvirus (KSHV) lytic infection reduces PB formation through several specific interactions with viral RNA-binding protein ORF57. The wild-type ORF57, but not its N-terminal dysfunctional mutant, inhibits PB formation by interacting with the N-terminal GW-domain of GW182 and the N-terminal domain of Ago2, two major components of PB. KSHV ORF57 also induces nuclear Ago2 speckles. Homologous HSV-1 ICP27, but not EBV EB2, shares this conserved inhibitory function with KSHV ORF57. By using time-lapse confocal microscopy of HeLa cells co-expressing GFP-tagged GW182, we demonstrated that viral ORF57 inhibits primarily the scaffolding of GW182 at the initial stage of PB formation. Consistently, KSHV-infected iSLK/Bac16 cells with reduced GW182 expression produced far fewer PB and SG, but 100-fold higher titer of infectious KSHV virions when compared to cells with normal GW182 expression. Altogether, our data provide the first evidence that a DNA virus evades host innate immunity by encoding an RNA-binding protein that promotes its replication by blocking PB formation.

AbstractThe unambiguous identification of closely related species is useful for many practical purposes in forest tree species. For example, international laws require timber identification and the control of the origin of forest reproductive material. In this paper, we present a mitochondrial DNA marker which can be used to differentiate among groups of fir species (Abies spp.). Eight Mediterranean and one North American fir species (used as reference) were analysed at the fourth intron of the NAD subunit 5 gene. A total of six different haplotypes was identified, one in the American Abies concolor, the other five in Mediterranean species. Two different haplotypes were found each in the widespread A. alba and in A. cephalonica, one haplotype being shared among the two species. A single species specific haplotype was found in the near-eastern A. cilicica. The two southwestern species A. pinsapo and A. numidica shared one haplotype. The fifth haplotype was shared by all remaining eastern Mediterranean firs, A. cephalonica, A. bornmuelleriana, A. equi-troiani, and A. nordmanniana. Differences in haplotype sequences were mainly due to large insertions/deletions. Agarose gel electrophoresis thus provides a fast, cheap and reliable diagnosis method for species or species group identification.

ResumenObjetivos.El estudio de la concentración de N-acetil-aspartato (NAA) proporciona datos interesantes sobre las alteraciones corticales en las enfermedades psicóticas. Aunque la reducción de la concentración de NAA en la corteza cerebral es un resultado habitual en la esquizofrenia crónica, es menos constante en la enfermedad bipolar. Por otra parte, es probable que los valores de NAA puedan ser diferente en hombres y mujeres con esquizofrenia.Métodos.Mediante con espectroscopia por resonancia magnética protónica ('H MRS) calculamos las concentraciones de NAA en la corteza prefrontal de dos grupos de hombres, uno con esquizofrenia (n = 11) y otro con trastorno bipolar (n = 13) de similar duración y los comparamos con una muestra de hombres sanos que usamos como grupo control (n = 10). Además, comparamos el grado de desviaciones estructurales de los volúmenes normales de sustancia gris (SG) y líquido cefalorraquídeo (LCR) en la corteza prefrontal dorsolateral.Resultados.Comparados con los controles, los pacientes con esquizofrenia y trastorno bipolar tuvieron un cociente NAA/creatina más bajo, y sólo el grupo de pacientes con esquizofrenia mostró un aumento de LCR en la región prefrontal dorsolateral. No hubo ninguna diferencia entre los grupos en el cociente colina/creatina.Conclusiones.Estos datos sugieren que la disminución de NAA en la región prefrontal pueda ser similar en la esquizofrenia y en el trastorno bipolar, al menos, en estados crónicos. Sin embargo, el LCR cortical puede aumentar significativamente en pacientes con esquizofrenia.

Summary Clonal variations were observed amongst 12 clones of Dalbergia sissoo belonging to four states (U.P, Uttaranchal, Haryana and Rajasthan) of India, representing four different geographical zones in respect of ex vitro shoot coppicing ability and in vitro responses. Coppicing ability of shoot hedges of clones exhibited significant variation which ranged from average of 13.81 coppiced shoots (Clone 40, Uttar Pradesh) to 9.29 (Clone 64, Haryana). Comparative analysis of clones from different regions in respect to their coppicing ability revealed that clones from U.P had higher coppicing ability whereas those from Haryana proved to be least coppicers. Regional variations were also exhibited in the in vitro multiple bud induction ability on nodal explants excised from shoot hedges of clones (mean number of buds induced and percentage of cultures forming multiple buds). Regional as well as inter clonal variations were recorded in the shoot proliferation efficiency as well as rootability of microshoots of these clones as well as their optimal plant growth regulator requirements. BAP alone (2.5 μM) was sufficient for inducing multiple buds on cultured nodal explants of Uttaranchal and Uttar Pradesh region clones. On the contrary, clones from Rajasthan and Haryana had higher optimal requirement of BAP and in addition, they required media to be supplemented with auxin (NAA) for induction of multiple buds on explants. Correlation analysis between shoot coppicing ability of clones and in vitro performances of explants of these clones cultured on 2.5 μM BAP indicates a positive correlation. Observation lays credence to our view that these characters are genetically controlled and shoot coppicing can be used as a marker character in optimizing in vitro performance of clones. Using the information generated by this paper in vitro production of elite planting material can be maximized by ameliorating plant growth regulator requirement in the medium.

This study aimed to evaluate distribution of selected heavy metals (Cu, Zn, Pb, Cr and Cd) in clams Meretrixlyrata (clam), suspended particulate matter (SPM), water and sediment in the downstream area of Saigon – Dong Nai (SG-DN) River. During March to September 2015, the contamination of those metals at four sampling sites from fresh water to brackish water zone and Meretrix Lyrata clams, which were cultured at many clam farms at Can Thanh beach at Can Gio District, were monitored. The concentrations of metals in clam samples were also determined at a comparative sampling site at Tan Thanh beach (Tien Giang province). Generally, the order of metal concentrations in all environmental components along the SG-DN River was Zn>Cu>Cr>Pb>Cd while the metal concentrations in different environmental components at Can Thanh area were in different orders. According to the results, the increasing tendency of only Cu, Zn and Cd concentrations in SPM and sediment from river upstream to estuary were found. All trace metal concentrations in clam samples were higher than in water and smaller than in sediment and SPM at Can Thanh. Only Cr concentrations in medium and small clam samples had positive significant correlations with those in sediment and SPM (medium size only). In comparison with concentrations of trace metals in water, sediment, SPM and clams at Tan Thanh, those at Can Thanh were higher.

A U(H)PLC–MS/MS method is described for the analysis of acetaminophen and its sulphate, glucuronide, glutathione, cysteinyl and N-acetylcysteinyl metabolites in plasma using stable isotope-labeled internal standards. P-Aminophenol glucuronide and 3-methoxyacetaminophen were monitored and semi-quantified using external standards. The assay takes 7.5 min/sample, requires only 5 μl of plasma and involves minimal sample preparation. The method was validated for rat plasma and cross validated for human and pig plasma and mouse serum. LOQ in plasma for these analytes were 0.44 μg/ml (APAP-C), 0.58 μg/ml (APAP-SG), 0.84 μg/ml (APAP-NAC), 2.75 μg/ml (APAP-S), 3.00 μg/ml (APAP-G) and 16 μg/ml (APAP). Application of the method is illustrated by the analysis of plasma following oral administration of APAP to male Han Wistar rats.

A polymerase chain reaction (PCR)-based method for identifying the S-alleles in the Asian pear [Pyrus pyrifolia (Burm) Nak.] was applied to apple (Malus ×domestica Borkh.) cultivars. With minor modifications in one of the primers, the fragments from S-genes (S-RNases) with introns were amplified from total DNA of apple cultivars possessing S2-, S3-, S5-, S7-(=Sd-), S9-(=Sc-), Sf- and Sg-allele genotypes. S-genes within S24-(=Sh-) and S26-alleles were also amplified. The PCR amplification step of this method appears to be useful for preliminary investigation of apple S-genotypes, especially for species or cultivars of unknown origin or history. Using the primers, which are a part of a new S-allele, the Se-allele encoding Se-RNase with an intron in the Se-allele was amplified. We cloned the cDNA of Se-RNase, and developed a PCR-restriction fragment length polymorphism (RFLP) analysis method for Se-allele identification. S-allele genotypes of seven apple cultivars were investigated.

Abstract Cells limit energy-consuming mRNA translation during stress to maintain metabolic homeostasis. Sequestration of mRNAs by RNA binding proteins (RBPs) into RNA granules reduces their translation, but it remains unclear whether RBPs also function in partitioning of specific transcripts to polysomes (PSs) to guide selective translation and stress adaptation in cancer. To study transcript partitioning under cell stress, we catalogued mRNAs enriched in prostate carcinoma PC-3 cell PSs, as defined by polysome fractionation and RNA sequencing (RNAseq), and compared them to mRNAs complexed with the known SG-nucleator protein, G3BP1, as defined by spatially-restricted enzymatic tagging and RNAseq. By comparing these compartments before and after short-term arsenite-induced oxidative stress, we identified three major categories of transcripts, namely those that were G3BP1-associated and PS-depleted, G3BP1-dissociated and PS-enriched, and G3BP1-associated but also PS-enriched. Oxidative stress profoundly altered the partitioning of transcripts between these compartments. Under arsenite stress, G3BP1-associated and PS-depleted transcripts correlated with reduced expression of encoded mitochondrial proteins, PS-enriched transcripts that disassociated from G3BP1 encoded cell cycle and cytoprotective proteins whose expression increased, while transcripts that were both G3BP1-associated and PS-enriched encoded proteins involved in diverse stress response pathways. Therefore, G3BP1 guides transcript partitioning to reprogram mRNA translation and support stress adaptation.

Sulfoquinovose (SQ; 6-deoxy-6-sulfoglucose) is the polar head group of the plant sulfolipid SQ-diacylglycerol, and SQ comprises a major proportion of the organosulfur in nature, where it is degraded by bacteria. A first degradation pathway for SQ has been demonstrated recently, a “sulfoglycolytic” pathway, in addition to the classical glycolytic (Embden–Meyerhof) pathway in Escherichia coli K-12; half of the carbon of SQ is abstracted as dihydroxyacetonephosphate (DHAP) and used for growth, whereas a C3-organosulfonate, 2,3-dihydroxypropane sulfonate (DHPS), is excreted. The environmental isolate Pseudomonas putida SQ1 is also able to use SQ for growth, and excretes a different C3-organosulfonate, 3-sulfolactate (SL). In this study, we revealed the catabolic pathway for SQ in P. putida SQ1 through differential proteomics and transcriptional analyses, by in vitro reconstitution of the complete pathway by five heterologously produced enzymes, and by identification of all four organosulfonate intermediates. The pathway follows a reaction sequence analogous to the Entner–Doudoroff pathway for glucose-6-phosphate: It involves an NAD+-dependent SQ dehydrogenase, 6-deoxy-6-sulfogluconolactone (SGL) lactonase, 6-deoxy-6-sulfogluconate (SG) dehydratase, and 2-keto-3,6-dideoxy-6-sulfogluconate (KDSG) aldolase. The aldolase reaction yields pyruvate, which supports growth of P. putida, and 3-sulfolactaldehyde (SLA), which is oxidized to SL by an NAD(P)+-dependent SLA dehydrogenase. All five enzymes are encoded in a single gene cluster that includes, for example, genes for transport and regulation. Homologous gene clusters were found in genomes of other P. putida strains, in other gamma-Proteobacteria, and in beta- and alpha-Proteobacteria, for example, in genomes of Enterobacteria, Vibrio, and Halomonas species, and in typical soil bacteria, such as Burkholderia, Herbaspirillum, and Rhizobium.

Abstract Introduction Falls in the hospital is common. Morse Fall Scale was introduced in 2013 to Hospital Kula Lumpur as a tool for risk assessment in order that prevention strategies could be instituted in accordance to the falls risk. However, the rate of falls was on the rise in the last 5 years despite the use of the tool. The concern was that there is a lack of understanding in the use of the tool or that the scoring was not performed correctly by the nurses. Method A validated structured questionnaire regarding the knowledge of Morse Fall Scale was distributed to the registered nurse of the Medical Department Hospital Kuala Lumpur. Results 209 responses to the questionnaire were collected. The average correct answers were 7 points. Almost a quarter of the nurses had less than 5 correct answers. 50% of this group of nurses has less than 5 years of working experience; most of them only had a diploma and were working in the active medical wards. 17% had full scores, in which 92 % of them had more than 5 years’ experience and had higher nursing qualifications. Overall, the nurses with longer working experience scored 1 point higher than those with a diploma. However, there is no difference in the average score with regards to their place of work, either in clinic or ward. The highest scoring (97.6%) question was the question regarding the purpose of Morse Falls Scale. The least correctly answered (41.6 %) was the question regarding the number of categories in the Morse Falls Scale. Conclusion The nurses with more experience understood the use of the scoring and usage of the Morse Falls Scale better. Generally, with an average score of only 7 out of 10, may reflect an inadequacy in the understanding in falls prevention. References 1. SG Lim, SW Yam. The level of knowledge and competency in the use of the Morse Fall Scale as an assessment tool in the prevention of patient falls, IeJSME, 2016, 10(3): 14-23 2. Cruza S, AL Carvalho P, Barbosa BL. Morse fall scale user’s manual: Quality in supervision and in nursing practice. Procedia - Social and Behavioral Sciences 2015; 171: 334–9. 3. Enein NAE, Ghany ASAE, Zaghloul AA. Knowledge and performance among nurses before and after a training programme on patient falls. Open Journal of Nursing 2012; 2: 358–64.

Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans ‘Alba’ with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3′ region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three ‘Alba’ in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of ‘Alba’ by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.

Abstract Patients with “A-β+” Ketosis-Prone Diabetes (KPD) develop diabetic ketoacidosis (DKA) despite lacking islet autoantibodies and a phenotype of T1D, have good beta cell function and can come off insulin therapy 4–8 weeks after the DKA episode. When near-normoglycemic and stable on metformin, they have accelerated BCAA catabolism which promotes ketogenesis (Patel SG et al, Diabetes 2013). Here we measured BCAAs, their metabolites and acylcarnitine esters (C5,C3) in blood samples obtained from adults with DKA (N=74) compared to those with non-ketotic hyperglycemic crisis (N=21) at the time of acute presentation to the emergency center, and to healthy controls (N=17). Of the DKA patients, 53 were classified as likely A-β+ KPD based on absence of GAD65Ab and C-peptide levels or clinical features, and the 21 patients with non-ketotic hyperglycemia were classified as T2D. Serum concentrations of leucine, isoleucine and valine and their respective branch chain keto acids (BCKA) were higher (p&lt;0.05) in KPD patients compared to T2D and control. The ratio of each BCKA to its precursor BCAA was calculated as an index of its rate of transamination. Serum KIC/Leu, KMV/Ile and KIV/Val were significantly lower (p&lt;0.05) in KPD compared to T2D. The ratio of each acylcarnitine to its precursor BCKA was calculated as an index of its rate of entry and metabolism within mitochondria. Serum C5/KIC, C5/KMV and C5/KIC+KMV were lower (p&lt;0.05) in KPD patients compared to T2D patients. Serum C3/KIV, C3/KMV and C3/KIV+KMV were significantly lower (p&lt;0.05) in KPD patients compared to controls. Since KIC can be converted to acetoacetate and then reduced to β-hydroxybutyrate (BHOB), and KIC and KMV can be metabolized to acetyl CoA, the ratios of KIC+KMV/C2 and KIC/BHOB were calculated as indicators of their relative conversion to acetyl CoA and acetoacetate respectively. KIC+KMV/C2 was significantly lower (p&lt;0.001) in KPD than T2D and control and KIC/BOHB was lower (p&lt;0.001) in KPD than T2D. Acetyl carnitine was markedly elevated in the KPD group, indicating accelerated production of acetyl CoA from free fatty acids. During acute DKA, KPD patients have higher serum BCAAs because their catabolism is decreased, due to slower rate of transamination in the cytosol by BCAA transaminase 1 (BCAT1) and slower rate of entry into mitochondria and metabolism to acetyl CoA and acetoacetate by BCAT2, BCKA dehydrogenase and other catabolic enzymes. This is diametrically opposite to their profile in the stable, near-normoglycemic state, when BCAA catabolism is accelerated. We propose that during acute DKA, accelerated flux of fatty acids to acetyl CoA diminishes carnitine and NAD+ availability for mitochondrial transport and metabolism of BCAA catabolites in KPD patients, whereas in the near-normoglycemic state they have heightened dependence on BCAA catabolism for energy production through acetyl CoA and ketogenesis.

Cette contribution illustre le cadre légal suisse de l’aide médicale au suicide et des conditions d’octroi de Natrium Pentobarbital (NaP) notamment au regard du CP, de la LStup, de la LPTh et de la LPMéd, ainsi que le cadre réglementaire suisse actuel. Elle se penche aussi sur les traits saillants des systèmes du Benelux en matière de suicide assisté et de soins palliatifs dans le but d’examiner le potentiel de développement du système actuel en Suisse.

Abstract In the absence of the scanning ribosomes that unwind mRNA coding sequences and 5′UTRs, mRNAs are likely to form secondary structures and intermolecular bridges. Intermolecular base pairing of non polysomal mRNAs is involved in stress granule (SG) assembly when the pool of mRNAs freed from ribosomes increases during cellular stress. Here, we unravel the structural mechanisms by which a major partner of dormant mRNAs, YB-1 (YBX1), unwinds mRNA secondary structures without ATP consumption by using its conserved cold-shock domain to destabilize RNA stem/loops and its unstructured C-terminal domain to secure RNA unwinding. At endogenous levels, YB-1 facilitates SG disassembly during arsenite stress recovery. In addition, overexpression of wild-type YB-1 and to a lesser extent unwinding-defective mutants inhibit SG assembly in HeLa cells. Through its mRNA-unwinding activity, YB-1 may thus inhibit SG assembly in cancer cells and package dormant mRNA in an unfolded state, thus preparing mRNAs for translation initiation.

Abstract Background Sigesbeckia glabrescens Makino (SG) is one of the important plant origins of Sigesbeckiae herba and has been widely used for the treatment of chronic inflammatory diseases in China. However, the underlying anti-inflammatory mechanism of SG is rarely investigated and reported. There are more than 40 kinds of chemical constituents in SG, but the action of the bioactive compounds of SG is still unclear. Therefore, we aimed to systemically investigate the mechanisms behind the anti-inflammatory properties of SG by combining in vitro and in silico investigations. Methods Cytotoxicity was measured using the 3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyltetrazolium bromide (MTT) and lactate dehydrogenase (LDH) assays. Nitric oxide (NO) release was detected using the Griess assay. The secretion of pro-inflammatory cytokines and the expression of relevant proteins were assessed using ELISA kits and Western blots, respectively. Molecular docking was performed and scored using AutoDock via a comparison with the molecular docking of N-acetyl-d-glucosamine (NAG). Results In lipopolysaccharides (LPS)-stimulated macrophages, SG significantly inhibited NO, MCP-1, and IL-6 secretion; iNOS expression; and NF-κB activation but did not significantly affect MAPK signalling (p38, ERK, and JNK). Moreover, the results from the molecular docking prediction suggested that over 10 compounds in SG could likely target TLR4, p105, and p65. Conclusions These findings suggest that the anti-inflammatory effects of SG are highly related to the inactivation of NF-κB. Moreover, this study provides a novel approach to investigate the effects of herbal medicine using combined in vitro and in silico investigations.

ABSTRACTHuman respiratory syncytial virus (RSV) is a major pediatric respiratory pathogen. The attachment (G) and fusion (F) glycoproteins are major neutralization and protective antigens. RSV G is expressed as membrane-anchored (mG) and -secreted (sG) forms, both containing a central fractalkine-like CX3C motif. The CX3C motif and sG are thought to interfere with host immune responses and have been suggested to be omitted from a vaccine. We used a chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) vector to express RSV wild-type (wt) G and modified forms, including sG alone, mG alone, mutants with ablated CX3C, and G with enhanced packaging into vector virions. In hamsters, these viruses replicated to similar titers. When assayed with a complement-enhanced neutralization assay in Vero cells, sG did not reduce the serum RSV- or PIV3-neutralizing antibody (NAb) responses, whereas ablating CX3C drastically reduced the RSV NAb response. Protective efficacy against RSV challenge was not reduced by sG but was strongly dependent on the CX3C motif. In ciliated human airway epithelial (HAE) cells, NAbs induced by wt G, but not by wt F, completely blocked RSV infection in the absence of added complement. This activity was dependent on the integrity of the CX3C motif. In hamsters, the rB/HPIV3 expressing wt G conferred better protection against RSV challenge than that expressing wt F. Codon optimization of the wt G further increased its immunogenicity and protective efficacy. This study showed that ablation of the CX3C motif or sG in an RSV vaccine, as has been suggested previously, would be ill advised.IMPORTANCEHuman RSV is the leading viral cause of severe pediatric respiratory illness. An RSV vaccine is not yet available. The RSV attachment protein G is an important protective and neutralization antigen. G contains a conserved fractalkine-like CX3C motif and is expressed in mG and sG forms. sG and the CX3C motif are thought to interfere with host immune responses, but this remains poorly characterized. Here, we used an attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) vector to express various modified forms of RSV G. We demonstrated that strong antibody and protective responses could be induced by G alone, and that this was highly dependent on the integrity of the CX3C motif. There was no evidence that sG or the CX3C motif impaired immune responses against RSV G or the rB/HPIV3 vector. rB/HPIV3 expressing wt RSV G provides a bivalent vaccine against RSV and HPIV3.

On the night of 31 August, 1888, Mary Ann ‘Polly’ Nichols was found murdered in Buck’s Row, her throat slashed and her body mutilated. She was followed by Annie Chapman on 8 September in the year of 29 Hanbury Street, Elizabeth Stride in Dutfield’s Yard and Catherine Eddowes in Mitre Square on 30 September, and finally Mary Jane Kelly in Miller’s Court, on 9 November. These five women, all prostitutes, were victims of an unknown assailant commonly referred to by the epithet ‘Jack the Ripper’, forming an official canon which excludes at least thirteen other cases around the same time. As the Ripper was never identified or caught, he has attained an almost supernatural status in London’s history and literature, immortalised alongside other iconic figures such as Sherlock Holmes. And his killing ground, the East End suburb of Whitechapel, has become notorious in its own right. In this article, I will discuss how Whitechapel developed as a Gothic location through the body of literature devoted to the Whitechapel murders of 1888, known as 'Ripperature'. I will begin by speaking to the turn of Gothic literature towards the idea of the city as a Gothic space, before arguing that Whitechapel's development into a Gothic location may be attributed to the threat of the Ripper and the literature which emerged during and after his crimes. As a working class slum with high rates of crime and poverty, Whitechapel already enjoyed an evil reputation in the London press. However, it was the presence of Jack that would make the suburb infamous into contemporary times. The Gothic Space of the City In the nineteenth century, there was a shift in the representation of space in Gothic literature. From the depiction of the wilderness and ancient buildings such as castles as essentially Gothic, there was a turn towards the idea of the city as a Gothic space. David Punter attributes this turn to Robert Louis Stevenson’s 1886 novel The Strange Case of Dr. Jekyll and Mr. Hyde. The wild landscape is no longer considered as dangerous as the savage city of London, and evil no longer confined only to those of working-class status (Punter 191). However, it has been argued by Lawrence Phillips and Anne Witchard that Charles Dickens may have been the first author to present London as a Gothic city, in particular his description of Seven Dials in Bell’s Life in London, 1837, where the anxiety and unease of the narrator is associated with place (11). Furthermore, Thomas de Quincey uses Gothic imagery in his descriptions of London in his 1821 book Confessions of an English Opium-Eater, calling the city a “vast centre of mystery” (217). This was followed in 1840 with Edgar Allen Poe’s story The Man of the Crowd, in which the narrator follows a stranger through the labyrinthine streets of London, experiencing its poorest and most dangerous areas. At the end of the story, Poe calls the stranger “the type and the genius of deep crime (...) He is the man of the crowd” (n. p). This association of crowds with crime is also used by Jack London in his book The People of the Abyss, published in 1905, where the author spent time living in the slums of the East End. Even William Blake could be considered to have used Gothic imagery in his description of the city in his poem London, written in 1794. The Gothic city became a recognisable and popular trope in the fin-de-siècle, or end-of-century Gothic literature, in the last few decades of the nineteenth century. This fin-de-siècle literature reflected the anxieties inherent in increasing urbanisation, wherein individuals lose their identity through their relationship with the city. Examples of fin-de-siècle Gothic literature include The Beetle by Richard Marsh, published in 1897, and Bram Stoker’s Dracula, published in the same year. Evil is no longer restricted to foreign countries in these stories, but infects familiar city streets with terror, in a technique that is described as ‘everyday Gothic’ (Paulden 245). The Gothic city “is constructed by man, and yet its labyrinthine alleys remain unknowable (...) evil is not externalized elsewhere, but rather literally exists within” (Woodford n.p). The London Press and Whitechapel Prior to the Ripper murders of 1888, Whitechapel had already been given an evil reputation in the London press, heavily influenced by W.T. Stead’s reports for The Pall Mall Gazette, entitled The Maiden Tribute of Modern Babylon, in 1885. In these reports, Stead revealed how women and children were being sold into prostitution in suburbs such as Whitechapel. Stead used extensive Gothic imagery in his writing, one of the most enduring being the image of London as a labyrinth with a monstrous Minotaur at its centre, swallowing up his helpless victims. Counter-narratives about Whitechapel do exist, an example being Henry Mayhew’s London Labour and the London Poor, who attempted to demystify the East End by walking the streets of Whitechapel and interviewing its inhabitants in the 1860’s. Another is Arthur G. Morrison, who in 1889 dismissed the graphic descriptions of Whitechapel by other reporters as amusing to those who actually knew the area as a commercially respectable place. However, the Ripper murders in the autumn of 1888 ensured that the Gothic image of the East End would become the dominant image in journalism and literature for centuries to come. Whitechapel was a working-class slum, associated with poverty and crime, and had a large Jewish and migrant population. Indeed the claim was made that “had Whitechapel not existed, according to the rationalist, then Jack the Ripper would not have marched against civilization” (Phillips 157). Whitechapel was known as London’s “heart of darkness (…) the ultimate threat and the ultimate mystery” (Ackroyd 679). Therefore, the reporters of the London press who visited Whitechapel during and immediately following the murders understandably imbued the suburb with a Gothic atmosphere in their articles. One such newspaper article, An Autumn Evening in Whitechapel, released in November of 1888, demonstrates these characteristics in its description of Whitechapel. The anonymous reporter, writing during the Ripper murders, describes the suburb as a terrible dark ocean in which there are human monsters, where a man might get a sense of what humanity can sink to in areas of poverty. This view was shared by many, including author Margaret Harkness, whose 1889 book In Darkest London described Whitechapel as a monstrous living entity, and as a place of vice and depravity. Gothic literary tropes were also already widely used in print media to describe murders and other crimes that happened in London, such as in the sensationalist newspaper The Illustrated Police News. An example of this is an illustration published in this newspaper after the murder of Mary Kelly, showing the woman letting the Ripper into her lodgings, with the caption ‘Opening the door to admit death’. Jack is depicted as a manifestation of Death itself, with a grinning skull for a head and clutching a doctor’s bag filled with surgical instruments with which to perform his crimes (Johnston n.p.). In the magazine Punch, Jack was depicted as a phantom, the ‘Nemesis of Neglect’, representing the poverty of the East End, floating down an alleyway with his knife looking for more victims. The Ripper murders were explained by London newspapers as “the product of a diseased environment where ‘neglected human refuse’ bred crime” (Walkowitz 194). Whitechapel became a Gothic space upon which civilisation projected their inadequacies and fears, as if “it had become a microcosm of London’s own dark life” (Ackroyd 678). And in the wake of Jack the Ripper, this writing of Whitechapel as a Gothic space would only continue, with the birth of ‘Ripperature’, the body of fictional and non-fiction literature devoted to the murders. The Birth of Ripperature: The Curse upon Mitre Square and Leather Apron John Francis Brewer wrote the first known text about the Ripper murders in October of 1888, a sensational horror monograph entitled The Curse upon Mitre Square. Brewer made use of well-known Gothic tropes, such as the trans-generational curse, the inclusion of a ghost and the setting of an old church for the murder of an innocent woman. Brewer blended fact and fiction, making the Whitechapel murderer the inheritor, or even perhaps the victim of an ancient curse that hung over Mitre Square, where the second murdered prostitute, Catherine Eddowes, had been found the month before. According to Brewer, the curse originated from the murder of a woman in 1530 by her brother, a ‘mad monk’, on the steps of the high altar of the Holy Trinity Church in Aldgate. The monk, Martin, committed suicide, realising what he had done, and his ghost now appears pointing to the place where the murder occurred, promising that other killings will follow. Whitechapel is written as both a cursed and haunted Gothic space in The Curse upon Mitre Square. Brewer’s description of the area reflected the contemporary public opinion, describing the Whitechapel Road as a “portal to the filth and squalor of the East” (66). However, Mitre Square is the former location of a monastery torn down by a corrupt politician; this place, which should have been holy ground, is cursed. Mitre Square’s atmosphere ensures the continuation of violent acts in the vicinity; indeed, it seems to exude a self-aware and malevolent force that results in the death of Catherine Eddowes centuries later. This idea of Whitechapel as somehow complicit in or even directing the acts of the Ripper will later become a popular trope of Ripperature. Brewer’s work was advertised in London on posters splashed with red, a reminder of the blood spilled by the Ripper’s victims only weeks earlier. It was also widely promoted by the media and reissued in New York in 1889. It is likely that a ‘suggestion effect’ took place during the telegraph-hastened, press-driven coverage of the Jack the Ripper story, including Brewer’s monograph, spreading the image of Gothic Whitechapel as fact to the world (Dimolianis 63). Samuel E. Hudson’s account of the Ripper murders differs in style from Brewer’s because of his attempt to engage critically with issues such as the failure of the police force to find the murderer and the true identity of Jack. His book Leather Apron; or, the Horrors of Whitechapel, London, was published in December of 1888. Hudson described the five murders canonically attributed to Jack, wrote an analysis of the police investigation that followed, and speculated as to the Ripper’s motivations. Despite his intention to examine the case objectively, Hudson writes Jack as a Gothic monster, an atavistic and savage creature prowling Whitechapel to satisfy his bloodlust. Jack is associated with several Gothic tropes in Hudson’s work, and described as different types of monsters. He is called: a “fiend bearing a charmed and supernatural existence,” a “human vampire”, an “incarnate monster” and even, like Brewer, the perpetrator of “ghoulish butchery” (Hudson 40). Hudson describes Whitechapel as “the worst place in London (...) with innumerable foul and pest-ridden alleys” (9). Whitechapel becomes implicated in the Ripper murders because of its previously established reputation as a crime-ridden slum. Poverty forced women into prostitution, meaning they were often out alone late at night, and its many courts and alleyways allowed the Ripper an easy escape from his pursuers after each murder (Warwick 560). The aspect of Whitechapel that Hudson emphasises the most is its darkness; “off the boulevard, away from the streaming gas-jets (...) the knave ran but slight chance of interruption” (40). Whitechapel is a place of shadows, its darkest places negotiated only by ‘fallen women’ and their clients, and Jack himself. Hudson’s casting of Jack as a vampire makes his preference for the night, and his ability to skilfully disembowel prostitutes and disappear without a trace, intelligible to his readers as the attributes of a Gothic monster. Significantly, Hudson’s London is personified as female, the same sex as the Ripper victims, evoking a sense of passive vulnerability against the acts of the masculine and predatory Jack, Hudson writing that “it was not until four Whitechapel women had perished (...) that London awoke to the startling fact that a monster was at work upon her streets” (8). The Complicity of Gothic Whitechapel in the Ripper Murders This seeming complicity of Whitechapel as a Gothic space in the Ripper murders, which Brewer and Hudson suggest in their work, can be seen to have influenced subsequent representations of Whitechapel in Ripperature. Whitechapel is no longer simply the location in which these terrible events take place; they happen because of Whitechapel itself, the space exerting a self-conscious malevolence and kinship with Jack. Historically, the murders forced Queen Victoria to call for redevelopment in Spitalfields, the improvement of living conditions for the working class, and for a better police force to patrol the East End to prevent similar crimes (Sugden 2). The fact that Jack was never captured “seemed only to confirm the impression that the bloodshed was created by the foul streets themselves: that the East End was the true Ripper,” (Ackroyd 678) using the murderer as a way to emerge into the public consciousness. In Ripperature, this idea was further developed by the now popular image of Jack “stalking the black alleyways [in] thick swirling fog” (Jones 15). This otherworldly fog seems to imply a mystical relationship between Jack and Whitechapel, shielding him from view and disorientating his victims. Whitechapel shares the guilt of the murders as a malevolent and essentially pagan space. The notion of Whitechapel as being inscribed with paganism and magic has become an enduring and popular trope of Ripperature. It relates to an obscure theory that drawing lines between the locations of the first four Ripper murders created Satanic and profane religious symbols, suggesting that they were predetermined locations for a black magic ritual (Odell 217). This theory was expanded upon most extensively in Alan Moore’s graphic novel From Hell, published in 1999. In From Hell, Jack connects several important historical and religious sites around London by drawing a pentacle on a map of the city. He explains the murders as a reinforcement of the pentacle’s “lines of power and meaning (...) this pentacle of sun gods, obelisks and rational male fire, within unconsciousness, the moon and womanhood are chained” (Moore 4.37). London becomes a ‘textbook’, a “literature of stone, of place-names and associations,” stretching back to the Romans and their pagan gods (Moore 4.9). Buck’s Row, the real location of the murder of Mary Ann Nichols, is pagan in origin; named for the deer that were sacrificed on the goddess Diana’s altars. However, Moore’s Whitechapel is also Hell itself, the result of Jack slipping further into insanity as the murders continue. From Hell is illustrated in black and white, which emphasises the shadows and darkness of Whitechapel. The buildings are indistinct scrawls of shadow, Jack often nothing more than a silhouette, forcing the reader to occupy the same “murky moral and spiritual darkness” that the Ripper does (Ferguson 58). Artist Eddie Campbell’s use of shade and shadow in his illustrations also contribute to the image of Whitechapel-as-Hell as a subterranean place. Therefore, in tracing the representations of Whitechapel in the London press and in Ripperature from 1888 onwards, the development of Whitechapel as a Gothic location becomes clear. From the geographical setting of the Ripper murders, Whitechapel has become a Gothic space, complicit in Jack’s work if not actively inspiring the murders. Whitechapel, although known to the public before the Ripper as a crime-ridden slum, developed into a Gothic space because of the murders, and continues to be associated with the Gothic in contemporary Ripperature as an uncanny and malevolent space “which seems to compel recognition as not of this earth" (Ackroyd 581). References Anonymous. “An Autumn Evening in Whitechapel.” Littell’s Living Age, 3 Nov. 1888. Anonymous. “The Nemesis of Neglect.” Punch, or the London Charivari, 29 Sep. 1888. Ackroyd, Peter. London: The Biography. Great Britain: Vintage, 2001. Brewer, John Francis. The Curse upon Mitre Square. London: Simpkin, Marshall and Co, 1888. De Quincey, Thomas. Confessions of an English Opium-Eater. Boston: Ticknor, Reed and Fields, 1850. Dimolianis, Spiro. Jack the Ripper and Black Magic: Victorian Conspiracy Theories, Secret Societies and the Supernatural Mystique of the Whitechapel Murders. North Carolina: McFarland and Co, 2011. Ferguson, Christine. “Victoria-Arcana and the Misogynistic Poetics of Resistance in Iain Sinclair’s White Chappell, Scarlet Tracings and Alan Moore’s From Hell.” Lit: Literature Interpretation Theory 20.1-2 (2009): 58. Harkness, Mary, In Darkest London. London: Hodder and Staughton, 1889. Hudson, Samuel E. Leather Apron; or, the Horrors of Whitechapel. London, Philadelphia, 1888. Johnstone, Lisa. “Rippercussions: Public Reactions to the Ripper Murders in the Victorian Press.” Casebook 15 July 2012. 18 Aug. 2014 ‹http://www.casebook.org/dissertations/rippercussions.html›. London, Jack. The People of the Abyss. New York: Lawrence Hill, 1905. Mayhew, Henry. London Labour and the London Poor, Volume 1. London: Griffin, Bohn and Co, 1861. Moore, Alan, Campbell, Eddie. From Hell: Being a Melodrama in Sixteen Parts. London: Knockabout Limited, 1999. Morrison, Arthur G. “Whitechapel.” The Palace Journal. 24 Apr. 1889. Odell, Robin. Ripperology: A Study of the World’s First Serial Killer and a Literary Phenomenon. Michigan: Sheridan Books, 2006. Paulden, Arthur. “Sensationalism and the City: An Explanation of the Ways in Which Locality Is Defined and Represented through Sensationalist Techniques in the Gothic Novels The Beetle and Dracula.” Innervate: Leading Undergraduate Work in English Studies 1 (2008-2009): 245. Phillips, Lawrence, and Anne Witchard. London Gothic: Place, Space and the Gothic Imagination. London: Continuum International, 2010. Poe, Edgar Allen. “The Man of the Crowd.” The Works of Edgar Allen Poe. Vol. 5. Raven ed. 15 July 2012. 18 Aug. 2014 ‹http://www.gutenberg.org/files/2151/2151-h/2151-h.htm›. Punter, David. A New Companion to the Gothic. Sussex: Blackwell Publishing, 2012. Stead, William Thomas. “The Maiden Tribute of Modern Babylon.” The Pall Mall Gazette, 6 July 1885. Sugden, Peter. The Complete History of Jack the Ripper. London: Robinson Publishing, 2002. Walkowitz, Judith R. City of Dreadful Delight: Narratives of Sexual Danger in Late-Victorian London, London: Virago, 1998. Woodford, Elizabeth. “Gothic City.” 15 July 2012. 18 Aug. 2014 ‹http://courses.nus.edu.au/sg/ellgohbh/gothickeywords.html›.