Journal articles: 'Mt-COI'

1

KALAWATE, APARNA SURESHCHANDRA, K. P. DINESH, and A. SHABNAM. "DNA barcoding unravels three new species and a subspecies of Olepa Watson, 1980 (Lepidoptera, Erebidae, Arctiinae) from India, with morphotypes." Journal of Insect Biodiversity 19, no. 2 (September 30, 2020): 44–60. http://dx.doi.org/10.12976/jib/2020.19.2.2.

Full text

Abstract:

The genus Olepa is distributed in Palearctic and Oriental regions with more species in India and Sri Lanka. In the recent studies, morphological variations within the group were well established, with couple of first set of mt COI DNA barcodes for at least three species. In the present account, three new species and a new subspecies are described from the northern Western Ghats region of Maharashtra based on mt COI DNA barcode studies. Due to high morphological divergence and complete genetic homogeneity on the mt COI DNA, four morphotypes under two species are reported. Morphological and genital characters of male and female are provided along with their respective species morphotypes for the first time under this genus from India. The genitalia and the habitus of male and female are illustrated. Preliminary phylogenetic tree based on the mt COI DNA sequences available in the GenBank for the genus with the sequences for the new species also provided and discussed. Key words: new taxa, morphotype, Maharashtra, DNA barcoding, mt COI gene

APA, Harvard, Vancouver, ISO, and other styles

2

Wallace, LaShanale, Sharifeh Mehrabi, Methode Bacanamwo, Xuebiao Yao, and Felix O. Aikhionbare. "Expression of mitochondrial genes MT-ND1, MT-ND6, MT-CYB, MT-COI, MT-ATP6, and 12S/MT-RNR1 in colorectal adenopolyps." Tumor Biology 37, no. 9 (June 22, 2016): 12465–75. http://dx.doi.org/10.1007/s13277-016-5101-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Fang, Yiliang, Jianqing Zhang, Rongquan Wu, Baohai Xue, Qianqian Qian, and Bo Gao. "Genetic Polymorphism Study on Aedes albopictus of Different Geographical Regions Based on DNA Barcoding." BioMed Research International 2018 (May 29, 2018): 1–10. http://dx.doi.org/10.1155/2018/1501430.

Full text

Abstract:

Aedes albopictus is a very important vector for pathogens of many infectious diseases including dengue fever. In this study, we explored the genetic polymorphism of Aedes albopictus strains in different geographical regions using DNA barcoding of mitochondrial COI (MT-COI) gene. We collected MT-COI sequence of 106 Aedes albopictus mosquitos from 6 provinces in China including Fujian, Guangdong, Hainan, Yunnan, and Taiwan. The length of the sequences is 709bp with the content of A+T (67.7%) greater than that of G+C (32.3%). We identified mutations in 90 (13.68%) loci, of which 57 (63.33%) are transitions, 28 (31.11%) are transversions, and 5 (5.56%) are hypervariable loci. In addition, we obtained 42 haplotypes, 4 (9.52%) of which are shared among different populations. The haplotype diversity of Aedes albopictus is 0.882 and nucleotide diversity is 0.01017. Moreover, the pedigree network diagram shows that most haplotypes are under parallel evolution, suggesting a local expansion of Aedes albopictus in history. Finally, the Neighbor-Joining tree of MT-COI haplotypes reveals a certain correlation between haplotype clusters and geographical distribution, and there are differences among Aedes albopictus in different geographical regions. In conclusion, DNA barcoding of MT-COI gene is an effective method to study the genetic structure of Aedes albopictus.

APA, Harvard, Vancouver, ISO, and other styles

4

Kalawate, Aparna Sureshchandra, Shital Pawara, A. Shabnam, and K.P. Dinesh. "DNA barcode reveals the occurrence of Palearctic Olepa schleini Witt et al., 2005 (Lepidoptera: Erebidae: Arctiinae) from peninsular India with morphological variations and a new subspecies." Journal of Threatened Taxa 12, no. 9 (June 26, 2020): 16143–52. http://dx.doi.org/10.11609/jott.5596.12.9.16143-16152.

Full text

Abstract:

The present study was taken up to report a new record of the tiger moth genus, Olepa Watson, 1980 from India along with the discovery of a new subspecies. Earlier the genus was thought to have restricted distribution range in South and South-East Asia until the report of O. schleini Witt, Müller, Kravchenko, Miller, Hausmann & Speidel from the Mediterranean Coastal Plain of Israel in 2005. The species identification and the new subspecies is proposed based on the combination of morphological studies, available literature comparisons, geographical distribution, DNA barcoding and its phylogeny. Morphological character crypticity and genital structure variations are well documented in the genus with ‘bio-species’ groups. DNA Barcoding data of mt COI has provided some resolution in sorting the problems of ‘bio-species’ groups of the genus in the past studies. In the present study, with the available mt DNA COI barcodes and newly generated barcodes genetic identity is confirmed for the species O. ricini, O. schleini, O. toulgoeti and Olepa schleini chandrai ssp. nov., with their phylogenetic relationships. Morphological variations within the O. schleini species complex are discussed with a new record of the species for India and a new subspecies description. With the first mt COI barcode phylogeny for the genus, comments are made on the taxonomic identity of the mt COI DNA barcodes available in the GenBank for the Olepa species from India.

APA, Harvard, Vancouver, ISO, and other styles

5

Pan, Zhao, Jia-Chong Duan, Qi Gao, and Daniel K. Young. "The Adult, Larva, and Pupa of a New Pseudopyrochroa (Coleoptera: Pyrochroidae: Pyrochroinae) from China, with Molecular Phylogenetic Inferences." Insects 12, no. 12 (December 4, 2021): 1089. http://dx.doi.org/10.3390/insects12121089.

Full text

Abstract:

A new species of Pseudopyrochroa Pic, 1906, P. reni Pan & Young, n. sp., is described from the western region of Mt. Qinling, China. Larvae, pupae, and adults were associated using molecular phylogenetic analyses based on mtDNA COI barcode sequences. All three stages are described and illustrated. Additionally, preliminary phylogenetic relationships among five genera and 14 species of Pyrochroidae, including Pseudopyrochroa, are hypothesized based on COI sequence data. The fauna of Pyrochroidae from the Mt. Qinling biodiversity conservation area is discussed.

APA, Harvard, Vancouver, ISO, and other styles

6

Kamal, Mohammad Mukhlis, Agus Alim Hakim, Nurlisa Alias Butet, Yulia Fitrianingsih, and Rika Astuti. "AUTENTIKASI SPESIES IKAN KERAPU BERDASARKAN MARKA GEN MT-COI DARI PERAIRAN PEUKAN BADA, ACEH." Jurnal Biologi Tropis 19, no. 2 (August 14, 2019): 116. http://dx.doi.org/10.29303/jbt.v19i2.1245.

Full text

Abstract:

Abstrak : Variasi bentuk dan pola pewarnaan tubuh ikan kerapu (Famili Serranidae) sangat variatif, sehingga pengenalan spesies secara morfologis sering tidak akurat. Penelitian ini bertujuan untuk mengautentikasi ikan kerapu dengan menggunakan marka gen COI. Contoh ikan kerapu yang diamati berjumlah 29 ekor yang dikumpulkan dari tiga tempat pendaratan ikan di Perairan Peukan Bada, Propinsi Aceh. Secara karakter morfologis, ikan kerapu tersebut teridentifikasi lebih dari 8 spesies. Untuk analisis DNA, sebanyak 30 mg daging sirip dari setiap ikan contoh diambil untuk dilakukan isolasi dan ekstraksi DNA, kemudian visualisasi elektroforesis dan fragmentasi DNA gen COI dengan metode PCR-sekuensing. Setelah diekstraksi, diperoleh 20 sampel DNA yang tervisualisasi dengan baik, yang dari jumlah tersebut terdapat 16 sampel dapat diamplifikasi. Hasilnya menunjukkan terdapat 6 spesies yang terautentikasi. Kelompok pertama adalah Variola albimarginata, Cephalopholis urodeta, dan C. sexmaculata dengan tingkat kemiripan ≥ 97%. Berikutnya C. boenak, Epinephelus merra, dan Scolopsis vosmeri tingkat kemiripannya ≤ 97%. Bila dibandingkan hasil autentikasi DNA, hasil penelitian menunjukkan bahwa 13 sampel atau > 80% tidak teridentifikasi dengan benar secara morfologis. Berdasarkan jarak genetik, pohon filogeni membentuk 2 clade antara Serranidae dan Nemipteridae. Hasil penelitian menunjukkan bahwa penggunaan marka gen COI sangat efektif untuk autentikasi spesies yang dapat dijadikan sebagai instrumen dalam pemanfaatan dan pengelolaan ikan kerapu.Kata kunci : kerapu, variasi morfologi, gen MT-COI, autentikasi.Abstract : The groupers (family Serranidae) show high variability both in body shapes and coloration leads to highly morphological-based misidentification. The research was aimed in autenthication of the grouper species using MT-COI gene. A total of 29 grouper fishes were collected from three fish landing sites of Peukan Bada, Aceh Province. These fishes were morphologically identified from which more than 8 species were obtained. A 30 mg of the fin meat of each sample was taken for DNA extraction, isolation, electrophoresis visualization, and DNA fragmentation of COI gene using PCR-sequenching. There were 20 DNA samples was clearly visualized of which 16 has been proceeded for amplification. The results showed that V. albimarginata, C. urodeta, and C. sexmaculata showed ≥ 97% similarity, whereas C. boenak, E. merra, dan S. vosmeri with ≤ 97% similarity. Based on phylogenetic tree analysis there was 2 clearly different clades separating family of Serranidae and Nemipteridae. The use of MT-COI gene was effective and accurate tool in species authentication which could be used as an instrument for utilization and management of the grouper species.Keywords : groupers, morphological variation, MT-COI gene, autenthication.

APA, Harvard, Vancouver, ISO, and other styles

7

Cieniewicz, Elizabeth, Victoria Poplaski, Melina Brunelli, Jason Dombroskie, and Marc Fuchs. "Two Distinct Genotypes of Spissistilus festinus (Say, 1830) (Hemiptera, Membracidae) in the United States Revealed by Phylogenetic and Morphological Analyses." Insects 11, no. 2 (January 23, 2020): 80. http://dx.doi.org/10.3390/insects11020080.

Full text

Abstract:

Spissistilus festinus (Say, 1830) (Hemiptera: Membracidae) is a frequent pest of leguminous crops in the Southern United States, and a vector of grapevine red blotch virus. There is currently no information on the genetic diversity of S. festinus. In this study, populations of S. festinus were collected in 2015–2017 from various crops and geographic locations in the United States, and fragments of the mitochondrial cytochrome C oxidase 1 (mt-COI) gene and the nuclear internal transcribed spacer 2 (ITS2) region were characterized by polymerase chain reaction and sequencing. Maximum-likelihood and Bayesian analyses of the mt-COI and ITS2 sequences yielded similar phylogenetic tree topologies, revealing two distinct genetic S. festinus lineages with all of the specimens from California comprising one phylogenetic clade, alongside a single GenBank entry from Arizona, and all specimens from the Southeastern United States comprising a statistically-supported distinct clade, regardless of host and year of collection. The mt-COI gene fragment showed up to 10.8% genetic distance between the two phylogenetic clades. These results suggest the existence of two genotypes within S. festinus in the United States. The only distinct morphological trait between the two genotypes was a less elevated pronotum in the representative specimens from California, compared to the representative specimens from the Southeastern United States. Since this phenotypic feature is inconspicuous, a diagnostic polymerase chain reaction targeting a variable region of the mt-COI fragment was developed to reliably distinguish between the specimens of the two genotypes of S. festinus and to facilitate their specific identification.

APA, Harvard, Vancouver, ISO, and other styles

8

Kurniawaty, Nia, Purnama Hidayat, and Aunu Rauf. "Characterization of Three Species of Thrips on Weeping Fig, Nutmeg, and Marine Seruni Plants Based on Mtcoi DNA Sequences." Biosaintifika: Journal of Biology & Biology Education 8, no. 2 (September 19, 2016): 185. http://dx.doi.org/10.15294/biosaintifika.v8i2.5448.

Full text

Abstract:

Thrips are widely reported as pests in vegetable crops. However, the existence of Phlaeothripidae members has a less concern in Indonesia. Phlaeothripidae is the only family of Tubulifera Suborder and some reports suggested that they had potential to be pests in several crops due to their ability to roll up and to make galls on leaves. The first step in pest management attempt is to identify the pest accurately and quickly, so the pest management can be on target and more efficient. One of the identification methods is the molecular identification using DNA barcoding techniques. This study aimed to characterize and to compare species thrips in banyan, nutmeg, and marine seruni based on their molecular characteristics. This research was conducted in Bogor and Kuningan. The process of molecular characterization consisteds of four steps DNA total extraction, amplification by using PCR, COI gene sequence, and data analysis. PCR programme was succesfully to amplified mtCOI gene fragment at 710 bp. The length of mtCOI gene of Gynaikothrips uzeli, Haplothrips ganglbaueri, and Pseudophilothrips ichini were 704, 686, and 702 bp dominated by A and T bases with nucleotide variation value of 27.8%. This results confirmed that molecular characterization using mtCOI gene mitochondrial had successfully supported the morphological data. How to CiteKurniawaty, N., Hidayat, P. & Rauf, A. (2016). Characterization of Three Species of Thrips on Banyan, Nutmeg, and Marine Seruni Plants Based on Coi Gene. Biosaintifika: Journal of Biology & Biology Education, 8(2), 185-192.

APA, Harvard, Vancouver, ISO, and other styles

9

Kholilah, Nenik, Norma Afiati, Subagiyo Subagiyo, and Retno Hartati. "Meta-analysis of Indonesian Octopus laqueus Kaneko & Kubodera 2005 (Cephalopoda: Octopodidae) using Mt-DNA COI as Genetic Marker." Jurnal Kelautan Tropis 24, no. 1 (February 12, 2021): 7–14. http://dx.doi.org/10.14710/jkt.v24i1.10190.

Full text

Abstract:

O. laqueus was first discovered not long ago in 2005 in the Ryuku Islands, Japan. Its geographical distribution and molecular identification are therefore still rarely. Nucleotide sequences based on mt-DNA COI for O. laqueus that have been uploaded in the GenBank until before this study was carried out were only six sequences. Since DNA barcoding of mt-DNA COI has some advantageous characteristics, this study aimed to analyse the genetic difference of Indonesian O. laqueus to the data available in the GenBank. Samples were collected in 2019 - 2020 from Karimunjawa (n=16) and Bangka-Belitung (n=2). The mt-DNA COI was extracted using 10% chelex methods, PCR amplified using Folmer’s primer and sequenced in Sanger methods. Pairwise alignment and genetic distance were carried out in MEGA-X, whereas the phylogenetic tree was reconstructed using Bayesian methods. BLAST identification resulted in 685 bp with a range of 92,07-99,24 percentages of identity. The genetic mean pair-wise distances within-clade were 0,002 and 0,006, whilst the distance between the clade was 0.0883. Combining the suggestion with the ITF current, it is concluded that O. laqueus taken from Karimunjawa raised from the same species as those in Malaysia (MN711655) and Japan (AB302176). Specimens from Bangka-Belitung were suggested came from different species, as they were separated into the second clade by 8.83%. One single sample from Japan (AB430543) which laid outside the two clades by 11.63%-11.38% was also suggested to represent a different species. Overall, this study opens to various further studies on O. laqueus using other loci of genetic markers.

APA, Harvard, Vancouver, ISO, and other styles

10

Beagley, C. Timothy, Ronald Okimoto, and David R. Wolstenholme. "The Mitochondrial Genome of the Sea Anemone Metridium senile (Cnidaria): Introns, a Paucity of tRNA Genes, and a Near-Standard Genetic Code." Genetics 148, no. 3 (March 1, 1998): 1091–108. http://dx.doi.org/10.1093/genetics/148.3.1091.

Full text

Abstract:

Abstract The circular, 17,443 nucleotide-pair mitochondrial (mt) DNA molecule of the sea anemone, Metridium senile (class Anthozoa, phylum Cnidaria) is presented. This molecule contains genes for 13 energy pathway proteins and two ribosomal (r) RNAs but, relative to other metazoan mtDNAs, has two unique features: only two transfer RNAs (tRNAf-Met and tRNATrp) are encoded, and the cytochrome c oxidase subunit I (COI) and NADH dehydrogenase subunit 5 (ND5) genes each include a group I intron. The COI intron encodes a putative homing endonuclease, and the ND5 intron contains the molecule's ND1 and ND3 genes. Most of the unusual characteristics of other metazoan mtDNAs are not found in M. senile mtDNA: unorthodox translation initiation codons and partial translation termination codons are absent, the use of TGA to specify tryptophan is the only genetic code modification, and both encoded tRNAs have primary and secondary structures closely resembling those of standard tRNAs. Also, with regard to size and secondary structure potential, the mt-s-rRNA and mt-l-rRNA have the least deviation from Escherichia coli 16S and 23S rRNAs of all known metazoan mt-rRNAs. These observations indicate that most of the genetic variations previously reported in metazoan mtDNAs developed after Cnidaria diverged from the common ancestral line of all other Metazoa.

APA, Harvard, Vancouver, ISO, and other styles

11

Beauchamp, Kate C., Tyler W. Beyett, Mariah W. Scott, and David T. Zanatta. "Detection of hybrid Pyganodon grandis and P. lacustris (Bivalvia: Unionidae) using F- and M-type mitochondrial DNA sequences and geometric morphometrics." Journal of Molluscan Studies 86, no. 3 (June 22, 2020): 233–39. http://dx.doi.org/10.1093/mollus/eyaa013.

Full text

Abstract:

ABSTRACT Pyganodon grandis and P. lacustris, widespread and common species in North America, are known to co-occur across parts of their distributions. These mussels are genetically distinguishable with a sequence divergence between 9% and 13% for the mitochondrial (mt) DNA barcoding region, cytochrome c oxidase subunit I (COI), which is well beyond thresholds for distinct species. The objectives of this study were to (1) confirm the presence of two genetically distinct species (P. grandis and P. lacustris) in Font Lake and Lake Geneserath on Beaver Island in northern Lake Michigan, (2) identify hybrids using mitogenotype mismatch and (3) compare species and populations morphometrically. Of the 212 specimens sequenced, 146 (68.9%) were found to be heteroplasmic, with successful amplifications of both maternally (F-type, from mantle tissue) and paternally (M-type, from gonad tissue) inherited mt DNA sequences. Mismatches in species identity of the F- and M-type COI sequences were found in 22 specimens (15.1% of heteroplasmic specimens), with these being considered putative hybrids. Geometric morphometric analyses of shell shape reliably differentiated specimens by species (identified using COI sequences) and between lakes, correctly assigning 97.4% of homoplasmic and heteroplasmic specimens with matching mitogenomes to both species and lake of origin. The shape of putative hybrids generally resembled those of the F-type mt DNA sequence that was recovered. This study confirms that hybridization does occur between sympatric Pyganodon species. Additionally, our results reemphasize the value of modern morphometric techniques for distinguishing among species and populations with overlapping morphological variability.

APA, Harvard, Vancouver, ISO, and other styles

12

Yudhistira, Amri, and dan Arisuryanti. "Preliminary findings of cryptic diversity of the giant tiger shrimp (Penaeus monodon Fabricius, 1798) in Indonesia inferred from COI mitochondrial DNA." Genetika 51, no. 1 (2019): 251–60. http://dx.doi.org/10.2298/gensr1901251y.

Full text

Abstract:

This study investigated genetic diversity of the giant tiger shrimp (Penaeus monodon), an economically important penaeid species in Indonesia, using 558 base pairs of the mitochondrial cytochrome c oxidase Subunit I (COI) gene. A total of 10 samples were collected from three populations throughout Indonesia and three samples were taken from hatchery. The mitochondrial COI results found high levels of genetic differentiation. From Bayesian tree building method there were two clades on phylogenetic tree with high posterior probability value 1.00. COI mt-DNA analyses revealed that there were six haplotypes in which four haplotypes in clade A and two haplotypes in clade B. Divergences of COI between two clades showed an average 6.9% (range=6.7%-7.6%), while genetic distance within clade A 0.2% (range=0-0.5%) and within clade B 0.3% (range=0-1.1%). Results from this study suggest the occurrence of two cryptic species in the Penaeus monodon from Indonesia.

APA, Harvard, Vancouver, ISO, and other styles

13

LI, DENGQING, HAO LIU, and XIN XU. "Three new species of the primitively segmented spiders from Mt Yuelu, Hunan, China (Mesothelae, Liphistiidae)." Zootaxa 4691, no. 2 (October 30, 2019): 139–52. http://dx.doi.org/10.11646/zootaxa.4691.2.3.

Full text

Abstract:

We diagnose and describe two Songthela and one Vinathela species of the primitively segmented spiders, Liphistiidae, as new to science based on morphological characters and molecular data: Songthela pyriformis sp. nov. (male, female), Songthela shuyuan sp. nov. (male, female), Vinathela nenglianggu sp. nov. (male, female), which were collected at Mt Yuelu in Changsha, Hunan Province, China. To facilitate future identification of our species, we also provide the GenBank accession numbers of the DNA barcode gene, cytochrome c oxidase subunit I (COI) for all type specimens and the evidence of genetic distances based on COI for three new species.

APA, Harvard, Vancouver, ISO, and other styles

14

Oliveira, J. A., B. A. Crispim, A. C. Banari, A. A. Egito, F. M. V. Junior, L. O. Seno, and A. V. Grisolia. "Segregação do MT-COI RFLP em ovinos de Mato Grosso do Sul, Brasil." Archivos de Zootecnia 65, no. 250 (June 11, 2016): 231–33. http://dx.doi.org/10.21071/az.v65i250.493.

Full text

Abstract:

Pesquisas em regiões do DNA mitocondrial de Ovis aries mostraram a existência de haplogrupos de origem asiática e européia. Assim o objetivo do presente estudo foi aplicar o teste molecular de PCR-RFLP do gene mitocondrial citocromo oxidase I com a enzima de restrição HinfI para caracterizar, em relação aos haplogrupos existentes, algumas raças de ovinos criadas no Estado do Mato Grosso do Sul. Foram analisadas amostras de DNA de 155 animais pertencentes a sete raças de ovinos. Dezesseis animais foram identificados como pertencendo ao haplogrupo asiático, representados pelas raças Ile de France (n=3), Dorper (n=2), White Dorper (n=9) e Suffolk (n=2). Os outros 139 animais foram identificados como haplogrupo europeu, representantes das raças Pantaneira (n=40), Brazilian Bergamácia (n=21), Ile de France (n=17), Dorper (n=17), White Dorper (n=6), Hampshire Down (n=20) e Suffolk (n=18). Os resultados indicaram que a maioria dos animais pertenciam ao haplogrupo europeu, evidenciando a origem europeia das raças criadas no Estado. A identificação da origem desses animais possibilita melhorar o manejo das populações localmente adaptadas visando sua conservação e o seu aproveitamento no Estado.

APA, Harvard, Vancouver, ISO, and other styles

15

Zhao, Xiaoling, Nan Wu, Qing Zhu, Uma Gaur, Ting Gu, and Diyan Li. "High-altitude adaptation of Tibetan chicken from MT-COI and ATP-6 perspective." Mitochondrial DNA Part A 27, no. 5 (February 19, 2015): 3280–88. http://dx.doi.org/10.3109/19401736.2015.1015006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Sonoda, Shoji, Jun Yamashita, Yoko Kohara, Yohei Izumi, Hideya Yoshida, and Takashi Enomoto. "Population survey of spiders using mt-DNA (COI) sequences in Japanese peach orchards." Applied Entomology and Zoology 46, no. 1 (December 3, 2010): 81–86. http://dx.doi.org/10.1007/s13355-010-0011-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Kalawate, Aparna S., A. Shabnam, and K.P. Dinesh. "First Indian DNA barcode record for the moth species Pygospila tyres (Cramer, 1780) (Lepidoptera: Crambidae: Spilomelinae) distributed in Asia and Australia." Journal of Threatened Taxa 14, no. 2 (February 26, 2022): 20637–42. http://dx.doi.org/10.11609/jott.6899.14.2.20637-20642.

Full text

Abstract:

The species Pygospila tyres was described from the Coromandel region of India about 240 years ago, accommodated in the family Crambidae having immense importance. The species is morphologically cryptic and is known to have 10 extant species under the genus. Earlier mt DNA Barcodes for the species were available from Pakistan, Korea, and Australia, here we report the first barcode of the species from the country of its type locality. Morphological details for the collections with the male and female genitalia are provided for the taxonomic identification. Identities of the mt COI DNA sequences for the genus in the GenBank are discussed.

APA, Harvard, Vancouver, ISO, and other styles

18

Sihotang, Maria A. E. D., Yola Eka Erwinda, Eniek Suwarni, and Erita Lusianti. "Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)." Eruditio : Indonesia Journal of Food and Drug Safety 1, no. 2 (November 30, 2021): 20–29. http://dx.doi.org/10.54384/eruditio.v1i2.82.

Full text

Abstract:

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR. Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

APA, Harvard, Vancouver, ISO, and other styles

19

Zhang, Xiao, Ding Yang, and Zehui Kang. "Net-Winged Midge Genus Blepharicera Macquart (Diptera: Blephariceridae) in China: The First DNA Barcode Database with Descriptions of Four New Species and Notes on Distribution." Insects 13, no. 9 (August 31, 2022): 794. http://dx.doi.org/10.3390/insects13090794.

Full text

Abstract:

Mitochondrial (mt) cytochrome c oxidase 1 (COI) gene is more and more widely used for DNA barcoding, which provides a rapid and timely identification as this technique is not limited by polymorphism, sex, and life stages and fundamentally complements traditional evolutionary taxonomy. The present study generated 33 mt COI sequences of seven Chinese Blepharicera Macquart, 1843 species with an average of 594 bp, which represent the first DNA barcode database for Chinese Blepharicera. Genetic distance analysis reveals that intraspecific distances in the genus are generally less than 1.7%, and interspecific distances range from 5.4% to 20.3%. Phylogenetic analysis shows that each species recovered in our analyses is separated from all neighboring species. Based on molecular and morphological data, four Blepharicera species from China, B. beishanica sp. nov., B. dushanzica sp. nov., B. nigra sp. nov. and B. xinjiangica sp. nov., are described and illustrated as new to science. Identification keys for adults and larvae of Chinese Blepharicera are also presented. Geographical analysis shows that Southwest China is the species' richest region. Our results will be useful in tackling taxonomic problems, understanding species distribution, and resolving nomenclature conflicts associated with Blepharicera species.

APA, Harvard, Vancouver, ISO, and other styles

20

Podnar, Martina, Nikola Tvrtković, Marijana Vuković, Fran Rebrina, Irena Grbac, and Christoph Hörweg. "Alpiscorpius liburnicus sp. n. with a note on the “Alpiscorpius croaticus group” (Scorpiones: Euscorpiidae) in Croatia." Natura Croatica 31, no. 2 (December 30, 2022): 265–82. http://dx.doi.org/10.20302/nc.2022.31.19.

Full text

Abstract:

Alpiscorpius liburnicus sp. n. is described from Krk Island, Croatia, as the first cave dwelling scorpion species in the genus. Clear differences from the genetically closest epigean species were found in metasomal morphometry. Its delineation is supported phylogenetically based on mitochondrial (COI and 16S rRNA) and nuclear (ITS1) markers. In the barcode fragment of the mitochondrial cytochrome oxidase subunit 1 gene (COI), the uncorrected pairwise genetic distances to other known taxa in “Alpiscorpius croaticus group” range between 4.2 and 4.8 %. The first molecular evidence of the species’ presence on the coastal part of Mt. Velebit implies its potential distribution in the whole of the eastern Adriatic coastal area, roughly from Rijeka City area to the source of the Zrmanja River. The new species is sympatric with common epigean taxa of the “Euscorpius tergestinus group” and with the synanthropic E. italicus in Mediterranean habitats. The phylogenetic relationships within the “A. croaticus group” are estimated. Localities of epigean A. croaticus are restricted to the continental side of southern and southeastern parts of Mt. Velebit. There it is sympatric and syntopic with the smaller A. omega in karst beech forests, with an extrazonal enclave in the Velika Paklenica canyon area on the southern slopes of the mountain. The third taxon in the group is known at the moment from a single locality in the middle part of Mt. Velebit, where it is also syntopic with A. omega in a beech forest near limestone cliffs.

APA, Harvard, Vancouver, ISO, and other styles

21

Saranga, Rudi, Heru Santoso, Nova Tumanduk, Hetty Ondang, and Jul Manohas. "KAJIAN MORFOMETRI DAN MOLEKULER IKAN SELAR MATA BESAR DAN SELAR MATA KECIL YANG DI DARATKAN DI PELABUHAN PERIKANAN SAMUDERA BITUNG." JURNAL BLUEFIN FISHERIES 1, no. 1 (August 8, 2019): 23. http://dx.doi.org/10.15578/jbf.v1i1.1.

Full text

Abstract:

Abstract–Bigeye scad resources which landed at Bitung Oceanic Fishing Port is one of important fish capture in Bitung because its have economic value and second ratings after scad mackerel in product volume. Bigeye scad fish capture was often mixed with another species in fisherman fish capture, so it making difficult to distinguish clearly.The objective of this research are : 1) to indentification bigeye scad in morfology, 2) to analyzemolecular bigeye scad, (3) to evidence the bigeye scad are the same species or not.Sample for the study were collectedfish landing site at Bitung Ocean Fishing Port from December 2015 to March 2016. The methodology of the research is survey research. For data analysis using truss morfometrics, principal component analysis (PCA) and mtDNA region COI. The result of this research indicated that based on the analysis of morphometric characters and PCA, bigeye scad and smalleye scad have differences in morphology, but result of mt DNA-COI analysis indicated those species are the same as Selar crumenophthalmus with similarity value 99,67%. Keywords: bigeye scad, morfometric, mtDNA-COI

APA, Harvard, Vancouver, ISO, and other styles

22

Zittra, Carina, Günther Wöss, Lara Van der Vloet, Karin Bakran-Lebl, Bita Shahi Barogh, Peter Sehnal, and Hans-Peter Fuehrer. "Barcoding of the Genus Culicoides (Diptera: Ceratopogonidae) in Austria—An Update of the Species Inventory Including the First Records of Three Species in Austria." Pathogens 9, no. 5 (May 23, 2020): 406. http://dx.doi.org/10.3390/pathogens9050406.

Full text

Abstract:

Ceratopogonidae are small nematoceran Diptera with a worldwide distribution, consisting of more than 5400 described species, divided into 125 genera. The genus Culicoides is known to comprise hematophagous vectors of medical and veterinary importance. Diseases transmitted by Culicoides spp. Such as African horse sickness virus, Bluetongue virus, equine encephalitis virus (Reoviridae) and Schmallenberg virus (Bunyaviridae) affect large parts of Europe and are strongly linked to the spread and abundance of its vectors. However, Culicoides surveillance measures are not implemented regularly nor in the whole of Austria. In this study, 142 morphologically identified individuals were chosen for molecular analyses (barcoding) of the mitochondrial cytochrome c oxidase subunit I gene (mt COI). Molecular analyses mostly supported previous morphologic identification. Mismatches between results of molecular and morphologic analysis revealed three new Culicoides species in Austria, Culicoides gornostaevae Mirzaeva, 1984, which is a member of the Obsoletus group, C. griseidorsum Kieffer, 1918 and C. pallidicornis Kieffer, 1919 as well as possible cryptic species. We present here the first Austrian barcodes of the mt COI region of 26 Culicoides species and conclude that barcoding is a reliable tool with which to support morphologic analysis, especially with regard to the difficult to identify females of the medically and economically important genus Culicoides.

APA, Harvard, Vancouver, ISO, and other styles

23

Krishnega, M., S. Upasna, and S. Mohankumar. "Assessment of genetic diversity of Callosobruchus maculatus populations of Tamil Nadu through mt-COI maker." Journal of Entomology and Zoology Studies 9, no. 1 (January 1, 2021): 766–70. http://dx.doi.org/10.22271/j.ento.2021.v9.i1k.8237.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

Singh, Rajnish Kumar, Sunil Kumar Saini, Gopinath Prakasam, Ponnuusamy Kalairasan, and Rameshwar N. K. Bamezai. "Role of ectopically expressed mtDNA encoded cytochrome c oxidase subunit I (MT-COI) in tumorigenesis." Mitochondrion 49 (November 2019): 56–65. http://dx.doi.org/10.1016/j.mito.2019.07.002.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Palanisamy, Satheesh Kumar, Chinnamani Prasanna Kumar, Purushothaman Paramasivam, and Umamaheswari Sundaresan. "DNA barcoding of horn snail Telescopium telescopium (Linnaeus C, 1758) using mt-COI gene sequences." Regional Studies in Marine Science 35 (March 2020): 101109. http://dx.doi.org/10.1016/j.rsma.2020.101109.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

CATALANO, SARAH R., IAN D. WHITTINGTON, STEPHEN C. DONNELLAN, TERRY BERTOZZI, and BRONWYN M. GILLANDERS. "First comparative insight into the architecture ofCOImitochondrial minicircle molecules of dicyemids reveals marked inter-species variation." Parasitology 142, no. 8 (April 16, 2015): 1066–79. http://dx.doi.org/10.1017/s0031182015000384.

Full text

Abstract:

SUMMARYDicyemids, poorly known parasites of benthic cephalopods, are one of the few phyla in which mitochondrial (mt) genome architecture departs from the typical ~16 kb circular metazoan genome. In addition to a putative circular genome, a series of mt minicircles that each comprises the mt encoded units (I–III) of the cytochromecoxidase complex have been reported. Whether the structure of the mt minicircles is a consistent feature among dicyemid species is unknown. Here we analyse the complete cytochromecoxidase subunit I (COI) minicircle molecule, containing theCOIgene and an associated non-coding region (NCR), for ten dicyemid species, allowing for first time comparisons between species of minicircle architecture, NCR function and inferences of minicircle replication. Divergence inCOInucleotide sequences between dicyemid species was high (average net divergence = 31·6%) while within species diversity was lower (average net divergence = 0·2%). The NCR and putative 5′ section of theCOIgene were highly divergent between dicyemid species (average net nucleotide divergence of putative 5′COIsection = 61·1%). No tRNA genes were found in the NCR, although palindrome sequences with the potential to form stem-loop structures were identified in some species, which may play a role in transcription or other biological processes.

APA, Harvard, Vancouver, ISO, and other styles

27

Vitorino, Carla A., Renata C. C. Oliveira, Vladimir P. Margarido, and Paulo C. Venere. "Genetic diversity of Arapaima gigas (Schinz, 1822) (Osteoglossiformes: Arapaimidae) in the Araguaia-Tocantins basin estimated by ISSR marker." Neotropical Ichthyology 13, no. 3 (September 2015): 557–68. http://dx.doi.org/10.1590/1982-0224-20150037.

Full text

Abstract:

The genetic diversity of the specimens of four natural populations of Arapaima from Araguaia-Tocantins basin was assessed within and among these stocks, using five primers for ISSR. COI (cytochrome c oxidase subunit I ) partial sequences confirmed that the specimens belongs to Arapaima gigas . The ISSR provided 168 loci, of which 165 were polymorphic. However, the number of loci for each population and expected heterozygosity values were low. AMOVA showed 52.63% intra-population variation and 47.37% inter-population variation. The F ST was high among all populations (F ST ≥ 0.25), however, the cluster analysis (PCoA) and Bayesian inference showed three major groups: Araguaiana-MT + São Félix do Araguaia-MT, Novo Santo Antônio-MT and Itupiranga-PA. The genetic distance was not correlated with geographical distance. The ISSR marker revealed that the populations of the Araguaia-Tocantins are structured and have a low genetic diversity. These are the first data from a population analysis using molecular markers for A. gigas of Araguaia-Tocantins basins and may be used to define the best management strategies and conservation projects for this species.

APA, Harvard, Vancouver, ISO, and other styles

28

Barloy, Jean, Florin Prunar, Stephane Dréano, Silvia Prunar, and Frédérique Barloy-Hubler. "Nebria Species (Subfamily Nebriinae, Family: Carabidae) from the Romanian Carpathians. Morphological and Molecular Data." Advanced Research in Life Sciences 1, no. 1 (December 20, 2017): 90–103. http://dx.doi.org/10.1515/arls-2017-0016.

Full text

Abstract:

Abstract Among the ten species of the Nebria genus, present in the Romanian Carpathians, seven are the object of morphological, geographical distribution and molecular biological studies: Nebria (Eunebria) jockischi hoepfneri Dejean, 1826, Nebria (Boreonebria) heegeri Dejean, 1826, Nebria (Boreonebria) gyllenhali Schönherr, 1806, Nebria (Alpaeonebria) reichei Dejean, 1826, Nebria (Alpaeonebria) reitteri Rybinsky, 1902, Nebria (Alpaeonebria) bissenica Bielz, 1887, Nebria (Nebria) transsylvanica Germar, 1824, Nebria (Nebria) femoralis alpigrada Csiki 1905), collected from the Maramureș Mt., Rodnei Mt., Parâng Mt., Rarău Mt., Făgăraș Mt., Cozia Mt., Bucegi Mt., Retezat Mt., Muntele Mic and Semenic Mt. The morphological description exploits the body size, the elytral reflection, the colour of the appendages and the legs, the shape of the first antennary segment, its chaetotaxy and that of the submentum, the shape and size of the elytra and alae, the position of the bristles on the ventrites 4-5-6. The shape of the first antennary segment and its chaetotaxy appear as more discriminating criteria, but supposes the integrity of the bristles. The identification is sometimes malaise due to the fragility of the bristles (first antennomere, submentum). Nebria (Alpaeonebria) reichei Dejean, 1826 has a variable chaetotaxy of antenna, 1 to 3 bristles on the first antennomere. The individuals with yellow appendages and legs provided with 2 unequal length can be confused with transsylvanica. They are distinguished by the triangular shape of the aileron (S-shaped in transsylvanica). Molecular data are given for the first time on Carpathian Nebria. The mitochondrial markers (COI I, cyt b) clearly identify the species studied and confirm that alpigrada does not belong to transsylvanica. The results show an infraspecific variability of geographic and altitudinal origin in jockischi one of the most widespread species (gyllenhali, jockischi, reichei).

APA, Harvard, Vancouver, ISO, and other styles

29

Sudiarta, I. Putu, Dwi Martiningsia, and I. Nyoman Wijaya. "MOLECULAR IDENTIFICATION OF EXOTIC FRUIT FLY Bactrocera occipitalis (DIPTERA: TEPHRITIDAE) USING MITOCHONDRIAL CYTOCHROME OXIDASE I (COI) GENE." International Journal of Biosciences and Biotechnology 6, no. 1 (December 4, 2018): 34. http://dx.doi.org/10.24843/ijbb.2018.v06.i01.p03.

Full text

Abstract:

Some of fruit flies have been reported as the important pest on fruits and vegetables in the world. Agricultural Quarantine Agency Denpasar reported that there was new coming species (exotic) of fruit flies in Bali in 2014 based on the morphological identification, namely Bactrocera occipitalis. However Bactrocera dorsalis complex have similar morphological characters and have a less distinctive character for taxonomic identification, therefore it is difficult to identify fruit flies accurately. Based on that phenomena, the accurate identification is needed. One of the more accurate identification techniques is based on molecular identification using DNA-based barcode. To identify fruit flies, DNA-based barcode using mitochondrial cytochrome oxidase I (COI) gene has been conducted. PCR analysis using Fruit Fly MT-CO1-F (FFMT-CO1-F) 5’-GGAGCATTAATYGGRGAYG-3’ as forward primer and HCO 5’-TAAACTTCAGGGTGACCAAAAATCA-3’ as reverse primer was successfully amplified around 600 bp of COI gene of fruit flies. Based on similarity of sequence product, the species was identifiedas Bactrocera occipitalis and same result was revealed using morphological identification. Phylogenetic analysis of B. occipitalis based on COI genes showed that B. occipitalis from Bali were in the same groups with Bactrocera species from Tarakan and Philippines. In addition, Bactrocera occipitalis as exotic fruit fly is a new report in Bali, Indonesia.

APA, Harvard, Vancouver, ISO, and other styles

30

Beagley, C. Timothy, Ronald Okimoto, and David R. Wolstenholme. "Mytilus Mitochondrial DNA Contains a Functional Gene for a tRNASer(UCN) With a Dihydrouridine Arm-Replacement Loop and a pseudo-tRNASer(UCN) Gene." Genetics 152, no. 2 (June 1, 1999): 641–52. http://dx.doi.org/10.1093/genetics/152.2.641.

Full text

Abstract:

Abstract A 2500-nucleotide pair (ntp) sequence of F-type mitochondrial (mt) DNA of the Pacific Rim mussel Mytilus californianus (class Bivalvia, phylum Mollusca) that contains two complete (ND2 and ND3) and two partial (COI and COIII) protein genes and nine tRNA genes is presented. Seven of the encoded tRNAs (Ala, Arg, His, Met(AUA), Pro, Ser(UCN), and Trp) have the potential to fold into the orthodox four-armed tRNA secondary structure, while two [tRNASer(AGN) and a second tRNASer(UCN)] will fold only into tRNAs with a dihydrouridine (DHU) arm-replacement loop. Comparison of these mt-tRNA gene sequences with previously published, corresponding M. edulis F-type mtDNA indicates that similarity between the four-armed tRNASer(UCN) genes is only 63.8% compared with an average of 92.1% (range 86.2-98.5%) for the remaining eight tRNA genes. Northern blot analysis indicated that mature tRNAs encoded by the DHU arm-replacement loop-containing tRNASer(UCN), tRNASer(AGN), tRNAMet(AUA), tRNATrp, and tRNAPro genes occur in M. californianus mitochondria, strengthening the view that all of these genes are functional. However, Northern blot and 5′ RACE (rapid amplification of cDNA ends) analyses indicated that the four-armed tRNASer(UCN) gene is transcribed into a stable RNA that includes the downstream COI sequence and is not processed into a mature tRNA. On the basis of these observations the M. californianus and M. edulis four-armed tRNASer(UCN) sequences are interpreted as pseudo-tRNASer(UCN) genes.

APA, Harvard, Vancouver, ISO, and other styles

31

Simón, Belén, José Luis Cenis, Francisco Beitia, Saif Khalid, Ignacio M. Moreno, Aurora Fraile, and Fernando García-Arenal. "Genetic Structure of Field Populations of Begomoviruses and of Their Vector Bemisia tabaci in Pakistan." Phytopathology® 93, no. 11 (November 2003): 1422–29. http://dx.doi.org/10.1094/phyto.2003.93.11.1422.

Full text

Abstract:

The genetic structure of field populations of begomoviruses and their whitefly vector Bemisia tabaci in Pakistan was analyzed. Begomoviruses and B. tabaci populations were sampled from different crops and weeds in different locations in Punjab and Sindh provinces, in areas where cotton leaf curl disease (CLCuD) occurs or does not occur. Phylogenetic analysis based on nucleotide sequences of the intergenic region in the viral DNA-A provided evidence of two clusters of isolates: viruses isolated from species in the family Malvaceae, and viruses isolated from other dicotyledon families. Analysis of the capsid protein (CP) open reading frame grouped isolates into three geographical clusters, corresponding to isolates collected in Punjab, Sindh, or both provinces. Random amplified polymorphic DNA analyses of the B. tabaci population showed that intrapopulation diversity was high at both the local and regional scales. Sequence analysis of the mitocondrial cytochrome oxydase I (mt COI) gene showed that the B. tabaci population was structured into at least three genetic lineages corresponding to the previously described Indian, Southeast Asian, and Mediterranean-African clades. The Indian clade was present only in Punjab, the Mediterranean-African only in Sindh, and the Southeast Asian in both provinces. B. tabaci haplotypes of the Indian clade were found only in the Punjab, where CLCuD occurs. Hence, the geographical distribution of virus and vector genotypes may be correlated, because similar phylogenetic relationships were detected for the viral CP and the vector mt COI genes.

APA, Harvard, Vancouver, ISO, and other styles

32

Huemer, Peter, and Jae-Cheon Sohn. "Eidophasia assmanni sp. nov., the first alpine representative of the genus, detected in the Russian Altai Mountains (Lepidoptera, Plutellidae)." ZooKeys 959 (August 14, 2020): 99–111. http://dx.doi.org/10.3897/zookeys.959.54259.

Full text

Abstract:

Eidophasia assmannisp. nov., a new species of Plutellidae from the alpine zone of Russian Altai Mountains, is described from diagnostic morphology and DNA barcodes. Male adult and genitalia are illustrated, whereas the female sex remains unknown. The species inhabits alpine scree with patchy herbaceous plants and is considered as possible endemic species of the Altai Mountains. An updated checklist of the 13 global Eidophasia Stephens, 1842 species is provided. The likely polyphyly of the genus is discussed from molecular data of the barcode region of the mt COI gene.

APA, Harvard, Vancouver, ISO, and other styles

33

GAN, ZHIBIN, and XINZHENG LI. "Report on four deep-water barnacles (Cirripedia, Thoracica) from the north west Pacific, with remarks on Trianguloscalpellum regium (Wyville-Thomson, 1873)." Zootaxa 4565, no. 2 (March 8, 2019): 201. http://dx.doi.org/10.11646/zootaxa.4565.2.4.

Full text

Abstract:

Four deep-water species of stalked barnacles were collected by the manned submersibles Jiaolong and Shenhaiyongshi during recent expeditions. Trianguloscalpellum regium (Wyville-Thomson, 1873), collected from the Mariana Trench at a depth of 5,462 m, represents a new distribution record. Glyptelasma gigas (Annandale, 1916), Poecilasma litum Pilsbry, 1907 and Poecilasma obliqua Hoek, 1907, collected from the South China Sea, are recorded for the first time from a mud volcano environment. Detailed photographs of these four species are presented and their partial sequences of 16S rRNA and mt COI genes are provided.

APA, Harvard, Vancouver, ISO, and other styles

34

SHI, AIMIN, HU LI, XIAOSHUAN BAI, XUN DAI, JIAN CHANG, ERIC GUILBERT, and WANZHI CAI. "The complete mitochondrial genome of the flat bug Aradacanthia heissi (Hemiptera: Aradidae)." Zootaxa 3238, no. 1 (March 19, 2012): 23. http://dx.doi.org/10.11646/zootaxa.3238.1.2.

Full text

Abstract:

The 15528 bp long complete mitochondrial genome (mt-genome) of a flat bug, Aradacanthia heissi Bai, Zhang & Cai,was determined. The entire genome contains typical 37 genes with an A+T content of 74.7%. The gene arrangement dif-fers from that of Drosophila yakuba Burla which is considered the representative ground pattern for insect mt-genomes,as the results of inversion of tRNAIle - tRNAGln and tRNACys - tRNATrp . All protein-coding genes (PCGs) use standard initia-tion codons (methionine and isoleucine), except COI which starts with TTG. Three of the 13 PCGs harbor the incompletetermination codon. Meanwhile, opposite CG-skew tendency occurs on the nucleotide composition and codon usage andthis tendency is also reflected on the J-strand and N-strand of PCGs. All tRNAs can fold into classic clover-leaf structure,whereas the dihydrouridine (DHU) arm of tRNASer(AGN) forms a simple loop. Secondary structure models of the ribosomalRNA genes of A. heissi are predicted and similar to those proposed for other insects. The control region is located betweensrRNA and tRNAGln with 81.5% A+T content, which was the most A+T-rich region of the mt-genome and four 68 bp tan-dem repeat units were found in this region. Phylogenetic analyses of available species of Pentatomomorpha showed Ara-doidea and the Trichophora are sister groups that bolstered the mainstream hypothesis, and provide the evidence for the feasibility of mt-genome data to resolve relationships at the subfamily level in Aradidae.

APA, Harvard, Vancouver, ISO, and other styles

35

Lyu, Zhi-Tong, Zhong Huang, Xiao-Wen Liao, Li Lin, Yong Huang, Ying-Yong Wang, and Yun-Ming Mo. "A new species of Music frog (Anura, Ranidae, Nidirana) from Mt Daming, Guangxi, China." ZooKeys 1059 (September 1, 2021): 35–56. http://dx.doi.org/10.3897/zookeys.1059.68140.

Full text

Abstract:

Nidirana guangxiensissp. nov., a new music frog species, is proposed, based on a series of specimens collected from Mt Daming, Guangxi, southern China. The new species is close to N. yeae, N. daunchina, N. yaoica, and N. chapaensis from southwestern and south-central China and northern Indochina, while the relationships among these species remain unresolved. Nidirana guangxiensis sp. nov. can be distinguished from all known congeners by the genetic divergences in the mitochondrial 16S and COI genes, the behavior of nest construction, the advertisement call containing 6–11 rapidly repeated regular notes, and a combination of morphological characteristics. Furthermore, the Nidirana populations recorded in Guangxi are clarified in this work, providing valuable new information on the knowledge of the genus Nidirana.

APA, Harvard, Vancouver, ISO, and other styles

36

Francis, Sanu V., and Shuhei Nishida. "Amendment of the status of Pontella sewelli Heinrich, 1987 as a junior synonym of P. sinica Chen & Zhang, 1965, with confirmation of female-male matching by genetic analysis (Copepoda, Calanoida)." Crustaceana 91, no. 4 (2018): 439–49. http://dx.doi.org/10.1163/15685403-00003749.

Full text

Abstract:

Specimens of Pontella sinica Chen & Zhang, 1965, that were collected for the first time from the eastern Indian Ocean, are described, and a revised synonymy of the species is presented, including an amendment of P. sewelli Heinrich, 1987 as a junior synonym of P. sinica. The present specimens agree with most of the previous descriptions except for the frontal, rostral, and/or ventral eye lenses, which have been described as present in some previous studies, but proved to be all absent in the present examination. In addition, an analysis applying mitochondrial cytochrome c oxidase subunit I (mt COI) as a genetic marker confirmed matching of the female and male that were morphologically described by previous workers.

APA, Harvard, Vancouver, ISO, and other styles

37

SHINOHARA, AKIHIKO, TSUNEO KAKUDA, MEICAI WEI, and YUICHI KAMEDA. "DNA Barcodes Identify the Larvae and Unassociated Male of Three Onycholyda Sawflies (Hymenoptera, Pamphiliidae) from China." Zootaxa 4403, no. 1 (April 3, 2018): 123. http://dx.doi.org/10.11646/zootaxa.4403.1.7.

Full text

Abstract:

A molecular analysis based on mitochondrial cytochrome oxidase subunit 1 (COI) gene sequences has indicated that larvae collected in Sichuan and Zhejiang Provinces, China, belong to Onycholyda xanthogaster Shinohara, 1999, and O. fulvicornis Shinohara, in Shinohara & Wei, 2016 (Hymenoptera, Pamphiliidae), and that a male Onycholyda specimen from Mt. Tianmushan, Zhejiang Province is the hitherto unknown male of O. tianmushana Shinohara & Xiao, 2006. The first host plant records are Rubus inopertus (Focke) Focke (Rosaceae) for O. xanthogaster and Rubus hirsutus Thunb. for O. fulvicornis. The larvae of O. xanthogaster and O. fulvicornis are briefly described and O. xanthogaster is newly recorded from Sichuan Province. The male of O. tianmushana is described for the first time.

APA, Harvard, Vancouver, ISO, and other styles

38

Ruiz-García, Manuel, Kelly Luengas-Villamil, Norberto Leguizamon, Benoit de Thoisy, and Hugo Gálvez. "Molecular phylogenetics and phylogeography of all the Saimiri taxa (Cebidae, Primates) inferred from mt COI and COII gene sequences." Primates 56, no. 2 (October 28, 2014): 145–61. http://dx.doi.org/10.1007/s10329-014-0452-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Mdanat, Hanna, Nida Salem, Eman Al-Anaswah, Sadeer Amasha, Nasser Romeiah, and Nizar Haddad. "Molecular Characterization and Geographical Distribution of Whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) in Jordan." Jordan Journal of Agricultural Sciences 18, no. 3 (September 1, 2022): 221–30. http://dx.doi.org/10.35516/jjas.v18i3.451.

Full text

Abstract:

The whitefly Bemisia tabaci (Gennadius) is a large complex of cryptic species and is considered an invasive pest transmitting many plant viruses. It is a highly polyphagous insect that causes damage and economic losses to many plant species including vegetables, cotton, ornamentals, and weeds either in the open field or the greenhouses. A two-year survey (2016 to 2018) was conducted to biotype B. tabaci for B (MEAN1) and Q (MED) biotypes putative species. 18 host plants were screened from 14 different locations with a total of 101 samples that were collected and tested. Microsatellite markers and mitochondrial cytochrome oxidase I (mt COI) gene sequencing were used. The results showed that biotype B is dominant and prevailed in all surveyed locations.

APA, Harvard, Vancouver, ISO, and other styles

40

MITCHELL, KIRSTY D., KATHRYN A. HALL, and JOHN N. A. HOOPER. "A new species of Sigmaxinella Dendy, 1897 (Demospongiae, Poecilosclerida, Desmacellidae) from the Tasman Sea." Zootaxa 2901, no. 1 (June 1, 2011): 19. http://dx.doi.org/10.11646/zootaxa.2901.1.2.

Full text

Abstract:

Sigmaxinella hipposiderus sp. nov. is described from morphological and molecular datasets, based on a single known specimen collected from the upper margin of a submarine canyon on the edge of the continental shelf, south-east of coastal Victoria (Tasman Sea), Australia. Morphologically, the species is clearly assigned to the genus Sigmaxinella, and preliminary molecular data (COI mt DNA) support the close relationship of this new species to other specimens attributed to Desmacellidae. This is the thirteenth species of Sigmaxinella and the seventh described for the Australian EEZ. Remarkably, 12 of the 13 known species are recorded predominantly from temperate or subantarctic Australian, New Zealand or South African waters, with only a single species described so far from the temperate Atlantic Ocean.

APA, Harvard, Vancouver, ISO, and other styles

41

Melia, T., N. G. H. B. Simulingga, M. V. Maretha, R. Wijaya, R. R. Efendi, L. S. S. Oliveira, S. K. Khadan, W. de S. Tavares, M. Tarigan, and A. Duran. "First report of Tetracona (Agrotera) amathealis (Walker, 1859) on a Eucalyptus grandis W. Hill × Eucalyptus pellita F. Muell. (Myrtaceae) hybrid in Indonesia (Lepidoptera: Crambidae, Spilomelinae)." SHILAP Revista de lepidopterología 49, no. 195 (September 30, 2021): 407–12. http://dx.doi.org/10.57065/shilap.279.

Full text

Abstract:

Tetracona amathealis (Walker, 1859) (Lepidoptera: Crambidae) is previously known from Australia and New Guinea, where it feeds on the native Eucalyptus tereticornis Sm. (Myrtaceae). The objective of this study was the report, for the first time, T. amathealis in Indonesia as well as to record new host plants for this insect. Were collected manually from a Eucalyptus grandis W. Hill. × Eucalyptus pellita F. Muell. hybrid commercial plantation in Riau, Sumatra, Indonesia and a sample sent for identification via molecular analysis. Our findings revealed that the molecular approach used (through sequencing of its mt-COI gene) successfully allowed the identification of the species as T. amathealis. This insect is recorded for the first time in Indonesia on a new host, a E. grandis × E. pellita hybrid.

APA, Harvard, Vancouver, ISO, and other styles

42

Kholilah, Nenik, Norma Afiati, and Subagiyo Subagiyo. "Characterization of Some Commercially Important Octopus (Mollusca: Cephalopoda) from Indonesian Waters using Mitochondrial DNA Cytochrome Oxidase Sub-Unit I (Mt-DNA COI)." ILMU KELAUTAN: Indonesian Journal of Marine Sciences 26, no. 1 (February 27, 2021): 17–26. http://dx.doi.org/10.14710/ik.ijms.26.1.17-26.

Full text

Abstract:

As per the FAO data, octopus identification is very limited in the species level at world fishery and also they are cryptic nature. On the other hand, Indonesia is one of the top ten highest octopus exporters. This study therefore aimed to determine the species of octopus based on phylogenetic analysis of mt-DNA COI. Octopuses were collected from nine different locations throughout Indonesia, i.e., Anambas, Bangka-Belitung, Cirebon, Karimunjawa, Tuban, Lombok, Buton, Wakatobi and Jayapura. Samples were mostly in the form of tentacles that were directly collected from fishermen. After being preserved in 96% ethanol, the sample was extracted in 10% chelexÒ, PCR amplification using Folmer’s primer then was further analysed by sequencing in Sanger methods. Of the 24 samples sequenced, the results recognized four species Octopodidae belongs to the three genera, named Amphioctopus aegina, Hapalochlaena fasciata, Octopus laqueus and Octopus cyanea. Mean pair-wise distances of within-species were ranged from 0 to 5.5 % and between-species was ranged from 12.9 to 15.8 %. This study distinctly confirmed the difference between genus Amphioctopus and Hapalochlaena (15.5 %), as also between O. laqueus and O. cyanea (12.9%) which was previously not completely distinguished. Although performing species identification using DNA sequences for shallow-water benthic octopus species is perhaps considered premature, this study indicated the possible application of COI sequences for species identification, thereby providing a preliminary dataset for future DNA barcoding of octopus, in particular for Indonesia waters.

APA, Harvard, Vancouver, ISO, and other styles

43

Saher, Noor Us, Farah Naz, Syeda Hadiqa Noor, and Mustafa Kamal. "Genetic Diversity Evaluated through Mt-DNA COI Gene among Population of the Thenus unimaculatus in the Indo West Pacific Region." Thalassas: An International Journal of Marine Sciences 37, no. 1 (January 11, 2021): 393–401. http://dx.doi.org/10.1007/s41208-020-00279-9.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

PYO, JOOYEON, TAEKJUN LEE, and SOOK SHIN. "Two newly recorded invasive alien ascidians (Chordata, Tunicata, Ascidiacea) based on morphological and molecular phylogenetic analysis in Korea." Zootaxa 3368, no. 1 (July 4, 2012): 211. http://dx.doi.org/10.11646/zootaxa.3368.1.10.

Full text

Abstract:

We report five alien ascidians with some distinct features that were investigated from August 2009 to October 2011 in Korea, among which Ascidiella aspersa (Müller, 1776) belonging to family Ascidiidae of order Phlebobranchia and Molgula manhattensis (De Kay, 1843) belonging to family Molgulidae of order Stolidobranchia are newly discovered invasive species. These ascidians were identified and their phylogenetic relationships were clarified through molecular analysis using about 680 bp of nuclear 18S rDNA and about 670 bp of mt-COI genes along with detailed morphological characteristics, and reported for the first time in Korea. It was discovered that A. aspersa was widespread three coastlines of Korea except Jeju Island, and M. manhattensis first found in Mokpo, Gunsan, and Incheon in June 2010 extended into Busan of Korea Strait in 2011.

APA, Harvard, Vancouver, ISO, and other styles

45

Yara, Kaori. "Relationship between the introduced and indigenous parasitoids Torymus sinensis and T. beneficus (Hymenoptera: Torymidae) as inferred from mt-DNA (COI) sequences." Applied Entomology and Zoology 39, no. 3 (2004): 427–33. http://dx.doi.org/10.1303/aez.2004.427.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Balakirev, Evgeniy S. "Recombinant Mitochondrial Genomes Reveal Recent Interspecific Hybridization between Invasive Salangid Fishes." Life 12, no. 5 (April 29, 2022): 661. http://dx.doi.org/10.3390/life12050661.

Full text

Abstract:

The interspecific recombination of the mitochondrial (mt) genome, if not an experimental artifact, may result from interbreeding of species with broken reproductive barriers, which, in turn, is a frequent consequence of human activities including species translocations, habitat modifications, and climate change. This issue, however, has not been addressed for Protosalanx chinensis and other commercially important and, simultaneously, invasive salangid fishes that were the product of successful aquaculture in China. To assess the probability of interspecific hybridization, we analyzed the patterns of diversity and recombination in the complete mitochondrial (mt) genomes of these fishes using the GenBank resources. A sliding window analysis revealed a non-uniform distribution of the intraspecific differences in P. chinensis with four highly pronounced peaks of divergence centered at the COI, ND4L-ND4, and ND5 genes, and also at the control region. The corresponding divergent regions in P. chinensis show a high sequence similarity (99–100%) to the related salangid fishes, Neosalanx tangkahkeii and N. anderssoni. This observation suggests that the divergent regions of P. chinensis may represent a recombinant mitochondrial DNA (mtDNA) containing mt genome fragments belonging to different salangid species. Indeed, four, highly significant (pairwise homoplasy index test, P < 0.00001) signals of recombination have been revealed at coordinates closely corresponding to the divergent regions. The recombinant fragments are, however, not fixed, and different mt genomes of P. chinensis are mosaic, containing different numbers of recombinant events. These facts, along with the high similarity or full identity of the recombinant fragments between the donor and the recipient sequences, indicate a recent interspecific hybridization between P. chinensis and two Neosalanx species. Alternative hypotheses, including taxonomical misidentifications, sequence misalignments, DNA contamination, and/or artificial PCR recombinants, are not supported by the data. The recombinant fragments revealed in our study represent diagnostic genetic markers for the identification and distinguishing of hybrids, which can be used to control the invasive dynamics of hybrid salangid fishes.

APA, Harvard, Vancouver, ISO, and other styles

47

Mvogo Ndongo, Pierre A., Thomas von Rintelen, Minette Tomedi-Tabi Eyango, and Neil Cumberlidge. "Morphological and molecular analyses reveal three new endemic species of the freshwater crab genus Buea Cumberlidge, Mvogo Ndongo, Clark & Daniels, 2019 (Crustacea: Brachyura: Potamonautidae) from a rainforest biodiversity hotspot in Cameroon, Central Africa." Journal of Crustacean Biology 40, no. 3 (May 2020): 288–300. http://dx.doi.org/10.1093/jcbiol/ruaa019.

Full text

Abstract:

Abstract Three new species of the Cameroonian endemic freshwater crab genus Buea Cumberlidge, Mvogo Ndongo, Clark & Daniels, 2019 are described. The new species were collected from protected areas in the Southwest region of Cameroon, the Korup and Bakossi National Parks and the Mt. Nlonako Ecological Reserve. These species are distinguished from each other and from the type species of the genus, Buea asylos (Cumberlidge, 1993), by a combination of morphological characters (carapace, thoracic sternum, chelipeds, and male first gonopod) and by partial sequences of three mitochondrial DNA genes (COI, 12S rRNA, and 16S rRNA). A phylogenetic analysis that included representatives of all other freshwater crab genera found in Cameroon recovered each of the new species as a well-supported distinct lineage. An identification key is also provided for the four species of Buea and the conservation status of the new species is discussed.

APA, Harvard, Vancouver, ISO, and other styles

48

STÖHR, SABINE, EMILIE BOISSIN, and ANNE CHENUIL. "Potential cryptic speciation in Mediterranean populations of Ophioderma (Echinodermata: Ophiuroidea)." Zootaxa 2071, no. 1 (April 14, 2009): 1–20. http://dx.doi.org/10.11646/zootaxa.2071.1.1.

Full text

Abstract:

Ophioderma longicauda is a large brittlestar species, common in the Mediterranean Sea and spread across the subtropical-tropical eastern Atlantic Ocean. Recently, a morphologically similar brooding form of O. longicauda was discovered in the eastern Mediterranean Sea. The brooding period is restricted to late May and early June and the largest females brood over 1,000 juveniles, all of the same ontogenetic stage. Brooders differ from non-brooding O. longicauda in body colour (dominated by green instead of red), gonad colour (in alcohol white instead of oliveto reddish-brown) and size (up to 17 mm disk diameter instead of 30 mm). These characters overlap between both forms though. Molecular data (mt-COI sequences) lend weak support to the existence of two separate species, but suggest that if a split occurred it is recent and both forms interbreed. Alternatively, the eastern Mediterranean populations could represent a poecilogonous subgroup of O. longicauda.

APA, Harvard, Vancouver, ISO, and other styles

49

Sahu, R., D. K. Biswal, B. Roy, and V. Tandon. "Molecular characterization ofOpisthorchis noverca(Digenea: Opisthorchiidae) based on nuclear ribosomal ITS2 and mitochondrial COI genes." Journal of Helminthology 90, no. 5 (October 15, 2015): 607–14. http://dx.doi.org/10.1017/s0022149x15000851.

Full text

Abstract:

AbstractOpisthorchiasis is a public health problem in South-East Asian countries and Eastern Europe. The infection implicates mainly two species ofOpisthorchis, namelyO. viverriniandO. felineus,that occur mostly in fish-eating mammals and humans, although there are rare reports of human cases involving two other species,O. novercaandO. guayaquilensis.Opisthorchis novercahas been reported frequently in dogs and pigs from the Indian subcontinent, with rare reports from cattle and human subjects. With a view to supplementing morphology-based identification of this species, the present study aimed to provide molecular characterization ofO. noverca, using rDNA internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome oxidase I (mt COI) markers so as to determine its genetic correlation with other species of Opisthorchiidae, and also to generate a taxon-specific molecular marker based on the ITS2 region. The phylogenetic relationship betweenO. novercaand other species of the genus was determined using molecular sequence data. To strengthen the result, secondary structure sequence analyses of ITS2 with hemi-compensatory base changes (hCBCs), and amino acid sequence analyses, were also evaluated. Our results confirm thatO. novercais a distinct and valid species.

APA, Harvard, Vancouver, ISO, and other styles

50

Myoung, Se Hun, Laith A. Jawad, and Joo Myun Park. "New record of Neoclinus lacunicola (Actinopterygii: Perciformes: Chaenopsidae) from Ulleung Island, Korea revealed by body morphometry and mitochondrial DNA barcoding." Acta Ichthyologica et Piscatoria 51, no. 4 (October 1, 2021): 339–44. http://dx.doi.org/10.3897/aiep.51.67056.

Full text

Abstract:

One specimen (38.3 mm SL) of Neoclinus lacunicola Fukao, 1980, belonging to the family Chaenopsidae, was first recorded from Ulleung Island, Korea (East Sea, otherwise known as the Sea of Japan) on 5 January 2021. This species was characterized by paired external pores of incomplete lateral line running from the upper margin of the opercle, seven pairs of supraorbital cirri arranged in two rows, occipital region with a pair of cirri, and 13 rays of pectoral fin. This species is morphologically similar to the Neoclinus toshimaensis Fukao, 1980, but differs in the number of cirri on the supraorbital (6–7 versus 9–11 cirri). This study documents the first report of N. lacunicola in Korean waters and proposes the new Korean name of ‘eol-lug-bi-neul-be-do-la-chi’ for the species. For the confirmation of the identity of the species, a partial gene sequence of the mt COI (570 bp) of N. lacunicola was obtained for the first time.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Mt-COI'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles