Journal articles: 'Moss-bag'

1

Ares, A., J. R. Aboal, A. Carballeira, S. Giordano, P. Adamo, and J. A. Fernández. "Moss bag biomonitoring: A methodological review." Science of The Total Environment 432 (August 2012): 143–58. http://dx.doi.org/10.1016/j.scitotenv.2012.05.087.

Full text

APA, Harvard, Vancouver, ISO, and other styles

2

Popovic, Dragana, Dragana Todorovic, Jelena Ajtic, and Jelena Nikolic. "Active biomonitoring of air radioactivity in urban areas." Nuclear Technology and Radiation Protection 24, no. 2 (2009): 100–103. http://dx.doi.org/10.2298/ntrp0902100p.

Full text

Abstract:

To assess the validity of the moss bag monitoring technique in the radioactivity control of ground level urban air, a study on radionuclide contents in moss was performed in the city of Belgrade, Serbia. From May 2006 to May 2007, moss (Sphagnum girgensohni, Dubna, Russia) was exposed to the aero pollution in a location in the central area of the city. The activity of 40K, 210Pb, and 137Cs was measured on an HPGe detector (Canberra, relative efficiency 23%) by standard gamma spectrometry. The activities 245 ? 25 Bq/kg for 40K, 315 ? 34 Bq/kg for 210Pb, and 28 ? 4 Bq/kg for 137Cs are in the range of values reported for the region; the differences are due to the moss species, local climate and measuring technique. Taking into consideration the time of the exposure and appropriate calibration procedure, moss bag biomonitoring could be used as a complementary method for determination of radionuclides in urban air.

APA, Harvard, Vancouver, ISO, and other styles

3

Shvetsova, M. S., I. Z. Kamanina, M. V. Frontasyeva, A. I. Madadzada, I. I. Zinicovscaia, S. S. Pavlov, K. N. Vergel, and N. S. Yushin. "Active Moss Biomonitoring Using the “Moss Bag Technique” in the Park of Moscow." Physics of Particles and Nuclei Letters 16, no. 6 (November 2019): 994–1003. http://dx.doi.org/10.1134/s1547477119060293.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Saxena, Dinesh K., Kajal Srivastava, and Shiv Om Singh. "Moss bag technique for monitoring of metal precipitation." Environment Conservation Journal 8, no. 1&2 (June 21, 2007): 85–92. http://dx.doi.org/10.36953/ecj.2007.081211.

Full text

Abstract:

Moss Barbula vinealis and Rhodobryum roseum used as biomonitor of metal precipitation at Nainital during 2004 - 2005 to examine deposition of Zn, Cu, Cd, Pb at Nainital area, around point sources in all the four directions. Moss bags were transplanted at 8 sites for fixed exposure time in sampling seasons (summer, monsoon and winter) and were harvested periodically after 4 months of exposure. An increase in amount of metals in 2004 - 2005 reflects an increase in metals in air. High metallic load was observed in locations in proximity of higher traffic density. From the result, it is concluded that local sources in Nainital, especially due to enhanced tourism during summer, contributes to elevated metal deposition in comparison to winter and monsoon season. Active monitoring by 4 months of exposure of mosses gives reliable results on metal contamination. Study also aim at assessing the suitability of both mosses as a biomonitor for metal deposition. Study confirms that in Nainital, where due to higher vehicular traffic, wear and tear of vehicular parts and beside it increasing tourist activity, high level of Zn, Pb was measured in moss transplant bags.Bioaccumulation ability in these two mosses was evaluated statistically using Dunkun's Multiple Range Test and was presented on contour maps obtained from SURFER program.

APA, Harvard, Vancouver, ISO, and other styles

5

Nguyen, Son An, Nguyen Thi Minh Sang, and Le Hong Khiem. "Comparison of moss bag and native moss technique in monitoring airborne particulate and toxic elements." Science and Technology Development Journal 24, no. 2 (May 12, 2021): first. http://dx.doi.org/10.32508/stdj.v24i2.2531.

Full text

Abstract:

Introduction: In Vietnam, the government has invested in monitoring stations in a few big cities like Hanoi and Ho Chi Minh City, which have transportation centers and industrial zones, to assess and predict levels of air pollution. However, the main disadvantage of installing monitoring stations is the cost of investment for operations, maintenance, and equipment. It is also time-consuming to collect and analyze the results. Therefore, it is generally not suitable for the country as a whole. Methods: Using mosses to monitor air quality brings qualitative and quantitative data with simple, environmentally-friendly economic methods. Mosses have particular biological characteristics that make them very suitable adsorbents for a wide variety of chemical elements. When used as transplants like moss bags, allow them to monitor a highly dense sampling network of any site easily. Mosses are bioindicators, plants with artificial roots. Results: In this study, moss bag and native moss were the two methods used to evaluate the accumulation of trace elements in air through Barbula Indica. Observations showed that both methods could detect the same elements: Al, Si, P, S, Ca, Ti, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Br, Rb, Y, Sb, Ba, Pb, and U. However, the accumulation of the elements in native moss is higher than in moss bag. The main reason is that the absorption efficiency of native moss in air-deposited elements is higher than in moss bags. Conclusion: Moss bags have been used most extensively and successfully in urban areas, where vegetation samples are either unobtainable or are poorly located to the source. These areas can lack moss, or the native moss simply does not grow during the dry season.

APA, Harvard, Vancouver, ISO, and other styles

6

Shvetsova, M. S., I. Z. Kamanina, M. V. Frontasyeva, A. I. Madadzada, I. I. Zinicovscaia, S. S. Pavlov, K. N. Vergel, and N. S. Yushin. "ACTIVE MOSS BIOMONITORING USING THE «MOSS BAG TECHNIQUE» AT THE STATE MUSEUM-RESERVE «TSARITSYNO»." Bulletin of Dubna International University for Nature, Society, and Man. Series: Natural and engineering sciences, no. 1 (42) (September 23, 2019): 68–75. http://dx.doi.org/10.37005/1818-0744-2019-1-68-75.

Full text

Abstract:

Moscow is a large metropolis in which the air is affected by the constant effects of chemicals produced by industrial facilities, vehicles, residential heating and other human activities on a daily basis. The protected and park areas on the territory of Moscow have an important recreational role, therefore, air quality control in these territories should be carried out first. Active moss biomonitoring has been used as an alternative method to conventional atmospheric monitoring for more than 40 years. This type of biomonitoring is successfully applied all over the world: in China, Serbia, Moldova, Azerbaijan, Italy, Romania, etc. In this study, active moss biomonitoring was used for the first time on the territory of the Tsaritsyno Museum-Reserve to assess the air pollution. The moss species Sphagnum girgensohnii was chosen for the experiment. Neutron activation analysis was used to determine the concentrations of the elements: Na, Mg, Al, Cl, K, Ca, Sc, V, Cr, Mn, Fe, Co, Ni, Zn, Se, As, Br, Rb, Mo, Sr , Sb, Ba, Cs, La, Sm, Tb, Ce, Hf, Ta, W, Th, and U. The concentrations of Pb, Cu, and Cd were determined by atomic absorption spectrometry.

APA, Harvard, Vancouver, ISO, and other styles

7

Gecheva, Gana, Vesela Yancheva, Iliana Velcheva, Elenka Georgieva, Stela Stoyanova, Desislava Arnaudova, Violeta Stefanova, et al. "Integrated Monitoring with Moss-Bag and Mussel Transplants in Reservoirs." Water 12, no. 6 (June 24, 2020): 1800. http://dx.doi.org/10.3390/w12061800.

Full text

Abstract:

For the first time, transplants with moss-bags and mussels together were applied to study the water quality in standing water bodies. The tested species: Fontinalis antipyretica Hedw. and Sinanodonta woodiana (Lea, 1834) were collected from unpolluted sites and analyzed to obtain background levels. Then, the moss and mussels were left in cages for a period of 30 days in three reservoirs where both are not present naturally. Two of the reservoirs suffer from old industrial contamination and one is affected by untreated wastes. Twenty-four compounds were studied, among them trace elements Al, As, Cd, Co, Cr, Cu, Fe, Hg, Mn, Ni, Pb, Zn and organic priority substances: six polybrominated diphenyl ethers (PBDEs) congeners and short-chain chlorinated paraffins (SCCPs). The trace element accumulation was significant after the exposition period in all studied stations. PBDEs and SCCPs were also accumulated up to two times more in the moss tissues. PBDEs in the mussels exceeded the environmental quality standard (EQS). The applied combined transplants, and especially the moss-bags, revealed severe contamination with heavy metals not detected by the water samples. The moss and the mussel followed a different model of trace element and PBDEs accumulation. The SCCPs levels were alarmingly high in all plant samples. The study confirmed PBDEs and SCCPs as bioaccumulative compounds and suggested that an EQS for SCCPs in biota needs to be established.

APA, Harvard, Vancouver, ISO, and other styles

8

Lenka, Demková, Baranová Beáta, Oboňa Jozef, Árvay Július, and Lošák Tomáš. "Assessment of air pollution by toxic elements on petrol stations using moss and lichen bag technique." Plant, Soil and Environment 63, No. 8 (September 4, 2017): 355–61. http://dx.doi.org/10.17221/297/2017-pse.

Full text

Abstract:

Three moss (Pleurosium spp., Polytrichum spp., Rhytidiadelphus spp.) and two lichen taxa (Hypogymnia physodes L., Pseudevernia furfuracea L.), were exposed for four weeks in six petrol stations, two consecutive years (2015–2016), in urban area of the Prešov city (Slovakia), to assess accumulation of selected airborne elements Cd, Co, Cu, Fe, Hg, Mn, Ni, Pb and Zn. Significantly highest (P < 0.01) ability to accumulate Zn, Ni, Co and Fe was found in Pleurosium spp.; Pseudevernia furfuracea was determined the best accumulator of Hg, whereas Rhytidiadelphus spp. was found as the least suitable for this purpose. No significant differences in heavy metal accumulation between moss and lichen taxonomic group were found. Samples of conifer (used as a moss/lichen bag holder) showed significantly lower content of heavy metals compared to mosses and lichens. Major content of heavy metals trapped in the air around petrol stations, did not originate from the petrol combustion, but predominantly from the car body, which is mechanically disrupted during fuelling.

APA, Harvard, Vancouver, ISO, and other styles

9

Gecheva, Gana, Ivelin Mollov, Galina Yahubyan, Mariyana Gozmanova, Elena Apostolova, Tonka Vasileva, Mariana Nikolova, Ivanka Dimitrova-Dyulgerova, and Tzenka Radoukova. "Can Biomarkers Respond Upon Freshwater Pollution?—A Moss-Bag Approach." Biology 10, no. 1 (December 22, 2020): 3. http://dx.doi.org/10.3390/biology10010003.

Full text

Abstract:

Moss-bags were applied to study the effect of contamination in three standing water bodies in Bulgaria (Kardzhali, Studen Kladenets and Zhrebchevo Reservoirs), the first two with old industrial contamination and the last polluted with short-chain chlorinated paraffins (SCCPs). Fontinalis antipyretica Hedw. collected from background (unpolluted) site was placed in cages for a period of 30 days. The present study examined whether inorganic and organic pollution detected with moss-bags resulted in corresponding differences in molecular, chemical and micromorphological markers. Suppressed large subunit of ribulose-1,5-bisphosphate carboxylase (rbcL) expression was assessed in moss-bags from two of the reservoirs, contaminated with heavy metals. There was a decrease of the total phenolic content (TPC) in the moss-bags, which provides a basis for further studies of the chemical content of aquatic mosses. Fontinalis antipyretica also showed a response through leaf micromorphological characteristics. In the all three reservoirs, an increase of the twig leaf cell number was recorded (p ≤ 0.01 for Kardzhali and p ≤ 0.001 for Studen Kladenets and Zhrebchevo reservoirs), as well as of the stem leaf cell number in Zhrebchevo Reservoir (p ≤ 0.001). On the contrary, the width of the cells decreased in the studied anthropogenically impacted reservoirs. All three studied groups of biomarkers (molecular, chemical and micromorphological) appeared to be sensitive to freshwater pollution. The results achieved indicated that rbcL gene expression, TPC, cell number and size are promising biomonitoring tools.

APA, Harvard, Vancouver, ISO, and other styles

10

Świsłowski, Paweł, Pavel Hrabák, Stanisław Wacławek, Klára Liskova, Vojtěch Antos, Małgorzata Rajfur, and Maria Ząbkowska-Wacławek. "The Application of Active Biomonitoring with the Use of Mosses to Identify Polycyclic Aromatic Hydrocarbons in an Atmospheric Aerosol." Molecules 26, no. 23 (November 30, 2021): 7258. http://dx.doi.org/10.3390/molecules26237258.

Full text

Abstract:

The use of biological indicators of environmental quality is an alternative method of monitoring ecosystem pollution. Various groups of contaminants, including organic ones, can be measured in environmental samples. Polycyclic aromatic hydrocarbons (PAHs) have not yet been determined by the moss bag technique. This technique uses several moss species simultaneously in urban areas to select the best biomonitoring of these compounds, which are dangerous to humans and the environment. In this research, a gas chromatography coupled with mass spectrometry was used for the determination of selected PAHs in three species of mosses: Pleurozium schreberi, Sphagnum fallax and Dicranum polysetum (active biomonitoring) and for comparison using an air filter reference method for atmospheric aerosol monitoring. The chlorophyll fluorescence of photosystem II (PSII) was also measured to assess changes in moss viability during the study. As a result of the study, the selective accumulation of selected PAHs by mosses was found, with Pleurozium schreberi being the best bioindicator—9 out of 13 PAHs compounds were determined in this species. The photosynthetic yield of photosystem (II) decreased by 81% during the exposure time. The relationship between PAHs concentrations in mosses and the total suspended particles (TSP) on the filter indicated the possibility of using this bioindicator to trace PAHs in urban areas and to apply the moss bag technique as a method supporting classical instrumental air monitoring.

APA, Harvard, Vancouver, ISO, and other styles

11

Sorrentino, Maria Cristina, Fiore Capozzi, Karen Wuyts, Steven Joosen, Valentine K. Mubiana, Simonetta Giordano, Roeland Samson, and Valeria Spagnuolo. "Mobile Biomonitoring of Atmospheric Pollution: A New Perspective for the Moss-Bag Approach." Plants 10, no. 11 (November 5, 2021): 2384. http://dx.doi.org/10.3390/plants10112384.

Full text

Abstract:

In this work the potential of moving moss-bags, fixed to bicycles, to intercept particulate matter (PM) and linked metal(loid)s was tested for the first time. Seven volunteers carried three moss-bags for fifty days while commuting by bicycle in the urban area of Antwerp, Belgium. Moreover, one bike, equipped with mobile PM samplers, travelled along four routes: urban, industrial, green route and the total path, carrying three moss-bags at each route. The saturation isothermal remanent magnetization (SIRM) signal and chemical composition (assessed by HR-ICP-MS) of the moss samples indicated that the industrial route was the most polluted. Element fluxes (i.e., the ratio between element daily uptake and the specific leaf area) could discriminate among land uses; particularly, they were significantly higher in the industrial route for Ag, As, Cd and Pb; significantly lowest in the green route for As and Pb; and comparable for all accumulated elements along most urban routes. A comparison with a previous experiment carried out in the same study area using similar moss-bags at static exposure points, showed that the element fluxes were significantly higher in the mobile system. Finally, PM2.5 and PM10 masses measured along the four routes were consistent with element fluxes.

APA, Harvard, Vancouver, ISO, and other styles

12

Świsłowski, Paweł, Arkadiusz Nowak, and Małgorzata Rajfur. "Is Your Moss Alive during Active Biomonitoring Study?" Plants 10, no. 11 (November 5, 2021): 2389. http://dx.doi.org/10.3390/plants10112389.

Full text

Abstract:

Biomonitoring was proposed to assess the condition of living organisms or entire ecosystems with the use of bioindicators—species sensitive to specific pollutants. It is important that the bioindicator species remains alive for as long as possible while retaining the ability to react to the negative effects of pollution (elimination/neutralization of hazardous contaminants). The purpose of the study was to assess the survival of Pleurozium schreberi moss during exposure (moss-bag technique) based on the measurement of the concentration of elements (Ni, Cu, Zn, Cd, and Pb), chlorophyll content, and its fluorescence. The study was carried out using a CCM-300 portable chlorophyll content meter, portable fluorometer, UV-Vis spectrophotometer, and a flame atomic absorption spectrometer. As a result of the laboratory tests, no significant differences were found in the chlorophyll content in the gametophytes of mosses tested immediately after collection from the forest, compared to those drying at room temperature in the laboratory (p = 0.175 for Student’s t-test results). Mosses exposed using the moss-bag technique of active biomonitoring were characterized by a drop in the chlorophyll content over 12 weeks (more than 50% and 60% for chlorophyll-a and chlorophyll-b, respectively). Chlorophyll content in mosses during exposure was correlated with actual photochemical efficiency (yield) of photosystem II (calculated value of Pearson’s linear correlation coefficient was 0.94—there was a significant correlation between chlorophyll a and yield p = 0.02). The highest metal increases in mosses (RAF values) were observed for zinc, lead, and copper after the second and third month of exposure. The article demonstrates that the moss exposed in an urbanized area for a period of three months maintains the properties of good bioindicator of environmental quality.

APA, Harvard, Vancouver, ISO, and other styles

13

Motyka, Oldřich, Barbora Macečková, Jana Seidlerová, and Blanka Krejčí. "Novel Technique of Active Biomonitoring Introduced in the Czech Republic: Bioaccumulation of Atmospheric Trace Metals in two moss species / Nová Metoda Aktivního Biomonitoringu Zavedená V České Republice: Bioakumulace Stopových Kovů V Atmosféře U Dvou Druhů Mechů." GeoScience Engineering 57, no. 3 (September 1, 2011): 30–36. http://dx.doi.org/10.2478/gse-2014-0026.

Full text

Abstract:

Abstract A biomonitoring technique never before used in the Czech Republic was used to test its validity and applicability in the region of Ostrava that is eminently affected by industry. Transplants of two moss species Hylocomium splendens and Pleurozium schreberi were exposed to atmospheric pollution using the technique of an “irrigated moss bag” placed at a height of both 1 m and 2 m above ground. The samples were then analysed for concentration levels of trace elements Al, As, Cd, Cr, Cu, Fe, Hg, Pb, V and Zn. The patterns of bioaccumulation in general show that Hylocomium splendens is more suitable for monitoring purposes and that 2 m height above ground of transplants should be preferred.

APA, Harvard, Vancouver, ISO, and other styles

14

Debén, S., J. R. Aboal, P. Giráldez, Z. Varela, and J. A. Fernández. "Developing a Biotechnological Tool for Monitoring Water Quality: In vitro Clone Culture of the Aquatic Moss Fontinalis Antipyretica." Water 11, no. 1 (January 15, 2019): 145. http://dx.doi.org/10.3390/w11010145.

Full text

Abstract:

One of the main factors limiting active biomonitoring with aquatic mosses is the lack of sufficient material. A laboratory culture of the moss would solve this problem and thus convert the technique into a valuable biotechnological tool for monitoring water quality. With this aim, we first established small and large scale axenic in vitro culture systems for the aquatic moss Fontinalis Antipyretica. We then attempted to enhance the growth rate of the cultures by modifying temperature, photoperiod and medium composition (N:P ratio, P concentration, CO2 supply, NH4NO3 supply and sucrose supply). None of these modifications greatly increased the in vitro growth rate. However, the growth rates were sufficiently high (relative to the initial weight of the cultures) in both systems (45 and 6 mg·day−1·g−1· for flasks and bioreactors respectively) to enable the production of large amounts of material. The ability to culture the material will substantially improve the applicability of the moss bag technique.

APA, Harvard, Vancouver, ISO, and other styles

15

Ilieva-Makulec, Krassimira, Paweł Dariusz Plichta, and Maciej Sierakowski. "Biomonitoring of Heavy Metal Air Pollution in Warsaw Using Two Moss Species Pleurozium schreberi and Sphagnum palustre." Studia Ecologiae et Bioethicae 19, no. 4 (January 5, 2022): 111–24. http://dx.doi.org/10.21697/seb.2021.19.4.09.

Full text

Abstract:

The aim of the study was to assess air pollution with heavy metals in Warsaw, on the basis of the concentrations of selected elements in moss samples. The active biomonitoring method (moss-bag technique) was applied using two moss species Pleurozium schreberi and Sphagnum palustre. Moss samples were collected in the Kampinos National Park, and the prepared moss bags were distributed and exposed on seven sites in Warsaw. The analysis of metals accumulated in mosses was performed twice in 2020, after two (August-September) and four months (August-November) of exposure. The concentrations of seven heavy metals (Cr, Cu, Pb, Ni, Fe, Cd and Zn) in the mosses were determined, using an Inductively Coupled Plasma Optical Emission Spectrometer (ICP OES). Our results showed a clear dependence of heavy metal accumulation in the mosses on the location of the exposition site and the exposure period. Both species of mosses were found to accumulate the most metals in the vicinity of pollutant emitters, such as the ArcelorMittal Warsaw smelter, exit roads or roads in the city with heavy traffic, petrol stations, or construction works. After 4 months of exposure, in both moss species, the highest increases in the concentrations were found for four elements: Cr, Pb, Ni and Cd. Higher concentrations of some heavy metals in the mosses in 2020, as compared to previous studies, indicate a negative influence of progressing urbanisation on air pollution in Warsaw.

APA, Harvard, Vancouver, ISO, and other styles

16

Iodice, P., P. Adamo, F. Capozzi, A. Di Palma, A. Senatore, V. Spagnuolo, and S. Giordano. "Air pollution monitoring using emission inventories combined with the moss bag approach." Science of The Total Environment 541 (January 2016): 1410–19. http://dx.doi.org/10.1016/j.scitotenv.2015.10.034.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

Vuković, Gordana, Mira Aničić Urošević, Sandra Škrivanj, Konstantin Vergel, Milica Tomašević, and Aleksandar Popović. "The first survey of airborne trace elements at airport using moss bag technique." Environmental Science and Pollution Research 24, no. 17 (May 11, 2017): 15107–15. http://dx.doi.org/10.1007/s11356-017-9140-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

18

Świsłowski, Paweł, Zbigniew Ziembik, and Małgorzata Rajfur. "Air Quality during New Year’s Eve: A Biomonitoring Study with Moss." Atmosphere 12, no. 8 (July 29, 2021): 975. http://dx.doi.org/10.3390/atmos12080975.

Full text

Abstract:

Mosses are one of the best bioindicators in the assessment of atmospheric aerosol pollution by heavy metals. Studies using mosses allow both short- and long-term air quality monitoring. The increasing contamination of the environment (including air) is causing a search for new, cheap and effective methods of monitoring its condition. Once such method is the use of mosses in active biomonitoring. The aim of the study was to assess the atmospheric aerosol pollution with selected heavy metals (Ni, Cu, Zn, Cd, Hg and Pb) from the smoke of fireworks used during New Year’s Eve in the years 2019/2020 and 2020/2021. In studies a biomonitoring moss-bag method with moss Pleurozium schreberi (Willd. ex Brid.) Mitt. genus Pleurozium was used. The research was conducted in the town Prószków (5 km in south direction from Opole, opolskie voivodship, Poland). The moss was exposed 14 days before 31 December (from 17 to 30 of December), on New Year’s Eve (31 December and 1 January) and 2 weeks after the New Year (from 2–15 January). Higher concentrations of analysed elements were determined in samples exposed during New Year’s Eve. Increases in concentrations were demonstrated by analysis of the Relative Accumulation Factor (RAF). The results indicate that the use of fireworks during New Year’s Eve causes an increase in air pollution with heavy metals. In addition, it was shown that the COVID-19 induced restrictions during New Year’s Eve 2020 resulted in a reduction of heavy metal content in moss samples and thus in lower atmospheric aerosol pollution with these analytes. The study confirmed moss usefulness in monitoring of atmospheric aerosol pollution from point sources.

APA, Harvard, Vancouver, ISO, and other styles

19

Arndt, Julia, and Britta Planer-Friedrich. "Moss bag monitoring as screening technique to estimate the relevance of methylated arsine emission." Science of The Total Environment 610-611 (January 2018): 1590–94. http://dx.doi.org/10.1016/j.scitotenv.2017.06.123.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

Al-Radady, A. S., B. E. Davies, and M. J. French. "A new design of moss bag to monitor metal deposition both indoors and outdoors." Science of The Total Environment 133, no. 3 (June 1993): 275–83. http://dx.doi.org/10.1016/0048-9697(93)90249-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

21

Sun, Shou-Qin, Ding-Yong Wang, Ming He, and Cheng Zhang. "Monitoring of atmospheric heavy metal deposition in Chongqing, China—based on moss bag technique." Environmental Monitoring and Assessment 148, no. 1-4 (January 23, 2008): 1–9. http://dx.doi.org/10.1007/s10661-007-0133-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Salo, Hanna, Anna-Kaisa Berisha, and Joni Mäkinen. "Seasonal comparison of moss bag technique against vertical snow samples for monitoring atmospheric pollution." Journal of Environmental Sciences 41 (March 2016): 128–37. http://dx.doi.org/10.1016/j.jes.2015.04.021.

Full text

APA, Harvard, Vancouver, ISO, and other styles

23

Sahubawa, Latif, and Ambar Pertiwiningrum. "Bioconversion and bioeconomics of thorn stringray skin waste (Dasyatis sp.) as a commercial leather products." IOP Conference Series: Earth and Environmental Science 1033, no. 1 (June 1, 2022): 012065. http://dx.doi.org/10.1088/1755-1315/1033/1/012065.

Full text

Abstract:

Abstract Stingray skin can be utilized and processed into commercial products with high economic value. The aim of the research is to maximize the use and increase the economic value of thorn stingray skin waste through the processing of commercial products (wallet and bracelets) that consumers prefer. The research method used product design & processing, added value, and consumer preferences. The number of stingray skins used for processing 1 (one) men’s/women’s wallet-bag is two skin sheets (IDR. 100,000). The commercial leather products produced are women’s wallets-bag (hanging model, type 3-in-1, maroon, moss green, light brown, pink) and men’s wallet-bag (handle model, type 3-in-1, black and light brown), with four pieces of pearl bracelet and two beaded bracelet. Based on the analysis results, it is known that the selling value of women’s wallet-bags is IDR 950,000 per piece & men’s wallet-bags is IDR. 1,500,000; pearl bracelet is IDR. 200,000 & beaded bracelet is IDR 150,000. The economic value obtained from processing 1 item of stingray leather wallet-bag (for women) is IDR 1,500,000 & added value is IDR 1,400% while for men is IDR 2,050,000 & added value 1,950%. The level of consumer preference of the main products is women’s wallet-bag are 85% very likes & 15% likes and men’s wallets are 90% very likes & 10% like. Derivative products are pearl bracelets (100% very like) and bead bracelets (87% very like & 13% like). The total economy value, added value & consumer preferences of the stingray leather product of men’s wallet are higher than women’s wallets.

APA, Harvard, Vancouver, ISO, and other styles

24

Ares, A., J. R. Aboal, A. Carballeira, S. Giordano, P. Adamo, and J. A. Fernández. "Corrigendum to “Moss bag biomonitoring: A methodological review” [Sci Total Environ 432 (2012) 143–158]." Science of The Total Environment 475 (March 2014): 153–54. http://dx.doi.org/10.1016/j.scitotenv.2014.01.035.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Ștefănuț, Sorin, Kinga Öllerer, Anca Manole, Mihaela C. Ion, Marian Constantin, Cristian Banciu, Gabriel M. Maria, and Larisa I. Florescu. "National environmental quality assessment and monitoring of atmospheric heavy metal pollution - A moss bag approach." Journal of Environmental Management 248 (October 2019): 109224. http://dx.doi.org/10.1016/j.jenvman.2019.06.125.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Aničić Urošević, Mira, Gordana Vuković, Petar Jovanović, Milorad Vujičić, Aneta Sabovljević, Marko Sabovljević, and Milica Tomašević. "Urban background of air pollution: Evaluation through moss bag biomonitoring of trace elements in Botanical garden." Urban Forestry & Urban Greening 25 (July 2017): 1–10. http://dx.doi.org/10.1016/j.ufug.2017.04.016.

Full text

APA, Harvard, Vancouver, ISO, and other styles

27

Cortis, Pierluigi, Candida Vannini, Annalena Cogoni, Fabrizio De Mattia, Marcella Bracale, Valerio Mezzasalma, and Massimo Labra. "Chemical, molecular, and proteomic analyses of moss bag biomonitoring in a petrochemical area of Sardinia (Italy)." Environmental Science and Pollution Research 23, no. 3 (September 26, 2015): 2288–300. http://dx.doi.org/10.1007/s11356-015-5393-7.

Full text

APA, Harvard, Vancouver, ISO, and other styles

28

Świsłowski, Paweł, Arkadiusz Nowak, Stanisław Wacławek, Zbigniew Ziembik, and Małgorzata Rajfur. "Is Active Moss Biomonitoring Comparable to Air Filter Standard Sampling?" International Journal of Environmental Research and Public Health 19, no. 8 (April 13, 2022): 4706. http://dx.doi.org/10.3390/ijerph19084706.

Full text

Abstract:

Recently, significant attention has been paid to air quality awareness and its impact on human health, especially in urban agglomerations. Many types of dust samplers for air quality monitoring are used by governmental environmental monitoring agencies. However, these techniques are associated with high costs; as a consequence, biological methods such as active moss biomonitoring are being developed. The main disadvantages of such techniques are the lack of standardization of the preparation procedures and the lack of reliable comparisons of results with data from instrumental analyses. Our study aimed to compare the results obtained from active biomonitoring with the use of three moss species: Pleurozium schreberi, Sphagnum fallax and Dicranum polysetum. Samples were exposed via the moss-bag technique to measure the concentrations of analytes (Mn, Fe, Cu, Zn, Cd, Hg and Pb) which had accumulated among the total suspended particulates (TSP) collected from the filters of a dust collector in the city of Opole (Opole voivodeship, Poland). With regard to the physicochemical and biological traits of the mosses, their assessed lifetime and actual photochemical efficiency (yield) following exposure were meagre, which may have been related to the change of environment and their exposure to pollutants. When comparing the results obtained by the two methods used to monitor air pollution, the biomonitoring method was found to be incompletely consistent with the reference method. Biological monitoring using mosses must be carefully considered depending on the monitoring objectives, the required level of sensitivity and quality of measurement and the type of pollutant.

APA, Harvard, Vancouver, ISO, and other styles

29

Morales-Casa, Verónica, José Rebolledo, Rosanna Ginocchio, and César Saéz-Navarrete. "The effect of “moss bag” shape in the air monitoring of metal(oid)s in semi-arid sites: Influence of wind speed and moss porosity." Atmospheric Pollution Research 10, no. 6 (November 2019): 1921–30. http://dx.doi.org/10.1016/j.apr.2019.08.005.

Full text

APA, Harvard, Vancouver, ISO, and other styles

30

Ares, A., J. A. Fernández, A. Carballeira, and J. R. Aboal. "Towards the methodological optimization of the moss bag technique in terms of contaminants concentrations and replicability values." Atmospheric Environment 94 (September 2014): 496–507. http://dx.doi.org/10.1016/j.atmosenv.2014.05.066.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Salo, H., P. Paturi, and J. Mäkinen. "Moss bag (Sphagnum papillosum) magnetic and elemental properties for characterising seasonal and spatial variation in urban pollution." International Journal of Environmental Science and Technology 13, no. 6 (April 25, 2016): 1515–24. http://dx.doi.org/10.1007/s13762-016-0998-z.

Full text

APA, Harvard, Vancouver, ISO, and other styles

32

Alsup, Clydette M., and Pamela B. Trewatha. "Bagged Soil Tested as an Alternative for Growing Bedding Plants in the Landscape." HortScience 41, no. 5 (August 2006): 1272–75. http://dx.doi.org/10.21273/hortsci.41.5.1272.

Full text

Abstract:

Many homeowners have difficulty establishing ornamental gardens in shallow, rocky soils. “Gardening in a Bag” (planting directly into bags of topsoil) offers a viable alternative for growing many herbaceous ornamental plants. This study compares the growth and appearance of several herbaceous bedding plants using “Gardening in a Bag” versus “in the ground” planting methods. Twenty-five cultivars of Alternanthera dentata R. Br., ornamental pepper (Capsicum annuum var. annuum L.), dianthus (Dianthus barbatus L.), gazania [Gazania rigens (L.) Gaertn.], marigold (Tagetes patula L.), petunia (Petunia hybrida hort. ex E. Vilm.), salvia (Salvia splendens Sellow ex Schult.), peek-a-boo plant (Spilanthes oleracea L.), verbena (Verbena hybrida hort. ex Groenl. & Rümpler), and vinca [Catharanthus roseus (L.) G. Don] were evaluated in 2002 under the two planting methods: in the ground versus in bags of topsoil. Wave petunias, dianthus, vinca, and rose moss (Portulaca grandiflora Hook.) were evaluated using the same methods in 2003. All plants were mulched with 7.5 cm coarse sawdust. In 2002, the planting method had no effect on the average height for 16 of the 25 cultivars tested. Seven cultivars were taller when grown in the ground whereas two cultivars were shorter during that treatment. Planting method had no effect on average plant spread of 13 of the cultivars. Plant spread was greater for nine cultivars grown in bags, whereas three cultivars were wider when grown in the ground. Visual ratings of overall appearance were similar for 14 of the cultivars regardless of planting method. In 2003, performance of the five species was evaluated on 3 July, 29 July, and 5 Sept. Planting method did not affect growth and appearance of rose moss or vinca. The two petunia cultivars and the dianthus tended to be taller and wider and had more flowers when grown in the ground compared with growth in bags. Visual quality of the petunias and the dianthus was unaffected by planting method until September when the `Purple Wave' petunias and the dianthus grown in the ground received better ratings than plants grown in bags.

APA, Harvard, Vancouver, ISO, and other styles

33

Rocha de Souza Drumond, Adriana, Efraim Lázaro Reis, Maria Adelaide Vasconcelos Rabelo Veado, and José Márcio Quintão Moreira. "UTILIZAÇÃO DE MAPAS AUTO-ORGANIZÁVEIS PARA VERIFICAÇÃO DA DISTRIBUIÇÃO DE METAIS NA ATMOSFERA DE IPATINGA, MINAS GERAIS, ATRAVÉS DE BIOMONITORAMENTO COM Sphagnum capillifolium." Eclética Química Journal 39, no. 1 (July 9, 2014): 175. http://dx.doi.org/10.26850/1678-4618eqj.v39.1.2014.p175-191.

Full text

Abstract:

This paper refers to the active biomonitoring moss bag of air quality of Ipatinga - MG, using Sphagnum capillifolium, determining the metals Al, Ca, Cd, Cr, Co, Cu, Fe, In, Li, Mg, Mn , Ni, Pb, Sn, Sr, Tl and Zn adsorbed on plant material through the analytical technique of Optical Emission Spectrometry with Inductively Coupled Plasma (ICP-OES). The self-organizing maps have proved useful to visualize the similarities and differences of samples and variables, making a positive correlation with the experimental observations. Both in the dry and in the rainy season, it was found that the majority of certain metals in plant samples were identified in the southern districts of this research, the regions predominant wind direction and close to local steel. In the dry period were higher concentrations of certain metals.

APA, Harvard, Vancouver, ISO, and other styles

34

Chong, Calvin. "Experiences with Weed Discs and Other Nonchemical Alternatives for Container Weed Control." HortTechnology 13, no. 1 (January 2003): 23–27. http://dx.doi.org/10.21273/horttech.13.1.0023.

Full text

Abstract:

The first weed disc (Weed Guard) was introduced to Ontario in the early 1980s. They were made of semirigid plastic similar to 45-rpm records. Small holes allow water to penetrate but weeds germinating on the substrate often grow through them. In the 1990s, we obtained 85% reduction of container weeds using discs made from geotextile fabric (Mori Guard) or foam (similar to polyfoam used for container winter protection). The foam disc tended to curl upward at the edges, become easily windblown, and tended to partially expose the surface of the container mix. During the past 15 years, we have annually reused the same fabric discs (now unavailable due to high unit cost), and have tested various other weed discs, including several new-generation types and also the Mori Weed Bag. The new-generation discs are fabricated from materials such as fabric (Tex-R Geodisc), pressed peat moss (Biodisc), corrugated cardboard (Corrudisc), and plastic (Enviro LID). Both Tex-R Geodisc and Enviro LID were as effective or better in controlling weeds than weekly hand-weeding, herbicides, or the Mori Guard fabric disc. The Mori Weed Bag, a patented black polyethylene sleeve with prepunched holes fitted around the container like a florist's plant prepared for market, is used effectively and almost exclusively by one Ontario nursery. We also tested two types of insulated blanket covers, which when placed around the ball of above-ground container-grown trees, prevented weed growth during the summer and also protected the root ball against cold during the winter. We introduced the garbage bag sleeve, the ultimate no-weed method for pot-in-pot tree culture, which also reduces water use and frequency of irrigation. Due to factors such as under-performance, insufficient demand, and/or high costs, only certain discs are currently manufactured: Weed Guard, Tex-R Geodisc, Biodisc, and Enviro LID. The Mori Weed Bag is available but not the insulated blankets.

APA, Harvard, Vancouver, ISO, and other styles

35

Gutberlet, Jutta. "Uso de Sphagnum recurvum P. Beauv. como biofiltro no monitoramento de poluição aérea industrial de metais pesados." Acta Botanica Brasilica 2, no. 1 suppl 1 (1988): 103–14. http://dx.doi.org/10.1590/s0102-33061988000300010.

Full text

Abstract:

O uso de bioindicadores e biofiltros, principalmente plantas inferiores, representa uma alternativa eficiente no monitoramento da qualidade ambiental. A vantagem do emprego de vegetais na avaliação da contaminação ambiental consiste no reduzido custo de instalação e no fato de poder retratar uma situação global, integrando a soma dos diferentes efeitos dos agentes contaminantes. Segundo o método "moss-bag", adaptado aos fatores regionais específicos, foram empregados saquinhos de nylon contendo o musgo Sphagnum Recurvum P. Beauv. como biofiltro dentro do estudo realizado na Serra do Mar de Cubatão/SP/Brasil. A contaminação atmosférica de metais pesados (Al, Fe, Ni, Zn) foi monitorada mensalmente durante o ano de 1987. Primeiros dados analíticos sobre a acumulação absoluta e relativa dos metais pesados em ppm e porcentagem (%), respectivamente, confirmam a excelente capacidade de retenção de agentes contaminantes atmosféricos pelo musgo.

APA, Harvard, Vancouver, ISO, and other styles

36

Vuković, Gordana, Mira Aničić Urošević, Sandra Škrivanj, Tijana Milićević, Dragoljub Dimitrijević, Milica Tomašević, and Aleksandar Popović. "Moss bag biomonitoring of airborne toxic element decrease on a small scale: A street study in Belgrade, Serbia." Science of The Total Environment 542 (January 2016): 394–403. http://dx.doi.org/10.1016/j.scitotenv.2015.10.091.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Rajfur, Małgorzata, Paweł Świsłowski, Filip Nowainski, and Bogusław Śmiechowicz. "Mosses as Biomonitor of Air Pollution with Analytes Originating from Tobacco Smoke." Chemistry-Didactics-Ecology-Metrology 23, no. 1-2 (December 1, 2018): 127–36. http://dx.doi.org/10.1515/cdem-2018-0008.

Full text

Abstract:

Abstract The aim of the carried out research was the assessment of the possibility to use a popular bioindicator - Pleurozium schreberi mosses as a biosensor of the air pollution in living quarters with the analytes originating from tobacco smoke. The moss bag method of active biomonitoring, popular in environmental studies, was applied; the method is based on exposing mosses collected in clean areas in the locations polluted with, for example, heavy metals. However, this experiment involved exposing mosses in living quarters, in which approximately 10 cigarettes were smoked daily (first room - kitchen). For the purpose of comparison, moss samples were also placed in another room (bedroom), which was potentially not polluted. After three months of exposure, the following heavy metals were determined in mosses: Mn, Fe, Ni, Cu, Zn, Cd, Pb and Hg, using the atomic absorption spectrometry method. Additionally, these analytes were also determined in hair samples from the persons smoking in the room and from other smokers; the determined metal concentrations were compared with the results of the studies carried out using hair samples collected from non-smokers. On the basis of carried out research it was confirmed that, among others, the mosses exposed in living quarters accumulate heavy metals, such as Ni, Zn, Pb and Hg, which originate from tobacco smoke. Higher heavy metal concentrations were determined in hair samples from smokers, compared to hair samples from non-smokers.

APA, Harvard, Vancouver, ISO, and other styles

38

Di Palma, A., D. Crespo Pardo, V. Spagnuolo, P. Adamo, R. Bargagli, D. Cafasso, F. Capozzi, et al. "Molecular and chemical characterization of a Sphagnum palustre clone: Key steps towards a standardized and sustainable moss bag technique." Ecological Indicators 71 (December 2016): 388–97. http://dx.doi.org/10.1016/j.ecolind.2016.06.044.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Makholm, M. M., and David J. Mladenoff. "Efficacy of a Biomonitoring (Moss Bag) Technique for Determining Element Deposition Trends on a Mid-Range (375 Km) Scale." Environmental Monitoring and Assessment 104, no. 1-3 (May 2005): 1–18. http://dx.doi.org/10.1007/s10661-005-6398-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Vuković, Gordana, Mira Aničić Urošević, Miodrag Pergal, Milan Janković, Zoya Goryainova, Milica Tomašević, and Aleksandar Popović. "Residential heating contribution to level of air pollutants (PAHs, major, trace, and rare earth elements): a moss bag case study." Environmental Science and Pollution Research 22, no. 23 (July 28, 2015): 18956–66. http://dx.doi.org/10.1007/s11356-015-5096-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

41

Gao, Guiping, Hui Zeng, and Qixing Zhou. "Biomonitoring Atmospheric Pollution of Polycyclic Aromatic Hydrocarbons Using Mosses." Atmosphere 14, no. 1 (December 23, 2022): 26. http://dx.doi.org/10.3390/atmos14010026.

Full text

Abstract:

Polycyclic aromatic hydrocarbons (PAHs), as the main components of petroleum hydrocarbons (PHCs), are carcinogenic organic pollutants that occur widely in the atmospheric environment with increasing concentration. Moreover, PAHs are widespread all over the world due to their high volatility and long-range transport potential. The monitoring of atmospheric PAHs is often limited by working conditions, especially around oil field operation areas and other industrial areas. Mosses (Bryophyta), the most sensitive atmosphere pollution indicators, can be easily collected and have been used to monitor atmospheric pollutants including PAHs. Thus, characteristics and influencing factors of mosses’ absorption and accumulation of PAHs in the atmosphere were discussed, and the application of mosses in the biomonitoring of atmospheric PAHs were summarized. Biomonitoring mosses include Dicranum scoparium, Hypnum cupressiforme, Thamnobryum alopecurum, Thuidium tamariscinum, Hylocomium splendens, Pleurozium scheberi, etc. Currently, the main methods for monitoring PAHs by mosses are biomonitoring with the chemical analysis method, the index of atmospheric purity (IAP) method, the ecological survey method, and the Moss-bag technique. Biomonitoring of atmospheric PAHs using mosses has a relatively wide range of prospects.

APA, Harvard, Vancouver, ISO, and other styles

42

Capozzi, F., P. Adamo, A. Di Palma, J. R. Aboal, R. Bargagli, J. A. Fernandez, P. Lopez Mahia, et al. "Sphagnum palustre clone vs native Pseudoscleropodium purum : A first trial in the field to validate the future of the moss bag technique." Environmental Pollution 225 (June 2017): 323–28. http://dx.doi.org/10.1016/j.envpol.2017.02.057.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Giordano, S., P. Adamo, V. Spagnuolo, M. Tretiach, and R. Bargagli. "Accumulation of airborne trace elements in mosses, lichens and synthetic materials exposed at urban monitoring stations: Towards a harmonisation of the moss-bag technique." Chemosphere 90, no. 2 (January 2013): 292–99. http://dx.doi.org/10.1016/j.chemosphere.2012.07.006.

Full text

APA, Harvard, Vancouver, ISO, and other styles

44

Matny, O. N. "First Report of Damping-Off of Okra Caused by Phytophthora nicotianae in Iraq." Plant Disease 97, no. 4 (April 2013): 558. http://dx.doi.org/10.1094/pdis-08-12-0735-pdn.

Full text

Abstract:

Okra, Abelmoschus esculentus L., is a popular vegetable grown in Iraq. Three pathogens have been identified as causal agents of damping-off of okra in Iraq: Pythium spp., Rhizoctonia solani, and Fusarium solani (1). In California and Brazil, Phytophthora nicotianae has also been reported as a pathogen of okra (2). P. nicotianae can cause significant damage when soils are cool to warm (20 to 30°C) and wet. Damping-off is now considered one of the most important and destructive diseases of okra in Iraq with disease incidence reaching 50 to 75% in some fields. In March and April 2012, symptoms of damping-off were observed in two okra fields of ~0.75 and 1.50 ha located north and south of Baghdad, Iraq, respectively. The symptoms included dark brown lesions that coalesced, girdling the stem at the base, and causing seedling collapse within a few days. Symptomatic tissues were surface-sterilized in 1% NaOCl for 1 min and plated on potato dextrose agar (PDA). Emerging fungal colonies were transferred to new plates of PDA and incubated at 25°C. P. nicotianae was identified by morphological and molecular techniques. Spherical, bipapillate sporangia had a mean length of 48 μm, mean width of 40 μm, and 1.0 to 1.4:1.0 ratio of length to breadth with 40-μm-long chlamydospores. Oospores and antheridia were not observed when two isolates were grown on PDA or in water. Swelling and radiating hyphae developed in water culture. No hyphal growth was observed on PDA when the culture was incubated at 35°C. These morphological and cultural characteristics were similar to those reported by van Breda de Haan (4) concerning P. nicotianae. The identification of two isolates was confirmed by sequencing the internal transcribed spacer (ITS) region of rDNA using forward and reverse primers (ITS1: I1, TCCGTAGGTGAACCTGCGG; and ITS4: I4, TCCTCCGCTTATTGATATGC, respectively) at the BCCM/LMG Microbiology Collection Laboratory for Microbiology, University of Ghent, Belgium (MUCL 54380). The ITS rDNA consensus sequence for the two isolates showed 99% identity with the ITS sequences of known P. nicotianae isolates, and was deposited in GenBank. Pathogenicity tests of one of the isolates of P. nicotianae were performed on okra seedlings of a local cultivar grown in a 1:1 mixture of sterile soil and peat moss in pots (each 5 cm tall × 10 cm wide). The soil peat mix in each pot was infested with a half PDA plate of fungal growth (7 days old), from which the mycelium and agar were homogenized and added to the soil. A half PDA plate without P. nicotianae was added to potting mix for the non-inoculated treatment. Ten okra seeds were sown in each pot and three pots were used for each treatment. Plants were irrigated as needed with sterilized water, and maintained in a greenhouse at 25 ± 2°C with 100% relative humidity for 48 h by covering the pots with polyethylene bag. Thereafter, the bags were removed and the pots kept in the greenhouse at ambient relative humidity (approximately 50%) for 5 days. Inoculated plants showed seed decay and damping-off after 7 days, whereas control plants remained healthy. The pathogen reisolated from inoculated seedling had the same morphological and molecular (ITS rDNA) characteristics as described above. References: (1) A. J. Al Ashoor. Ph.D. Thesis, University of Koofa, Iraq, 2009. (2) D. C. Erwin. Phytopathology 54:114, 1964. (3) D. S. M. Maria et al. Summa Phytopatológica 29:193, 2003. (4) C. Waterhouse. Key to the Species of Phytophthora De Bary. Comm. Mycol. Papers No. 92, 1963.

APA, Harvard, Vancouver, ISO, and other styles

45

van Laaten, Neele, Dirk Merten, Wolf von Tümpling, Thorsten Schäfer, and Michael Pirrung. "Comparison of Spider Web and Moss Bag Biomonitoring to Detect Sources of Airborne Trace Elements." Water, Air, & Soil Pollution 231, no. 10 (September 30, 2020). http://dx.doi.org/10.1007/s11270-020-04881-8.

Full text

Abstract:

Abstract Atmospheric particulate matter has become a major issue in urban areas from both a health and an environmental perspective. In this context, biomonitoring methods are a potential complement to classical monitoring methods like impactor samplers, being spatially limited due to higher costs. Monitoring using spider webs is compared with the more common moss bag technique in this study, focusing on mass fractions and ratios of elements and the applicability for source identification. Spider webs and moss bags with Hypnum cupressiforme were sampled at the same 15 locations with different types of traffic in the city of Jena, Germany. In the samples, mass fractions of 35 elements, mainly trace metals, were determined using inductively coupled plasma-optical emission spectroscopy (ICP-OES) and inductively coupled plasma-mass spectrometry (ICP-MS) after aqua regia digestion. Significantly higher mass fractions in spider webs than in moss bags were found, even after a much shorter exposure period, and could not be ascribed completely to a diluting effect by the biological material in the samples. Different mechanisms of particle retention by the two materials are therefore assumed. More significant correlations between elements have been found for the spider web dataset. Those patterns allow for an identification of different sources of particulate matter (e.g. geogenic dust, brake wear), while correlations between elements in the moss bags show a rather general anthropogenic influence. Therefore, it is recommended to use spider webs for the short-term detection of local sources while moss bag biomonitoring is a good tool to show a broader, long-term anthropogenic influence.

APA, Harvard, Vancouver, ISO, and other styles

46

MacNairn, Ian Adam Smith, and Abdullah Al-Ani. "Âcimowin Waspison: Cultivating curiosity, sharing stories, and taking steps forward in Canada’s ‘Calls to Action’." Paediatrics & Child Health, February 22, 2022. http://dx.doi.org/10.1093/pch/pxab098.

Full text

Abstract:

Abstract We have yet to fully walk the path of the Calls to Action put forth by the Truth & Reconciliation Commission of Canada within our health care system. In this piece, we offer a suggestion of enhanced and increased curiosity and empathy in our practice as health care providers, particularly in regard to Call 22. This encouragement is exemplified through sharing learning we received around an Indigenous way of knowing and traditional health practice: waspison, known in English as, ‘moss bag’. Waspison is a sacred prenatal and postnatal practice used since time immemorial and carrying through to today, across Canada and the USA. It is a novel teaching example not previously discussed in medical literature. Our intention is to stoke greater interest in practicing deep caring for our patients in ways that are culturally humble, safe, and as competent as possible. That is, learning more about our patients through curiosity and empathy.

APA, Harvard, Vancouver, ISO, and other styles

47

Aničić Urošević, Mira, Maja Kuzmanoski, Tijana Milićević, Igor Kodranov, Konstantin Vergel, and Aleksandar Popović. "Moss bag sensitivity for the assessment of airborne elements at suburban background site during spring/summer season characterized by Saharan dust intrusions." Air Quality, Atmosphere & Health, January 27, 2022. http://dx.doi.org/10.1007/s11869-022-01161-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

48

Quaiattini, Andrea. "The Owl and the Lemming by R. Akulukjuk." Deakin Review of Children's Literature 7, no. 2 (October 30, 2017). http://dx.doi.org/10.20361/g2nh47.

Full text

Abstract:

Akulukjuk, Roselynn. The Owl and the Lemming, illustrated by Amanda Sandland, Inhabit Media, 2016.The Owl and the Lemming is a traditional Inuit fable, and is based off of Roselynn Akulukjuk’s live-action and puppetry short film of the same name. This is a simple story of pride getting in the way of a tasty dinner on the Arctic tundra.After a long winter, Lemming comes out of her burrow to gorge herself on the tasty moss. Owl, who is also hungry, sees Lemming, and blocks the entrance to her home. Unable to pass, Lemming realizes she will have to trick Owl into moving away from her home. She suggests to Owl that he lean back, and look up into the blue sky - “No way! I am not stupid!” She then suggests that Owl wait for a fatter lemming to come by - “Why would I want to wait for a lemming that might never come out when I can just eat you?” Finally, Lemming suggests they have a contest to see who can jump the highest.The book is written simply enough that it could be used for children to practice their reading, though the text size is small and compact, making pointing a challenge. The illustrations are a combination of photographs of the tundra landscape, with Owl and Lemming superimposed as cartoon figures, which makes for an odd juxtaposition. However, the cartoons do allow for Owl and Lemming to show their personalities and reactions to their respective predicaments.Overall, this is an entertaining story, and the illustrations help to root it in the Inuit tradition. This book would do well in both schools and public libraries.Recommended: 3 out of 4 starsReviewer: Andrea QuaiattiniAndrea Quaiattini is a Public Services Librarian at the University of Alberta’s JW Scott Health Sciences Library. While working as a camp counsellor, she memorized Mortimer and The Paper Bag Princess by Robert Munsch as bedtime stories for the kids. She can still do all the voices.

APA, Harvard, Vancouver, ISO, and other styles

49

Crous, P. W., D. A. Cowan, G. Maggs-Kölling, N. Yilmaz, R. Thangavel, M. J. Wingfield, M. E. Noordeloos, et al. "Fungal Planet description sheets: 1182–1283." Persoonia - Molecular Phylogeny and Evolution of Fungi, 2021. http://dx.doi.org/10.3767/persoonia.2021.46.11.

Full text

Abstract:

Novel species of fungi described in this study include those from various countries as follows: Algeria, Phaeoacremonium adelophialidum from Vitis vinifera. Antarctica, Comoclathris antarctica from soil. Australia, Coniochaeta salicifolia as endophyte from healthy leaves of Geijera salicifolia, Eremothecium peggii in fruit of Citrus australis, Microdochium ratticaudae from stem of Sporobolus natalensis, Neocelosporium corymbiae on stems of Corymbia variegata, Phytophthora kelmanii from rhizosphere soil of Ptilotus pyramidatus, Pseudosydowia backhousiae on living leaves of Backhousia citriodora, Pseudosydowia indooroopillyensis, Pseudosydowia louisecottisiae and Pseudosydowia queenslandica on living leaves of Eucalyptus sp. Brazil, Absidia montepascoalis from soil. Chile, Ilyonectria zarorii from soil under Maytenus boaria. Costa Rica, Colletotrichum filicis from an unidentified fern. Croatia, Mollisia endogranulata on deteriorated hardwood. Czech Republic, Arcopilus navicularis from tea bag with fruit tea, Neosetophoma buxi as endophyte from Buxus sempervirens, Xerochrysium bohemicum on surface of biscuits with chocolate glaze and filled with jam. France, Entoloma cyaneobasale on basic to calcareous soil, Fusarium aconidiale from Triticum aestivum, Fusarium juglandicola from buds of Juglans regia. Germany, Tetraploa endophytica as endophyte from Microthlaspi perfoliatum roots. India, Castanediella ambae on leaves of Mangifera indica, Lactifluus kanadii on soil under Castanopsis sp., Penicillium uttarakhandense from soil. Italy, Penicillium ferraniaense from compost. Namibia, Bezerromyces gobabebensis on leaves of unidentified succulent, Cladosporium stipagrostidicola on leaves of Stipagrostis sp., Cymostachys euphorbiae on leaves of Euphorbia sp., Deniquelata hypolithi from hypolith under a rock, Hysterobrevium walvisbayicola on leaves of unidentified tree, Knufia hypolithi and Knufia walvisbayicola from hypolith under a rock, Lapidomyces stipagrostidicola on leaves of Stipagrostis sp., Nothophaeotheca mirabibensis (incl. Nothophaeotheca gen. nov.) on persistent inflorescence remains of Blepharis obmitrata, Paramyrothecium salvadorae on twigs of Salvadora persica, Preussia procaviicola on dung of Procavia sp., Sordaria equicola on zebra dung, Volutella salvadorae on stems of Salvadora persica. Netherlands, Entoloma ammophilum on sandy soil, Entoloma pseudocruentatum on nutrient poor (acid) soil, Entoloma pudens on plant debris, amongst grasses. New Zealand, Amorocoelophoma neoregeliae from leaf spots of Neoregelia sp., Aquilomyces metrosideri and Septoriella callistemonis from stem discolouration and leaf spots of Metrosideros sp., Cadophora neoregeliae from leaf spots of Neoregelia sp., Flexuomyces asteliae (incl. Flexuomyces gen. nov.) and Mollisia asteliae from leaf spots of Astelia chathamica, Ophioceras freycinetiae from leaf spots of Freycinetia banksii, Phaeosphaeria caricis-sectae from leaf spots of Carex secta. Norway, Cuphophyllus flavipesoides on soil in semi-natural grassland, Entoloma coracis on soil in calcareous Pinus and Tilia forests, Entoloma cyaneolilacinum on soil semi-natural grasslands, Inocybe norvegica on gravelly soil. Pakistan, Butyriboletus parachinarensis on soil in association with Quercus baloot. Poland, Hyalodendriella bialowiezensis on debris beneath fallen bark of Norway spruce Picea abies. Russia, Bolbitius sibiricus on а moss covered rotting trunk of Populus tremula, Crepidotus wasseri on debris of Populus tremula, Entoloma isborscanum on soil on calcareous grasslands, Entoloma subcoracis on soil in subalpine grasslands, Hydropus lecythiocystis on rotted wood of Betula pendula, Meruliopsis faginea on fallen dead branches of Fagus orientalis, Metschnikowia taurica from fruits of Ziziphus jujube, Suillus praetermissus on soil, Teunia lichenophila as endophyte from Cladonia rangiferina. Slovakia, Hygrocybe fulgens on mowed grassland, Pleuroflammula pannonica from corticated branches of Quercus sp. South Africa, Acrodontium burrowsianum on leaves of unidentified Poaceae, Castanediella senegaliae on dead pods of Senegalia ataxacantha, Cladophialophora behniae on leaves of Behnia sp., Colletotrichum cliviigenum on leaves of Clivia sp., Diatrype dalbergiae on bark of Dalbergia armata, Falcocladium heteropyxidicola on leaves of Heteropyxis canescens, Lapidomyces aloidendricola as epiphyte on brown stem of Aloidendron dichotomum, Lasionectria sansevieriae and Phaeosphaeriopsis sansevieriae on leaves of Sansevieria hyacinthoides, Lylea dalbergiae on Diatrype dalbergiae on bark of Dalbergia armata, Neochaetothyrina syzygii (incl. Neochaetothyrina gen. nov.) on leaves of Syzygium chordatum, Nothophaeomoniella ekebergiae (incl. Nothophaeomoniella gen. nov.) on leaves of Ekebergia pterophylla, Paracymostachys euphorbiae (incl. Paracymostachys gen. nov.) on leaf litter of Euphorbia ingens, Paramycosphaerella pterocarpi on leaves of Pterocarpus angolensis, Paramycosphaerella syzygii on leaf litter of Syzygium chordatum, Parateichospora phoenicicola (incl. Parateichospora gen. nov.) on leaves of Phoenix reclinata, Seiridium syzygii on twigs of Syzygium chordatum, Setophoma syzygii on leaves of Syzygium sp., Starmerella xylocopis from larval feed of an Afrotropical bee Xylocopa caffra, Teratosphaeria combreti on leaf litter of Combretum kraussii, Teratosphaericola leucadendri on leaves of Leucadendron sp., Toxicocladosporium pterocarpi on pods of Pterocarpus angolensis. Spain, Cortinarius bonachei with Quercus ilex in calcareus soils, Cortinarius brunneovolvatus under Quercus ilex subsp. ballota in calcareous soil, Extremopsis radicicola (incl. Extremopsis gen. nov.) from root-associated soil in a wet heathland, Russula quintanensis on acidic soils, Tubaria vulcanica on volcanic lapilii material, Tuber zambonelliae in calcareus soil. Sweden, Elaphomyces borealis on soil under Pinus sylvestris and Betula pubescens. Tanzania, Curvularia tanzanica on inflorescence of Cyperus aromaticus. Thailand, Simplicillium niveum on Ophiocordyceps camponoti-leonardi on underside of unidentified dicotyledonous leaf. USA, Calonectria californiensis on leaves of Umbellularia californica, Exophiala spartinae from surface sterilised roots of Spartina alterniflora, Neophaeococcomyces oklahomaensis from outside wall of alcohol distillery. Vietnam, Fistulinella aurantioflava on soil. Morphological and culture characteristics are supported by DNA barcodes.

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'Moss-bag'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles