Journal articles on the topic 'Minor Historical Centres (MHC)'

Abstract. The main topic of this work focuses on the semantic, historical and spatial documentation of Minor Historical Centres (MHC) with a focus on (semi-abandoned alpine) hamlets. The key point is the possibility to standardise spatial information in the domain of MHC and their related cultural, architectural, built and landscape heritage. This work analyses the notions of historical centre and ancient area, which took different meanings and evolved over the centuries. MHC are historical part of cities, villages and hamlets (urban, rural, minor or abandoned) with cultural, social and economic values. Thus, MHC need to be preserved, documented and safeguarded. The spatial and semantic documentation is a fundamental tool for increasing their knowledge. In these places, many actors and stakeholders are involved in different activities, and for this reason, they need to share common knowledge and use a unique language. In this regard, spatial ontology is of relevant interest and usability. Ontologies are conceptual structures that formalise specific knowledge and create a unique and standard thesaurus that ensures semantic interoperability. This paper is part of a PhD research targeted at developing an ontology containing helpful information to manage, share and collect data on MHC due to the lack of an interoperable structure to formalise such knowledge. The main aim is to populate and enrich the already developed ontological structure with data of a mountain semi-abandoned hamlet: Pomieri. The methodological workflow is validated, enriching and populating the ontology, adding classes and instances with information and unstructured data of a real data case study.

Heritage tourism bases its definition on searching for different, authentic, and somewhat unexplored places. Recent literature speaks of the growth of new forms of tourism based on the tradition that seeks to surprise visitors with popular culture, traditional activities, or actions that bring traditional culture closer to tourists. However, the reality is that the influx of tourists to small mountain villages is marked by the most “monumental” historical and architectural values, leaving aside some other minor attributes. This article uses the historical centres of rural villages to place inhabitants’ knowledge at the centre of tourism initiatives. The aim of the study was to develop cohesive and inclusive tourism activities in historic centres by analysing the built environment’s attributes and values. A participatory methodology marks the cultural change to enhance collaboration through transparent and ethical foundations and respect these places’ distinctive character. The study of values helped to conduct an in-depth analysis of local realities to document and map historical centres’ tangible attributes through crafts, traditional culture, and local heritage forms.

The localisation of the three cities / centres of early Rus’ mentioned by Islamic authors is complicated due to significant differences in the versions of this plot. However, the traditional orientation of most historical interpretations to Eastern Slavic medieval realities does not find confirmation in narrative and archaeological data. The original core of the plot was connected with the state-political formations that left the monuments of Saltovo-Mayaki archaeological culture in the basin of the Don and its tributaries. Subsequently, after the destruction of some of these formations, this real plot acquires legendary details, Arab and Persian geographers change the location of some of its main points to the south of the Caucasus. The threads of biblical stories about the prince or the people of Rosh, connected with the Lesser Caucasus or Asia Minor, are woven into the historical canvas.

This article analyses the differences and similarities between documentation centres active in the aftermath of the Holocaust both in France and in Poland. While in Poland the task was from 1945 assigned to the Central Jewish Historical Commission, in France, the Center of Contemporary Jewish Documentation quickly overtook the lead on other minor centres established by Communist Jews or Bundists. The paper focuses on the links between those institutions, through contacts between members, exchanges of documentation, and parallel publications and exhibits. It shows that despite quite different political conditions, men and women working in these institutions shared a similar vision of transmission of history and memory of the Holocaust. They managed to implement their vision pa 19.03.2019 rtly thanks to their transnational links that helped transcend political and material difficulties.

AbstractSince 1995, the ancient city of Kibyra, situated in southwestern Turkey, has been investigated through historical, epigraphic and archaeological surveys. During the ceramic survey, an area inside the city was found where vessels with identical characteristics of surface and fabric were observed. This area is located in the northwestern part of the city close to the theatre. Together with numerous misfired pieces, these vessel fragments are suggestive of a potters' quarter. Based on historical evidence and ceramic comparisons, pottery production in Kibyra can be dated between the late Hellenistic and early Byzantine periods. Not only are the potters' quarter itself and the forms and types produced there of interest, but they also widen our knowledge of different ceramic production centres in the region of ancient Asia Minor. With the help of this material, archaeologists working on other sites will be able to recognise Kibyran pottery and provide us with information about trade connections between Kibyra and other regions.

This article explores measures, operationalisations and effects of rhythm and weight as two constraints on the variation between thes-genitive and theof-genitive. We base the analysis on interchangeable genitives in the news and letters sections of ARCHER (A Representative Corpus of Historical English Registers), which covers the period between 1650 and 1999. Thus, we are ultimately concerned with the applicability of two factors that have their roots in speech (rhythm: phonology; weight: online processing) to an ‘unconventional’, written data set with a historical dimension. As for weight, we focus on the comparison of simple single-constituent and more complex multi-constituent measurements. Our notion of rhythm centres on the ideally even distribution of stressed and unstressed syllables. We find that in our data set, both rhythm and weight show theoretically unexpected quadratic effects: rhythmically better-behaveds-genitives are not necessarily preferred overof-genitives, and short constituents exhibit odd weight effects. In conclusion, we argue that while rhythm is only a minor player in our data set, the quadratic quirks it exhibits should inspire further study. Weight, on the other hand, is a crucial factor which, however, likewise comes with measurement and modelling complications.

Historical masonry towers are relevant architectural heritage often in a strategic position within city centres. Their height and position require specific controls in order to define the state of preservation. The paper describes the investigation procedures developed by the authors in selected case studies. According to the timing and to the complexity of the structure, the approach requires preliminary visual inspections, geometric, crack pattern survey supplemented by historical research and stratigraphic survey. Operational modal testing evaluates the overall structural behaviour, indicating eventual local (or global) problems to study in depth by monitoring or further local tests. Emergency operations, such as controls after earthquakes, could require prompt procedures. In this case, the combination of visual inspection, geometric and damage survey with dynamic testing is a reliable procedure for structural assessment. Additional investigation increases the knowledge of local problems or gives information for further activity such as structural modelling. For instance, relevant data are the evaluation of the masonry quality or the control of the local state of stress to estimate through non-destructive or minor destructive testing in selected positions. Nevertheless, such activities require accurate projects of the investigation too, planning and localising several tests in order to solve the problems detected in the preliminary steps of the diagnosis process.

The 2020 collapse of the global economy due to the Covid-19 pandemic has enabled us to think about long term trends and what the future could hold for our cities and regions, especially due to the climate agenda. The paper sets out the historical precedents for economic transitions after collapses that unleash new technologically based innovation waves. These are shown to be associated with different energy and infrastructure priorities and their transport and resulting urban forms. The new technologies in the past were emerging but mainstreamed as the new economy was built on new investments. The paper suggests that the new economy, for the next 30 years, is likely to be driven by the Paris Agreement and Sustainable Development Goals (SDGs) agendas (summarised as zero carbon–zero poverty) and will have a strong base in a cluster of innovative technologies: renewable energy, electromobility, smart cities, hydrogen-based industry, circular economy technologies, and biophilic urbanism. The first three are well underway, and the other three will need interventions if not cultural changes and may miss being mainstreamed in this recovery but could still play a minor role in the new economy. The resulting urban transformations are likely to build on Covid-19 through “global localism” and could lead to five new features: (1) relocalised centres with distributed infrastructure, (2) tailored innovations in each urban fabric, (3) less car dependence, (4) symbiotic partnerships for funding, and (5) rewritten manuals for urban professionals. This period needs human creativity to play a role in revitalising the human dimension of cities. The next wave following this may be more about regenerative development.

The perception of the landscape by the population is one of the themes introduced by the European Landscape Convention. Perception is the key to the integration between human and territorial activities, and between economic development and sustainability. Local Action Groups (LAGs) are groups with territorial boundaries, established by the European Common Agricultural Policy for implementing local development strategies by awarding grants to local projects. The aim of this work is the development of a method for evaluating the ability of the LAGs to enhance the sense of belonging of the population with their territories. The developed method includes identification of those natural, agricultural, historical, and cultural resources for which people feel a sense of belonging, and evaluation of the same through a comprehensive multivariate statistical analysis. This paper reports the results of the statistical analysis of the rankings of local landscapes made by 330 residents of an Italian LAG on the basis of their sense of belonging with them. People showed that the community of the studied LAG does not recognize itself in the typical crops of the entire area, and the attachment to minor historical centres scattered in the territory remains the prerogative of the individual municipalities. The results of this method could be used as a performance indicator for a local plan, in respect to the creation of a shared perception of the local area.

The fortified settlement at Dolní Věstonice – Vysoká zahrada belongs to the important Early Medieval centres connected with the establishment of the Přemyslid domain in Moravia. The site functioned as a local administrative and economic centre from about the middle of the 11th century to the end of the 12th century. In written historical sources it was known as Strachotíngrad (“Castrum Strachotín”). Between 1948 and 1986, several minor archaeological excavations were made at this site. Our work’s purpose was to gain new knowledge by deploying proven geophysical prospecting methods in archaeology. The first two of these methods, Electrical Resistivity Tomography (ERT) and Groundpenetrating radar (GPR) focused on the rampart. Within the third used method – magnetometry, we focused on the prospection of the inner area of the hillfort. Based on the results, it was possible to identify some of the construction features of the fortification and locate the course of the no longer existing rampart and several settlement structures. At the same time, the geophysical survey also made clear the overall plan of past archaeological excavations.

Abstract On behalf of Eurobank Members CD1a is a lipid antigen-presenting protein related to MHC class I that is frequently but incorrectly said to be non-polymorphic. There are two alleles in humans that differ by two linked amino acid substitutions, I13T and W51C in the alpha-1 domain. Substitution of threonine and cysteine in the minor allele may modify the structure of the antigen-binding groove and influence antigen specificity and T cell recognition. The CD1a gene on chromosome 1 may be mismatched in MHC identical sibling transplants, but the effect of this on GVHD is unknown. We hypothesized that CD1a might act as a tissue antigen and that GVHD would increase in recipients who possessed an allele unknown to the donor. 163 recipient-donor sibling pairs transplanted with full and reduced intensity conditioning but without T depletion were identified from a database of all sequential transplants performed in Newcastle from Nov 1984 to Sept 2004 and in collaborating Eurobank centres from Nov 1997 to Sept 2004. DNA was amplified by PCR primers 5′: CCTGGAAACAAAATCTGGTC and 3′: GGGTACTTAACGTCAAACTT producing a 209 bp fragment, encompassing the C to G substitution at nucleotide 738 (W51C). This was analysed by SSCP and RFLP using the Hae III site 737–741. The overall allele frequency was: allele 1 (I13; W51): 0.07; allele 2 (T13; C51): 0.93. 148 pairs were matched at CD1a (2,2 into 2,2 or 1,2 into 1,2) and 15 were unmatched in the GVHD direction (2,2 into 1,2). There were no significant differences between the cohorts in age, gender mismatch, conditioning or transplant center. 5 year projected survival was 57% months in the matched cohort and 59% months in the unmatched (p=0.10 Kaplan-Meier). 43/148 (29%) matched transplants received cyclosporin alone GVHD prophylaxis compared with 9/15 (60%) of unmatched transplants (p=0.01; Fisher’s exact test). The incidence and severity of GVHD was similar in both matched and unmatched cohorts: grade I–IV: 81% and 87% respectively (p=0.59); II–IV: 61% and 62% (p=0.48); III–IV: 22% and 20% (p=0.51; Fisher’s exact test). The use of less GVHD prophylaxis in the unmatched group strengthens a negative result and as predicted, no increase in risk due to mismatching was revealed after correction for GVHD prophylaxis and other variables by binomial logistic regression. CD1a is an antigen-presenting molecule important in host defense. It is dimorphic in humans with a minor allele found in 16% of individuals and mismatched in the GVHD direction in 9% of HLA-identical sibling allogeneic transplants. Although amino acid substitution may alter the antigen specificity of the two isoforms of CD1a, mismatching does not increase the risk of GVHD and therefore CD1a does not appear to function as a tissue antigen in transplantation. This functional result supports recent structural analysis of the CD1a-TCR interaction showing that the glycolipid antigen makes little contribution to TCR binding, in contrast to the peptide antigens of conventional class I MHC molecules, which play an essential role in T cell recognition (Zajonc et al. Immunity2005. 22: 209–19).

ABSTRACTArchaeological investigations demonstrate that peoples first settled the Caribbean islands approximately 6000–7000 years ago. At least four major, and multiple minor, migrations took place over the next millennia by peoples from Mesoamerica and South America who practised various subsistence strategies and had different levels of technology. For decades, researchers have been interested in investigating how these groups adapted to and impacted insular environments through time. This paper combines archaeological, palaeoecological, historical, and modern biological data to examine the effects of humans on Caribbean island ecosystems using a historical ecology approach. By synthesising a wide range of data sources, we take a human/nature dialectical perspective to understanding how peoples adapted to and modified their environments. The data suggest that earlier foraging/fishing Archaic groups (ca. 6000–3000 BP), who used a stone tool and shell technology and transported few, if any non-indigenous plants or animals, still impacted island landscapes as evidenced by bird and sloth extinctions. As more advanced ceramic making horticulturalists entered the Antillean chain around 2500 BP, there is an observable change to island environments as a result of forest clearance, overexploitation of both terrestrial and marine resources, and growing populations. Palaeoecological and palaeoenvironmental records also suggest, however, that an increased moisture regime during the late Holocene probably led to a decrease in near-shore salinity and heavier sediment and nutrient loads in rivers. These conditions would have been exacerbated by land clearance for agriculture, leading to coastline progradation, increased turbidity, and mangrove development resulting in changes to the availability of resources for humans on some islands. Although prehistoric peoples in the Caribbean were certainly impacting their environments, it was not until Europeans arrived and population centres grew that intensive and widespread degradation of island landscapes and resources occurred. Modern ecological studies, along with historical and archaeological data, indicate that hundreds of species have been driven to extinction or extirpation – many others have significantly diminished in number, especially within the last two millennia.

AbstractIncreasing the number of vehicles on the road network and the growing popularity of sustainable development of urban areas have resulted in the need for implementing efficient and cost-effective traffic measurement methods. From the perspective of traffic management, up-to-date information about vehicle density and access to historical data are the key components of traffic variability analyses. Rapid technological development based on Intelligent Transport Systems (ITS) has popularised the wireless sensor networks (WSN) application. The solution enables continuous monitoring of selected area using multiple wireless and low-cost sensors connected within a network. Those systems are dynamically evolving tools for solving an effective traffic management issues in city centres and urban environments. In the study, authors have performed a traffic variability and its dynamics analysis in a selected area using a multi-sensor network for traffic volume monitoring. The article presents the results of research conducted between years 2015 - 2018 throughout the city of Bielsko-Biala with the support of OnDynamic multimodal system. Within the context of the analyses, basic traffic parameters have been determined and variability trends have been identified on selected road sections. Long-term research indicated the minor variation in a number of vehicle detections and relatively stable traffic volume in the city centre during the analysis period.

En ciudades con un importante patrimonio histórico son cada vez más frecuentes los procesos de homogeneización del paisaje urbano. Una dinámica que conduce a la transformación de determinados entornos históricos en espacios en donde apenas queda lugar para la singularidad, las actividades no reguladas o la participación ciudadana. Este estudio propone analizar una serie de iniciativas desarrolladas en la última década en centros de cuatro ciudades españolas, concretamente en Sevilla, Barcelona, Madrid y Zaragoza. Proyectos que se apoyan en la agricultura y la jardinería urbanas para sortear la banalización imperante, creando espacios para la cultura, las relaciones sociales y la imaginación. Pese a las dificultades en su gestión y su repercusión minoritaria, estas intervenciones ejemplifican un modo de reconfigurar el paisaje urbano, planteando esquemas de activación, percepción activa y participación en lugares centrales de la ciudad en proceso de abandono, donde las actividades agrícolas y jardineras adquieren un peso importante.PALABRAS CLAVE: paisaje urbano, acupuntura urbana, agricultura urbana, participación ciudadana, derecho a la ciudad.Processes of homogenization of the urban landscape are becoming more frequent in cities with an important historical heritage. A dynamic that leads to the transformation of certain historical environments in spaces where there is hardly any room for uniqueness, unregulated activities or public participation. This study aims to analyse a number of initiatives developed in the last decade in four Spanish city centres, particularly in Seville, Barcelona, Madrid and Zaragoza. Projects that are using urban agriculture and gardening to escape form current banality, creating spaces for culture, social relations and imagination. Despite the difficulties in its management and its minor impact, these interventions exemplify a way to reshape urban landscape, through schemes of activation, active perception and participation in abandoned places in the city, where agricultural activities and gardening are now playing an important role.KEYWORDS: urban landscape, urban acupuncture, urban agriculture, citizen participation, right to the city.

<p>In the last decades, the topic of lighting of the historical minor centres is taking a prominent role in the cultural debate on the urban recovery interventions, because of the development of a greater awareness of the regenerative potential role that a careful planning system of urban lighting can take in this context.</p><p>The latter, which had a purely functional role in the past, has recently taken a figurative and emotional role, associated with the vision of the urban light scene during the night and its valorization.</p><p>The study of light, therefore, has inevitably turned into an instrument of knowledge and critical interpretation of the urban spaces, aimed both to functional recovery of the lighting network technology, and the regeneration of the urban image and its night scenes.</p><p>The needs that this sector should satisfy are multiple and, sometimes, conflicting: the need for road safety, the reduction of light pollution, the need for energy and cost savings.</p><p>The research aims to define an operative methodology to deal with the light planning in complex contexts as the minor historical centers, in which the concept of transformation of the urban scene clashes directly with the concept of preserving the identity features of the places and its constructive values and materials.</p><p>Among the goals, there is therefore the aim of highlighting the main gaps in the network, due both to plant engineering reasons and to the obsolescence of the existing lighting fixtures.</p><p>We operatively work in the urban voids system field, as spaces that characterize the urban scene. Through the knowledge of their dominant features it is possible to preserve their identity and, at the same time, enhance their singularity, with a suitable lighting project, which requires the study of materials, colors and consumption.</p><p>The purpose is to promote an urban development, able to produce positive economic, social and cultural effects, oriented to improve the quality of life, as well as to value the architectural and environmental heritage giving importance to energy and economic saving.</p>

With the exception of a minor mention, which Sharaf Khān (b.1543) made in theSharafnāma, the first information about the most southern group of Kurdish tribes in Iranian Kurdistan, the Lek, first became available to modern readers inBustān al-Sīyāḥa, a geographical and historical Persian text by Shīrwānī (1773–1832). These hitherto unknown Lek communities, were probably settled in north-western and northern Luristan, known as Lekistan, by order of Shāh ‘Abbās, who wished in this way to create some support for Ḥusayn Khān, thewālīof Luristan. Many of the centres of Lekî intellectual life in the late Afshārīd and early Zand period, which is also of much importance in that the Zand dynasty arose from it, are located in this geographical area. One has only to call to mind the names of such places as Alishtar (Silsila), Kūhdasht, Khāwa, Nūr Ābād, Uthmānwand and Jalālwand in the most southern districts of Kirmānshāh, and also the Lek tribes of eastern Īlām. The very mention of these cities and villages already sets in motion in one's imagination the parade of Twelver Shiites, Ahl-i Haqq heretics, and non-religious oral literary councils which constitutes the history of Lekî new era. But unfortunately little of this is known in the West and Lekî literature remains one of the neglected subjects of literary and linguistic Kurdish studies. This important oral literature and also some written manuscripts are unpublished and untranslated into western languages. The subject of this article is the translation ofZîn-ə Hördemîr, as an example of a genre of Lekî written literature which also provides linguistic data for the Lekî dialect of southern Kurdish.

In this unique and comprehensive article, Dr. Cusset presents a historical review of ideas and theories on leaf development, a detailed description and critique of the classical model, a discussion of Jeune's model, and finally his own synthetic model.According to Cusset, the classical model, which has been widely adopted in textbooks, reference books, and research, postulates that (i) leaf morphogenesis results from the successive activity of apical, marginal (or submarginal), and intercalary meristems; (ii) cell files arise from submarginal initials; (iii) the cell is the fundamental unit of morphogenesis. Cusset documents the shortcomings of these assumptions by discussing evidence from publications that deal with modem techniques ranging from the quantitative analysis of mitotic activity and chimeras to marker experiments and clonal analysis. All of these different approaches have led to the same conclusion: for nearly all taxa studied so far, there is no evidence, either in terms of mitotic activity (e.g., mitotic index) or in a functional sense, of apical or marginal meristems. This means that apical or marginal meristems cannot account for the elongation and lateral extension of the leaf blade. Rather, the available data support the following conclusions.(i) The young leaf primordium is fully meristematic, i.e., there is generalized mitotic activity throughout the primordium. Gradually the mitotic activity is restricted to the base and thus the leaf develops through the activity of an intercalary meristem. Both the orientation and the frequency of cell divisions indicate that the leaf margin plays only a minor role in the growth of the lamina. In only a very few cases (e.g., the petals of Nicotiana tabacum), and then in only relatively late developmental stages, has a maximal mitotic index been observed directly at the margin. More commonly, a peak of mitotic activity has been noted in a submarginal region. However, this region is at a considerable distance from the margin, and the increased mitotic activity, which is often not statistically significant, occurs in only some developmental stages. In summary, one may conclude that instead of distinct meristematic entities, the developing leaf shows a patterned continuum of meristematic activity.(ii) The so-called submarginal initials contribute relatively little to the lateral extension of the leaf blade. Hence, it is questionable whether they should be called "initials."(iii) In general, cells do not appear to be the fundamental units of morphogenesis. As pointed out long ago by De Bary: "the plant forms cells, not cells the plant," thus underscoring the need for a more holistic approach.In addition to the preceding conclusions, Jeune's model (developed in Cusset's laboratory) incorporates the notion of growth centres ("centres générateurs"). These are defined as fields with certain physiological properties that are transmitted to other areas of the developing leaf. Each leaf primordium has two growth centres. In compound or lobed leaves, they are responsible for the production of the lateral elements according to the following rules, (i) Each primordium of a leaflet or lobe arises at a fixed distance from the preceding one. (ii) The rhythm of their formation is constant with regard to the plastochron on the axis where the leaf is bom. (iii) As a consequence, the correlation between the number of lateral elements and the logarithm of the length of the blade primordium is linear (which confirms the exponential growth of the primordium). (iv) After the inception of a lateral element, the growth centre that gave rise to it is reconstituted. If, however, the growth centre is removed microsurgically on one side of the leaf primordium, no lateral elements are formed there. The concept of centre générateur closely corresponds to the idea of a growth centre sensu Wardlaw. Although Jeune's model has been confirmed for a great variety of leaves, both simple and compound, it does not fully apply in all cases, as for example in the leaves of Castanea sativa and Fraxinus excelsior. To cope with these exceptions, as well as other situations, Cusset proposes a synthetic model in which leaf blade development is modulated by the following eight internal effectors: (i) biochemical oscillations, according to the "brusselator," a model directly derived from ideas of Turing and Prigogine; (ii) the calmodulin–Ca2+ balance; (iii) a distal phyllopodial organizer, based on microsurgical evidence, but rather hypothetical; (iv) a system orienting the major veins according to the model of Ferré and Le Guyader; (v) interactions between the flux of inductive substances explaining the minor venation according to Mitchison's model; (vi) a microtubule orienting mechanism which might be an internal electromagnetic phenomenon; (vii) an organizing mechanism that eventually explains the particularities of the minor venation of each species; (viii) auxin acting in a complex fashion on several of the preceding effectors. External factors, such as temperature interact with the above internal mechanisms.Although some aspects of the above synthetic model remain rather hypothetical and speculative at the present time, Cusset's proposal may serve as a stimulating working hypothesis. Furthermore, it emphasizes that the study of leaf morphogenesis not only is a technical and morphological problem of limited interest, but also involves aspects of molecular biology and fundamental theoretical and philosopical issues. From this point of view, leaf morphogenesis may serve as a model case for the discussion and elucidation of contemporary morphogenetic and biological problems.

Actual importance of research theme: Combating hunger and providing the Earth’s population with sufficient amount of products is considered one of the strategic priorities of human civilization sustainable development by the UN up to 2030. The rapid growth of this planet’s human population in the 21st century, estimated at 7.6. billion people, leads to the global demand for production and foodstuff. Simultaneously, traditional strategies of extensive development conventional in the 20th century and “target” intensification of agriculture do not take expected positive effect nowadays. World economy requires for new strategies of agricultural production, as well as promoting ‘green revolution’ based on the ground of IT technology advances and “Industry 4.0.”. The generalization of world experience concerning development and implementing agricultural production strategies in the 21st century is of greater theoretical and practical importance for all countries which export agricultural production in mass scales, including Ukraine which focuses on the leadership in the world agricultural business. Thus, the urgency of the issue confirms the actual importance of this article. The problem statement. Foodstuff output in world economy is growing slowly and does not meet the increasing demand for food and agricultural products in industry in global scales. Under these conditions the manufacturers of agricultural products like farmers, agro-businesses and agro-holdings, as well as transnational corporation alter and modify agricultural strategies that were conventional in the 20th century. Among the new strategies transition to precision farming and innovational agriculture based on implementing IT technologies takes the leading role. The core and socio-economic consequences of such strategy implementation require further study. Analysis of latest studies and publication. The important contribution to the study of the core and dimensions of agricultural production strategies linked to innovation and investment development as well as to improvement property relations is made by such Ukrainian scholars as P. Makarenko, V. Pilyavskiy [1] and O. Shul’ga [2]. Foreign scientists like Smaller, C., andW. Speller, withH. Mirza, N. Bernasconi-Osterwalder, andG. Dixie [3] paid the specific attention to the study of strategic priorities concerning risks minimization and profit maximization by agro-businesses and TNC within the realization of agricultural contracts at world markets. Overseas researchers KeatingB., HerreroM., CarberryP. [4] emphasized on actual importance of compliance with strategy of foodstuff security in global environment in their studies. However, the issue of developing the strategy of precise agricultural production based on widespread use of innovation and IT technologies, research into socio-economic consequences accompanying their implementation in the 21st century remains poorly studied. Research challenge of general issue. The issue of studies the core and elements of agricultural production development process in world economy is highlighted in world economic literature pretty well. Nevertheless, the study of TNCs and agricultural businesses strategies and strategies concerning transition of TNCs to the development of precise agriculture is really meaningful. Besides, at present time the trends of direct foreign investments as for agricultural lands purchase and priorities analysis of their use by TNCs in developed and developing world countries are uncertain. Socio economic consequences of mass precise agriculture introduction for national economy in countries with agrarian specialization also require detailed researching. Problem statement, objective of research. The objective of research is to highlight the core and define the regularity of formation, as well as emphasize the basic expected socio-economic consequences of precise agriculture development strategy implementing on the grounds of generalization the world experience of agricultural TNC sactivity. To achieve the objective set the article aimed at solution the following tasks: to note the main ‘players’ at the world agricultural market and study the priorities of their economic activity; to study the core and the elements of ‘green revolution’ strategy, as well as strategy of transition to precise agricultural production based on implementing innovations and IT technologies; to define strategic goals of TNCs as for the use of acquiring land ( at the cost of direct foreign investments) on the grounds of generalization developed and developing countries experience; to point out the expected socio-economic consequences of mass implementation of precise agricultural production strategies by TNCs and national agro-businesses for the economy of the countries specialized in agriculture. Method and methodology of the study. While studying the world experience of implementation the precise agricultural production development strategies theoretical and empirical methods of scientific research were employed. Historical and logical methods, abstract and specific methods, methods of analysis and synthesis, as well as causal (cause-and-effect) method were applied in the article to define strategic priorities of agricultural business and agricultural TNC specialization, to point out expected socio-economic consequences of mass transition to precise agricultural production in the countries with agrarian specialization. Synergetic approach, method of expert estimates and casual methods were applied to ground “green revolution” strategy, as well as strategy of TNCs as for transition to precise agriculture based on innovations and IT technologies. The results of study. Agricultural production is presented by farmers, households, state agricultural sector, national agro-businesses and agro-holdings, international TNCs. As a rule, farms are focused on domestic market; they specialize in production of minor parties of manual crop production and horticulture, grow vegetables, fruit and berries, as well as they are engaged in poultry farming, beekeeping, dairy production, stockbreeding in rather small scales. The farmers in developed world countries, particularly EU countries, concentrate on organic production which is of high demand among middle-class representatives. In EU countries farming is traditionally supported by the state, as it bears both economic and social valuable functions, i.e. assists in rural development and creates workplaces in countryside. The main stakeholders at the mass agricultural market in the world are considered large national and international agro-holdings an TNCs specialized in agricultural production and its industrial processing. TNCs shaped the closed loop – from selection to agricultural production, from its processing to its manufacturing. At the cost of large production scales, as well as capital concentration and centralization it is the agricultural TNCs which leads in production and export of foodstuffs at world markets. TNCs ‘ leadership at world agriculture markets is grounded on ‘green revolution’ strategy implementing, which consists of such elements as innovations, bio-selection to produce performance breed, intensive growth in crop productivity, including the one using GMO which makes cropping insensitive to water shortage, high temperatures and droughts. Agrarian TNCs in the 21st century actively implement the strategies of transition to precise agriculture based on the use of innovations and IT technologies. As the world experience confirms, strategies of transition to precise agriculture combine the following innovations: astronaut and aviation technologies, unmanned technologies, unmanned aerial vehicles; mass transition to the use of apparatus to analyze the ground online; spreading of “agro-scouting” innovation technologies as for field information gathering concerning the condition and development of agriculture; implementation intellectual system of managerial decision-making support; introduction of monitoring and control auto-system and implementation of IT-system as for account of agriculture process elements. The development of precise agriculture for national world economies which are agriculture-based offers a lot of benefits, such as: increase in labor productivity in agriculture; the decrease in employment that saves working capital of agro-businesses; industrialization and technical renovation of agrarian sector which promotes the market for IT products, precise machine building; increase in commerce and export potential of the country, mainly, in the sphere of monostructural crop production (grain, corn, soya, raps, oilseeds etc.). Such strategies also provide revitalization of direct foreign investment processes by TNCsconcerning purchasing farmland in the developing countries with their further listing as raw materials supplier for TNCs. The latter shape and control international links of production value added to all kinds of agricultural products. Among the risks which implementation of precise agriculture strategies bear for national developing country’s economy which are agriculture-based the following should be mentioned: risks concerning decrease in farms and decline in production of labor-intensive small-scale agriculture products (vegetables, fruit, honey etc.); risks of jobs recession and, respectively, the number of rural population and others. There are also other risks linked to these processes like risks of growing volumes of ready foodstuffs import, chronic scarcity of state budget and increase in internal debt, enhancing migration processes etc. In case of falling world prices for foodstuffs and worsening global conditions for agriculture products, including agrarian raw materials, in particular, due to another world economic crisis, the abandonment of occasional farmland purchased by TNCs in developing agrarian countries, their further freezing and ceasing the processing for better times should not be excluded. Under such circumstances the risks of famine for countries which could lose the managerial control over own land resources are also a threatening exercise as for implementing such TNC strategy. The field of results application. International economic relations and world economy, development of agriculture competitive strategies in world countries and agrarian TNCs in world economy. Conclusions. Farms, agro-businesses, agro-holdings and agrarian TNCs are the economic centres of mass agriculture production in all world countries. Farms are mainly specialized in labour-intensive small-scale agriculture production like horticulture, gardening, bee-keeping etc. Large agro-businesses and agrarian TNCs choose the strategy of specializing in mass monostructural agriculture production such as crop production (grain, corn, soya beans and industrial crops). In developed world countries TNCs apply the strategy of farmlands multi-purpose use, including the goals aimed at development and processing livestock and crop production; at development of renewable energy and bio-energy. In developed world countries TNCs focus on processing all kinds of agriculture products and foodstuffs production with high value added. Purchasing of farmlands by TNCs in developing countries, in particular, at the cost of direct foreign investment, provides for implementation the strategy of purchased lands engagement, mainly, to develop crop production as a raw basis for their further processing in the native countries for TNCs. The general world trend of agrarian TNCs development is use of innovation technologies, transition to precise agriculture based on IT technologies, aviation and astronautic technologies, unmanned aerial vehicles and other innovations which positively impact labor productivity and mass industrial production profitability, as well as choose transition to monostructural agrarian specialization as a priority, but bear a set of social risks for developing countries’ economies. Transition of Ukrainian agro-businesses and agro-holdings to the strategy of precise agriculture development based on innovations and IT technologies provides Ukraine’s competitiveness at the world agrarian markets. This process should go hand-in-hand with land reform taking into account Ukrainian farming interests. Establishing industrial processing of agriculture raw products and production of ready foodstuffs with high value added should be strategic for Ukraine.

Abstract This paper presents a novel hybrid-based methodology devoted to develop urban fragility curves and damage probability matrices to predict likelihood seismic damage scenarios for small and medium Italian urban centres, considering URM buildings only. The concept of urban fragility curve consists of a single curve mean-representative of the seismic fragility of an entire area accounting for the combinations of building classes and their percentage, then they differ from those typological. The methodology has been developed with reference to Rocca di Mezzo, a small Italian urban centre located in the central Apennine area, Italy. Based on CarTiS inventory, building classes have been firstly recognized and urban fragility curves, representative for damage scenarios at Ultimate Limit State, developed. To predict damage scenarios from low to high-intensity earthquakes, an approach to define multi-damage urban fragility curves and damage probability matrices has been also presented. To this aim, a damage scale suffered by building classes has been defined by converting the final outcomes of the AeDES form (used in Italy for post-earthquake surveys) in the damage levels provided by the European Macroseismic Scale (EMS98). Data coming from urban fragility curves have been compared with the actual damage scenario recorded in Rocca di Mezzo after the 2009 L’Aquila’s earthquake, in terms of both peak-ground acceleration and Mecalli-Cancani-Sieberg scale. The achieved results showed a good accordance between theoretical predictions and actual damage scenarios, coherent also with the damage scenarios occurred in other Italian historical centres hit by severe earthquakes over the years. Thus, the methodology can provide a first important indicator to support the development of emergently plans devoted to identify priority of interventions in such areas particularly vulnerable with respect to others.

The doctoral research links the issue of rehabilitation of small historic centres of Abruzzo Region hit by earthquake of 2009 to the environmental issue, proposing the reuse of this heritage through a sustainable strategy that put in network its potentiality and investigates open spaces and energy networks. The research proposes the development of an operative methodology that helps to overcome the gaps of the reconstruction process and those related to the integration of energy efficiency in historical contexts, providing indicators of compatibility and a lot of compatible solutions.

The doctoral research links the issue of rehabilitation of small historic centres of Abruzzo Region hit by earthquake of 2009 to the environmental issue, proposing the reuse of this heritage through a sustainable strategy that put in network its potentiality and investigates open spaces and energy networks. The research proposes the development of an operative methodology that helps to overcome the gaps of the reconstruction process and those related to the integration of energy efficiency in historical contexts, providing indicators of compatibility and a lot of compatible solutions.

<p>In the Sicily Channel, volcanic activity has been concentrated mainly on the Pantelleria and Linosa islands, while minor submarine volcanism took place in the Adventure, Graham and Nameless banks. The volcanic activity spanned mostly during Plio-Pleistocene, however, historical submarine eruptions occurred in 1831 on the Graham Bank and in 1891 offshore Pantelleria Island. On the Graham Bank, 25 miles SW of Sciacca, the 1831 eruption formed the short-lived Ferdinandea Island that represents the only Italian volcano active in historical times currently almost completely unknown and not yet monitored. Moreover, most of the Sicily Channel seismicity is concentrated along a broad NS belt extending from the Graham Bank to Lampedusa Island. In 2012, the Istituto Nazionale di Geofisica e Vulcanologia (INGV) carried out a multidisciplinary oceanographic cruise, named “Ferdinandea 2012”, the preliminary results of which represent the aim of this paper. The cruise goal was the mapping of the morpho-structural features of some submarine volcanic centres located in the northwestern side of the Sicily Channel and the temporary recording of their seismic and degassing activity. During the cruise, three OBS/Hs (ocean bottom seismometer with hydrophone) were deployed near the Graham, Nerita and Terribile submarine banks. During the following 9 months they have recorded several seismo-acoustic signals produced by both tectonic and volcanic sources. A high-resolution bathymetric survey was achieved on the Graham Bank and on the surrounding submarine volcanic centres. A widespread and voluminous gas bubbles emission was observed by both multibeam sonar echoes and a ROV (remotely operated vehicle) along the NW side of the Graham Bank, where gas and seafloor samples were also collected.</p>

IntroductionMusicians and critics regard Australian jazz as vibrant and creative (Shand; Chessher; Rechniewski). From its tentative beginnings in the early twentieth century (Whiteoak), jazz has become a major aspect of Australia’s music and performance. Due to the large distances separating cities and towns, its development has been influenced by geographical isolation (Nikolsky; Chessher; Clare; Johnson; Stevens; McGuiness). While major cities have been the central hubs, it is increasingly acknowledged that regional centres also provide avenues for jazz performance (Curtis).This article discusses findings relating to transient musical populations shaped by geographical conditions, venue issues that are peculiar to the Northern region, and finally the challenges of cultural and parochial mindsets that North Queensland jazz musicians encounter in performance.Cairns and MackayCairns and Mackay are regional centres on the coast of Queensland, Australia. Cairns – population 156,901 in 2016 (ABS) – is a world famous tourist destination situated on the doorstep of the Great Barrier Reef (Thorp). Mackay – population 114,969 in 2016 (ABS) – is a lesser-known community with an economy largely underpinned by the sugar cane and coal mining industries (Rolfe et al. 138). Both communities lie North of the capital city Brisbane – Mackay in the heart of Central Queensland, and Cairns as the unofficial capital of Far North Queensland. Mackay and Cairns were selected for this study, not on representational grounds, but because they provide an opportunity to learn through case studies. Stake notes that “potential for learning is a different and sometimes superior criterion to representativeness,” adding, “that may mean taking the one most accessible or the one we can spend the most time with (451).”Musically, both regional centres have a number of venues that promote live music, however, only Cairns has a dedicated jazz club, the Cairns Jazz Club (CJC). Each has a community convention centre that brings high-calibre touring musicians to the region, including jazz musicians.Mackay is home to the Central Queensland Conservatorium of Music (CQCM) a part of the Central Queensland University that has offered conservatoire-style degree programs in jazz, contemporary music and theatre for over twenty-five years. Cairns does not have any providers of tertiary jazz qualifications.MethodologySemi-structured in-depth interviews were conducted with twenty-two significant individuals associated with the jazz communities in Mackay and Cairns over a twelve-month period from 2015 to 2016. Twelve of the interviewees were living in Cairns at the time, and ten were living in Mackay. The selection of interviewees was influenced by personal knowledge of key individuals, historical records located at the CQCM, and from a study by (Mitchell), who identified important figures in the Cairns jazz scene. The study participants included members of professional jazz ensembles, dedicated jazz audience members and jazz educators. None of the participants who were interviewed relied solely on the performance of jazz as their main occupation. All of the musicians combined teaching duties with music-making in several genres including rock, jazz, Latin and funk, as well as work in the recording and producing of recorded music. Combining the performance of jazz and commercial musical styles is a common and often crucial part of being a musician in a regional centre due to the low demand for any one specific genre (Luckman et al. 630). The interview data that was gathered during the study’s data collection phase was analysed for themes using the grounded theory research method (Charmaz). The following sections will discuss three areas of findings relating to some of the unique North Queensland influences that have impacted the development and sustainability of the two regional jazz communities.Transient Musical PopulationsThe prospect of living in North Queensland is an alluring proposition for many people. According to the participants in this study, the combination of work and a tropical lifestyle attracts people from all over the country to Cairns and Mackay, but this influx is matched by a high population turnover. Many musicians who move into the region soon move away again. High population turnover is a characteristic of several Northern regional centres such as the city of Darwin (Luckman, Gibson and Lea 12). The high growth and high population turnover in Cairns, in particular, was one of the highest in the country between 2006 and 2011 (ABS). The study participants in both regions believed that the transient nature of the local population is detrimental to the development and sustainability of the jazz communities. One participant described the situation in Cairns this way: “The tropics sort of lure them up there, tease them with all of the beauty and nature, and then spit them out when they realise it’s not what they imagined (interviewee 1, 24 Aug. 2016).” Looking more broadly to other coastal regional areas of Australia, there is evidence of the counter-urban flow of professionals and artists seeking out a region’s “natural and cultural environment” (Gibson 339). On the far North coast of New South Wales, Gibson examined how the climate, natural surroundings and cultural charms attracted city dwellers to that region (337). Similarly, most of the participants in this study mentioned lifestyle choices such as raising a family and living in the tropics as reasons to move to Cairns or Mackay. The prospect of working in the tourism and hospitality industry was found to be another common reason for musicians to move to Cairns in particular. In contrast to some studies (Salazar; Conradson and Latham) where it was found that the middle- to upper-classes formed the majority of lifestyle migrants, the migrating musicians identified by this study were mostly low-income earners seeking a combination of music work and other types of employment outside the music industry. There have been studies that have explored and critically reviewed the theoretical frameworks behind lifestyle migration (Benson and Osbaldiston) including the examination of issues and the motivation to ‘lifestyle migrate’. What is interesting in this current study is the focus of discussion on the post-migration effects. Study participants believe that most of the musicians who move into their region leave soon afterwards because of their disillusionment with the local music industry. Despite the lure of musical jobs through the tourism and hospitality industry, local musicians in Cairns tend to believe there is less work than imagined. Pub rock duos and DJs have taken most of the performance opportunities, which makes it hard for new musicians to compete.The study also reveals that Cairns jazz musicians consider it more difficult to find and collaborate with quality newcomers. This may be attributed to the smaller jazz communities’ demand for players of specific instruments. One participant explained, “There’s another bass player that just moved here, but he only plays by ear, so when people want to play charts and new songs, he can’t do it so it's hard finding the right guys up here at times (interviewee 2, 23 Aug. 2016).” Cairns and Mackay participants agreed that the difficulty of finding and retaining quality musicians in the region impacted on the ability of certain groups to be sustainable. One participant added, “It’s such a small pool of musicians, at the moment, I've got a new project ready to go and I've got two percussionists, but I need a bass player, but there is no bass player that I'm willing to work with (interviewee 3, 24 Aug. 2016).” The same participant has been fortunate over the years, performing with a different local group whose members have permanently stayed in the Cairns region, however, forging new musical pathways and new groups seemed challenging due to the lack of musical skills in some of the potential musicians.In Mackay, the study revealed a smaller influx of new musicians to the region, and study participants experienced the same difficulties forming groups and retaining members as their Cairns counterparts. One participant, who found it difficult to run a Big Band as well as a smaller jazz ensemble because of the transient population, claimed that many local musicians were lured to metropolitan centres for university or work.Study participants in both Northern centres appeared to have developed a tolerance and adaptability for their regional challenges. While this article does not aim to suggest a solution to the issues they described, one interesting finding that emerged in both Cairns and Mackay was the musicians’ ability to minimise some of the effects of the transient population. Some musicians found that it was more manageable to sustain a band by forming smaller groups such as duos, trios and quartets. An example was observed in Mackay, where one participant’s Big Band was a standard seventeen-piece group. The loss of players was a constant source of anxiety for the performers. Changing to a smaller ensemble produced a sense of sustainability that satisfied the group. In Cairns, one participant found that if the core musicians in the group (bass, drums and vocals) were permanent local residents, they could manage to use musicians passing through the region, which had minimal impact on the running of the group. For example, the Latin band will have different horn players sit in from time to time. When those performers leave, the impact on the group is minimal because the rhythm section is comprised of long-term Cairns residents.Venue Conditions Heat UpAt the Cape York Hotel in Cairns, musicians and audience members claimed that it was uncomfortable to perform or attend Sunday afternoon jazz gigs during the Cairns summer due to the high temperatures and non air-conditioned venues. This impact of the physical environment on the service process in a venue was first modelled and coined the ‘Servicescape’ by Bitner (57). The framework, which includes physical dimensions like temperature, noise, space/function and signage, has also been further investigated in other literature (Minor et al.; Kubacki; Turley and Fugate). This model is relevant to this study because it clearly affects the musician’s ability to perform music in the Northern climate and attract audiences. One of the regular musicians at the Cape York Hotel commented: So you’re thinking, ‘Well, I’m starting to create something here, people are starting to show up’, but then you see it just dwindling away and then you get two or three weeks of hideously hot weather, and then like last Sunday, by the time I went on in the first set, my shirt was sticking to me like tissue paper… I set up a gig, a three-hour gig with my trio, and if it’s air conditioned you’re likely to get people but if it’s like the Cape York, which is not air conditioned, and you’re out in the beer garden with a tin roof over the top with big fans, it’s hideous‘. (Interviewee 4, 24 Aug. 2016)The availability of venues that offer live jazz is limited in both regions. The issue was twofold: firstly, the limited availability of a larger venue to cater for the ensembles was deemed problematic; and secondly, the venue manager needed to pay for the services of the club, which contributed to its running costs. In Cairns, the Cape York Hotel has provided the local CJC with an outdoor beer garden as a venue for their regular Sunday performances since 2015. The president of the CJC commented on the struggle for the club to find a suitable venue for their musicians and patrons. The club has had residencies in multiple venues over the last thirty years with varying success. It appears that the club has had to endure these conditions in order to provide their musicians and audiences an outlet for jazz performance. This dedication to their art form and sense of resilience appears to be a regular theme for these Northern jazz musicians.Minor et al. (7) recommended that live music organisers needed to consider offering different physical environments for different events (7). For example, a venue that caters for a swing band might include a dance floor for potential dancers or if a venue catered for a sit down jazz show, the venue might like to choose the best acoustic environment to best support the sound of the ensemble. The research showed that customers have different reasons for attending events, and in relation to the Cape York Hotel, the majority of the customers were the CJC members who simply wanted to enjoy their jazz club performances in an air conditioned environment with optimal acoustics as the priority. Although not ideal, the majority of the CJC members still attended during the summer months and endured the high temperatures due to a lack of venue suitability.Parochial MindsetsOne of the challenging issues faced by many of the participants in both regions was the perceived cultural divide between jazz aficionados and general patrons at many venues. While larger centres in Australia have enjoyed an international reputation as creative hubs for jazz such as Melbourne and Sydney (Shand), the majority of participants in this study believed that a significant portion of the general public is quite parochial in their views on various musical styles including jazz. Coined the ‘bogan factor’, one participant explained, “I call it the bogan factor. Do you think that's an academic term? It is now” (interviewee 5, 17 Feb. 2016). They also commented on dominant cultural choices of residents in these regions: “It's North Queensland, it's a sport orientated, 4WD dominated place. Culturally they are the main things that people are attracted to” (interviewee 5, 17 Feb. 2016). These cultural preferences appear to affect the performance opportunities for the participants in Cairns and Mackay.Waitt and Gibson explored how the Wollongong region was chosen as an area for investigation to see if city size mattered for creativity and creativity-led regeneration (1224). With the ‘Creative Class’ framework in mind (Florida), the researchers found that Wollongong’s primarily blue-collar industrial identity was a complex mixture of cultural pursuits including the arts, sport and working class ideals (Waitt and Gibson 1241). This finding is consistent with the comments of study participants from Cairns and Mackay who believed that the identities of their regions were strongly influenced by sport and industries like mining and farming. One Mackay participant added, “I think our culture, in itself, would need to change to turn more people to jazz. I can’t see that happening. That’s Australia. You’re fighting against 200 years of sport” (interviewee 6, 12 Feb. 2016). Performing in Mackay or Cairns in venues that attract various demographics can make it difficult for musicians playing jazz. A Cairns participant added, “As Ingrid James once told me, ‘It's North Queensland, you’ve got an audience of tradesman, they don't get it’. It's silly to think it's going to ever change” (interviewee 7, 26 Aug. 2016). One Mackay participant believed that the lack of appreciation for jazz in regional areas was largely due to a lack of exposure to the art form. Most people grow up listening to other styles of music in their households.Another participant made the point that regardless of the region’s cultural and leisure-time preferences, if a jazz band is playing in a football club, you must expect it to be unpopular. Many of the research participants emphasised that playing in a suitable venue is paramount for developing a consistent and attentive audience. Choosing a venue that values and promotes the style of jazz music that the musicians are performing could help to attract more jazz fans and therefore build a sustainable jazz community.Refreshingly, this study revealed that musicians in both regions showed considerable resilience in dealing with the issue of parochial mindsets, and they have implemented methods to help educate their audiences. The audience plays a significant part in the development and future of a jazz community (Becker; Martin). For the Central Queensland Conservatorium of Music in Mackay, part of the ethos of the institution is to provide music performance and educational opportunities to the region. One of the lecturers who made a significant contribution to the design of the ensemble program had a clear vision to combine jazz and popular music styles in order to connect with a regional audience. He explained, “The popular music strand of the jazz program and what we called the commercial ensembles was very much birthed out of that concept of creating a connection with the community and making us more accessible in the shortest amount of time, which then enabled us to expose people to jazz” (interviewee 8, 20 Mar. 2016).In a similar vein, several Cairns musicians commented on how they engaged with their audiences through education. Some musicians attempted to converse with the patrons on the comparative elements of jazz and non-jazz styles, which helped to instil some appreciation in patrons with little jazz knowledge. One participant cited that although not all patrons were interested in an education at a pub, some became regular attendees and showed greater appreciation for the different jazz styles. These findings align with other studies (Radbourne and Arthurs; Kubacki; Kubacki et al.), who found that audiences tend to return to arts organizations or events more regularly if they feel connected to the experience (Kubacki et al. 409).ConclusionThe Cairns and Mackay jazz musicians who were interviewed in this study revealed some innovative approaches for sustaining their art form in North Queensland. The participants discussed creative solutions for minimising the influence of a transient musician population as well as overcoming some of the parochial mindsets in the community through education. The North Queensland summer months proved to be a struggle for musicians and audience members alike in Cairns in particular, but resilience and commitment to the music and the social network of jazz performers seemed to override this obstacle. Although this article presents just a subset of the findings from a study of the development and sustainability of the jazz communities in Mackay and Cairns, it opens the way for further investigation into the unique issues faced. Deeper understanding of these issues could contribute to the ongoing development and sustainability of jazz communities in regional Australia.ReferencesAustralian Bureau of Statistics. "Mackay (Statistical Area 2), Cairns (R) (Statistical Local Area), Census 2016." Canberra: Australian Bureau of Statistics.———. "Perspectives on Regional Australia: Population Growth and Turnover in Local Government Areas (Lgas), 2006-2011." Canberra: Australian Bureau of Statistics.Becker, H. Art Worlds. Berkeley, CA: University of California Press, 1982.Benson, Michaela, and Nick Osbaldiston. "Toward a Critical Sociology of Lifestyle Migration: Reconceptualizing Migration and the Search for a Better Way of Life." The Sociological Review 64.3 (2016): 407-23.Bitner, Mary Jo. "Servicescapes: The Impact of Physical Surroundings on Customers and Employees." The Journal of Marketing (1992): 57-71. Charmaz, K. Constructing Grounded Theory. 2nd ed. Thousand Oaks, California: Sage, 2014. Chessher, A. "Australian Jazz Musician-Educators: An Exploration of Experts' Approaches to Teaching Jazz." Sydney: University of Sydney, 2009. Clare, J. Bodgie Dada and the Cult of Cool: Jazz in Australia since the 1940s. Sydney: University of New South Wales Press, 1995. Conradson, David, and Alan Latham. "Transnational Urbanism: Attending to Everyday Practices and Mobilities." Journal of Ethnic and Migration Studies 31.2 (2005): 227-33. Curtis, Rebecca Anne. "Australia's Capital of Jazz? The (Re)creation of Place, Music and Community at the Wangaratta Jazz Festival." Australian Geographer 41.1 (2010): 101-16. Florida, Richard. The Rise of the Creative Class: And How It’s Transforming Work, Leisure, Community and Everyday Life. Melbourne, Victoria: Pluto Press Australia, 2003. Gibson, Chris. "Migration, Music and Social Relations on the NSW Far North Coast." Transformations 2 (2002): 1-15. ———. "Rural Transformation and Cultural Industries: Popular Music on the New South Wales Far North Coast." Australian Geographical Studies 40.3 (2002): 337-56. Johnson, Bruce. The Inaudible Music: Jazz, Gender and Australian Modernity. Strawberry Hills, NSW: Currency Press, 2000. Kubacki, Krzysztof. "Jazz Musicians: Creating Service Experience in Live Performance." International Journal of Contemporary Hospitality Management 20.4 (2008): 401- 13. ———, et al. "Comparing Nightclub Customers’ Preferences in Existing and Emerging Markets." International Journal of Hospitality Management 26.4 (2007): 957-73. Luckman, S., et al. "Life in a Northern (Australian) Town: Darwin's Mercurial Music Scene." Continuum: Journal of Media & Cultural Studies 22.5 (2008): 623-37. ———, Chris Gibson, and Tess Lea. "Mosquitoes in the Mix: How Transferable Is Creative City Thinking?" Singapore Journal of Tropical Geography 30.1 (2009): 70-85. Martin, Peter J. "The Jazz Community as an Art World: A Sociological Perspective." Jazz Research Journal 2.1 (2005): 5-13. McGuiness, Lucian. "A Case for Ethnographic Enquiry in Australian Jazz." Sydney: University of Sydney, 2010.Minor, Michael S., et al. "Rock On! An Elementary Model of Customer Satisfaction with Musical Performances." Journal of Services Marketing 18.1 (2004): 7-18. Mitchell, A. "Jazz on the Far North Queensland Resort Circuit: A Musician's Perspective." Proceedings of the History & Future of Jazz in the Asia-Pacific Region. Eds. P. Hayward and G. Hodges. Vol. 1. Hamilton Island, Australia: Central Queensland Conservatorium of Music, 2004. Nikolsky, T. "The Development of the Australian Jazz Real Book." Melbourne: RMIT University, 2012. Radbourne, Jennifer, and Andy Arthurs. "Adapting Musicology for Commercial Outcomes." 9th International Conference on Arts and Cultural Management (AIMAC 2007), 2007.Rechniewski, Peter. The Permanent Underground: Australian Contemporary Jazz in the New Millennium. Platform Papers 16. Redfern, NSW: Currency House, 2008. Rolfe, John, et al. "Lessons from the Social and Economic Impacts of the Mining Boom in the Bowen Basin 2004-2006." Australasian Journal of Regional Studies 13.2 (2007): 134-53. Salazar, Noel B. "Migrating Imaginaries of a Better Life … until Paradise Finds You." Understanding Lifestyle Migration. Springer, 2014. 119-38. Shand, J. Jazz: The Australian Accent. Sydney: UNSW Press, 2009.Stake, Robert E. "Qualitative Case Studies." The Sage Handbook of Qualitative Research. Eds. Norman K. Denzin and Yvonna S. Lincoln. 3rd ed. Thousand Oaks, CA: Sage, 2005. 443-66. Stevens, Timothy. "The Red Onion Jazz Band at the 1963 Australian Jazz Convention." Musicology Australia 24.1 (2001): 35-61. Thorp, Justine. "Tourism in Cairns: Image and Product." Journal of Australian Studies 31.91 (2007): 107-13. Turley, L., and D. Fugate. "The Multidimensional Nature of Service Facilities." Journal of Services Marketing 6.3 (1992): 37-45. Waitt, G., and C. Gibson. "Creative Small Cities: Rethinking the Creative Economy in Place." Urban Studies 46.5-6 (2009): 1223-46. Whiteoak, J. "'Jazzing’ and Australia's First Jazz Band." Popular Music 13.3 (1994): 279-95.

Complexity is the central theme of our contemporary age, and what technical culture needs today is to know how to manage it. Knowing how to deal with situations that are anything but straightforward – situations that require flexible thinking, the ability to establish a dialogue between fields of knowledge, and the intermingling of points of view that are, by their very nature, heterogeneous. If this is the direction that needs to be taken in order to tackle the major challenges of the future – from energy to the environment, healthcare to data management, and so on – then it naturally follows that the old monodisciplinary paradigm that we have grown accustomed to as a result of tradition, divided up and compartmentalised, is now outdated. In order to face the great trials of our time, of which architecture is an interpreter, we need a broader vision. Indeed, the growing speed of technological evolution, its pervasiveness and the impact that this is capable of having on the community and our future increasingly point towards the validity of a multifaceted approach that reflects and anticipates the dynamics of social development. If complexity is in fact the theme of the future, then, we cannot avoid engaging in a careful reflection on the dualism between specialisation and a systemic vision; on the relationship between a solid specialist culture, required to understand problems in depth, and a broader cultural perspective, crucial to understanding the direction that the world is moving in. Here is a very simple example: we cannot begin to think about creating new spaces and new functions for living and dwelling if we do not first consider some of the major issues dominating our era. One of the many, and one that I hold particularly dear, is mobility: a new concept of mobility – sustainable, intelligent, shared – redefines everything that revolves around it, starting with our behaviours. And in order to analyse these behaviours, we must first understand the potential and impact of the new technologies underpinning them. It goes without saying that the architect, the engineer, the sociologist and the visionary start-up must all be able to interface within a common framework, a shared perspective, a circular approach. As such, the task that the university is faced with is arming its students, as well as the professionals of today and tomorrow, with skills that, whilst based on solid disciplinary foundations, are not isolated in monothematic contexts, but instead benefit from complementary paths and interaction. Points of comparison and dialogue between different fields of knowledge, different experiences, different practices. At the heart of what we refer to as “polytechnic culture” is the value of design, which everyone contributes to with methods and tools that are different, yet all equally useful: some apply the laws of dynamics, others the laws of physics or electronics; some use an experimental method, others are more firmly rooted in tradition. Designing becomes synonymous with sharing and hybridising, in that it means forming a complex response to a need expressed by the community. It is then worth reflecting upon how, in a civilisation in which everything is contemporary – in which a unitary and evolutionary conception of time has disappeared entirely – we are forced to design in a condition of great discontinuity. Whilst on the one hand, the relentless forward march of technology has got us used to fast dynamics, on the other, space is notoriously subject to slow transformations. Indeed, an architectural project takes months to design and years to actually construct. It also has an intrinsic characteristic, namely surviving the passage of time, of preserving memory and seeing the end of its lifecycle only decades down the line. Whereas once upon a time, historical developments were slow and predictable – as it was easy enough to imagine what would happen over the course of the next twenty years – nowadays, this sort of long-term vision is impossible because society evolves not only rapidly, but also in radical leaps and bounds. Hence the adjective “disruptive” which so often recurs in our conversations: the unexpected, changing our paradigms. Unexpected, just like COVID-19: a catalyst which accelerated some of the major technological changes that were underway, first and foremost digital technology, the true potential of which emerged clearly as we sought to tackle the health crisis. From distance learning to remote working, digital technology allowed us to carry on with our lives, but at the same time, it emptied out schools and universities, offices and skyscrapers; it reassigned new functions to our living spaces; it redefined interpersonal relationships; it depopulated entire urban areas and brought international mobility to a standstill. That said, despite the fact that technology managed to soften the blow of a sudden and dramatic situation almost overnight, I struggle to believe that the pandemic and social distancing will empty out the cities in any definitive way. On the contrary, I believe that after this not-so-brief interlude, the large urban centres will once again become lively, dynamic hubs of activity. They will continue to offer that unique and eclectic collection of ideas, values and opportunities that smaller settlements struggle to ever develop. Architecture will then be faced with the challenge of responding to this distancing and emptying by designing a different understanding of what “being there” means, and in order to do so, it will have to interface with a variety of contexts. Architecture will have the task of redefining a new living experience, of developing a complex conception of planning that lies on the borderline between the opportunities offered by remote learning and working and our needs in terms of socialising; between the needs of the economy and those of protecting the nation’s health; between an immediate response dictated by an emergency and a need for long-term sustainability. In the case of our universities, it will mean completely overhauling our idea of campus life. Whereas some of the most prestigious universities in the world, starting with Cambridge, are offering entirely online courses, riding the long wave of COVID and using the tools offered by digital technology, I believe that, on the contrary, it is absolutely essential to restore a sense of physicality and experience. I believe that the time is right to once again start talking about physical spaces in response to virtual classrooms. I consider it necessary to do everything we can to ensure that our universities continue to draw in talented young people who choose to engage in a first-hand experience of the academic spaces and cities playing host to them – the cities that reflect these people. It is therefore not enough to welcome new students with open arms: we must instead offer them a unique experience of life, from campus life to the services that the wider area can offer. The university needs a modern, welcoming city in order to be attractive, and vice versa: a double bond, a two-way street. An experience that will take tangible form within the university itself – with interactive classrooms, spaces dedicated to hospitality, sports, social interaction, study, workshops – as well as intangible form in the values that we will be able to convey in places that increasingly represent points of engagement and personal growth. Places which can wholeheartedly embody the approach to complexity mentioned earlier. The lesson to draw from this pandemic is that in order to respond to complex challenges, we must turn to knowledge as our starting point. And so, after dedicating years to minor jobs and maintenance work, the university is once again positioning itself as an active force engaging in society and change. This is the best guarantee for the future: ensuring that the classrooms and lecture halls of universities everywhere can once again become “construction sites for knowledge”. And these sites – as our alumnus and master Renzo Piano has taught us – are wellsprings of hope, even and above all in times of uncertainty such as we are currently living through.

Introduction The academic area known as food studies—incorporating elements from disciplines including anthropology, folklore, history, sociology, gastronomy, and cultural studies as well as a range of multi-disciplinary approaches—asserts that cooking and eating practices are less a matter of nutrition (maintaining life by absorbing nutrients from food) and more a personal or group expression of various social and/or cultural actions, values or positions. The French philosopher, Michel de Certeau agrees, arguing, moreover, that there is an urgency to name and unpick (what he identifies as) the “minor” practices, the “multifarious and silent reserve of procedures” of everyday life. Such practices are of crucial importance to all of us, as although seemingly ordinary, and even banal, they have the ability to “organise” our lives (48). Within such a context, the following aims to consider the influence and significance of an important (although largely unstudied) professional figure in rural and regional economic life: the country food preparer variously known as the local chef or cook. Such an approach is obviously framed by the concept of “cultural economy”. This term recognises the convergence, and interdependence, of the spheres of the cultural and the economic (see Scott 335, for an influential discussion on how “the cultural geography of space and the economic geography of production are intertwined”). Utilising this concept in relation to chefs and cooks seeks to highlight how the ways these figures organise (to use de Certeau’s term) the social and cultural lives of those in their communities are embedded in economic practices and also how, in turn, their economic contributions are dependent upon social and cultural practices. This initial mapping of the influence and significance of the rural and regional chef in one rural and regional area, therefore, although necessarily different in approach and content, continues the application of such converged conceptualisations of the cultural and economic as Teema Tairu’s discussion of the social, recreational and spiritual importance of food preparation and consumption by the unemployed in Finland, Guy Redden’s exploration of how supermarket products reflect shared values, and a series of analyses of the cultural significance of individual food products, such as Richard White’s study of vegemite. While Australians, both urban and rural, currently enjoy access to an internationally renowned food culture, it is remarkable to consider that it has only been during the years following the Second World War that these sophisticated and now much emulated ways of eating and cooking have developed. It is, indeed, only during the last half century that Australian eating habits have shifted from largely Anglo-Saxon influenced foods and meals that were prepared and eaten in the home, to the consumption of a wider range of more international and sophisticated foods and meals that are, increasingly, prepared by others and eaten outside the consumer’s residence. While a range of commonly cited influences has prompted this relatively recent revolution in culinary practice—including post-war migration, increasing levels of prosperity, widespread international travel, and the forces of globalisation—some of this change owes a debt to a series of influential individual figures. These tastemakers have included food writers and celebrity chefs; with early exponents including Margaret Fulton, Graham Kerr and Charmaine Solomon (see Brien). The findings of this study suggests that many restaurant chefs, and other cooks, have similarly played, and continue to take, a key role in the lives of not only the, necessarily, limited numbers of individuals who dine in a particular eatery or the other chefs and/or cooks trained in that establishment (Ruhlman, Reach), but also the communities in which they work on a much broader scale. Considering Chefs In his groundbreaking study, A History of Cooks and Cooking, Australian food historian Michael Symons proposes that those who prepare food are worthy of serious consideration because “if ‘we are what we eat’, cooks have not just made our meals, but have also made us. They have shaped our social networks, our technologies, arts and religions” (xi). Writing that cooks “deserve to have their stories told often and well,” and that, moreover, there is a “need to invent ways to think about them, and to revise our views about ourselves in their light” (xi), Symons’s is a clarion call to investigate the role and influence of cooks. Charles-Allen Baker-Clark has explicitly begun to address this lacunae in his Profiles from the Kitchen: What Great Cooks Have Taught Us About Ourselves and Our Food (2006), positing not only how these figures have shaped our relationships with food and eating, but also how these relationships impact on identities, culture and a range of social issues including those of social justice, spirituality and environmental sustainability. With the growing public interest in celebrities, it is perhaps not surprising that, while such research on chefs and/or cooks is still in its infancy, most of the existing detailed studies on individuals focus on famed international figures such as Marie-Antoine Carême (Bernier; Kelly), Escoffier (James; Rachleff; Sanger), and Alexis Soyer (Brandon; Morris; Ray). Despite an increasing number of tabloid “tell-all” surveys of contemporary celebrity chefs, which are largely based on mass media sources and which display little concern for historical or biographical accuracy (Bowyer; Hildred and Ewbank; Simpson; Smith), there have been to date only a handful of “serious” researched biographies of contemporary international chefs such as Julia Child, Alice Waters (Reardon; Riley), and Bernard Loiseux (Chelminski)—the last perhaps precipitated by an increased interest in this chef following his suicide after his restaurant lost one of its Michelin stars. Despite a handful of collective biographical studies of Australian chefs from the later-1980s on (Jenkins; O’Donnell and Knox; Brien), there are even fewer sustained biographical studies of Australian chefs or cooks (Clifford-Smith’s 2004 study of “the supermarket chef,” Bernard King, is a notable exception). Throughout such investigations, as well as in other popular food writing in magazines and cookbooks, there is some recognition that influential chefs and cooks have worked, and continue to work, outside such renowned urban culinary centres as Paris, London, New York, and Sydney. The Michelin starred restaurants of rural France, the so-called “gastropubs” of rural Britain and the advent of the “star-chef”-led country bed and breakfast establishment in Australia and New Zealand, together with the proliferation of farmer’s markets and a public desire to consume locally sourced, and ecologically sustainable, produce (Nabhan), has focused fresh attention on what could be called “the rural/regional chef”. However, despite the above, little attention has focused on the Australian non-urban chef/cook outside of the pages of a small number of key food writing magazines such as Australian Gourmet Traveller and Vogue Entertaining + Travel. Setting the Scene with an Australian Country Example: Armidale and Guyra In 2004, the Armidale-Dumaresq Council (of the New England region, New South Wales, Australia) adopted the slogan “Foodies thrive in Armidale” to market its main city for the next three years. With a population of some 20,000, Armidale’s main industry (in economic terms) is actually education and related services, but the latest Tourist Information Centre’s Dining Out in Armidale (c. 2006) brochure lists some 25 restaurants, 9 bistros and brasseries, 19 cafés and 5 fast food outlets featuring Australian, French, Italian, Mediterranean, Chinese, Thai, Indian and “international” cuisines. The local Yellow Pages telephone listings swell the estimation of the total number of food-providing businesses in the city to 60. Alongside the range of cuisines cited above, a large number of these eateries foreground the use of fresh, local foods with such phrases as “local and regional produce,” “fresh locally grown produce,” “the finest New England ingredients” and locally sourced “New England steaks, lamb and fresh seafood” repeatedly utilised in advertising and other promotional material. Some thirty kilometres to the north along the New England highway, the country town of Guyra, proclaimed a town in 1885, is the administrative and retail centre for a shire of some 2,200 people. Situated at 1,325 metres above sea level, the town is one of the highest in Australia with its main industries those of fine wool and lamb, beef cattle, potatoes and tomatoes. Until 1996, Guyra had been home to a large regional abattoir that employed some 400 staff at the height of its productivity, but rationalisation of the meat processing industry closed the facility, together with its associated pet food processor, causing a downturn in employment, local retail business, and real estate values. Since 2004, Guyra’s economy has, however, begun to recover after the town was identified by the Costa Group as the perfect site for glasshouse grown tomatoes. Perfect, due to its rare combination of cool summers (with an average of less than two days per year with temperatures over 30 degrees celsius), high winter light levels and proximity to transport routes. The result: 3.3 million kilograms of truss, vine harvested, hydroponic “Top of the Range” tomatoes currently produced per annum, all year round, in Guyra’s 5-hectare glasshouse: Australia’s largest, opened in December 2005. What residents (of whom I am one) call the “tomato-led recovery” has generated some 60 new local jobs directly related to the business, and significant flow on effects in terms of the demand for local services and retail business. This has led to substantial rates of renovation and building of new residential and retail properties, and a noticeably higher level of trade flowing into the town. Guyra’s main street retail sector is currently burgeoning and stories of its renewal have appeared in the national press. Unlike many similar sized inland towns, there are only a handful of empty shops (and most of these are in the process of being renovated), and new commercial premises have recently been constructed and opened for business. Although a small town, even in Australian country town terms, Guyra now has 10 restaurants, hotel bistros and cafés. A number of these feature local foods, with one pub’s bistro regularly featuring the trout that is farmed just kilometres away. Assessing the Contribution of Local Chefs and Cooks In mid-2007, a pilot survey to begin to explore the contribution of the regional chef in these two close, but quite distinct, rural and regional areas was sent to the chefs/cooks of the 70 food-serving businesses in Armidale and Guyra that I could identify. Taking into account the 6 returns that revealed a business had closed, moved or changed its name, the 42 replies received represented a response rate of 65.5per cent (or two thirds), representatively spread across the two towns. Answers indicated that the businesses comprised 18 restaurants, 13 cafés, 6 bistro/brasseries, 1 roadhouse, 1 takeaway/fast food and 3 bed and breakfast establishments. These businesses employed 394 staff, of whom 102 were chefs and/cooks, or 25.9 per cent of the total number of staff then employed by these establishments. In answer to a series of questions designed to ascertain the roles played by these chefs/cooks in their local communities, as well as more widely, I found a wide range of inputs. These chefs had, for instance, made a considerable contribution to their local economies in the area of fostering local jobs and a work culture: 40 (95 per cent) had worked with/for another local business including but not exclusively food businesses; 30 (71.4 per cent) had provided work experience opportunities for those aspiring to work in the culinary field; and 22 (more than half) had provided at least one apprenticeship position. A large number had brought outside expertise and knowledge with them to these local areas, with 29 (69 per cent) having worked in another food business outside Armidale or Guyra. In terms of community building and sustainability, 10 (or almost a quarter) had assisted or advised the local Council; 20 (or almost half) had worked with local school children in a food-related way; 28 (two thirds) had helped at least one charity or other local fundraising group. An extra 7 (bringing the cumulative total to 83.3 per cent) specifically mentioned that they had worked with/for the local gallery, museum and/or local history group. 23 (more than half) had been involved with and/or contributed to a local festival. The question of whether they had “contributed anything else important, helpful or interesting to the community” elicited the following responses: writing a food or wine column for the local paper (3 respondents), delivering TAFE teacher workshops (2 respondents), holding food demonstrations for Rotary and Lions Clubs and school fetes (5 respondents), informing the public about healthy food (3 respondents), educating the public about environmental issues (2 respondents) and working regularly with Meals on Wheels or a similar organisation (6 respondents, or 14.3 per cent). One respondent added his/her work as a volunteer driver for the local ambulance transport service, the only non-food related response to this question. Interestingly, in line with the activity of well-known celebrity chefs, in addition to the 3 chefs/cooks who had written a food or wine column for the local newspaper, 11 respondents (more than a quarter of the sample) had written or contributed to a cookbook or recipe collection. One of these chefs/cooks, moreover, reported that he/she produced a weblog that was “widely read”, and also contributed to international food-related weblogs and websites. In turn, the responses indicated that the (local) communities—including their governing bodies—also offer some support of these chefs and cooks. Many respondents reported they had been featured in, or interviewed and/or photographed for, a range of media. This media comprised the following: the local newspapers (22 respondents, 52.4 per cent), local radio stations (19 respondents, 45.2 per cent), regional television stations (11 respondents, 26.2 per cent) and local websites (8 respondents, 19 per cent). A number had also attracted other media exposure. This was in the local, regional area, especially through local Council publications (31 respondents, 75 per cent), as well as state-wide (2 respondents, 4.8 per cent) and nationally (6 respondents, 14.3 per cent). Two of these local chefs/cooks (or 4.8 per cent) had attracted international media coverage of their activities. It is clear from the above that, in the small area surveyed, rural and regional chefs/cooks make a considerable contribution to their local communities, with all the chefs/cooks who replied making some, and a number a major, contribution to those communities, well beyond the requirements of their paid positions in the field of food preparation and service. The responses tendered indicate that these chefs and cooks contributed regularly to local public events, institutions and charities (with a high rate of contribution to local festivals, school programs and local charitable activities), and were also making an input into public education programs, local cultural institutions, political and social debates of local importance, as well as the profitability of other local businesses. They were also actively supporting not only the future of the food industry as a whole, but also the viability of their local communities, by providing work experience opportunities and taking on local apprentices for training and mentorship. Much more than merely food providers, as a group, these chefs and cooks were, it appears, also operating as food historians, public intellectuals, teachers, activists and environmentalists. They were, moreover, operating as content producers for local media while, at the same time, acting as media producers and publishers. Conclusion The terms “chef” and “cook” can be diversely defined. All definitions, however, commonly involve a sense of professionalism in food preparation reflecting some specialist knowledge and skill in the culinary arts, as well as various levels of creativity, experience and responsibility. In terms of the specific duties that chefs and professional cooks undertake every day, almost all publications on the subject deal specifically with workplace related activities such as food and other supply ordering, staff management, menu planning and food preparation and serving. This is constant across culinary textbooks (see, for instance, Culinary Institute of America 2002) and more discursive narratives about the professional chef such as the bestselling autobiographical musings of Anthony Bourdain, and Michael Ruhlman’s journalistic/biographical investigations of US chefs (Soul; Reach). An alternative preliminary examination, and categorisation, of the roles these professionals play outside their kitchens reveals, however, a much wider range of community based activities and inputs than such texts suggest. It is without doubt that the chefs and cooks who responded to the survey discussed above have made, and are making, a considerable contribution to their local New England communities. It is also without doubt that these contributions are of considerable value, and valued by, those country communities. Further research will have to consider to what extent these contributions, and the significance and influence of these chefs and cooks in those communities are mirrored, or not, by other country (as well as urban) chefs and cooks, and their communities. Acknowledgements An earlier version of this paper was presented at the Engaging Histories: Australian Historical Association Regional Conference, at the University of New England, September 2007. I would like to thank the session’s participants for their insightful comments on that presentation. A sincere thank you, too, to the reviewers of this article, whose suggestions assisted my thinking on this piece. Research to complete this article was carried out whilst a Visiting Fellow with the Research School of Humanities, the Australian National University. References Armidale Tourist Information Centre. Dining Out in Armidale [brochure]. Armidale: Armidale-Dumaresq Council, c. 2006. Baker-Clark, C. A. Profiles from the Kitchen: What Great Cooks have Taught us about Ourselves and our Food. Lexington: UP of Kentucky, 2006. Bernier, G. Antoine Carême 1783-1833: La Sensualité Gourmande en Europe. Paris: Grasset, 1989. Bourdain, A. Kitchen Confidential: Adventures in the Culinary Underbelly. New York: Harper Perennial, 2001. Bowyer, A. Delia Smith: The Biography. London: André Deutsch, 1999. Brandon, R. The People’s Chef: Alexis Soyer, A Life in Seven Courses. Chichester: Wiley, 2005. Brien, D. L. “Australian Celebrity Chefs 1950-1980: A Preliminary Study.” Australian Folklore 21 (2006): 201–18. Chelminski, R. The Perfectionist: Life and Death In Haute Cuisine. New York: Gotham Books, 2005. Clifford-Smith, S. A Marvellous Party: The Life of Bernard King. Milson’s Point: Random House Australia, 2004. Culinary Institute of America. The Professional Chef. 7th ed. New York: Wiley, 2002. de Certeau, M. The Practice of Everyday Life. Berkeley: U of California P, 1988. Hildred, S., and T. Ewbank. Jamie Oliver: The Biography. London: Blake, 2001. Jenkins, S. 21 Great Chefs of Australia: The Coming of Age of Australian Cuisine. East Roseville: Simon and Schuster, 1991. Kelly, I. Cooking for Kings: The Life of Antoine Carême, The First Celebrity Chef. New York: Walker and Company, 2003. James, K. Escoffier: The King of Chefs. London and New York: Hambledon and London, 2002. Morris, H. Portrait of a Chef: The Life of Alexis Soyer, Sometime Chef to the Reform Club. Cambridge: Cambridge UP, 1938. Nabhan, G. P. Coming Home to Eat: The Pleasures and Politics of Local Foods. New York: W.W. Norton, 2002. O’Donnell, M., and T. Knox. Great Australian Chefs. Melbourne: Bookman Press, 1999. Rachleff, O. S. Escoffier: King of Chefs. New York: Broadway Play Pub., 1983. Ray, E. Alexis Soyer: Cook Extraordinary. Lewes: Southover, 1991. Reardon, J. M. F. K. Fisher, Julia Child, and Alice Waters: Celebrating the Pleasures of the Table. New York: Harmony Books, 1994. Redden, G. “Packaging the Gifts of Nation.” M/C: A Journal of Media and Culture 2.7 (1999) accessed 10 September 2008 http://www.uq.edu.au/mc/9910/gifts.php. Riley, N. Appetite For Life: The Biography of Julia Child. New York: Doubleday, 1977. Ruhlman, M. The Soul of a Chef. New York: Viking, 2001. Ruhlman, M. The Reach of a Chef. New York: Viking, 2006. Sanger, M. B. Escoffier: Master Chef. New York: Farrar Straus Giroux, 1976. Scott, A. J. “The Cultural Economy of Cities.” International Journal of Urban and Regional Research 212 (1997) 323–39. Simpson, N. Gordon Ramsay: The Biography. London: John Blake, 2006. Smith, G. Nigella Lawson: A Biography. London: Andre Deutsch, 2005. Symons, M. A History of Cooks and Cooking. Urbana and Chicago: U of Illinois P, 2004. Tairu, T. “Material Food, Spiritual Quest: When Pleasure Does Not Follow Purchase.” M/C: A Journal of Media and Culture 2.7 (1999) accessed 10 September 2008 http://www.uq.edu.au/mc/9910/pleasure.php. White, R. S. “Popular Culture as the Everyday: A Brief Cultural History of Vegemite.” Australian Popular Culture. Ed. I. Craven. Cambridge UP, 1994. 15–21.

One of the most distinct places the politics of affect have played out in Australia of late has been in the struggles around the mandatory detention of undocumented migrants; specifically, in arguments about the amount of compassion border control practices should or do entail. Indeed, in 1990 the newly established Joint Standing Committee on Migration (JSCM) published its first report, Illegal Entrants in Australia: Balancing Control and Compassion. Contemporaneous, thought not specifically concerned, with the establishment of mandatory detention for asylum seekers, this report helped shape the context in which detention policy developed. As the Bureau of Immigration and Population Research put it in their summary of the report, “the Committee endorsed a tough stance regarding all future illegal entrants but a more compassionate stance regarding those now in Australia” (24). It would be easy now to frame this report in a narrative of decline. Under a Labor government the JSCM had at least some compassion to offer; since the 1996 conservative Coalition victory any such compassion has been in increasingly short supply, if not an outright political liability. This is a popular narrative for those clinging to the belief that Labor is still, in some residual sense, a social-democratic party. I am more interested in the ways the report’s subtitle effectively predicted the framework in which debates about detention have since been constructed: control vs. compassion, with balance as the appropriate mediating term. Control and compassion are presented as the poles of a single governmental project insofar as they can be properly calibrated; but at the same time, compassion is presented as an external balance to the governmental project (control), an extra-political restriction of the political sphere. This is a very formal way to put it, but it reflects a simple, vernacular theory that circulates widely among refugee activists. It is expressed with concision in Peter Mares’ groundbreaking book on detention centres, Borderlines, in the chapter title “Compassion as a vice”. Compassion remains one of the major themes and demands of Australian refugee advocates. They thematise compassion not only for the obvious reasons that mandatory detention involves a devastating lack thereof, and that its critics are frequently driven by intense emotional connections both to particular detainees and TPV holders and, more generally, to all who suffer the effects of Australian border control. There is also a historical or conjunctural element: as Ghassan Hage has written, for the last ten years or so many forms of political opposition in Australia have organised their criticisms in terms of “things like compassion or hospitality rather than in the name of a left/right political divide” (7). This tendency is not limited to any one group; it ranges across the spectrum from Liberal Party wets to anarchist collectives, via dozens of organised groups and individuals varying greatly in their political beliefs and intentions. In this context, it would be tendentious to offer any particular example(s) of compassionate activism, so let me instead cite a complaint. In November 2002, the conservative journal Quadrant worried that morality and compassion “have been appropriated as if by right by those who are opposed to the government’s policies” on border protection (“False Refugees” 2). Thus, the right was forced to begin to speak the language of compassion as well. The Department of Immigration, often considered the epitome of the lack of compassion in Australian politics, use the phrase “Australia is a compassionate country, but…” so often they might as well inscribe it on their letterhead. Of course this is hypocritical, but it is not enough to say the right are deforming the true meaning of the term. The point is that compassion is a contested term in Australian political discourse; its meanings are not fixed, but constructed and struggled over by competing political interests. This should not be particularly surprising. Stuart Hall, following Ernesto Laclau and others, famously argued that no political term has an intrinsic meaning. Meanings are produced – articulated, and de- or re-articulated – through a dynamic and partisan “suturing together of elements that have no necessary or eternal belongingness” (10). Compassion has many possible political meanings; it can be articulated to diverse social (and antisocial) ends. If I was writing on the politics of compassion in the US, for example, I would be talking about George W. Bush’s slogan of “compassionate conservatism”, and whatever Hannah Arendt meant when she argued that “the passion of compassion has haunted and driven the best men [sic] of all revolutions” (65), I think she meant something very different by the term than do, say, Rural Australians for Refugees. As Lauren Berlant has written, “politicized feeling is a kind of thinking that too often assumes the obviousness of the thought it has” (48). Hage has also opened this assumed obviousness to question, writing that “small-‘l’ liberals often translate the social conditions that allow them to hold certain superior ethical views into a kind of innate moral superiority. They see ethics as a matter of will” (8-9). These social conditions are complex – it isn’t just that, as some on the right like to assert, compassion is a product of middle class comfort. The actual relations are more dynamic and open. Connections between class and occupational categories on the one hand, and social attitudes and values on the other, are not given but constructed, articulated and struggled over. As Hall put it, the way class functions in the distribution of ideologies is “not as the permanent class-colonization of a discourse, but as the work entailed in articulating these discourses to different political class practices” (139). The point here is to emphasise that the politics of compassion are not straightforward, and that we can recognise and affirm feelings of compassion while questioning the politics that seem to emanate from those feelings. For example, a politics that takes compassion as its basis seems ill-suited to think through issues it can’t put a human face to – that is, the systematic and structural conditions for mandatory detention and border control. Compassion’s political investments accrue to specifiable individuals and groups, and to the harms done to them. This is not, as such, a bad thing, particularly if you happen to be a specifiable individual to whom a substantive harm has been done. But compassion, going one by one, group by group, doesn’t cope well with situations where the form of the one, or the form of the disadvantaged minority, constitutes not only a basis for aid or emancipation, but also violently imposes particular ideas of modern western subjectivity. How does this violence work? I want to answer by way of the story of an Iranian man who applied for asylum in Australia in 2004. In the available documents he is referred to as “the Applicant”. The Applicant claimed asylum based on his homosexuality, and his fear of persecution should he return to Iran. His asylum application was rejected by the Refugee Review Tribunal because the Tribunal did not believe he was really gay. In their decision they write that “the Tribunal was surprised to observe such a comprehensive inability on the Applicant’s part to identify any kind of emotion-stirring or dignity-arousing phenomena in the world around him”. The phenomena the Tribunal suggest might have been emotion-stirring for a gay Iranian include Oscar Wilde, Alexander the Great, Andre Gide, Greco-Roman wrestling, Bette Midler, and Madonna. I can personally think of much worse bases for immigration decisions than Madonna fandom, but there is obviously something more at stake here. (All quotes from the hearing are taken from the High Court transcript “WAAG v MIMIA”. I have been unable to locate a transcript of the original RRT decision, and so far as I know it remains unavailable. Thanks to Mark Pendleton for drawing my attention to this case, and for help with references.) Justice Kirby, one of the presiding Justices at the Applicant’s High Court appeal, responded to this with the obvious point, “Madonna, Bette Midler and so on are phenomena of the Western culture. In Iran, where there is death for some people who are homosexuals, these are not in the forefront of the mind”. Indeed, the High Court is repeatedly critical and even scornful of the Tribunal decision. When Mr Bennett, who is appearing for the Minister for Immigration in the appeal begins his case, he says, “your Honour, the primary attack which seems to be made on the decision of the –”, he is cut off by Justice Gummow, who says, “Well, in lay terms, the primary attack is that it was botched in the Tribunal, Mr Solicitor”. But Mr Bennett replies by saying no, “it was not botched. If one reads the whole of the Tribunal judgement, one sees a consistent line of reasoning and a conclusion being reached”. In a sense this is true; the deep tragicomic weirdness of the Tribunal decision is based very much in the unfolding of a particular form of homophobic rationality specific to border control and refugee determination. There have been hundreds of applications for protection specifically from homophobic persecution since 1994, when the first such application was made in Australia. As of 2002, only 22% of those applications had been successful, with the odds stacked heavily against lesbians – only 7% of lesbian applicants were successful, against a shocking enough 26% of gay men (Millbank, Imagining Otherness 148). There are a number of reasons for this. The Tribunal has routinely decided that even if persecution had occurred on the basis of homosexuality, the Applicant would be able to avoid such persecution if she or he acted ‘discreetly’, that is, hid their sexuality. The High Court ruled out this argument in 2003, but the Tribunal maintains an array of effective techniques of homophobic exclusion. For example, the Tribunal often uses the Spartacus International Gay Guide to find out about local conditions of lesbian and gay life even though it is a tourist guide book aimed at Western gay men with plenty of disposable income (Dauvergne and Millbank 178-9). And even in cases which have found in favour of particular lesbian and gay asylum seekers, the Tribunal has often gone out of its way to assert that lesbians and gay men are, nevertheless, not the subjects of human rights. States, that is, violate no rights when they legislate against lesbian and gay identities and practices, and the victims of such legislation have no rights to protection (Millbank, Fear 252-3). To go back to Madonna. Bennett’s basic point with respect to the references to the Material Girl et al is that the Tribunal specifically rules them as irrelevant. Mr Bennett: The criticism which is being made concerns a question which the Tribunal asked and what is very much treated in the Tribunal’s judgement as a passing reference. If one looks, for example, at page 34 – Kirby J: This is where Oscar, Alexander and Bette as well as Madonna turn up? Mr Bennett: Yes. The very paragraph my learned friend relies on, if one reads the sentence, what the Tribunal is saying is, “I am not looking for these things”. Gummow J: Well, why mention it? What sort of training do these people get in decision making before they are appointed to this body, Mr Solicitor? Mr Bennett: I cannot assist your Honour on that. Gummow J: No. Well, whatever it is, what happened here does not speak highly of the results of it. To gloss this, Bennett argues that the High Court are making too much of an irrelevant minor point in the decision. Mr Bennett: One would think [based on the High Court’s questions] that the only things in this judgement were the throwaway references saying, “I wasn’t looking for an understanding of Oscar Wilde”, et cetera. That is simply, when one reads the judgement as a whole, not something which goes to the centre at all… There is a small part of the judgement which could be criticized and which is put, in the judgement itself, as a subsidiary element and prefaced with the word “not”. Kirby J: But the “not” is a bit undone by what follows when I think Marilyn [Monroe] is thrown in. Mr Bennett: Well, your Honour, I am not sure why she is thrown in. Kirby J: Well, that is exactly the point. Mr Bennett holds that, as per Wayne’s World, the word “not” negates any clause to which it is attached. Justice Kirby, on the other hand, feels that this “not” comes undone, and that this undoing – and the uncertainty that accrues to it – is exactly the point. But the Tribunal won’t be tied down on this, and makes use of its “not” to hold gay stereotypes at arm’s length – which is still, of course, to hold them, at a remove that will insulate homophobia against its own illegitimacy. The Tribunal defends itself against accusations of homophobia by announcing specifically and repeatedly, in terms that consciously evoke culturally specific gay stereotypes, that it is not interested in those stereotypes. This unconvincing alibi works to prevent any inconvenient accusations of bias from butting in on the routine business of heteronormativity. Paul Morrison has noted that not many people will refuse to believe you’re gay: “Claims to normativity are characteristically met with scepticism. Only parents doubt confessions of deviance” (5). In this case, it is not a parent but a paternalistic state apparatus. The reasons the Tribunal did not believe the applicant [were] (a) because of “inconsistencies about the first sexual experience”, (b) “the uniformity of relationships”, (c) the “absence of a “gay” circle of friends”, (d) “lack of contact with the “gay” underground” and [(e)] “lack of other forms of identification”. Of these the most telling, I think, are the last three: a lack of gay friends, of contact with the gay underground, or of unspecified other forms of identification. What we can see here is that even if the Tribunal isn’t looking for the stereotypical icons of Western gay culture, it is looking for the characteristic forms of Western gay identity which, as we know, are far from universal. The assumptions about the continuities between sex acts and identities that we codify with names like lesbian, gay, homosexual and so on, often very poorly translate the ways in which non-Western populations understand and describe themselves, if they translate them at all. Gayatri Gopinath, for example, uses the term “queer diaspor[a]... in contradistinction to the globalization of “gay” identity that replicates a colonial narrative of development and progress that judges all other sexual cultures, communities, and practices against a model of Euro-American sexual identity” (11). I can’t assess the accuracy of the Tribunal’s claims regarding the Applicant’s social life, although I am inclined to scepticism. But if the Applicant in this case indeed had no gay friends, no contact with the gay underground and no other forms of identification with the big bad world of gaydom, he may obviously, nevertheless, have been a Man Who Has Sex With Men, as they sometimes say in AIDS prevention work. But this would not, either in the terms of Australian law or the UN Convention, qualify him as a refugee. You can only achieve refugee status under the terms of the Convention based on membership of a ‘specific social group’. Lesbians and gay men are held to constitute such groups, but what this means is that there’s a certain forcing of Western identity norms onto the identity and onto the body of the sexual other. This shouldn’t read simply as a moral point about how we should respect diversity. There’s a real sense that our own lives as political and sexual beings are radically impoverished to the extent we fail to foster and affirm non-Western non-heterosexualities. There’s a sustaining enrichment that we miss out on, of course, in addition to the much more serious forms of violence others will be subject to. And these are kinds of violence as well as forms of enrichment that compassionate politics, organised around the good refugee, just does not apprehend. In an essay on “The politics of bad feeling”, Sara Ahmed makes a related argument about national shame and mourning. “Words cannot be separated from bodies, or other signs of life. So the word ‘mourns’ might get attached to some subjects (some more than others represent the nation in mourning), and it might get attached to some objects (some losses more than others may count as losses for this nation)” (73). At one level, these points are often made with regard to compassion, especially as it is racialised in Australian politics; for example, that there would be a public outcry were we to detain hypothetical white boat people. But Ahmed’s point stretches further – in the necessary relation between words and bodies, she asks not only which bodies do the describing and which are described, but which are permitted a relation to language at all? If “words cannot be separated from bodies”, what happens to those bodies words fail? The queer diasporic body, so reductively captured in that phrase, is a case in point. How do we honour its singularity, as well as its sociality? How do we understand the systematicity of the forces that degrade and subjugate it? What do the politics of compassion have to offer here? It’s easy for the critic or the cynic to sneer at such politics – so liberal, so sentimental, so wet – or to deconstruct them, expose “the violence of sentimentality” (Berlant 62), show “how compassion towards the other’s suffering might sustain the violence of appropriation” (Ahmed 74). These are not moves I want to make. A guiding assumption of this essay is that there is never a unilinear trajectory between feelings and politics. Any particular affect or set of affects may be progressive, reactionary, apolitical, or a combination thereof, in a given situation; compassionate politics are no more necessarily bad than they are necessarily good. On the other hand, “not necessarily bad” is a weak basis for a political movement, especially one that needs to understand and negotiate the ways the enclosures and borders of late capitalism mass-produce bodies we can’t put names to, people outside familiar and recognisable forms of identity and subjectivity. As Etienne Balibar has put it, “in utter disregard of certain borders – or, in certain cases, under covers of such borders – indefinable and impossible identities emerge in various places, identities which are, as a consequence, regarded as non-identities. However, their existence is, none the less, a life-and-death question for large numbers of human beings” (77). Any answer to that question starts with our compassion – and our rage – at an unacceptable situation. But it doesn’t end there. References Ahmed, Sara. “The Politics of Bad Feeling.” Australian Critical Race and Whiteness Studies Association Journal 1.1 (2005): 72-85. Arendt, Hannah. On Revolution. Harmondsworth: Penguin, 1973. Balibar, Etienne. We, the People of Europe? Reflections on Transnational Citizenship. Trans. James Swenson. Princeton: Princeton UP, 2004. Berlant, Lauren. “The Subject of True Feeling: Pain, Privacy and Politics.” Cultural Studies and Political Theory. Ed. Jodi Dean. Ithaca and Cornell: Cornell UP, 2000. 42-62. Bureau of Immigration and Population Research. Illegal Entrants in Australia: An Annotated Bibliography. Canberra: Australian Government Publishing Service, 1994. Dauvergne, Catherine and Jenni Millbank. “Cruisingforsex.com: An Empirical Critique of the Evidentiary Practices of the Australian Refugee Review Tribunal.” Alternative Law Journal 28 (2003): 176-81. “False Refugees and Misplaced Compassion” Editorial. Quadrant 390 (2002): 2-4. Hage, Ghassan. Against Paranoid Nationalism: Searching for Hope in a Shrinking Society. Annandale: Pluto, 2003. Hall, Stuart. The Hard Road to Renewal: Thatcherism and the Crisis of the Left. London: Verso, 1988. Joint Standing Committee on Migration. Illegal Entrants in Australia: Balancing Control and Compassion. Canberra: The Committee, 1990. Mares, Peter. Borderline: Australia’s Treatment of Refugees and Asylum Seekers. Sydney: UNSW Press, 2001. Millbank, Jenni. “Imagining Otherness: Refugee Claims on the Basis of Sexuality in Canada and Australia.” Melbourne University Law Review 26 (2002): 144-77. ———. “Fear of Persecution or Just a Queer Feeling? Refugee Status and Sexual orientation in Australia.” Alternative Law Journal 20 (1995): 261-65, 299. Morrison, Paul. The Explanation for Everything: Essays on Sexual Subjectivity. New York: New York UP, 2001. Pendleton, Mark. “Borderline.” Bite 2 (2004): 3-4. “WAAG v MIMIA [2004]. HCATrans 475 (19 Nov. 2004)” High Court of Australia Transcripts. 2005. 17 Oct. 2005 http://www.austlii.edu.au/au/other/HCATrans/2004/475.html>. Citation reference for this article MLA Style McGrath, Shane. "Compassionate Refugee Politics?." M/C Journal 8.6 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0512/02-mcgrath.php>. APA Style McGrath, S. (Dec. 2005) "Compassionate Refugee Politics?," M/C Journal, 8(6). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0512/02-mcgrath.php>.

Introduction I think the Privacy Act is a huge edifice to protect the minority of things that could go wrong. I’ve got a good example for you, I’m just trying to think … yeah the worst one I’ve ever seen was the Balga Youth Program where we took these students on a reward excursion all the way to Fremantle and suddenly this very alienated kid started to jump under a bus, a moving bus so the kid had to be restrained. The cops from Fremantle arrived because all the very good people in Fremantle were alarmed at these grown-ups manhandling a kid and what had happened is that DCD [Department of Community Development] had dropped him into the program but hadn’t told us that this kid had suicide tendencies. No, it’s just chronically bad. And there were caseworkers involved and … there is some information that we have to have that doesn’t get handed down. Rather than a blanket rule that everything’s confidential coming from them to us, and that was a real live situation, and you imagine how we’re trying to handle it, we had taxis going from Balga to Fremantle to get staff involved and we only had to know what to watch out for and we probably could have … well what you would have done is not gone on the excursion I suppose (School Principal, quoted in Balnaves and Luca 49). These comments are from a school principal in Perth, Western Australia in a school that is concerned with “at-risk” students, and in a context where the Commonwealth Privacy Act 1988 has imposed limitations on their work. Under this Act it is illegal to pass health, personal or sensitive information concerning an individual on to other people. In the story cited above the Department of Community Development personnel were apparently protecting the student’s “negative right”, that is, “freedom from” interference by others. On the other hand, the principal’s assertion that such information should be shared is potentially a “positive right” because it could cause something to be done in that person’s or society’s interests. Balnaves and Luca noted that positive and negative rights have complex philosophical underpinnings, and they inform much of how we operate in everyday life and of the dilemmas that arise (49). For example, a ban on euthanasia or the “assisted suicide” of a terminally ill person can be a “positive right” because it is considered to be in the best interests of society in general. However, physicians who tacitly approve a patient’s right to end their lives with a lethal dose by legally prescribed dose of medication could be perceived as protecting the patient’s “negative right” as a “freedom from” interference by others. While acknowledging the merits of collaboration between people who are working to improve the wellbeing of students “at-risk”, this paper examines some of the barriers to collaboration. Based on both primary and secondary sources, and particularly on oral testimonies, the paper highlights the tension between privacy as a negative right and collaborative helping as a positive right. It also points to other difficulties and dilemmas within and between the institutions engaged in this joint undertaking. The authors acknowledge Michel Foucault’s contention that discourse is power. The discourse on privacy and the sharing of information in modern societies suggests that privacy is a negative right that gives freedom from bureaucratic interference and protects the individual. However, arguably, collaboration between agencies that are working to support individuals “at-risk” requires a measured relaxation of the requirements of this negative right. Children and young people “at-risk” are a case in point. Towards Collaboration From a series of interviews conducted in 2004, the school authorities at Balga Senior High School and Midvale Primary School, people working for the Western Australian departments of Community Development, Justice, and Education and Training in Western Australia, and academics at the Edith Cowan and Curtin universities, who are working to improve the wellbeing of students “at-risk” as part of an Australian Research Council (ARC) project called Smart Communities, have identified students “at-risk” as individuals who have behavioural problems and little motivation, who are alienated and possibly violent or angry, who under-perform in the classroom and have begun to truant. They noted also that students “at-risk” often suffer from poor health, lack of food and medication, are victims of unwanted pregnancies, and are engaged in antisocial and illegal behaviour such as stealing cars and substance abuse. These students are also often subject to domestic violence (parents on drugs or alcohol), family separation, and homelessness. Some are depressed or suicidal. Sometimes cultural factors contribute to students being regarded as “at-risk”. For example, a social worker in the Smart Communities project stated: Cultural factors sometimes come into that as well … like with some Muslim families … they can flog their daughter or their son, usually the daughter … so cultural factors can create a risk. Research elsewhere has revealed that those children between the ages of 11-17 who have been subjected to bullying at school or physical or sexual abuse at home and who have threatened and/or harmed another person or suicidal are “high-risk” youths (Farmer 4). In an attempt to bring about a positive change in these alienated or “at-risk” adolescents, Balga Senior High School has developed several programs such as the Youth Parents Program, Swan Nyunger Sports Education program, Intensive English Centre, and lower secondary mainstream program. The Midvale Primary School has provided services such as counsellors, Aboriginal child protection workers, and Aboriginal police liaison officers for these “at-risk” students. On the other hand, the Department of Community Development (DCD) has provided services to parents and caregivers for children up to 18 years. Academics from Edith Cowan and Curtin universities are engaged in gathering the life stories of these “at-risk” students. One aspect of this research entails the students writing their life stories in a secured web portal that the universities have developed. The researchers believe that by engaging the students in these self-exploration activities, they (the students) would develop a more hopeful outlook on life. Though all agencies and educational institutions involved in this collaborative project are working for the well-being of the children “at-risk”, the Privacy Act forbids the authorities from sharing information about them. A school psychologist expressed concern over the Privacy Act: When the Juvenile Justice Department want to reintroduce a student into a school, we can’t find out anything about this student so we can’t do any preplanning. They want to give the student a fresh start, so there’s always that tension … eventually everyone overcomes [this] because you realise that the student has to come to the school and has to be engaged. Of course, the manner and consequences of a student’s engagement in school cannot be predicted. In the scenario described above students may have been given a fair chance to reform themselves, which is their positive right but if they turn out to be at “high risk” it would appear that the Juvenile Department protected the negative right of the students by supporting “freedom from” interference by others. Likewise, a school health nurse in the project considered confidentiality or the Privacy Act an important factor in the security of the student “at-risk”: I was trying to think about this kid who’s one of the children who has been sexually abused, who’s a client of DCD, and I guess if police got involved there and wanted to know details and DCD didn’t want to give that information out then I’d guess I’d say to the police “Well no, you’ll have to talk to the parents about getting further information.” I guess that way, recognising these students are minor and that they are very vulnerable, their information … where it’s going, where is it leading? Who wants to know? Where will it be stored? What will be the outcomes in the future for this kid? As a 14 year old, if they’re reckless and get into things, you know, do they get a black record against them by the time they’re 19? What will that information be used for if it’s disclosed? So I guess I become an advocate for the student in that way? Thus the nurse considers a sexually abused child should not be identified. It is a positive right in the interest of the person. Once again, though, if the student turns out to be at “high risk” or suicidal, then it would appear that the nurse was protecting the youth’s negative right—“freedom from” interference by others. Since collaboration is a positive right and aims at the students’ welfare, the workable solution to prevent the students from suicide would be to develop inter-agency trust and to share vital information about “high-risk” students. Dilemmas of Collaboration Some recent cases of the deaths of young non-Caucasian girls in Western countries, either because of the implications of the Privacy Act or due to a lack of efficient and effective communication and coordination amongst agencies, have raised debates on effective child protection. For example, the British Laming report (2003) found that Victoria Climbié, a young African girl, was sent by her parents to her aunt in Britain in order to obtain a good education and was murdered by her aunt and aunt’s boyfriend. However, the risk that she could be harmed was widely known. The girl’s problems were known to 6 local authorities, 3 housing authorities, 4 social services, 2 child protection teams, and the police, the local church, and the hospital, but not to the education authorities. According to the Laming Report, her death could have been prevented if there had been inter-agency sharing of information and appropriate evaluation (Balnaves and Luca 49). The agencies had supported the negative rights of the young girl’s “freedom from” interference by others, but at the cost of her life. Perhaps Victoria’s racial background may have contributed to the concealment of information and added to her disadvantaged position. Similarly, in Western Australia, the Gordon Inquiry into the death of Susan Taylor, a 15 year old girl Aboriginal girl at the Swan Nyungah Community, found that in her short life this girl had encountered sexual violation, violence, and the ravages of alcohol and substance abuse. The Gordon Inquiry reported: Although up to thirteen different agencies were involved in providing services to Susan Taylor and her family, the D[epartment] of C[ommunity] D[evelopment] stated they were unaware of “all the services being provided by each agency” and there was a lack of clarity as to a “lead coordinating agency” (Gordon et al. quoted in Scott 45). In this case too, multiple factors—domestic, racial, and the Privacy Act—may have led to Susan Taylor’s tragic end. In the United Kingdom, Harry Ferguson noted that when a child is reported to be “at-risk” from domestic incidents, they can suffer further harm because of their family’s concealment (204). Ferguson’s study showed that in 11 per cent of the 319 case sample, children were known to be re-harmed within a year of initial referral. Sometimes, the parents apply a veil of secrecy around themselves and their children by resisting or avoiding services. In such cases the collaborative efforts of the agencies and education may be thwarted. Lack of cultural education among teachers, youth workers, and agencies could also put the “at-risk” cultural minorities into a high risk category. For example, an “at-risk” Muslim student may not be willing to share personal experiences with the school or agencies because of religious sensitivities. This happened in the UK when Khadji Rouf was abused by her father, a Bangladeshi. Rouf’s mother, a white woman, and her female cousin from Bangladesh, both supported Rouf when she finally disclosed that she had been sexually abused for over eight years. After group therapy, Rouf stated that she was able to accept her identity and to call herself proudly “mixed race”, whereas she rejected the Asian part of herself because it represented her father. Other Asian girls and young women in this study reported that they could not disclose their abuse to white teachers or social workers because of the feeling that they would be “letting down their race or their Muslim culture” (Rouf 113). The marginalisation of many Muslim Australians both in the job market and in society is long standing. For example, in 1996 and again in 2001 the Muslim unemployment rate was three times higher than the national total (Australian Bureau of Statistics). But since the 9/11 tragedy and Bali bombings visible Muslims, such as women wearing hijabs (headscarves), have sometimes been verbally and physically abused and called ‘terrorists’ by some members of the wider community (Dreher 13). The Howard government’s new anti-terrorism legislation and the surveillance hotline ‘Be alert not alarmed’ has further marginalised some Muslims. Some politicians have also linked Muslim asylum seekers with terrorists (Kabir 303), which inevitably has led Muslim “at-risk” refugee students to withdraw from school support such as counselling. Under these circumstances, Muslim “at-risk” students and their parents may prefer to maintain a low profile rather than engage with agencies. In this case, arguably, federal government politics have exacerbated the barriers to collaboration. It appears that unfamiliarity with Muslim culture is not confined to mainstream Australians. For example, an Aboriginal liaison police officer engaged in the Smart Communities project in Western Australia had this to say about Muslim youths “at-risk”: Different laws and stuff from different countries and they’re coming in and sort of thinking that they can bring their own laws and religions and stuff … and when I say religions there’s laws within their religions as well that they don’t seem to understand that with Australia and our laws. Such generalised misperceptions of Muslim youths “at-risk” would further alienate them, thus causing a major hindrance to collaboration. The “at-risk” factors associated with Aboriginal youths have historical connections. Research findings have revealed that indigenous youths aged between 10-16 years constitute a vast majority in all Australian States’ juvenile detention centres. This over-representation is widely recognised as associated with the nature of European colonisation, and is inter-related with poverty, marginalisation and racial discrimination (Watson et al. 404). Like the Muslims, their unemployment rate was three times higher than the national total in 2001 (ABS). However, in 1998 it was estimated that suicide rates among Indigenous peoples were at least 40 per cent higher than national average (National Advisory Council for Youth Suicide Prevention, quoted in Elliot-Farrelly 2). Although the wider community’s unemployment rate is much lower than the Aboriginals and the Muslims, the “at-risk” factors of mainstream Australian youths are often associated with dysfunctional families, high conflict, low-cohesive families, high levels of harsh parental discipline, high levels of victimisation by peers, and high behavioural inhibition (Watson et al. 404). The Macquarie Fields riots in 2005 revealed the existence of “White” underclass and “at-risk” people in Sydney. Macquarie Fields’ unemployment rate was more than twice the national average. Children growing up in this suburb are at greater risk of being involved in crime (The Age). Thus small pockets of mainstream underclass youngsters also require collaborative attention. In Western Australia people working on the Smart Communities project identified that lack of resources can be a hindrance to collaboration for all sectors. As one social worker commented: “government agencies are hierarchical systems and lack resources”. They went on to say that in their department they can not give “at-risk” youngsters financial assistance in times of crisis: We had a petty cash box which has got about 40 bucks in it and sometimes in an emergency we might give a customer a couple of dollars but that’s all we can do, we can’t give them any larger amount. We have bus/metro rail passes, that’s the only thing that we’ve actually got. A youth worker in Smart Communities commented that a lot of uncertainty is involved with young people “at-risk”. They said that there are only a few paid workers in their field who are supported and assisted by “a pool of volunteers”. Because the latter give their time voluntarily they are under no obligation to be constant in their attendance, so the number of available helpers can easily fluctuate. Another youth worker identified a particularly important barrier to collaboration: because of workers’ relatively low remuneration and high levels of work stress, the turnover rates are high. The consequence of this is as follows: The other barrier from my point is that you’re talking to somebody about a student “at-risk”, and within 14 months or 18 months a new person comes in [to that position] then you’ve got to start again. This way you miss a lot of information [which could be beneficial for the youth]. Conclusion The Privacy Act creates a dilemma in that it can be either beneficial or counter-productive for a student’s security. To be blunt, a youth who has suicided might have had their privacy protected, but not their life. Lack of funding can also be a constraint on collaboration by undermining stability and autonomy in the workforce, and blocking inter-agency initiatives. Lack of awareness about cultural differences can also affect unity of action. The deepening inequality between the “haves” and “have-nots” in the Australian society, and the Howard government’s harshness on national security issues, can also pose barriers to collaboration on youth issues. Despite these exigencies and dilemmas, it would seem that collaboration is “the only game” when it comes to helping students “at-risk”. To enhance this collaboration, there needs to be a sensible modification of legal restrictions to information sharing, an increase in government funding and support for inter-agency cooperation and informal information sharing, and an increased awareness about the cultural needs of minority groups and knowledge of the mainstream underclass. Acknowledgments The research is part of a major Australian Research Council (ARC) funded project, Smart Communities. The authors very gratefully acknowledge the contribution of the interviewees, and thank *Donald E. Scott for conducting the interviews. References Australian Bureau of Statistics. 1996 and 2001. Balnaves, Mark, and Joe Luca. “The Impact of Digital Persona on the Future of Learning: A Case Study on Digital Repositories and the Sharing of Information about Children At-Risk in Western Australia”, paper presented at Ascilite, Brisbane (2005): 49-56. 10 April 2006. http://www.ascilite.org.au/conferences/brisbane05/blogs/proceedings/ 06_Balnaves.pdf>. Dreher, Tanya. ‘Targeted’: Experiences of Racism in NSW after September 11, 2001. Sydney: University of Technology, 2005. Elliot-Farrelly, Terri. “Australian Aboriginal Suicide: The Need for an Aboriginal Suicidology”? Australian e-Journal for the Advancement of Mental Health, 3.3 (2004): 1-8. 15 April 2006 http://www.auseinet.com/journal/vol3iss3/elliottfarrelly.pdf>. Farmer, James. A. High-Risk Teenagers: Real Cases and Interception Strategies with Resistant Adolescents. Springfield, Ill.: C.C. Thomas, 1990. Ferguson, Harry. Protecting Children in Time: Child Abuse, Child Protection and the Consequences of Modernity. London: Palgrave Macmillan, 2004. Foucault, Michel. Power/Knowledge: Selected Interviews and Other Writings, 1972-1977. Ed. Colin Gordon, trans. Colin Gordon et al. New York: Pantheon, 1980. Kabir, Nahid. Muslims in Australia: Immigration, Race Relations and Cultural History. London: Kegan Paul, 2005. Rouf, Khadji. “Myself in Echoes. My Voice in Song.” Ed. A. Bannister, et al. Listening to Children. London: Longman, 1990. Scott E. Donald. “Exploring Communication Patterns within and across a School and Associated Agencies to Increase the Effectiveness of Service to At-Risk Individuals.” MS Thesis, Curtin University of Technology, August 2005. The Age. “Investing in People Means Investing in the Future.” The Age 5 March, 2005. 15 April 2006 http://www.theage.com.au>. Watson, Malcolm, et al. “Pathways to Aggression in Children and Adolescents.” Harvard Educational Review, 74.4 (Winter 2004): 404-428. Citation reference for this article MLA Style Kabir, Nahid, and Mark Balnaves. "Students “at Risk”: Dilemmas of Collaboration." M/C Journal 9.2 (2006). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0605/04-kabirbalnaves.php>. APA Style Kabir, N., and M. Balnaves. (May 2006) "Students “at Risk”: Dilemmas of Collaboration," M/C Journal, 9(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0605/04-kabirbalnaves.php>.

Introduction Based on the profusion of scholarly and populist analysis of the relationship between books and films one could easily be forgiven for thinking that the exchange between the two media was a decidedly one-way affair. Countless words have been expended upon the subject of literary adaptation, in which the process of transforming stories and novels into cinematic or televisual form has been examined in ways both general and particular. A relationship far less well-documented though is that between popular novels and the films that have spawned them. With the notable exception of Randall D. Larson’s valuable Films into Books, which is centred mainly on correspondence with prolific writers of “novelisations”, academic study of this extremely widespread phenomenon has been almost non-existent. Even Linda Hutcheon’s admirable recent publication, A Theory of Adaptation, makes scant mention of novelisations, in spite of her claim that this flourishing industry “cannot be ignored” (38). Retelling film narratives in a written form is nothing new. Indeed, as Larson notes, “novelisations have existed almost as long as movies have” and can be found as far back as the 1920s, although it was not until the advent of mass-market paperbacks that they truly came into their own (3-4). The sixties and seventies were boom years for novelisations as they provided film lovers with a way to re-experience their favourite movies long after they had disappeared from cinema screens. It shouldn’t be forgotten that before the advent of home video and DVD books were, along with television broadcasts, the most widely accessible way in which people could do so. Even today they continue to appear in book shops. At the same time, the Internet age has fuelled the creation and dissemination of a vast array of “fan-fiction” that supplements the output of authorised writers. Despite the vast consumer appetite for novelisations, however, their critical reception has been noticeably cool. Jonathan Coe’s caustic appraisal of novelisations as “that bastard, misshapen offspring of the cinema and the written word” represents the prevailing attitude toward them (45). The fact that many are genre novels—sci-fi, western and crime thrillers—and that the majority are decidedly low-brow has not helped to secure them critical plaudits. Other reasons though lie beyond these prejudices. For one thing, many are simply not very well written according to any conventional measure. When one considers the time constraints under which a lot of these books were produced this is hardly surprising. Based on his extensive correspondence with authors, Larson suggests four to six weeks as around the average writing time, with some adaptations, such as Michael Avallone’s Beneath the Planet of the Apes, spewed out in a single weekend (12). The quality of the writing in many novelisations is certainly hard to defend, and yet one other widely held view of them holds considerably less water. This is the idea of novelisations as pale shadows of the movies deemed to be their source, in which only the most manifest content of characterisation and plot are reproduced. In this denuded form, it is implied, a great deal of value has been lost while only rarely has anything of significant value been added. This point of view is in strong contrast with the now customary acceptance that in the reverse process of adaptation—from book to film—while some elements may be necessarily or wilfully sacrificed, significant gains in emotional impact, characterisation or other dramatic features may often be made as a result of the different techniques available through the film medium. If we think of films as the source of novelisations we slip into a great fallacy however. In the vast majority of cases the books are not based on films at all but on their screenplays. Unlike literary adaptations, film and book do not draw one from the other but instead each produces in a different medium an adaptation of a shared source. It has generally been considered desirable to have a novelisation available for public purchase by the time the movie reaches theatres and, since time must be allowed for printing and distribution, this has generally meant that the book must be completed before the filming wraps (Larson, 12-3). No wonder, then, that novelisations rarely attempt to describe a film’s mise-en-scène. While the industrial process by which the books are produced can help to explain some features of their relationship to the films whose stories they share, the fact that they are seldom adaptations of these actual films is a point that their marketing has tended to suppress. It is normal for book covers to feature one or more images from the film. Names of stars often appear prominently, and a more detailed list of the film’s key cast and credits can generally be found in smaller print on the back of the book. Novelisations are not sold or consumed as alternative adaptations of a screenplay but through the implication of a much closer relationship to the film than many in fact possess. This discordance allows us to consider novelisations as a re-imagining of the film on two temporal levels. On the one hand, the novelisation can be thought of as preceding the film. It is not unusual for such a book to adapt an older version of the script than the one that was actually shot, thus rendering a single definitive script source elusive if not downright illusory. It is fairly common to find whole scenes missing from the book or conversely to read extensive narrative episodes that never made their way into the finished picture. Dialogue is often a mere paraphrase, no matter how diligently the author has replicated the lines of the script. Such largely unintentional differences can provide fascinating insights into the film’s production history, revealing other paths that the film might well have taken. On the other hand, despite its being published simultaneously with (or even before) the film’s release, a novelisation will often be consumed after viewing the film, in order to help its readers re-experience the movie or to develop and augment that experience. Novelisations can thus be seen to give rise to three main areas of interest. As historical documents they can be of use when considering a film’s developmental process. They also provide alternative readings of the film script and may, by extension, help to enrich a viewer’s retrospective relationship with the film itself. Thirdly, they offer an avenue for exploring the differing narrational forms and capabilities of the two media. “Talk of adaptation,” Yvonne Tasker has argued, “often seems to take place in an abstract hierarchical mode—a hierarchy in which literature seems to emerge as almost by default ‘better’, more complex than film” (18). As we shall see, such a position is not always easy to support. In considering these aspects of the novelisation we now turn to two closely related examples. The film Capricorn One, released in the United States in 1978, was directed by Peter Hyams from his own screenplay. For our purposes it is most notable as one of several works that spawned two separate English language novelisations, each by different authors. One by Bernard L. Ross (a youthful pseudonym of the now popular novelist Ken Follett) was published in England, while Ron Goulart’s version was published in the United States. The story of Capricorn One centres on a colossal fraud perpetrated by NASA in an attempt to conceal a catastrophic problem with its manned mission to Mars. Realising that a fault in the shuttle’s life support system means that the astronauts will not survive the journey, but that admission of failure will provide the government with the long-sought excuse to cut the program’s funding, a conspiracy is hatched to fake a successful mission by enacting the landing in a clandestine television studio. When the shuttle breaks up on re-entry, the three astronauts realise that their existence jeopardises this elaborate fraud and that they must go on the run for a chance at survival. Meanwhile, a journalist finds his own life in peril as he doggedly pursues a hunch that all is not as it should be with the Capricorn One mission. Novelisations as Evidence of the Film’s Production History Each book shows, in a range of ways, its fidelity to a shared source: the screenplay (or, at least, to the elements that remained unchanged through various screenplay drafts). That the screenplay comprised not only extensive dialogue but also some descriptive material becomes clear at a very early stage. Goulart opens with the following image: “The sun, an intense orange ball, began to rise over the Atlantic” (5). Several pages into his own book, Ross introduces the same narrative event with these words: “The morning sun rose like a big orange lollipop over the Atlantic Ocean” (10). The comparability of these visually evocative images with the equivalent moment in the finished film might suggest a fairly straightforward transposition of the screenplay into the three marketed texts. However, other sections belie any such assumption. The books’ origin in the screenplay and not in the film itself, and the considerable evolution that has occurred between screenplay and finished film, are expressed in two main ways. The first is the presence of corresponding scenes in both books that do not occur in the film. Where a non-filmed scene occurs in one book only we can assume a high probability that it is an invention of the book’s author which is intended to develop the narrative or characterisation. When found in both books, though, we can only infer that a scene outlined in the screenplay was dropped during either the film’s production or editing phase. For instance, in all three versions of the narrative, an attempt is made on the life of reporter Robert Caulfield (Elliott Gould) by tampering with his car. A high-speed action sequence culminates when car and driver plummet into a deep river. Whereas the film moves swiftly to the next scene without ever explaining how Caulfield managed to extricate himself from this perilous situation, each book extends the sequence with a description of how he disentangles his trouser leg from the door handle in order to pull himself through the open window and out of the sinking vehicle (Goulart, 96-7; Ross, 86). Indeed, the retention of this scene in the novelisations fills what is in the film an unsatisfying narrative ellipsis. The second proof of an evolution between screenplay and film is perhaps even more interesting in understanding the production process. This is that narrative events do not all occur in the same order in each book. The differences between the two books, as well as between books and film, suggest that Goulart’s was based on a later version of the screenplay as it corresponds more closely with the film’s chronology of events. The narrational structure of each text consists of a number of alternating segments designed to maintain tension while following simultaneously occurring incidents in the adventures of each of the protagonists. This is especially the case in the last half of the story where the three astronauts—Col. Charles Brubaker (James Brolin), Lt. Col. Peter Willis (Sam Waterston) and Cmdr. John Walker (O. J. Simpson)—have escaped into the desert and split up to maximise the chance that one will survive to expose the swindle. Narrational segments follow their individual progress as well as that of Caulfield’s investigation and of NASA director James Kelloway (Hal Holbrook)’s attempts to manage the crisis of the astronauts’ escape. It is evident that during the film’s post-production some reshuffling of these sequences was undertaken in order to maximise suspense. Further evidence that Ross’s book was based on an earlier screenplay than Goulart’s source emerges through its ending which, unlike Goulart’s, differs from the finished film. In every version of the story, Caulfield is able to rescue Brubaker and deliver him to his wife Kay (Brenda Vaccaro) in front of the watching media. Instead of doing so at a memorial service for the “dead” astronauts, however, Ross has this event take place at Bru’s home, after the service occurs without incident some pages earlier. This episode, more that any other in either book, is conspicuous in its variance from the film. Other discrepancies are based on addition, non-inclusion or reordering: different tellings of the same tale. Here, however, consumers of these texts are faced with two mutually exclusive finales that enforce a choice between the “right” and “wrong” version of the story. Enriching Character and Plot through Alternative Readings of the Script Although the examples above highlight some significant variations in the three versions of Capricorn One, none show evidence of intentional narrative difference. In some other respects, though, the authors of the novelisations did employ constituents of their own invention in order to transform the source material into the format expected by the readers of any novel. One key technique is shared by both authors. This is the fleshing-out of characters, a technique used more extensively by Ross than Goulart, and one which is largely responsible for his book’s greater length (an estimated 68,000 words, compared with Goulart’s 37,000). Goulart, for his part, largely confines this technique to the latter section of the story where the astronauts make their individual journeys across the desert. While his book is comprised, for the most part, of reported speech, the protagonists’ solitude in this part of the story leads him to recourse to descriptions of their thoughts in order to stretch out and enliven what would otherwise be an exceptionally brief and potentially dull account. Ross embraces the task of elaborating characterisation with considerably greater fervour. As well as representing their thoughts, he regularly adds passages of back story. During a breakfast scene before the launch (present in both books but absent from the finished film) he describes how each astronaut came to be involved in the mission and their feelings about it. Similarly he describes childhood or youthful incidents in their lives and in those of Kelloway and Caulfield in order to explain and add believability to some of their later actions. Even the biography and thoughts of relatively minor characters, such as the whistleblowing NASA employee Elliot Whitter (Robert Walden), are routinely developed. However, Ross does not stop here in elaborating the blueprint offered by the screenplay. New characters are added in order to develop a subplot glossed over in the film. These additions relate to an elderly European man, Mr. Julius, who is affiliated with a couple of Kelloway’s corporate accomplices and whose shady employees are responsible for both the attempts to assassinate Caulfield and for piloting the helicopters used to seek and destroy the escaped astronauts. In such ways, Ross succeeds in producing a rendition of the story that (barring its anomalous ending) enhances that of the film without conspicuously competing against what all the marketing points to as the “definitive” version. The Differing Narrational Capabilities of Films and Books While this section is indebted to the methods and findings of existing studies of novel-to-film adaptations, through close attention to the reverse process (or, more accurately, to screenplay-to-novel adaptations) we can observe another less recognised dynamic at work. This is the novelisers’ efforts to assimilate what are more traditionally cinematic devices into their writing. By way of illustration, our case study shows how it has led both Ross and Goulart to employ a writing style that sometimes contrasts with the norms of original mainstream novels. My comments thus far have dwelt mainly on differences in the placement and inclusion of narrative events, although the description of how the novelisers have expanded characters’ back stories suggests one way in which the written word can lend itself more readily to the concise interspersion of such material than can the film medium. This is not to say that film is incapable of rendering such incidents; merely that the representation of back story requires either lengthy spoken exposition or the insertion of flashbacks (some of which would require younger actors doubling for the stars). Either technique is prone to be more disruptive of the narrative flow, and therefore justifiable only in rarer instances where such information proves crucial, rather than merely useful, to the main narrative thrust. There are other ways, though, in which comparison of these three texts highlights the relative strengths of the different media in stimulating the response of their viewers or readers. One of these is the handling of audiovisual spectacle. It perhaps goes without saying that the film elicits a far more visceral response during its action scenes. This is especially true of a climactic sequence in which Caulfield and cropduster pilot Albain (Telly Savalas) do aerial battle with two helicopters as each strives to be the first to reach the fugitive Brubaker. Ross is far more successful than Goulart in conveying the excitement of this scene, although even his version pales in comparison with the movie. A device on which the film regularly draws, both in order to heighten tension and so as to suggest dramatic or ironic parallels between different narrative strands, is that of cross-cutting. This technique is adapted by each of the novelisers, who use it in a diluted form. Each of the books subdivides its chapters into many segments, which are often much shorter than those found in conventional novels. Ross uses ninety such segments and Goulart sixty-seven. The shortest of these, by Ross, is a solitary sentence sitting amidst a sea of white space, in which he signals the cancellation of the plan to reunite the astronauts with their shuttle at the projected splashdown site: “High over the Pacific Ocean, the Falcon jet went into a tight banking turn and began to head back the way it had come” (116). Neither author, however, has the audacity to cut between locations with the speed that the film does. One of the movie’s most effective sequences is that in which rapid edits alternate between Kelloway solemnly announcing the fictive death of the astronauts to the press and the astronauts sitting in their hideaway imagining this very eulogy. Neither one of the novelisations succeeds in creating a sequence quite so biting in its satire. In this case study we are able to observe some of the ways in which films and novelisations can relate to one another, each providing a reading of the film script (or scripts) that, through a mutual interlocking in the mind of the reader versed in these multiple versions of the tale, can contribute to an experience of the narrative that is richer than one text alone can produce. Robert Block, who has written both novelisations and original novels, alleges that “the usual rule seems to be that while films can widely and wildly deviate from previously-published-and-purchased novels, a novelisation cannot supersede a screenplay in terms of content” (Larson, 44). Whereas this assertion describes with reasonable accuracy the approach that Ron Goulart has taken to his version of Capricorn One, the more ambitious and detailed story told by Bernard Ross provides one clear exception to this rule. It thus offers firm evidence that novelisations are not, by their very nature, merely impoverished derivations of the cinema. Instead they constitute a medium capable of original and intrinsic value and which fully deserves more detailed critical appreciation than its current reputation suggests. References Coe, Jonathan. 9th and 13th. London: Penguin Books, 2005. Goulart, Ron. Capricorn One. New York: Fawcett Gold Medal, 1978. Hutcheon, Linda. A Theory of Adaptation. New York: Routledge, 2006. Larson, Randall D. Films into Books: An Analytical Bibliography of Film Novelizations, Movie, and TV Tie-Ins. London: Scarecrow Press, 1995. Ross, Bernard L. Capricorn One. London: Futura, 1978. Tasker, Yvonne, The Silence of the Lambs. London: BFI, 2002. Citation reference for this article MLA Style Allison, Deborah. "Film/Print: Novelisations and Capricorn One." M/C Journal 10.2 (2007). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0705/07-allison.php>. APA Style Allison, D. (May 2007) "Film/Print: Novelisations and Capricorn One," M/C Journal, 10(2). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0705/07-allison.php>.