Academic literature on the topic 'Local-position coding'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Local-position coding.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Local-position coding"
1
Gao, Guangwei, Jian Yang, Zhihui Lai, Pu Huang, Jielin Jiang, Hao Gao, and Dong Yue. "Nuclear norm regularized coding with local position-patch and nonlocal similarity for face hallucination." Digital Signal Processing 64 (May 2017): 107–20. http://dx.doi.org/10.1016/j.dsp.2017.02.009.
Full text
2
Howard, Michael J., Nisha A. Cavanaugh, Vinod K. Batra, David D. Shock, William A. Beard, and Samuel H. Wilson. "DNA polymerase β nucleotide-stabilized template misalignment fidelity depends on local sequence context." Journal of Biological Chemistry 295, no. 2 (December 4, 2019): 529–38. http://dx.doi.org/10.1074/jbc.ra119.010594.
Full textAbstract:
DNA polymerase β has two DNA-binding domains that interact with the opposite sides of short DNA gaps. These domains contribute two activities that modify the 5′ and 3′ margins of gapped DNA during base excision repair. DNA gaps greater than 1 nucleotide (nt) pose an architectural and logistical problem for the two domains to interact with their respective DNA termini. Here, crystallographic and kinetic analyses of 2-nt gap-filling DNA synthesis revealed that the fidelity of DNA synthesis depends on local sequence context. This was due to template dynamics that altered which of the two template nucleotides in the gap served as the coding nucleotide. We observed that, when a purine nucleotide was in the first coding position, DNA synthesis fidelity was similar to that observed with a 1-nt gap. However, when the initial templating nucleotide was a pyrimidine, fidelity was decreased. If the first templating nucleotide was a cytidine, there was a significantly higher probability that the downstream template nucleotide coded for the incoming nucleotide. This dNTP-stabilized misalignment reduced base substitution and frameshift deletion fidelities. A crystal structure of a binary DNA product complex revealed that the cytidine in the first templating site was in an extrahelical position, permitting the downstream template nucleotide to occupy the coding position. These results indicate that DNA polymerase β can induce a strain in the DNA that modulates the position of the coding nucleotide and thereby impacts the identity of the incoming nucleotide. Our findings demonstrate that “correct” DNA synthesis can result in errors when template dynamics induce coding ambiguity.
3
Wang, Bin, Yu Liu, Wei Wang, Wei Xu, and Maojun Zhang. "Multi-Scale Locality-Constrained Spatiotemporal Coding for Local Feature Based Human Action Recognition." Scientific World Journal 2013 (2013): 1–11. http://dx.doi.org/10.1155/2013/405645.
Full textAbstract:
We propose a Multiscale Locality-Constrained Spatiotemporal Coding (MLSC) method to improve the traditional bag of features (BoF) algorithm which ignores the spatiotemporal relationship of local features for human action recognition in video. To model this spatiotemporal relationship, MLSC involves the spatiotemporal position of local feature into feature coding processing. It projects local features into a sub space-time-volume (sub-STV) and encodes them with a locality-constrained linear coding. A group of sub-STV features obtained from one video with MLSC and max-pooling are used to classify this video. In classification stage, the Locality-Constrained Group Sparse Representation (LGSR) is adopted to utilize the intrinsic group information of these sub-STV features. The experimental results on KTH, Weizmann, and UCF sports datasets show that our method achieves better performance than the competing local spatiotemporal feature-based human action recognition methods.
4
Nguyen Thi, Hong, Yoshikazu Tanaka, Tuyen Vo Thi Minh, and Ham Le Huy. "Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line." Nuclear Science and Technology 8, no. 3 (September 1, 2021): 36–52. http://dx.doi.org/10.53747/jnst.v8i3.72.
Full textAbstract:
Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.
5
Dai, Yongpeng, Tian Jin, Yongkun Song, Shilong Sun, and Chen Wu. "Convolutional Neural Network with Spatial-Variant Convolution Kernel." Remote Sensing 12, no. 17 (August 30, 2020): 2811. http://dx.doi.org/10.3390/rs12172811.
Full textAbstract:
Radar images suffer from the impact of sidelobes. Several sidelobe-suppressing methods including the convolutional neural network (CNN)-based one has been proposed. However, the point spread function (PSF) in the radar images is sometimes spatially variant and affects the performance of the CNN. We propose the spatial-variant convolutional neural network (SV-CNN) aimed at this problem. It will also perform well in other conditions when there are spatially variant features. The convolutional kernels of the CNN can detect motifs with some distinctive features and are invariant to the local position of the motifs. This makes the convolutional neural networks widely used in image processing fields such as image recognition, handwriting recognition, image super-resolution, and semantic segmentation. They also perform well in radar image enhancement. However, the local position invariant character might not be good for radar image enhancement, when features of motifs (also known as the point spread function in the radar imaging field) vary with the positions. In this paper, we proposed an SV-CNN with spatial-variant convolution kernels (SV-CK). Its function is illustrated through a special application of enhancing the radar images. After being trained using radar images with position-codings as the samples, the SV-CNN can enhance the radar images. Because the SV-CNN reads information of the local position contained in the position-coding, it performs better than the conventional CNN. The advance of the proposed SV-CNN is tested using both simulated and real radar images.
6
Li, Shuyi, Haigang Zhang, Yihua Shi, and Jinfeng Yang. "Novel Local Coding Algorithm for Finger Multimodal Feature Description and Recognition." Sensors 19, no. 9 (May 13, 2019): 2213. http://dx.doi.org/10.3390/s19092213.
Full textAbstract:
Recently, finger-based biometrics, including fingerprint (FP), finger-vein (FV) and finger-knuckle-print (FKP) with high convenience and user friendliness, have attracted much attention for personal identification. The features expression which is insensitive to illumination and pose variation are beneficial for finger trimodal recognition performance improvement. Therefore, exploring suitable method of reliable feature description is of great significance for developing finger-based biometric recognition system. In this paper, we first propose a correction approach for dealing with the pose inconsistency among the finger trimodal images, and then introduce a novel local coding-based feature expression method to further implement feature fusion of FP, FV, and FKP traits. First, for the coding scheme a bank of oriented Gabor filters is used for direction feature enhancement in finger images. Then, a generalized symmetric local graph structure (GSLGS) is developed to fully express the position and orientation relationships among neighborhood pixels. Experimental results on our own-built finger trimodal database show that the proposed coding-based approach achieves excellent performance in improving the matching accuracy and recognition efficiency.
7
Ostwald, Dirk, Judith M. Lam, Sheng Li, and Zoe Kourtzi. "Neural Coding of Global Form in the Human Visual Cortex." Journal of Neurophysiology 99, no. 5 (May 2008): 2456–69. http://dx.doi.org/10.1152/jn.01307.2007.
Full textAbstract:
Extensive psychophysical and computational work proposes that the perception of coherent and meaningful structures in natural images relies on neural processes that convert information about local edges in primary visual cortex to complex object features represented in the temporal cortex. However, the neural basis of these mid-level vision mechanisms in the human brain remains largely unknown. Here, we examine functional MRI (fMRI) selectivity for global forms in the human visual pathways using sensitive multivariate analysis methods that take advantage of information across brain activation patterns. We use Glass patterns, parametrically varying the perceived global form (concentric, radial, translational) while ensuring that the local statistics remain similar. Our findings show a continuum of integration processes that convert selectivity for local signals (orientation, position) in early visual areas to selectivity for global form structure in higher occipitotemporal areas. Interestingly, higher occipitotemporal areas discern differences in global form structure rather than low-level stimulus properties with higher accuracy than early visual areas while relying on information from smaller but more selective neural populations (smaller voxel pattern size), consistent with global pooling mechanisms of local orientation signals. These findings suggest that the human visual system uses a code of increasing efficiency across stages of analysis that is critical for the successful detection and recognition of objects in complex environments.
8
Shi, Jianli, Jin Zhang, Kun Wang, and Xin Fang. "Particle Swarm Optimization for Split Delivery Vehicle Routing Problem." Asia-Pacific Journal of Operational Research 35, no. 02 (April 2018): 1840006. http://dx.doi.org/10.1142/s0217595918400067.
Full textAbstract:
The split delivery vehicle routing problem (SDVRP) is a variation of the capacitated vehicle routing problem in which some customers may be served by more than one vehicle. We have proposed a particle swarm optimization approach that incorporates a local search to solve the SDVRP. An integer coding method was presented, and a decoding method based on Bellman’s equation was modified for the SDVRP. A way to address the differences in the length of the velocity vector, the position vector, the personal best position vector, the local best position vector and the global best position vector was designed. Two groups of local searches for top solutions were incorporated into the algorithm, with the ability to control whether they are executed on a given solution. The algorithm was initially tested using the modified Solomon’s instances to verify the parameters used, including the local search probability, the size of the swarm, the velocity equation and the length of the vectors. Extensive computational experiments were carried out on 131 benchmark instances available in the literature. The results obtained were competitive. More precisely, equally good solutions were found in 32 instances, and improved solutions were found in 35 instances, with an average improvement of 0.02% and a maximum improvement of 1.12%.
9
Buonomano, Dean V., and Michael Merzenich. "A Neural Network Model of Temporal Code Generation and Position-Invariant Pattern Recognition." Neural Computation 11, no. 1 (January 1, 1999): 103–16. http://dx.doi.org/10.1162/089976699300016836.
Full textAbstract:
Numerous studies have suggested that the brain may encode information in the temporal firing pattern of neurons. However, little is known regarding how information may come to be temporally encoded and about the potential computational advantages of temporal coding. Here, it is shown that local inhibition may underlie the temporal encoding of spatial images. As a result of inhibition, the response of a given cell can be significantly modulated by stimulus features outside its own receptive field. Feedforward and lateral inhibition can modulate both the firing rate and temporal features, such as latency. In this article, it is shown that a simple neural network model can use local inhibition to generate temporal codes of handwritten numbers. The temporal encoding of a spatial patterns has the interesting and computationally beneficial feature of exhibiting position invariance. This work demonstrates a manner by which the nervous system may generate temporal codes and shows that temporal encoding can be used to create position-invariant codes.
10
File-Muriel, Richard J., and Earl K. Brown. "The gradient nature ofs-lenition in Caleño Spanish." Language Variation and Change 23, no. 2 (June 10, 2011): 223–43. http://dx.doi.org/10.1017/s0954394511000056.
Full textAbstract:
AbstractWhereas previous studies of Spanishs-weakening have relied on impressionistic coding, the present study examines temporal and gradient acoustic details in the production of /s/ by eight females from Cali, Colombia, during sociolinguistic interviews. We propose a metric for quantifyings-realization by employing three scalar-dependent variables:s-duration, centroid, and voicelessness. The results of linear regressions indicate that the dependent variables are significantly conditioned by local speaking rate, word position, following and preceding phonological context, stress, and lexical frequency. This study sheds light on how each independent variable influencess-realization acoustically. For example, as local speaking rate increases, duration, centroid, and voicelessness decrease, which is indicative of lenition, and the same weakening tendency is observed when /s/ occurs in word-final position or is followed by a nonhigh vowel, whereas frequency contributes only tos-duration. We discuss the advantages of opting for instrumental measurements over symbolic representation.
Dissertations / Theses on the topic "Local-position coding"
1
Barannik, Vlad, Y. Babenko, S. Shulgin, and M. Parkhomenko. "Video encoding to increase video availability in telecommunication systems." Thesis, Taras Shevchenko National University of Kyiv, 2020. https://openarchive.nure.ua/handle/document/16582.
Full textAbstract:
Article shows presence of the imbalance caused by insufficient level of productivity of modern and perspective information communication technologies concerning information intensity of bit streams. It is described how imbalance level reducing can be formed as a result of increasing of information processing technologies efficiency and that JPEG platform is the basic concept for construction of technologies of compression representation. Therefore it is proposed to provide further development of video processing methods using individual components of the JPEG platform for improving the integrity of information in terms of ensuring the required level of its availability.:
Conference papers on the topic "Local-position coding"
1
EricksonKirk, Marjorie A., and Matthew Wagenhofer. "A Theoretically-Based Statistical Model of Transition Toughness." In ASME 2007 Pressure Vessels and Piping Conference. ASMEDC, 2007. http://dx.doi.org/10.1115/pvp2007-26303.
Full textAbstract:
A program was undertaken to develop a fully predictive model of the scatter in toughness across a wide range of transition temperatures based on a physical understanding of deformation and fracture behavior. The temperature dependence of the proposed model is taken from previous work in which the local mechanisms of cleavage fracture were used to define the plastic work to fracture. The local to global stress transference is achieved by a dislocation-mechanics based examination of the interaction between the globally applied stresses, a macroscopic crack and a nearby accumulation of dislocations blocked by a second phase particle, i.e. slip band, whose position relative to the macroscopic crack tip is variable. The scatter of toughness values at each temperature is captured through variation of this macro-crack / micro-crack geometry, and of the particle size. Once the local stress field is determined using the dislocation-based transference equations, an energy balance criterion for fracture is applied that incorporates the temperature-dependent fracture work term and the local stresses determined from the transference equations. This paper summarizes this multiscale fracture model, which serves as a foundation for more detailed descriptions of the mathematics of the quantitative model, its temperature dependence and scatter characteristics and coding efforts. These latter topics will be addressed in greater detail in subsequent papers.