Relevant bibliographies by topics / LHCSR / Journal articles
To see the other types of publications on this topic, follow the link: LHCSR.

Journal articles on the topic 'LHCSR'

Author: Grafiati
Published: 11 March 2023

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'LHCSR.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Correa-Galvis, Viviana, Petra Redekop, Katharine Guan, Annika Griess, Thuy B. Truong, Setsuko Wakao, Krishna K. Niyogi, and Peter Jahns. "Photosystem II Subunit PsbS Is Involved in the Induction of LHCSR Protein-dependent Energy Dissipation in Chlamydomonas reinhardtii." Journal of Biological Chemistry 291, no. 33 (June 29, 2016): 17478–87. http://dx.doi.org/10.1074/jbc.m116.737312.

Full text
Abstract:
Non-photochemical quenching of excess excitation energy is an important photoprotective mechanism in photosynthetic organisms. In Arabidopsis thaliana, a high quenching capacity is constitutively present and depends on the PsbS protein. In the green alga Chlamydomonas reinhardtii, non-photochemical quenching becomes activated upon high light acclimation and requires the accumulation of light harvesting complex stress-related (LHCSR) proteins. Expression of the PsbS protein in C. reinhardtii has not been reported yet. Here, we show that PsbS is a light-induced protein in C. reinhardtii, whose accumulation under high light is further controlled by CO2 availability. PsbS accumulated after several hours of high light illumination at low CO2. At high CO2, however, PsbS was only transiently expressed under high light and was degraded after 1 h of high light exposure. PsbS accumulation correlated with an enhanced non-photochemical quenching capacity in high light-acclimated cells grown at low CO2. However, PsbS could not compensate for the function of LHCSR in an LHCSR-deficient mutant. Knockdown of PsbS accumulation led to reduction of both non-photochemical quenching capacity and LHCSR3 accumulation. Our data suggest that PsbS is essential for the activation of non-photochemical quenching in C. reinhardtii, possibly by promoting conformational changes required for activation of LHCSR3-dependent quenching in the antenna of photosystem II.
APA, Harvard, Vancouver, ISO, and other styles
2

Tian, Lijin, Wojciech J. Nawrocki, Xin Liu, Iryna Polukhina, Ivo H. M. van Stokkum, and Roberta Croce. "pH dependence, kinetics and light-harvesting regulation of nonphotochemical quenching inChlamydomonas." Proceedings of the National Academy of Sciences 116, no. 17 (April 8, 2019): 8320–25. http://dx.doi.org/10.1073/pnas.1817796116.

Full text
Abstract:
Sunlight drives photosynthesis but can also cause photodamage. To protect themselves, photosynthetic organisms dissipate the excess absorbed energy as heat, in a process known as nonphotochemical quenching (NPQ). In green algae, diatoms, and mosses, NPQ depends on the light-harvesting complex stress-related (LHCSR) proteins. Here we investigated NPQ inChlamydomonas reinhardtiiusing an approach that maintains the cells in a stable quenched state. We show that in the presence of LHCSR3, all of the photosystem (PS) II complexes are quenched and the LHCs are the site of quenching, which occurs at a rate of ∼150 ps−1and is not induced by LHCII aggregation. The effective light-harvesting capacity of PSII decreases upon NPQ, and the NPQ rate is independent of the redox state of the reaction center. Finally, we could measure the pH dependence of NPQ, showing that the luminal pH is always above 5.5 in vivo and highlighting the role of LHCSR3 as an ultrasensitive pH sensor.
APA, Harvard, Vancouver, ISO, and other styles
3

Gabilly, Stéphane T., Christopher R. Baker, Setsuko Wakao, Thien Crisanto, Katharine Guan, Ke Bi, Elodie Guiet, Carmela R. Guadagno, and Krishna K. Niyogi. "Regulation of photoprotection gene expression in Chlamydomonas by a putative E3 ubiquitin ligase complex and a homolog of CONSTANS." Proceedings of the National Academy of Sciences 116, no. 35 (August 12, 2019): 17556–62. http://dx.doi.org/10.1073/pnas.1821689116.

Full text
Abstract:
Photosynthetic organisms use nonphotochemical quenching (NPQ) mechanisms to dissipate excess absorbed light energy and protect themselves from photooxidation. In the model green alga Chlamydomonas reinhardtii, the capacity for rapidly reversible NPQ (qE) is induced by high light, blue light, and UV light via increased expression of LHCSR and PSBS genes that are necessary for qE. Here, we used a forward genetics approach to identify SPA1 and CUL4, components of a putative green algal E3 ubiquitin ligase complex, as critical factors in a signaling pathway that controls light-regulated expression of the LHCSR and PSBS genes in C. reinhardtii. The spa1 and cul4 mutants accumulate increased levels of LHCSR1 and PSBS proteins in high light, and unlike the wild type, they express LHCSR1 and exhibit qE capacity even when grown in low light. The spa1-1 mutation resulted in constitutively high expression of LHCSR and PSBS RNAs in both low light and high light. The qE and gene expression phenotypes of spa1-1 are blocked by mutation of CrCO, a B-box Zn-finger transcription factor that is a homolog of CONSTANS, which controls flowering time in plants. CONSTANS-like cis-regulatory sequences were identified proximal to the qE genes, consistent with CrCO acting as a direct activator of qE gene expression. We conclude that SPA1 and CUL4 are components of a conserved E3 ubiquitin ligase that acts upstream of CrCO, whose regulatory function is wired differently in C. reinhardtii to control qE capacity via cis-regulatory CrCO-binding sites at key photoprotection genes.
APA, Harvard, Vancouver, ISO, and other styles
4

Pinnola, Alberta. "The rise and fall of Light-Harvesting Complex Stress-Related proteins as photoprotection agents during evolution." Journal of Experimental Botany 70, no. 20 (August 2, 2019): 5527–35. http://dx.doi.org/10.1093/jxb/erz317.

Full text
Abstract:
This review on the evolution of quenching mechanisms for excess energy dissipation focuses on the role of Light-Harvesting Complex Stress-Related (LHCSR) proteins versus Photosystem II Subunit S (PSBS) protein, and the reasons for the redundancy of LHCSR in vascular plants as PSBS became established.
APA, Harvard, Vancouver, ISO, and other styles
5

Giovagnetti, Vasco, and Alexander V. Ruban. "The evolution of the photoprotective antenna proteins in oxygenic photosynthetic eukaryotes." Biochemical Society Transactions 46, no. 5 (August 28, 2018): 1263–77. http://dx.doi.org/10.1042/bst20170304.

Full text
Abstract:
Photosynthetic organisms require rapid and reversible down-regulation of light harvesting to avoid photodamage. Response to unpredictable light fluctuations is achieved by inducing energy-dependent quenching, qE, which is the major component of the process known as non-photochemical quenching (NPQ) of chlorophyll fluorescence. qE is controlled by the operation of the xanthophyll cycle and accumulation of specific types of proteins, upon thylakoid lumen acidification. The protein cofactors so far identified to modulate qE in photosynthetic eukaryotes are the photosystem II subunit S (PsbS) and light-harvesting complex stress-related (LHCSR/LHCX) proteins. A transition from LHCSR- to PsbS-dependent qE took place during the evolution of the Viridiplantae (also known as ‘green lineage’ organisms), such as green algae, mosses and vascular plants. Multiple studies showed that LHCSR and PsbS proteins have distinct functions in the mechanism of qE. LHCX(-like) proteins are closely related to LHCSR proteins and found in ‘red lineage’ organisms that contain secondary red plastids, such as diatoms. Although LHCX proteins appear to control qE in diatoms, their role in the mechanism remains poorly understood. Here, we present the current knowledge on the functions and evolution of these crucial proteins, which evolved in photosynthetic eukaryotes to optimise light harvesting.
APA, Harvard, Vancouver, ISO, and other styles
6

Girolomoni, Laura, Stefano Cazzaniga, Alberta Pinnola, Federico Perozeni, Matteo Ballottari, and Roberto Bassi. "LHCSR3 is a nonphotochemical quencher of both photosystems inChlamydomonas reinhardtii." Proceedings of the National Academy of Sciences 116, no. 10 (February 19, 2019): 4212–17. http://dx.doi.org/10.1073/pnas.1809812116.

Full text
Abstract:
Photosynthetic organisms prevent oxidative stress from light energy absorbed in excess through several photoprotective mechanisms. A major component is thermal dissipation of chlorophyll singlet excited states and is called nonphotochemical quenching (NPQ). NPQ is catalyzed in green algae by protein subunits called LHCSRs (Light Harvesting Complex Stress Related), homologous to the Light Harvesting Complexes (LHC), constituting the antenna system of both photosystem I (PSI) and PSII. We investigated the role of LHCSR1 and LHCSR3 in NPQ activation to verify whether these proteins are involved in thermal dissipation of PSI excitation energy, in addition to their well-known effect on PSII. To this aim, we measured the fluorescence emitted at 77 K by whole cells in a quenched or unquenched state, using green fluorescence protein as the internal standard. We show that NPQ activation by high light treatment inChlamydomonas reinhardtiileads to energy quenching in both PSI and PSII antenna systems. By analyzing quenching properties of mutants affected on the expression of LHCSR1 or LHCSR3 gene products and/or state 1–state 2 transitions or zeaxanthin accumulation, namely,npq4,stt7,stt7 npq4,npq4 lhcsr1,lhcsr3-complementednpq4 lhcsr1andnpq1, we showed that PSI undergoes NPQ through quenching of the associated LHCII antenna. This quenching event is fast-reversible on switching the light off, is mainly related to LHCSR3 activity, and is dependent on thylakoid luminal pH. Moreover, PSI quenching could also be observed in the absence of zeaxanthin or STT7 kinase activity.
APA, Harvard, Vancouver, ISO, and other styles
7

Levin, Guy, and Gadi Schuster. "LHC-like Proteins: The Guardians of Photosynthesis." International Journal of Molecular Sciences 24, no. 3 (January 28, 2023): 2503. http://dx.doi.org/10.3390/ijms24032503.

Full text
Abstract:
The emergence of chlorophyll-containing light-harvesting complexes (LHCs) was a crucial milestone in the evolution of photosynthetic eukaryotic organisms. Light-harvesting chlorophyll-binding proteins form complexes in proximity to the reaction centres of photosystems I and II and serve as an antenna, funnelling the harvested light energy towards the reaction centres, facilitating photochemical quenching, thereby optimizing photosynthesis. It is now generally accepted that the LHC proteins evolved from LHC-like proteins, a diverse family of proteins containing up to four transmembrane helices. Interestingly, LHC-like proteins do not participate in light harvesting to elevate photosynthesis activity under low light. Instead, they protect the photosystems by dissipating excess energy and taking part in non-photochemical quenching processes. Although there is evidence that LHC-like proteins are crucial factors of photoprotection, the roles of only a few of them, mainly the stress-related psbS and lhcSR, are well described. Here, we summarize the knowledge gained regarding the evolution and function of the various LHC-like proteins, with emphasis on those strongly related to photoprotection. We further suggest LHC-like proteins as candidates for improving photosynthesis in significant food crops and discuss future directions in their research.
APA, Harvard, Vancouver, ISO, and other styles
8

GEROTTO, CATERINA, ALESSANDRO ALBORESI, GIORGIO M. GIACOMETTI, ROBERTO BASSI, and TOMAS MOROSINOTTO. "Role of PSBS and LHCSR in Physcomitrella patens acclimation to high light and low temperature." Plant, Cell & Environment 34, no. 6 (April 13, 2011): 922–32. http://dx.doi.org/10.1111/j.1365-3040.2011.02294.x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Furukawa, Ryo, Michiki Aso, Tomomichi Fujita, Seiji Akimoto, Ryouichi Tanaka, Ayumi Tanaka, Makio Yokono, and Atsushi Takabayashi. "Formation of a PSI–PSII megacomplex containing LHCSR and PsbS in the moss Physcomitrella patens." Journal of Plant Research 132, no. 6 (September 20, 2019): 867–80. http://dx.doi.org/10.1007/s10265-019-01138-2.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Pi, Xiong, Lirong Tian, Huai-En Dai, Xiaochun Qin, Lingpeng Cheng, Tingyun Kuang, Sen-Fang Sui, and Jian-Ren Shen. "Unique organization of photosystem I–light-harvesting supercomplex revealed by cryo-EM from a red alga." Proceedings of the National Academy of Sciences 115, no. 17 (April 9, 2018): 4423–28. http://dx.doi.org/10.1073/pnas.1722482115.

Full text
Abstract:
Photosystem I (PSI) is one of the two photosystems present in oxygenic photosynthetic organisms and functions to harvest and convert light energy into chemical energy in photosynthesis. In eukaryotic algae and higher plants, PSI consists of a core surrounded by variable species and numbers of light-harvesting complex (LHC)I proteins, forming a PSI-LHCI supercomplex. Here, we report cryo-EM structures of PSI-LHCR from the red alga Cyanidioschyzon merolae in two forms, one with three Lhcr subunits attached to the side, similar to that of higher plants, and the other with two additional Lhcr subunits attached to the opposite side, indicating an ancient form of PSI-LHCI. Furthermore, the red algal PSI core showed features of both cyanobacterial and higher plant PSI, suggesting an intermediate type during evolution from prokaryotes to eukaryotes. The structure of PsaO, existing in eukaryotic organisms, was identified in the PSI core and binds three chlorophylls a and may be important in harvesting energy and in mediating energy transfer from LHCII to the PSI core under state-2 conditions. Individual attaching sites of LHCRs with the core subunits were identified, and each Lhcr was found to contain 11 to 13 chlorophylls a and 5 zeaxanthins, which are apparently different from those of LHCs in plant PSI-LHCI. Together, our results reveal unique energy transfer pathways different from those of higher plant PSI-LHCI, its adaptation to the changing environment, and the possible changes of PSI-LHCI during evolution from prokaryotes to eukaryotes.
APA, Harvard, Vancouver, ISO, and other styles
11

Barera, Simone, Luca Dall’Osto, and Roberto Bassi. "Effect of lhcsr gene dosage on oxidative stress and light use efficiency by Chlamydomonas reinhardtii cultures." Journal of Biotechnology 328 (February 2021): 12–22. http://dx.doi.org/10.1016/j.jbiotec.2020.12.023.

Full text
APA, Harvard, Vancouver, ISO, and other styles
12

Dong, Meitao, Xiaowen Zhang, Zhimeng Zhuang, Jian Zou, Naihao Ye, Dong Xu, Shanli Mou, Chengwei Liang, and Wenqi Wang. "Characterization of the LhcSR Gene Under Light and Temperature Stress in the Green Alga Ulva linza." Plant Molecular Biology Reporter 30, no. 1 (April 27, 2011): 10–16. http://dx.doi.org/10.1007/s11105-011-0311-8.

Full text
APA, Harvard, Vancouver, ISO, and other styles
13

Kosuge, Kotaro, Ryutaro Tokutsu, Eunchul Kim, Seiji Akimoto, Makio Yokono, Yoshifumi Ueno, and Jun Minagawa. "LHCSR1-dependent fluorescence quenching is mediated by excitation energy transfer from LHCII to photosystem I in Chlamydomonas reinhardtii." Proceedings of the National Academy of Sciences 115, no. 14 (March 19, 2018): 3722–27. http://dx.doi.org/10.1073/pnas.1720574115.

Full text
Abstract:
Photosynthetic organisms are frequently exposed to light intensities that surpass the photosynthetic electron transport capacity. Under these conditions, the excess absorbed energy can be transferred from excited chlorophyll in the triplet state (3Chl*) to molecular O2, which leads to the production of harmful reactive oxygen species. To avoid this photooxidative stress, photosynthetic organisms must respond to excess light. In the green alga Chlamydomonas reinhardtii, the fastest response to high light is nonphotochemical quenching, a process that allows safe dissipation of the excess energy as heat. The two proteins, UV-inducible LHCSR1 and blue light-inducible LHCSR3, appear to be responsible for this function. While the LHCSR3 protein has been intensively studied, the role of LHCSR1 has been only partially elucidated. To investigate the molecular functions of LHCSR1 in C. reinhardtii, we performed biochemical and spectroscopic experiments and found that the protein mediates excitation energy transfer from light-harvesting complexes for Photosystem II (LHCII) to Photosystem I (PSI), rather than Photosystem II, at a low pH. This altered excitation transfer allows remarkable fluorescence quenching under high light. Our findings suggest that there is a PSI-dependent photoprotection mechanism that is facilitated by LHCSR1.
APA, Harvard, Vancouver, ISO, and other styles
14

Roach, Thomas. "LHCSR3-Type NPQ Prevents Photoinhibition and Slowed Growth under Fluctuating Light in Chlamydomonas reinhardtii." Plants 9, no. 11 (November 18, 2020): 1604. http://dx.doi.org/10.3390/plants9111604.

Full text
Abstract:
Natural light intensities can rise several orders of magnitude over subsecond time spans, posing a major challenge for photosynthesis. Fluctuating light tolerance in the green alga Chlamydomonas reinhardtii requires alternative electron pathways, but the role of nonphotochemical quenching (NPQ) is not known. Here, fluctuating light (10 min actinic light followed by 10 min darkness) led to significant increase in NPQ/qE-related proteins, LHCSR1 and LHCSR3, relative to constant light of the same subsaturating or saturating intensity. Elevated levels of LHCSR1/3 increased the ability of cells to safely dissipate excess light energy to heat (i.e., qE-type NPQ) during dark to light transition, as measured with chlorophyll fluorescence. The low qE phenotype of the npq4 mutant, which is unable to produce LHCSR3, was abolished under fluctuating light, showing that LHCSR1 alone enables very high levels of qE. Photosystem (PS) levels were also affected by light treatments; constant light led to lower PsbA levels and Fv/Fm values, while fluctuating light led to lower PsaA and maximum P700+ levels, indicating that constant and fluctuating light induced PSII and PSI photoinhibition, respectively. Under fluctuating light, npq4 suffered more PSI photoinhibition and significantly slower growth rates than parental wild type, whereas npq1 and npq2 mutants affected in xanthophyll carotenoid compositions had identical growth under fluctuating and constant light. Overall, LHCSR3 rather than total qE capacity or zeaxanthin is shown to be important in C. reinhardtii in tolerating fluctuating light, potentially via preventing PSI photoinhibition.
APA, Harvard, Vancouver, ISO, and other styles
15

Zhang, Xiaowen, Naihao Ye, Shanli Mou, Dong Xu, and Xiao Fan. "Occurrence of the PsbS and LhcSR products in the green alga Ulva linza and their correlation with excitation pressure." Plant Physiology and Biochemistry 70 (September 2013): 336–41. http://dx.doi.org/10.1016/j.plaphy.2013.05.024.

Full text
APA, Harvard, Vancouver, ISO, and other styles
16

Zheng, Zhenbing, Shan Gao, and Guangce Wang. "Far red light induces the expression of LHCSR to trigger nonphotochemical quenching in the intertidal green macroalgae Ulva prolifera." Algal Research 40 (June 2019): 101512. http://dx.doi.org/10.1016/j.algal.2019.101512.

Full text
APA, Harvard, Vancouver, ISO, and other styles
17

Mou, S., X. Zhang, M. Dong, X. Fan, J. Xu, S. Cao, D. Xu, W. Wang, and N. Ye. "Photoprotection in the green tidal algaUlva prolifera: role of LHCSR and PsbS proteins in response to high light stress." Plant Biology 15, no. 6 (July 19, 2013): 1033–39. http://dx.doi.org/10.1111/j.1438-8677.2012.00712.x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
18

Cantrell, Michael, and Graham Peers. "A mutant of Chlamydomonas without LHCSR maintains high rates of photosynthesis, but has reduced cell division rates in sinusoidal light conditions." PLOS ONE 12, no. 6 (June 23, 2017): e0179395. http://dx.doi.org/10.1371/journal.pone.0179395.

Full text
APA, Harvard, Vancouver, ISO, and other styles
19

Mou, Shanli, Xiaowen Zhang, Naihao Ye, Meitao Dong, Chengwei Liang, Qiang Liang, Jinlai Miao, Dong Xu, and Zhou Zheng. "Cloning and expression analysis of two different LhcSR genes involved in stress adaptation in an Antarctic microalga, Chlamydomonas sp. ICE-L." Extremophiles 16, no. 2 (January 3, 2012): 193–203. http://dx.doi.org/10.1007/s00792-011-0419-7.

Full text
APA, Harvard, Vancouver, ISO, and other styles
20

Ptushenko, Vasily V., Grigorii N. Bondarenko, Elizaveta N. Vinogradova, Elena S. Glagoleva, Olga V. Karpova, Oxana S. Ptushenko, Karina A. Shibzukhova, Alexei E. Solovchenko, and Elena S. Lobakova. "Chilling Upregulates Expression of the PsbS and LhcSR Genes in the Chloroplasts of the Green Microalga Lobosphaera incisa IPPAS C-2047." Biochemistry (Moscow) 87, no. 12-13 (December 2022): 1699–706. http://dx.doi.org/10.1134/s0006297922120240.

Full text
APA, Harvard, Vancouver, ISO, and other styles
21

Liguori, Nicoletta, Laura M. Roy, Milena Opacic, Grégory Durand, and Roberta Croce. "Regulation of Light Harvesting in the Green Alga Chlamydomonas reinhardtii: The C-Terminus of LHCSR Is the Knob of a Dimmer Switch." Journal of the American Chemical Society 135, no. 49 (November 26, 2013): 18339–42. http://dx.doi.org/10.1021/ja4107463.

Full text
APA, Harvard, Vancouver, ISO, and other styles
22

Roach, Thomas, Chae Sun Na, Wolfgang Stöggl, and Anja Krieger-Liszkay. "The non-photochemical quenching protein LHCSR3 prevents oxygen-dependent photoinhibition in Chlamydomonas reinhardtii." Journal of Experimental Botany 71, no. 9 (January 16, 2020): 2650–60. http://dx.doi.org/10.1093/jxb/eraa022.

Full text
Abstract:
Abstract Non-photochemical quenching (NPQ) helps dissipate surplus light energy, preventing formation of reactive oxygen species (ROS). In Chlamydomonas reinhardtii, the thylakoid membrane protein LHCSR3 is involved in pH-dependent (qE-type) NPQ, lacking in the npq4 mutant. Preventing PSII repair revealed that npq4 lost PSII activity faster than the wild type (WT) in elevated O2, while no difference between strains was observed in O2-depleted conditions. Low Fv/Fm values remained 1.5 h after moving cells out of high light, and this qH-type quenching was independent of LHCSR3 and not accompanied by losses of maximum PSII activity. Culturing cells in historic O2 atmospheres (30–35%) increased the qE of cells, due to increased LHCSR1 and PsbS levels, and LHCSR3 in the WT, showing that atmospheric O2 tensions regulate qE capacity. Colony growth of npq4 was severely restricted at elevated O2, and npq4 accumulated more reactive electrophile species (RES) than the WT, which could damage PSI. Levels of PsaA (PSI) were lower in npq4 grown at 35% O2, while PsbA (PSII) levels remained stable. We conclude that even at high O2 concentrations, the PSII repair cycle is sufficient to maintain net levels of PSII. However, LHCSR3 has an important function in protecting PSI against O2-mediated damage, such as via RES.
APA, Harvard, Vancouver, ISO, and other styles
23

Dinc, Emine, Lijin Tian, Laura M. Roy, Robyn Roth, Ursula Goodenough, and Roberta Croce. "LHCSR1 induces a fast and reversible pH-dependent fluorescence quenching in LHCII in Chlamydomonas reinhardtii cells." Proceedings of the National Academy of Sciences 113, no. 27 (June 22, 2016): 7673–78. http://dx.doi.org/10.1073/pnas.1605380113.

Full text
Abstract:
To avoid photodamage, photosynthetic organisms are able to thermally dissipate the energy absorbed in excess in a process known as nonphotochemical quenching (NPQ). Although NPQ has been studied extensively, the major players and the mechanism of quenching remain debated. This is a result of the difficulty in extracting molecular information from in vivo experiments and the absence of a validation system for in vitro experiments. Here, we have created a minimal cell of the green alga Chlamydomonas reinhardtii that is able to undergo NPQ. We show that LHCII, the main light harvesting complex of algae, cannot switch to a quenched conformation in response to pH changes by itself. Instead, a small amount of the protein LHCSR1 (light-harvesting complex stress related 1) is able to induce a large, fast, and reversible pH-dependent quenching in an LHCII-containing membrane. These results strongly suggest that LHCSR1 acts as pH sensor and that it modulates the excited state lifetimes of a large array of LHCII, also explaining the NPQ observed in the LHCSR3-less mutant. The possible quenching mechanisms are discussed.
APA, Harvard, Vancouver, ISO, and other styles
24

Li, Naicheng, Jingyao Zhang, Xinyu Zhao, Pengbin Wang, Mengmeng Tong, and Patricia M. Glibert. "Allelopathic Inhibition by the Bacteria Bacillus cereus BE23 on Growth and Photosynthesis of the Macroalga Ulva prolifera." Journal of Marine Science and Engineering 8, no. 9 (September 16, 2020): 718. http://dx.doi.org/10.3390/jmse8090718.

Full text
Abstract:
Bacteria-derived allelopathic effects on microalgae blooms have been studied with an aim to develop algicidal products that may have field applications. However, few such studies have been conducted on macroalgae. Therefore, a series of experiments was conducted to investigate the impacts of different concentrations of cell-free filtrate of the bacteria Bacillus cereus BE23 on Ulva prolifera. Excessive reactive oxygen species (ROS) were produced when these cells were exposed to high concentrations of filtrate relative to f/2 medium. In such conditions, the antioxidative defense system of the macroalga was activated as shown by activities of the enzymes superoxide dismutase (SOD) and catalase (CAT) and upregulation of the associated genes upMnSOD and upCAT. High concentrations of filtrate also inhibited growth of U. prolifera, and reduced chlorophyll a and b, the photosynthetic efficiency (Fv/Fm), and the electron transport rate (rETR). Non-photochemical quenching (NPQ) was also inhibited, as evidenced by the downregulation of the photoprotective genes PsbS and LhcSR. Collectively, this evidence indicates that the alteration of energy dissipation caused excess cellular ROS accumulation that further induced oxidative damage on the photosynthesis apparatus of the D1 protein. The potential allelochemicals were further isolated by five steps of extraction and insolation (solid phase–liquid phase–open column–UPLC–preHPLC) and identified as N-phenethylacetamide, cyclo (L-Pro-L-Val), and cyclo (L-Pro-L-Pro) by HR-ESI-MS and NMR spectra. The diketopiperazines derivative, cyclo (L-Pro-L-Pro), exhibited the highest inhibition on U. prolifera and may be a good candidate as an algicidal product for green algae bloom control.
APA, Harvard, Vancouver, ISO, and other styles
25

Lorenzen, Mette, John Erik Nielsen, Christine Hjorth Andreassen, Anders Juul, Birgitte Grønkær Toft, Ewa Rajpert-De Meyts, Gedske Daugaard, and Martin Blomberg Jensen. "Luteinizing Hormone Receptor Is Expressed in Testicular Germ Cell Tumors: Possible Implications for Tumor Growth and Prognosis." Cancers 12, no. 6 (May 26, 2020): 1358. http://dx.doi.org/10.3390/cancers12061358.

Full text
Abstract:
Luteinizing hormone/choriogonadotropin receptor (LHCGR) regulates gonadal testosterone production and recent studies have suggested a growth-regulatory role in somatic cancers. Here, we established that LHCGR is expressed in a fraction of seminoma cells and germ cell neoplasia in situ (GCNIS), and the seminoma-derived cell line TCam2 released LHCGR into the medium. LH treatment induced proliferation of TCam2 cells in vitro, while hCG treatment induced a non-significant 51% increase in volume of tumors formed in a TCam2 xenograft model. A specific ELISA was used to detect a soluble LHCGR in serum. Serum concentrations of soluble LHCGR could not distinguish 4 patients with GCNIS and 216 patients with testicular germ cell tumors (TGCTs) from 297 infertile or 148 healthy young men. Instead, serum LHCGR levels were significantly higher in 112 patients with a seminoma >5 cm or elevated serum lactate dehydrogenase (LDH) compared with men harboring smaller seminomas <2 cm or normal LDH levels. Serum LHCGR levels in TGCT patients could not predict relapse irrespective whether determined pre- or post-orchiectomy. Combined, these novel findings suggest that LHCGR may be directly involved in the progression and growth of seminomas, and our retrospective pilot study suggests that serum LHCGR may have some prognostic value in men with seminoma.
APA, Harvard, Vancouver, ISO, and other styles
26

Crovetto, Francesca, Francesc Figueras, Fatima Crispi, Stefania Triunfo, Michael Pugia, Luis Lasalvia, Anne E. Chambers, et al. "Forms of Circulating Luteinizing Hormone Human Chorionic Gonadotropin Receptor for the Prediction of Early and Late Preeclampsia in the First Trimester of Pregnancy." Fetal Diagnosis and Therapy 38, no. 2 (2015): 94–102. http://dx.doi.org/10.1159/000371516.

Full text
Abstract:
Objective: To explore the value of circulating luteinizing human chorionic gonadotropin receptor (LHCGR) forms for the prediction of preeclampsia (PE) in the first trimester of pregnancy. Methods: Case-control study, based on a cohort of 5,759 pregnancies, including 20 early PE, 20 late PE, and 300 controls. We recorded/measured maternal characteristics, mean arterial pressure (MAP), uterine artery (UtA) Doppler, placental growth factor (PlGF), soluble Fms-like tyrosine kinase-1 (sFtl-1), and LHCGR forms (hCG-LHCGR and soluble LHCGR), and their independent predictive values were analyzed by logistic regression. Results: For early PE, the model included black ethnicity, chronic hypertension, previous PE, MAP, UtA Doppler, PlGF, sFlt-1, and LHCGR forms, achieving detection rates (DR) of 83% at 10% of false-positive rates (FPR) [AUC: 0.961 (95% CI: 0.921-1)]. For late PE, the model included body mass index, previous PE, UtA Doppler, PlGF, sFlt-1, and LHCGR forms, with DR of 75% at 10% of FPR [AUC: 0.923 (95% CI: 0.871-0.976)]. In both early and late PE, LHCGR forms improved DR by 6-15%. Conclusions: LHCGR forms improved the prediction for early and late PE. These results should be confirmed in larger prospective studies.
APA, Harvard, Vancouver, ISO, and other styles
27

Doroszko, Milena, Marcin Chrusciel, Joanna Stelmaszewska, Tomasz Slezak, Adolfo Rivero-Muller, Artur Padzik, Slawomir Anisimowicz, et al. "Luteinizing Hormone and GATA4 Action in the Adrenocortical Tumorigenesis of Gonadectomized Female Mice." Cellular Physiology and Biochemistry 43, no. 3 (2017): 1064–76. http://dx.doi.org/10.1159/000481718.

Full text
Abstract:
Background/Aims: Physiological role of luteinizing hormone (LH) and its receptor (LHCGR) in adrenal remains unknown. In inhibin-α/Simian Virus 40 T antigen (SV40Tag) (inhα/Tag) mice, gonadectomy-induced (OVX) elevated LH triggers the growth of transcription factor GATA4 (GATA4)-positive adrenocortical tumors in a hyperplasia-adenoma-adenocarcinoma sequence. Methods: We investigated the role of LHCGR in tumor induction, by crossbreeding inhα/Tag with Lhcgr knockout (LuRKO) mice. By knocking out Lhcgr and Gata4 in Cα1 adrenocortical cells (Lhcgr-ko, Gata4-ko) we tested their role in tumor progression. Results: Adrenal tumors of OVX inhα/Tag mice develop from the hyperplastic cells localized in the topmost layer of zona fasciculata. OVX inhα/Tag/LuRKO only developed SV40Tag positive hyperplastic cells that were GATA4 negative, cleaved caspase-3 positive and did not progress into adenoma. In contrast to Lhcgr-ko, Gata4-ko Cα1 cells presented decreased proliferation, increased apoptosis, decreased expression of Inha, SV40Tag and Lhcgr tumor markers, as well as up-regulated adrenal- and down-regulated sex steroid gene expression. Both Gata4-ko and Lhcgr-ko Cα1 cells had decreased expression of steroidogenic genes resulting in decreased basal progesterone production. Conclusion: Our data indicate that LH/LHCGR signaling is critical for the adrenal cell reprogramming by GATA4 induction prompting adenoma formation and gonadal-like phenotype of the adrenocortical tumors in inhα/Tag mice.
APA, Harvard, Vancouver, ISO, and other styles
28

Cheung, Janelle, Noor A. Lokman, Riya D. Abraham, Anne M. Macpherson, Eunice Lee, Frank Grutzner, Nicolae Ghinea, Martin K. Oehler, and Carmela Ricciardelli. "Reduced Gonadotrophin Receptor Expression Is Associated with a More Aggressive Ovarian Cancer Phenotype." International Journal of Molecular Sciences 22, no. 1 (December 23, 2020): 71. http://dx.doi.org/10.3390/ijms22010071.

Full text
Abstract:
Follicle-stimulating hormone (FSH) and luteinising hormone (LH) play important roles in regulating cell growth and proliferation in the ovary. However, few studies have explored the expression of FSH and LH receptors (FSHR and LHCGR) in ovarian cancer, and their functional roles in cancer progression remain inconclusive. This study investigated the potential impact of both mRNA (FSHR, LHCGR) and protein (FSHR, LHCGR) expression on ovarian cancer progression using publicly available online databases, qRT-PCR (high grade serous ovarian cancers, HGSOC, n = 29 and benign ovarian tumors, n = 17) and immunohistochemistry (HGSOC, n = 144). In addition, we investigated the effect of FSHR and LHCGR siRNA knockdown on the pro-metastatic behavior of serous ovarian cancer cells in vitro. High FSHR or high LHCGR expression in patients with all subtypes of high-grade ovarian cancer was significantly associated with longer progression-free survival (PFS) and overall survival (OS). High FSHR protein expression was associated with increased PFS (p = 0.050) and OS (p = 0.025). HGSOC patients with both high FSHR and high LHCGR protein levels had the best survival outcome, whilst both low FSHR and low LHCGR expression was associated with poorest survival (p = 0.019). Knockdown of FSHR significantly increased the invasion of serous ovarian cancer cells (OVCAR3 and COV362) in vitro. LHCGR knockdown also promoted invasion of COV362 cells. This study highlights that lower FSHR and LHCGR expression is associated with a more aggressive epithelial ovarian cancer phenotype and promotes pro-metastatic behaviour.
APA, Harvard, Vancouver, ISO, and other styles
29

Gridelet, Virginie, Marie Tsampalas, Sarah Berndt, Marie-Thérèse Hagelstein, Chantal Charlet-Renard, Valérie Conrath, Fabien Ectors, et al. "Evidence for cross-talk between the LH receptor and LH during implantation in mice." Reproduction, Fertility and Development 25, no. 3 (2013): 511. http://dx.doi.org/10.1071/rd11241.

Full text
Abstract:
The present study investigated the first interaction that occurs between the blastocyst and endometrium during implantation. Given the ethical objections to studying implantation in humans, a mouse model was used to study the dialogue between luteinising hormone (LH) and luteinising hormone receptor (LHCGR). Several studies performed on LHCGR-knockout mice have generated controversy regarding the importance of the dialogue between LH and LHCGR during implantation. There has been no demonstration of a bioactive LH-like signal produced by the murine blastocyst. The first aim of the present study was to examine and quantify, using radioimmunoassay, the generation of a bioactive LH signal by the murine blastocyst. We went on to examine and quantify endometrial Lhcgr expression to validate the mouse model. Expression of LHCGR in mouse uteri was demonstrated using immunohistochemistry and western blot analysis. To quantify the expression of Lh in the mouse blastocyst and Lhcgr in the endometrium, reverse transcription–polymerase chain reaction (RT-PCR) and real-time quantitative (q) RT-PCR were performed. The results demonstrate that Lhcgr expression in BALB/c mouse endometrial epithelium is increased at the time of implantation and indicate that LHCGR may contribute to the implantation process. In support of this hypothesis, we identified a bioactive LH signal at the time of murine blastocyst implantation.
APA, Harvard, Vancouver, ISO, and other styles
30

Wang, Peng, Han Zhao, Tao Li, Wei Zhang, Keliang Wu, Mei Li, Yuehong Bian, et al. "Hypomethylation of the LH/Choriogonadotropin Receptor Promoter Region Is a Potential Mechanism Underlying Susceptibility to Polycystic Ovary Syndrome." Endocrinology 155, no. 4 (April 1, 2014): 1445–52. http://dx.doi.org/10.1210/en.2013-1764.

Full text
Abstract:
Our previous genome-wide association study identified LH/choriogonadotropin receptor (LHCGR) as a susceptibility gene for polycystic ovary syndrome (PCOS). The objective of this study was to determine whether the genetic or epigenetic components associated with LHCGR participate in the pathogenesis of PCOS. The exons and flanking regions of LHCGR were sequenced from 192 women with PCOS, and no novel somatic mutations were identified. In addition, the methylation statuses of 6 cytosine-phosphate-guanine (CpG) sites in the promoter region of LHCGR were measured by pyrosequencing using peripheral blood cells from 85 women with PCOS and 88 control women. We identified 2 hypomethylated sites, CpG −174 (corrected P = .018) and −111 (corrected P = .006). Bisulfite sequencing then was performed to replicate these findings and detect additional CpG sites in the promoter. CpG +17 was significantly hypomethylated in women with PCOS (corrected P = .02). Methylation statuses were further evaluated using granulosa cells (GCs), and the region described was hypomethylated as a whole (P = .004) with 8 significantly hypomethylated sites (CpG −174, −148, −61, −43, −8, +10, +17, and +20). Transcription of LHCGR was elevated in women with PCOS compared with that in control women (P &lt; .01). These findings were consistent with the decreased LHCGR methylation status associated with PCOS. The tendency of LHCGR to be hypomethylated across different tissues and its corresponding expression level suggest that hypomethylation of LHCGR is a potential mechanism underlying susceptibility to PCOS. Further studies are needed to evaluate whether a causal relationship exists between LHCGR methylation status and PCOS.
APA, Harvard, Vancouver, ISO, and other styles
31

Cannon, Jennifer D., Srinivas V. Seekallu, Catherine A. VandeVoort, and Charles L. Chaffin. "Association of luteinizing hormone receptor gene expression with cell cycle progression in granulosa cells." American Journal of Physiology-Endocrinology and Metabolism 296, no. 6 (June 2009): E1392—E1399. http://dx.doi.org/10.1152/ajpendo.90965.2008.

Full text
Abstract:
During hormonally induced ovarian follicle growth, granulosa cell proliferation increases and returns to baseline prior to the administration of an ovulatory stimulus. Several key genes appear to follow a similar pattern, including the luteinizing hormone receptor (LHCGR), suggesting an association between cell cycle progression and gene expression. The expression of LHCGR mRNA in granulosa cells isolated from immature rats and treated in culture with FSH increased in a time-dependent manner, whereas administration of the cell cycle inhibitor mimosine completely suppressed expression. Although forskolin was able to induce luteinization in cells treated with mimosine, human chorionic gonadotropin had no effect, indicating the functional loss of LHCGR. The effects of mimosine on cell cycle progression and LHCGR mRNA expression were reversible within 24 h of mimosine removal. Cell cycle inhibition did not alter the stability of LHCGR mRNA, indicating that the primary effect was at the transcriptional level. To determine whether the relationship between LHCGR expression and cell cycle were relevant in vivo, immature rats were given a bolus of PMSG, followed by a second injection of either saline or PMSG 24 h later to augment levels of proliferation. The expression of LHCGR mRNA was elevated in the ovaries of animals receiving a supplement of PMSG. Mimosine also blocked cell cycle progression and LHCGR mRNA expression in macaque granulosa cells isolated following controlled ovarian stimulation cycles and in two different mouse Leydig tumor lines. These data collectively indicate that LHCGR mRNA is expressed as a function of the passage of cells across the G1-S phase boundary.
APA, Harvard, Vancouver, ISO, and other styles
32

Lu, Xuefeng, Zheng Yan, Renfei Cai, Shuzin Khor, Ling Wu, Lihua Sun, Yun Wang, et al. "Pregnancy and Live Birth In Women With Pathogenic LHCGR Variants Using Their Own Oocytes." Journal of Clinical Endocrinology & Metabolism 104, no. 12 (August 8, 2019): 5877–92. http://dx.doi.org/10.1210/jc.2019-01276.

Full text
Abstract:
Abstract Context The LH/chorionic gonadotropin receptor (LHCGR) is mainly expressed in gonads and plays important roles in estradiol production, ovulation, and luteal formation. Women with pathogenic LHCGR variants suffer from infertility, and successful fertility treatments for such women have never been reported. Objective The purpose of this study was to determine whether women with pathogenic LHCGR variants can achieve successful pregnancies through in vitro fertilization. Design Three women with LH resistance and infertility and their parents underwent exome sequencing. The biochemical characteristics and functional effects of LHCGR mutation were assessed in transfected human embryonic kidney -293T cells and primary granulosa cells. Results All affected women harbored pathogenic LHCGR variants. The LHCGR variants lacked cell surface localization and signal transduction abilities in vitro and in vivo. After dual triggering and prolonging the interval between triggering and oocyte pick-up, all three patients achieved oocytes and high-quality embryos. After frozen embryo transfer, one woman successfully birthed twins, and one woman successfully birthed a live boy. Apart from difficulties in oocyte retrieval, no obvious abnormalities in fertilization or during embryo development and pregnancy were identified in these patients. Conclusions This study is, to our knowledge, the first to report successful assisted reproductive treatment of women with pathogenic LHCGR variants using their own oocytes. Our results supported that defects in LHCGR disrupted ovulation but had no effect on fertilization and embryo development.
APA, Harvard, Vancouver, ISO, and other styles
33

Costa, Marcia Helena Soares, Sorahia Domenice, Ana Claudia Latronico, Regina Matsunaga Martin, Mirian Yumie Nishi, Antonio Marmo Lucon, Berenice Bilharinho Mendonca, and Maria Candida Barisson Villares Fragoso. "Analysis of glucose-dependent insulinotropic peptide receptor (GIPR) and luteinizing hormone receptor (LHCGR) expression in human adrenocortical hyperplasia." Arquivos Brasileiros de Endocrinologia & Metabologia 53, no. 3 (April 2009): 326–31. http://dx.doi.org/10.1590/s0004-27302009000300005.

Full text
Abstract:
OBJECTIVE: To analyze the aberrant expression of the GIPR and LHCGR in different forms of adrenocortical hyperplasia: ACTH-independent macronodular adrenal hyperplasia (AIMAH), primary pigmented nodular adrenocortical disease (PPNAD) and diffuse adrenal hyperplasia secondary to Cushing's disease (DAHCD). METHODS: We quantified GIPR and LHCGR expressions using real time PCR in 20 patients with adrenocortical hyperplasia (seven with AIMAH, five with PPNAD, and eight with DAHCD). Normal adrenals tissues were used as control and the relative expression was compared with β-actin. RESULTS: GIPR and LHCGR expressions were demonstrated in all tissues studied. Median GIPR and LHCGR mRNA levels were 1.6; 0.4; 0.5 and 1.3; 0.9; 1.0 in adrenocortical tissues from AIMAH, PPNAD and DAHCD respectively. There were no differences between GIPR and LHCGR expressions in all tissues studied. CONCLUSIONS: GIPR and LHCGR overexpression were not identified in the studied cases, thus suggesting that this molecular mechanism is not involved in adrenocortical hyperplasia in our patients.
APA, Harvard, Vancouver, ISO, and other styles
34

Tjulin, A., M. André, A. I. Eriksson, and M. Maksimovic. "Observations of lower hybrid cavities in the inner magnetosphere by the Cluster and Viking satellites." Annales Geophysicae 22, no. 8 (September 7, 2004): 2961–72. http://dx.doi.org/10.5194/angeo-22-2961-2004.

Full text
Abstract:
Abstract. Observations by the Viking and Cluster satellites at altitudes up to 35000km show that Lower Hybrid Cavities (LHCs) are common in the inner magnetosphere. LHCs are density depletions filled with waves in the lower hybrid frequency range. The LHCs have, until recently, only been found at altitudes up to 2000km. Statistics of the locations and general shape of the LHCs is performed to obtain an overview of some of their properties. In total, we have observed 166 LHCs on Viking during 27h of data, and 535 LHCs on Cluster during 87h of data. These LHCs are found at invariant latitudes from the auroral region to the plasmapause. A comparison with lower altitude observations shows that the LHC occurrence frequency does not scale with the flux tube radius, so that the LHCs are moderately rarer at high altitudes. This indicates that the individual LHCs do not reach from the ionosphere to 35000km altitude, which gives an upper bound for their length. The width of the LHCs perpendicular to the geomagnetic field at high altitudes is a few times the ion gyroradius, consistent with observations at low altitudes. The estimated depth of the density depletions vary with altitude, being larger at altitudes of 20000-35000km (Cluster, 10-20%), smaller around 1500-13000km (Viking and previous Freja results, a few percent) and again larger around 1000km (previous sounding rocket observations, 10-20%). The LHCs in the inner magnetosphere are situated in regions with background electrostatic hiss in the lower hybrid frequency range, consistent with investigations at low altitudes. Individual LHCs observed at high altitudes are stable at least on time scales of 0.2s (about the ion gyro period), which is consistent with previous results at lower altitudes, and observations by the four Cluster satellites show that the occurrence of LHCs in a region in space is a stable phenomenon, at least on time scales of an hour.
APA, Harvard, Vancouver, ISO, and other styles
35

Hsu, Ya-Chuan, Tzeng-Ji Chen, Feng-Yuan Chu, Hao-Yen Liu, Li-Fang Chou, and Shinn-Jang Hwang. "Official Websites of Local Health Centers in Taiwan: A Nationwide Study." International Journal of Environmental Research and Public Health 16, no. 3 (January 31, 2019): 399. http://dx.doi.org/10.3390/ijerph16030399.

Full text
Abstract:
Local health centers (LHCs) play a key role in public health. Because it has now become popular to seek health information on the Internet, an effective website is indispensable to an LHC. Our study aimed to survey the official websites of LHCs in Taiwan with an evaluation framework. All 369 LHCs in Taiwan were surveyed in March 2018. The evaluation indicators included health information, online interactive services, technical features, institutional information, links to external resources, website management, the last updated time, and number of visitors. The indicators were stratified by the urbanization levels of the LHCs. In total, 98.0% (n = 360) of the LHCs had official websites. The majority (n = 241) of the websites were updated within the past 30 days, and most of the websites (n = 353) provided health information. However, the information provided varied considerably. Few LHCs (n = 31) provided online interactive services in terms of an online appointment function. In terms of providing online consultation services, rural LHCs outperformed suburban and urban LHCs (16.4% versus 14.5% and 6.0%, respectively). Most LHCs in Taiwan do not seem to take full advantage of the Internet, with their websites typically serving as static bulletin boards instead of new channels of communication. Further studies could focus on the effectiveness of these websites.
APA, Harvard, Vancouver, ISO, and other styles
36

Zheng, Cuihong, Thippeswamy Gulappa, Bindu Menon, and K. M. J. Menon. "Association between LH receptor regulation and ovarian hyperstimulation syndrome in a rodent model." Reproduction 160, no. 2 (August 2020): 239–45. http://dx.doi.org/10.1530/rep-20-0058.

Full text
Abstract:
Ovarian hyperstimulation syndrome (OHSS) is a common complication of ovarian stimulation associated with the administration of human chorionic gonadotropin (hCG) during assisted reproduction. We have determined the expression of luteinizing hormone receptor (Lhcgr) mRNA, vascular endothelial growth factor (VEGF), and its transcription factor, HIF1α, during the periovulatory period in a rodent model of OHSS and compared these results with normal ovulatory periods. These results showed that the downregulation of Lhcgr mRNA in response to conditions that mimic preovulatory LH surge was significantly impaired in the OHSS group compared to the complete downregulation seen in the control group. Most importantly, the downregulation of luteinizing hormone receptor mRNA expression following hCG administration was sustained in the control group up to 48 h, whereas it remained at significantly higher levels in the OHSS group. This impairment of hCG-induced Lhcgr downregulation in the OHSS group was accompanied by significantly elevated levels of VEGF and its transcription factor, HIF1α. Furthermore, the downregulation of Lhcgr that occurs in response to a preovulatory LH surge in normal cycles was accompanied by low levels of VEGF. This study shows that, while downregulation of Lhcgr as well as low VEGF levels are seen in response to a preovulatory LH surge in normal ovarian cycle, impaired Lhcgr downregulation and elevated VEGF levels were found in the OHSS group.
APA, Harvard, Vancouver, ISO, and other styles
37

Juel Mortensen, Li, Mette Lorenzen, Anne Jørgensen, Jakob Albrethsen, Niels Jørgensen, Søren Møller, Anna-Maria Andersson, Anders Juul, and Martin Blomberg Jensen. "Possible Relevance of Soluble Luteinizing Hormone Receptor during Development and Adulthood in Boys and Men." Cancers 13, no. 6 (March 16, 2021): 1329. http://dx.doi.org/10.3390/cancers13061329.

Full text
Abstract:
Luteinizing hormone (LH) and human chorionic gonadotropin (hCG) are agonists for the luteinizing hormone receptor (LHCGR) which regulates male reproductive function. LHCGR may be released into body fluids. We wish to determine whether soluble LHCGR is a marker for gonadal function. Cross-sectional, longitudinal, and intervention studies on 195 healthy boys and men and 396 men with infertility, anorchia, or Klinefelter Syndrome (KS) were used to correlate LHCGR measured in serum, seminal fluid, urine, and hepatic/renal artery and vein with gonadal function. LHCGR was determined in fluids from in vitro and in vivo models of human testicular tissue and cell lines, xenograft mouse models, and human fetal kidney and adrenal glands. Western blot showed LHCGR fragments in serum and gonadal tissue of similar size using three different antibodies. The LHCGR-ELISA had no species cross-reactivity or unspecific reaction in mouse serum even after human xenografting. Instead, sLHCGR was released into the media after the culture of a human fetal kidney and adrenal glands. Serum sLHCGR decreased markedly during puberty in healthy boys (p = 0.0001). In healthy men, serum sLHCGR was inversely associated with the Inhibin B/FSH ratio (β −0.004, p = 0.027). In infertile men, seminal fluid sLHCGR was inversely associated with serum FSH (β 0.006, p = 0.009), sperm concentration (β −3.5, p = 0.003) and total sperm count (β −3.2, p = 0.007). The injection of hCG lowered sLHCGR in serum and urine of healthy men (p < 0.01). In conclusion, sLHCGR is released into body-fluids and linked with pubertal development and gonadal function. Circulating sLHCGR in anorchid men suggests that sLHCGR in serum may originate from and possibly exert actions in non-gonadal tissues. (ClinicalTrials: NTC01411527, NCT01304927, NCT03418896).
APA, Harvard, Vancouver, ISO, and other styles
38

Lazzaretti, Clara, Valentina Secco, Elia Paradiso, Samantha Sperduti, Claudia Rutz, Annika Kreuchwig, Gerd Krause, Manuela Simoni, and Livio Casarini. "Identification of Key Receptor Residues Discriminating Human Chorionic Gonadotropin (hCG)- and Luteinizing Hormone (LH)-Specific Signaling." International Journal of Molecular Sciences 22, no. 1 (December 25, 2020): 151. http://dx.doi.org/10.3390/ijms22010151.

Full text
Abstract:
(1) The human luteinizing hormone (LH)/chorionic gonadotropin (hCG) receptor (LHCGR) discriminates its two hormone ligands and differs from the murine receptor (Lhr) in amino acid residues potentially involved in qualitative discerning of LH and hCG. The latter gonadotropin is absent in rodents. The aim of the study is to identify LHCGR residues involved in hCG/LH discrimination. (2) Eight LHCGR cDNAs were developed, carrying “murinizing” mutations on aminoacidic residues assumed to interact specifically with LH, hCG, or both. HEK293 cells expressing a mutant or the wild type receptor were treated with LH or hCG and the kinetics of cyclic adenosine monophosphate (cAMP) and phosphorylated extracellular signal-regulated kinases 1/2 (pERK1/2) activation was analyzed by bioluminescence resonance energy transfer (BRET). (3) Mutations falling within the receptor leucine reach repeat 9 and 10 (LRR9 and LRR10; K225S +T226I and R247T), of the large extracellular binding domain, are linked to loss of hormone-specific induced cAMP increase, as well as hCG-specific pERK1/2 activation, leading to a Lhr-like modulation of the LHCGR-mediated intracellular signaling pattern. These results support the hypothesis that LHCGR LRR domain is the interaction site of the hormone β-L2 loop, which differs between LH and hCG, and might be fundamental for inducing gonadotropin-specific signals. (4) Taken together, these data identify LHCGR key residues likely evolved in the human to discriminate LH/hCG specific binding.
APA, Harvard, Vancouver, ISO, and other styles
39

Lubis, Hilma Putri, Muhammad Fidel Ganis Siregar, Ichwanul Adenin, Binarwan Halim, Henry Salim Siregar, and M. Oky Prabudi. "Association between Luteinizing Hormone/Choriogonadotropin Receptor Ins18LQ Gene Polymorphism and Polycystic Ovary Syndrome." Open Access Macedonian Journal of Medical Sciences 8, A (August 10, 2020): 517–20. http://dx.doi.org/10.3889/oamjms.2020.4182.

Full text
Abstract:
BACKGROUND: Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders of women in the childbearing period. However, its pathophysiology is still unclear. Certain polymorphisms of the luteinizing hormone/choriogonadotropin receptor (LHCGR) genes may lead to changes in the bioactivity of this hormone. The important functional role of LHCGR in the metabolism of androgen and ovulation, the LHCGR gene variant, may be related to the risk of PCOS. AIM: The aim of this study was to evaluate the association between LHCGR Ins18LQ gene polymorphism and PCOS. METHODS: A case–control study was performed in women with PCOS and non-PCOS from May 2019 to October 2019 in HFC IVF Center. We included 50 women with PCOS and 50 healthy controls. Polymorphism of the LHCGR (ins18LQ) gene was genotyped using polymerase chain reaction-restriction fragment length polymorphism. RESULTS: From this study, we found that there was no significant difference in the proportion of ages between the groups (p > 0.05). There were significant differences in the characteristics of body mass index, FSH level, LH level, and LH/FSH ratio between the PCOS and control groups (p < 0.05). We also found that the proportion of heterozygote variant non-ins/ins was higher in the PCOS group compared to the control group, but there was no significant difference between the polymorphisms of the non-ins and non-nonins variants between the PCOS and control groups (p = 0.269). The frequency of ins alleles was higher in the PCOS group compared to the control group. CONCLUSION: There was no significant association between LHCGR ins18LQ gene polymorphism and PCOS.
APA, Harvard, Vancouver, ISO, and other styles
40

Zhang, Xuan, Yinghui Wei, Xiaoxuan Li, Chengyu Li, Liangliang Zhang, Zhaojun Liu, Yan Cao, et al. "The Corticosterone–Glucocorticoid Receptor–AP1/CREB Axis Inhibits the Luteinizing Hormone Receptor Expression in Mouse Granulosa Cells." International Journal of Molecular Sciences 23, no. 20 (October 18, 2022): 12454. http://dx.doi.org/10.3390/ijms232012454.

Full text
Abstract:
Under stress conditions, luteinizing hormone (LH)-mediated ovulation is inhibited, resulting in insufficient oocyte production and excretion during follicular development. When the body is stressed, a large amount of corticosterone (CORT) is generated, which will lead to a disorder of the body’s endocrine system and damage to the body. Our previous work showed that CORT can block follicular development in mice. Since LH acts through binding with the luteinizing hormone receptor (Lhcgr), the present study aimed to investigate whether and how corticosterone (CORT) influences Lhcgr expression in mouse ovarian granulosa cells (GCs). For this purpose, three-week-old ICR female mice were injected intraperitoneally with pregnant mare serum gonadotropin (PMSG). In addition, the treatment group was injected with CORT (1 mg/mouse) at intervals of 8 h and the control group was injected with the same volume of methyl sulfoxide (DMSO). GCs were collected at 24 h, 48 h, and 55 h after PMSG injection. For in vitro experiments, the mouse GCs obtained from healthy follicles were treated with CORT alone, or together with inhibitors against the glucocorticoid receptor (Nr3c1). The results showed that the CORT caused a downregulation of Lhcgr expression in GCs, which was accompanied by impaired cell viability. Moreover, the effect of the CORT was mediated by binding to its receptor (Nr3c1) in GCs. Further investigation revealed that Nr3c1 might regulate the transcription of Lhcgr through inhibiting the expression of Lhcgr transcription factors, including AP1 and Creb. Taken together, our findings suggested a possible mechanism of CORT-induced anovulation involving the inhibition of Lhcgr expression in GCs by the CORT–Nr3c1–AP1/Creb axis.
APA, Harvard, Vancouver, ISO, and other styles
41

Lizneva, Daria, Kseniia Ievleva, Anisa Gumerova, Eleanor Shelly, Funda Korkmaz, Valeriia Muradova, Jessica Netto, et al. "RF10 | PMON205 LH/CG Receptor Activation Protects Mice from Diet-Induced Obesity and Modifies Adipose Tissue Immune Response." Journal of the Endocrine Society 6, Supplement_1 (November 1, 2022): A27—A28. http://dx.doi.org/10.1210/jendso/bvac150.058.

Full text
Abstract:
Abstract Menopause is associated with the loss of LH ovulatory surges and enhanced visceral adiposity. Visceral fat depots increase from 5-8% at premenopause to 15-20% of total body fat at postmenopause. Here, we report that high-dose LH, hCG, or small molecule LH/CGR agonist ORG43553 injected twice-a-week into 14-weeks-old C57BL/6 male mice protects them from diet-induced obesity. Testosterone levels were elevated in mice treated with LH or hCG, but not with ORG43553. Notably, the anti-obesity action of LH/hCG is independent of testosterone, as blocking the androgen receptor using flutamide yielded similar results. Importantly, male Lhcgr knockout mice on a high-fat diet treated with LH failed to display a reduction in adiposity, confirming the in vivo specificity of action. Furthermore, our data phenocopied Lhcgr haploinsufficiency in mice. We confirmed the presence of Lhcgr in mouse genital and inguinal fat pads, adipose-derived stromal vascular cells, as well as in differentiated and undifferentiated 3T3-L1 murine adipocytes by qPCR, RNAscope in situ hybridization, and immunohistochemistry. Sanger sequencing showed that the extracellular domain of Lhcgr in genital fat depot was identical to the ovarian receptor. Similarly, we identified LHCGR in human subcutaneous and visceral fat depots. Binding of intraperitoneally injected AlexaFluor-488-labeled hCG was found not only in mouse ovary, but also in genital and subcutaneous fat pad, further confirming the presence of LHCGR in adipose tissue. This binding could be competitively displaced in 3T3-L1 cells using unlabeled hCG. LH, hCG and ORG43553 activated ERK1/2 in a dose-dependent manner in undifferentiated and differentiated 3T3-L1 cells, suggesting that the adipose LHCGR is fully functional. LH, hCG, and ORG43553 reduced adipogenic differentiation in 3T3-L1 cells, which is further confirmed by RNA sequencing. Moreover, we observed, that LH and hCG also alters several aspects of immune response in adipose tissue, including inflammatory response and adaptive immunity. In conclusion, we demonstrated that LH/CG receptors are present and fully functional in adipose tissue, and that high-dose intermittent activation of LHCGR in mouse fat depots protects mice from diet-induced obesity and modifies adipose tissue immune response. Presentation: Saturday, June 11, 2022 1:42 p.m. - 1:47 p.m., Monday, June 13, 2022 12:30 p.m. - 2:30 p.m.
APA, Harvard, Vancouver, ISO, and other styles
42

Costa, Marcia Helena Soares, Ana Claudia Latronico, Regina Matsunaga Martin, Angela S. Barbosa, Madson Q. Almeida, Claudimara Ferini Pacicco Lotfi, Helena P. Lima Valassi, et al. "Expression profiles of the glucose-dependent insulinotropic peptide receptor and LHCGR in sporadic adrenocortical tumors." Journal of Endocrinology 200, no. 2 (October 29, 2008): 167–75. http://dx.doi.org/10.1677/joe-08-0395.

Full text
Abstract:
Glucose-dependent insulinotropic peptide receptor (GIPR) and LHCGR are G-protein-coupled receptors with a wide tissue expression pattern. Aberrant expression of these receptors has rarely been demonstrated in adult sporadic adrenocortical tumors with a lack of data on pediatric tumors. We quantified the GIPR and LHCGR expression in a large cohort of 55 patients (25 children and 30 adults) with functioning and non-functioning sporadic adrenocortical tumors. Thirty-eight tumors were classified as adenomas whereas 17 were carcinomas. GIPR and LHCGR expression were analyzed by real-time PCR and normal human pancreatic and testicular tissue samples were used as positive controls. Mean expression values were determined by fold increase in comparison with a normal adrenal pool. GIPR mRNA levels were significantly higher in adrenocortical carcinomas than in adenomas from both pediatric and adult groups. LHCGR expression was similar in both carcinomas and adenomas from the pediatric group but significantly lower in carcinomas than in adenomas from the adult group (median 0.06 and 2.3 respectively, P<0.001). GIPR was detected by immunohistochemistry in both pediatric and adult tumors. Staining and real-time PCR results correlated positively only when GIPR mRNA levels were increased at least two-fold in comparison with normal adrenal expression levels. In conclusion, GIPR overexpression was observed in pediatric and adult adrenocortical tumors and very low levels of LHCGR expression were found in all adult adrenocortical carcinomas.
APA, Harvard, Vancouver, ISO, and other styles
43

Xu, Yufei, Yulin Chen, Niu Li, Xuyun Hu, Guoqiang Li, Yu Ding, Juan Li, Yiping Shen, Xiumin Wang, and Jian Wang. "Novel compound heterozygous variants in the LHCGR gene identified in a subject with Leydig cell hypoplasia type 1." Journal of Pediatric Endocrinology and Metabolism 31, no. 2 (January 26, 2018): 239–45. http://dx.doi.org/10.1515/jpem-2016-0445.

Full text
Abstract:
Abstract Background: Leydig cell hypoplasia (LCH) is a rare disease and one of the causes of male disorder of sexual differentiation (DSD). Inactivating mutations in the luteinizing hormone/chorionic gonadotropin receptor (LHCGR) gene account for the underlying LCH pathogenicity. This study aimed to analyze the clinical presentation and diagnosis as well as highlight the molecular characteristics of a subject with LCH type 1. Case presentation: Clinical data were collected from the subject and analyzed. Next generation sequencing of the immediate family pedigree using peripheral blood genomic DNA was performed, and the relevant mutations were verified with Sanger sequencing. We describe the case of a 5-year-old patient with DSD, presenting with a lateral inguinal hernia accompanied by abnormal hormone tests. The genetic analysis revealed novel compound heterozygous variants in the LHCGR gene, including a splice site mutation (c.681-1 G>A) and a frameshift variant (c.1582_1585del ATAT, p.Ile528*). Conclusions: We identified novel compound heterozygous variants in the LHCGR gene, and expanded the genotype-phenotype correlation spectrum of LHCGR variants.
APA, Harvard, Vancouver, ISO, and other styles
44

Cheemakurthi, Ravi Krishna, Gottumukkala Achyuta Rama Raju, Thota Sivanaryana, Kalagara Madan, Kota Murali Krishna, and Godi Sudhakar. "Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response." F1000Research 4 (March 18, 2015): 72. http://dx.doi.org/10.12688/f1000research.6137.1.

Full text
Abstract:
The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.
APA, Harvard, Vancouver, ISO, and other styles
45

Potorac, Iulia, Ashutosh Trehan, Kamila Szymańska, Julie Fudvoye, Albert Thiry, Ilpo Huhtaniemi, Adrian F. Daly, Albert Beckers, Anne-Simone Parent, and Adolfo Rivero-Müller. "Compound heterozygous mutations in the luteinizing hormone receptor signal peptide causing 46,XY disorder of sex development." European Journal of Endocrinology 181, no. 2 (August 2019): K11—K20. http://dx.doi.org/10.1530/eje-19-0170.

Full text
Abstract:
Testosterone production by the fetal testis depends on a functional relationship between hCG and the LH/chorionic gonadotropin receptor (LHCGR). Failure of the receptor to correctly respond to its ligand leads to impaired sexual differentiation in males. A phenotypically female patient with pubertal delay had a 46,XY karyotype and was diagnosed with 46,XY disorder of sex development (DSD). Novel compound heterozygous LHCGR mutations were found in the signal peptide: a duplication p.L10_Q17dup of maternal origin, and a deletion (p.K12_L15del) and a p.L16Q missense mutation of paternal origin. cAMP production was very low for both the deletion and duplication mutations and was halved for the missense mutant. The duplication and missense mutations were both expressed intracellularly, but at very low levels at the cell membrane; they were most likely retained in the endoplasmic reticulum. The deletion mutant had a very limited intracellular expression, indicating impaired biosynthesis. There was reduced expression of all three mutants, which was most marked for the deletion mutation. There was also decreased protein expression of all three mutant receptors. In the deletion mutation, the presence of a lower-molecular-weight band corresponding to LHCGR monomer, probably due to lack of glycosylation, and a lack of bands corresponding to dimers/oligomers suggests absent ER entry. This novel case of 46,XY DSD illustrates how different LHCGR signal peptide mutations led to complete receptor inactivation by separate mechanisms. The study underlines the importance of specific regions of signal peptides and expands the spectrum of LHCGR mutations.
APA, Harvard, Vancouver, ISO, and other styles
46

Zhang, Zhiwei, Shuk-Wa Lau, Lingling Zhang, and Wei Ge. "Disruption of Zebrafish Follicle-Stimulating Hormone Receptor (fshr) But Not Luteinizing Hormone Receptor (lhcgr) Gene by TALEN Leads to Failed Follicle Activation in Females Followed by Sexual Reversal to Males." Endocrinology 156, no. 10 (May 20, 2015): 3747–62. http://dx.doi.org/10.1210/en.2015-1039.

Full text
Abstract:
Gonadotropins are primary hormones that control vertebrate reproduction. In a recent study, we analyzed the impacts of FSH and LH on zebrafish reproduction by disrupting FSH and LH-β genes (fshb and lhb) using transcription activator-like effector nuclease (TALEN) technology. Using the same approach, we successfully deleted FSH and LH receptor genes (fshr and lhcgr) in the present study. In contrast to the deficiency of its cognate ligand FSH, the fshr-deficient females showed a complete failure of follicle activation with all ovarian follicles arrested at the primary growth-previtellogenic transition, which is the marker for puberty onset in females. Interestingly, after blockade at the primary growth stage for varying times, all females reversed to males, and all these males were fertile. In fshr-deficient males, spermatogenesis was normal in adults, but the initiation of spermatogenesis in juveniles was retarded. In contrast to fshr, the deletion of the lhcgr gene alone caused no obvious phenotypes in both males and females; however, double mutation of fshr and lhcgr resulted in infertile males. In summary, our results in the present study showed that Fshr was indispensable to folliculogenesis and the disruption of the fshr gene resulted in a complete failure of follicle activation followed by masculinization into males. In contrast, lhcgr does not seem to be essential to zebrafish reproduction in both males and females. Neither Fshr nor Lhcgr deficiency could phenocopy the deficiency of their cognate ligands FSH and LH, which is likely due to the fact that Fshr can be activated by both FSH and LH in the zebrafish.
APA, Harvard, Vancouver, ISO, and other styles
47

Ponomarenko, Ponomarenko I. V., Polonikov A. V. Polonikov, and Churnosov M. I. Churnosov. "POLYMORPHIC LOCI OF THE LHCGR GENE ARE ASSOCIATED WITH THE DEVELOPMENT OF UTERINE LEIOMYOMA." Akusherstvo i ginekologiia 10_2018 (October 31, 2018): 86–91. http://dx.doi.org/10.18565/aig.2018.10.86-91.

Full text
APA, Harvard, Vancouver, ISO, and other styles
48

Jeong, Hwal, Hae Lee, and Jin Hwang. "LHCGR Gene Analysis in Girls with Non-Classic Central Precocious Puberty." Experimental and Clinical Endocrinology & Diabetes 127, no. 04 (March 5, 2018): 234–39. http://dx.doi.org/10.1055/s-0043-125067.

Full text
Abstract:
Abstract Background Luteinizing hormone (LH) is a useful parameter in diagnosing precocious puberty. The pubertal response of serum LH to a GnRH stimulation test is varied, and clinical symptoms of precocious puberty are sometimes disproportionate with serum LH concentrations. Many patients present in a state of precocious puberty that advances rapidly, but the post-GnRH peak LH remains prepubertal. LH receptor mutations are suspected of involvement in the non-classic type of central precocious puberty (CPP). Objective To examine the association between LHCGR polymorphism and non-classic CPP in subjects exhibiting a peak LH<5 IU/L on a GnRH stimulation test. Methods: In total, 102 girls with non-classic CPP and 100 normal adult women were enrolled. All subjects underwent LHCGR gene analysis by the Sanger method, and patients and controls were compared. Auxological data and gonadotropin concentrations were analyzed in the 102 patients. Of these patients, 75 completed GnRH agonist treatment, and the treatment outcomes were analyzed. Results A total of seven variants were identified, including two missense mutations (g.48698754 G/A and g.48688613 G/A) that were found in the patient group (no patients contained both mutations). In silico analysis of these missense mutations suggested the possibility of damaging the LHCGR. However, no significant association was found between the identified LHCGR variants and non-classic CPP. GnRH agonist treatment decreased bone age advancement and increased predicted adult height. Conclusions LHCGR gene polymorphisms do not appear to be a major causative factor for the relatively low concentration of LH in patients with non-classic CPP. GnRH agonist treatment improved clinical parameters in these patients.
APA, Harvard, Vancouver, ISO, and other styles
49

Yarcheski, Adela, Noreen E. Mahon, and Thomas J. Yarcheski. "Psychometrics of the Laffrey Health Conception Scale for Adolescents." Journal of Nursing Measurement 13, no. 1 (January 2005): 65–76. http://dx.doi.org/10.1891/jnum.2005.13.1.65.

Full text
Abstract:
The purposes of this methodological study were to factor analyze the Laffrey Health Conception Scale (LHCS) and to assess construct validity of the instrument with early adolescents. The final sample consisted of 230 early adolescents, aged 12 to 14, who responded to instrument packets in classrooms in an urban middle school. Data obtained on the LHCS were subjected to principal components factor analysis with oblique rotation. A two-factor solution was accepted, which is consistent with early adolescents’ conceptions of health. Factor I was labeled Wellness and Factor II was labeled Clinical Health. A higher order factor analysis yielded one factor with 26 items, labeled the LHCS for Early Adolescents. The 26-item LHCS had a coefficient alpha of .95. Construct validity was assessed by testing three theoretical propositions, which significantly linked health conception to social support, self-esteem, and positive health practices. The findings indicate that the LHCS is a reliable and valid measure of health conceptions in early adolescents. Results also offer flexibility to researchers interested in testing theory involving the constructs of the definition of health, wellness, and clinical health in early adolescents.
APA, Harvard, Vancouver, ISO, and other styles
50

Boufermes, Radia, Mansouria Belhocine, Zaina Amirat, and Farida Khammar. "Assessment of Testicular Lhcgr mRNA Expression Correlated with Testis and Seminal Vesicle Activities in the Libyan jird (Meriones libycus, Rodentia: Muridae) during Breeding Season Compared with Nonbreeding Season." Animals 11, no. 2 (January 27, 2021): 320. http://dx.doi.org/10.3390/ani11020320.

Full text
Abstract:
The Libyan jird (Meriones libycus, 1823) is a wild desert rodent that is a seasonal breeder species adapted to breed when the environmental conditions can satisfy the energy and hydrous requirements of pregnant and nursing females to ensure that births occur at the most favorable time of the year. We assessed gene expression of testicular luteinizing hormone receptor (Lhcgr) correlated to testis activity. The expression of Lhcgr was evaluated using quantitative Real Time-Polymerase Chain Reaction (qRT-PCR and the testis activity by a histological method in adult male Libyan jirds during the nonbreeding and breeding seasons. Our results showed that Lhcgr mRNA expression increased in autumn during the nonbreeding season and decreased in spring during the breeding season. This expression varied in contrast to testicular structure or function and plasma testosterone levels. These results help to elucidate this desert rodent’s seasonal sexual activity, which is correlated with central regulation.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the bibliographies on the topic 'LHCSR' for other source types:
Dissertations / Theses
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography