Academic literature on the topic 'LHCGR gene'

ABSTRACT Restriction fragment length polymorphisms were identified in sheep and deer using ovine cDNA probes for the FSH receptor (FSHR) and the LH receptor (LHCGR). FSHR and LHCGR were closely linked in sheep with no recombinants and neither receptor was linked to the Booroola fecundity gene (FecB). Both receptors were also closely linked in deer at a map distance of 3·3 cM. Linkage between the receptor genes assigns FSHR to sheep chromosome 3. Sequence analysis showed that the mammalian LHCGRs and FSHRs are more similar to each other than to mammalian TSH receptor (TSHR). Taken together, these data suggest that TSHR and the LHCGR/FSHR arose from a common ancestral gene by a process of chromosomal duplication. Subsequent duplication of the region containing the LH/FSH receptor and functional divergence could have given rise to the two gonadotrophin receptors present in mammals today.

During hormonally induced ovarian follicle growth, granulosa cell proliferation increases and returns to baseline prior to the administration of an ovulatory stimulus. Several key genes appear to follow a similar pattern, including the luteinizing hormone receptor (LHCGR), suggesting an association between cell cycle progression and gene expression. The expression of LHCGR mRNA in granulosa cells isolated from immature rats and treated in culture with FSH increased in a time-dependent manner, whereas administration of the cell cycle inhibitor mimosine completely suppressed expression. Although forskolin was able to induce luteinization in cells treated with mimosine, human chorionic gonadotropin had no effect, indicating the functional loss of LHCGR. The effects of mimosine on cell cycle progression and LHCGR mRNA expression were reversible within 24 h of mimosine removal. Cell cycle inhibition did not alter the stability of LHCGR mRNA, indicating that the primary effect was at the transcriptional level. To determine whether the relationship between LHCGR expression and cell cycle were relevant in vivo, immature rats were given a bolus of PMSG, followed by a second injection of either saline or PMSG 24 h later to augment levels of proliferation. The expression of LHCGR mRNA was elevated in the ovaries of animals receiving a supplement of PMSG. Mimosine also blocked cell cycle progression and LHCGR mRNA expression in macaque granulosa cells isolated following controlled ovarian stimulation cycles and in two different mouse Leydig tumor lines. These data collectively indicate that LHCGR mRNA is expressed as a function of the passage of cells across the G1-S phase boundary.

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

BACKGROUND: Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders of women in the childbearing period. However, its pathophysiology is still unclear. Certain polymorphisms of the luteinizing hormone/choriogonadotropin receptor (LHCGR) genes may lead to changes in the bioactivity of this hormone. The important functional role of LHCGR in the metabolism of androgen and ovulation, the LHCGR gene variant, may be related to the risk of PCOS. AIM: The aim of this study was to evaluate the association between LHCGR Ins18LQ gene polymorphism and PCOS. METHODS: A case–control study was performed in women with PCOS and non-PCOS from May 2019 to October 2019 in HFC IVF Center. We included 50 women with PCOS and 50 healthy controls. Polymorphism of the LHCGR (ins18LQ) gene was genotyped using polymerase chain reaction-restriction fragment length polymorphism. RESULTS: From this study, we found that there was no significant difference in the proportion of ages between the groups (p > 0.05). There were significant differences in the characteristics of body mass index, FSH level, LH level, and LH/FSH ratio between the PCOS and control groups (p < 0.05). We also found that the proportion of heterozygote variant non-ins/ins was higher in the PCOS group compared to the control group, but there was no significant difference between the polymorphisms of the non-ins and non-nonins variants between the PCOS and control groups (p = 0.269). The frequency of ins alleles was higher in the PCOS group compared to the control group. CONCLUSION: There was no significant association between LHCGR ins18LQ gene polymorphism and PCOS.

Abstract Background: Leydig cell hypoplasia (LCH) is a rare disease and one of the causes of male disorder of sexual differentiation (DSD). Inactivating mutations in the luteinizing hormone/chorionic gonadotropin receptor (LHCGR) gene account for the underlying LCH pathogenicity. This study aimed to analyze the clinical presentation and diagnosis as well as highlight the molecular characteristics of a subject with LCH type 1. Case presentation: Clinical data were collected from the subject and analyzed. Next generation sequencing of the immediate family pedigree using peripheral blood genomic DNA was performed, and the relevant mutations were verified with Sanger sequencing. We describe the case of a 5-year-old patient with DSD, presenting with a lateral inguinal hernia accompanied by abnormal hormone tests. The genetic analysis revealed novel compound heterozygous variants in the LHCGR gene, including a splice site mutation (c.681-1 G>A) and a frameshift variant (c.1582_1585del ATAT, p.Ile528*). Conclusions: We identified novel compound heterozygous variants in the LHCGR gene, and expanded the genotype-phenotype correlation spectrum of LHCGR variants.

Background/Aims: Physiological role of luteinizing hormone (LH) and its receptor (LHCGR) in adrenal remains unknown. In inhibin-α/Simian Virus 40 T antigen (SV40Tag) (inhα/Tag) mice, gonadectomy-induced (OVX) elevated LH triggers the growth of transcription factor GATA4 (GATA4)-positive adrenocortical tumors in a hyperplasia-adenoma-adenocarcinoma sequence. Methods: We investigated the role of LHCGR in tumor induction, by crossbreeding inhα/Tag with Lhcgr knockout (LuRKO) mice. By knocking out Lhcgr and Gata4 in Cα1 adrenocortical cells (Lhcgr-ko, Gata4-ko) we tested their role in tumor progression. Results: Adrenal tumors of OVX inhα/Tag mice develop from the hyperplastic cells localized in the topmost layer of zona fasciculata. OVX inhα/Tag/LuRKO only developed SV40Tag positive hyperplastic cells that were GATA4 negative, cleaved caspase-3 positive and did not progress into adenoma. In contrast to Lhcgr-ko, Gata4-ko Cα1 cells presented decreased proliferation, increased apoptosis, decreased expression of Inha, SV40Tag and Lhcgr tumor markers, as well as up-regulated adrenal- and down-regulated sex steroid gene expression. Both Gata4-ko and Lhcgr-ko Cα1 cells had decreased expression of steroidogenic genes resulting in decreased basal progesterone production. Conclusion: Our data indicate that LH/LHCGR signaling is critical for the adrenal cell reprogramming by GATA4 induction prompting adenoma formation and gonadal-like phenotype of the adrenocortical tumors in inhα/Tag mice.

Abstract Background Luteinizing hormone (LH) is a useful parameter in diagnosing precocious puberty. The pubertal response of serum LH to a GnRH stimulation test is varied, and clinical symptoms of precocious puberty are sometimes disproportionate with serum LH concentrations. Many patients present in a state of precocious puberty that advances rapidly, but the post-GnRH peak LH remains prepubertal. LH receptor mutations are suspected of involvement in the non-classic type of central precocious puberty (CPP). Objective To examine the association between LHCGR polymorphism and non-classic CPP in subjects exhibiting a peak LH<5 IU/L on a GnRH stimulation test. Methods: In total, 102 girls with non-classic CPP and 100 normal adult women were enrolled. All subjects underwent LHCGR gene analysis by the Sanger method, and patients and controls were compared. Auxological data and gonadotropin concentrations were analyzed in the 102 patients. Of these patients, 75 completed GnRH agonist treatment, and the treatment outcomes were analyzed. Results A total of seven variants were identified, including two missense mutations (g.48698754 G/A and g.48688613 G/A) that were found in the patient group (no patients contained both mutations). In silico analysis of these missense mutations suggested the possibility of damaging the LHCGR. However, no significant association was found between the identified LHCGR variants and non-classic CPP. GnRH agonist treatment decreased bone age advancement and increased predicted adult height. Conclusions LHCGR gene polymorphisms do not appear to be a major causative factor for the relatively low concentration of LH in patients with non-classic CPP. GnRH agonist treatment improved clinical parameters in these patients.

Our previous genome-wide association study identified LH/choriogonadotropin receptor (LHCGR) as a susceptibility gene for polycystic ovary syndrome (PCOS). The objective of this study was to determine whether the genetic or epigenetic components associated with LHCGR participate in the pathogenesis of PCOS. The exons and flanking regions of LHCGR were sequenced from 192 women with PCOS, and no novel somatic mutations were identified. In addition, the methylation statuses of 6 cytosine-phosphate-guanine (CpG) sites in the promoter region of LHCGR were measured by pyrosequencing using peripheral blood cells from 85 women with PCOS and 88 control women. We identified 2 hypomethylated sites, CpG −174 (corrected P = .018) and −111 (corrected P = .006). Bisulfite sequencing then was performed to replicate these findings and detect additional CpG sites in the promoter. CpG +17 was significantly hypomethylated in women with PCOS (corrected P = .02). Methylation statuses were further evaluated using granulosa cells (GCs), and the region described was hypomethylated as a whole (P = .004) with 8 significantly hypomethylated sites (CpG −174, −148, −61, −43, −8, +10, +17, and +20). Transcription of LHCGR was elevated in women with PCOS compared with that in control women (P &lt; .01). These findings were consistent with the decreased LHCGR methylation status associated with PCOS. The tendency of LHCGR to be hypomethylated across different tissues and its corresponding expression level suggest that hypomethylation of LHCGR is a potential mechanism underlying susceptibility to PCOS. Further studies are needed to evaluate whether a causal relationship exists between LHCGR methylation status and PCOS.

Abstract Genome-wide association studies identified loci associated with polycystic ovary syndrome (PCOS), including those near the LH receptor gene (LHCGR), a clathrin-binding protein (DENND1A) that functions as a guanine nucleotide exchange factor, and the gene encoding RAB5B, a GTPase involved in vesicular trafficking. We proposed that these three PCOS loci could be assembled into a functional network that contributes to altered gene expression in theca cells, resulting in increased androgen synthesis. The functional significance of this network was supported by our discovery that a truncated protein splice variant of the DENND1A gene, termed DENND1A.V2, is elevated in PCOS theca cells, and that forced expression of DENND1A.V2 in normal theca cells increased CYP11A1 and CYP17A1 expression and androgen synthesis, a hallmark of PCOS. In this study, we demonstrate the colocalization of LHCGR, DENND1AV.2, and RAB5B proteins in various cellular compartments in normal and PCOS theca cells by immunofluorescence. Human chorionic gonadotropin and forskolin stimulation was shown to affect the cytoplasmic distribution of LHCGR, DENND1A.V2, and RAB5B. DENND1A.V2 accumulated in the nuclei of the theca cells. Moreover, PCOS theca cells, following forskolin treatment, had a significantly greater relative abundance of nuclear DENND1A.V2. RAB5B also accumulated in the nuclei of PCOS theca cells treated with forskolin. In contrast, LHCGR did not enter the nucleus. This cytological evidence, and the previously reported increase in androgen biosynthesis with forced expression of DENND1A.V2 in normal theca cells, raises the possibility that DENND1A.V2 and RAB5B participate in increasing transcription of genes involved in androgen synthesis.

Gonadotropins are primary hormones that control vertebrate reproduction. In a recent study, we analyzed the impacts of FSH and LH on zebrafish reproduction by disrupting FSH and LH-β genes (fshb and lhb) using transcription activator-like effector nuclease (TALEN) technology. Using the same approach, we successfully deleted FSH and LH receptor genes (fshr and lhcgr) in the present study. In contrast to the deficiency of its cognate ligand FSH, the fshr-deficient females showed a complete failure of follicle activation with all ovarian follicles arrested at the primary growth-previtellogenic transition, which is the marker for puberty onset in females. Interestingly, after blockade at the primary growth stage for varying times, all females reversed to males, and all these males were fertile. In fshr-deficient males, spermatogenesis was normal in adults, but the initiation of spermatogenesis in juveniles was retarded. In contrast to fshr, the deletion of the lhcgr gene alone caused no obvious phenotypes in both males and females; however, double mutation of fshr and lhcgr resulted in infertile males. In summary, our results in the present study showed that Fshr was indispensable to folliculogenesis and the disruption of the fshr gene resulted in a complete failure of follicle activation followed by masculinization into males. In contrast, lhcgr does not seem to be essential to zebrafish reproduction in both males and females. Neither Fshr nor Lhcgr deficiency could phenocopy the deficiency of their cognate ligands FSH and LH, which is likely due to the fact that Fshr can be activated by both FSH and LH in the zebrafish.

Polycystic ovary syndrome (PCOS) is the leading cause of anovulatory infertility and the most common endocrinopathy of women of reproductive age. Genome-wide association studies (GWAS) identified a number of loci associated PCOS in different ethnic populations, including women with Asian and European ancestry. Replication studies have confirmed some of these associations. Among the loci identified are those located near the LH receptor gene (LHCGR), a clathrin-binding protein gene (DENND1A) that also functions as a guanine nucleotide exchange factor, and the gene encoding RAB5B, a GTPase and protein involved in vesicular trafficking. The functional significance of one of these GWAS candidates (DENND1A) was supported by our discovery that a truncated protein splice variant of DENND1A termed DENND1A.V2, is elevated in PCOS theca cells, and that forced expression of DENND1A.V2 in normal theca cells increased CYP11A1 and CYP17A1 expression and androgen synthesis, a hallmark of PCOS. We previously proposed that the PCOS GWAS loci could be assembled into a functional network that contributes to altered gene expression in ovarian theca cells, resulting in increased androgen synthesis. Here we demonstrate the localization of LHCGR, DENND1AV.2 and RAB5B proteins in various cellular compartments in normal and PCOS theca cells. hCG and forskolin stimulation affects the distribution and co-localization of DENND1A.V2 and RAB5B in various cellular compartments This cytological evidence supports our PCOS gene network concept, and raises the intriguing possibility that LHCGR activation, via a cAMP-mediated process, promotes the translocation of DENND1A.V2 and RAB5B-containing vesicles from the PCOS theca cell cytoplasm into the nucleus, resulting in increased transcription of genes involved in androgen synthesis.

Introdução: Os receptores do peptídeo insulinotrópico dependente de glicose (GIPR) e do hormônio luteinizante (LHCGR) são receptores acoplados à proteína G com amplo padrão de expressão tecidual. A expressão anômala destes receptores tem sido descrita em casos de hiperplasia adrenal macronodular independente de ACTH (AIMAH) e em alguns adenomas, resultando em aumento da secreção hormonal (cortisol, andrógenos e aldosterona) pelo cortex adrenal. O papel destes receptores em outras formas de hiperplasia, como a doença adrenocortical nodular pigmentosa primária (PPNAD), aumento da adrenal associado à neoplasia endócrina múltipla tipo 1 (MEN1), e em carcinoma do córtex adrenal tem sido pouco investigado; sendo assim, considera-se relevante estudar a expressão destes receptores nos pacientes com tumores adrenocorticais esporádicos, nos pacientes com AIMAH, PPNAD e aumento adrenal associado à MEN1. Objetivos: 1) Caracterização molecular dos casos de neoplasia endócrina múltipla tipo 1 e PPNAD: pesquisa de mutações dos genes MEN1 e PRKAR1A e análise da perda de heterozigose (LOH) destes genes no tecido adrenal destes pacientes. 2) Quantificar a expressão do GIPR e do LHCGR em tecido adrenocortical normal, tumoral, hiperplásico e correlacionar a expressão destes com a classificação histológica dos tumores adrenocorticais. Pacientes: 55 pacientes (30 adultos) com tumores adrenocorticais (37 adenomas e 18 carcinomas); 7 pacientes com AIMAH, 4 com MEN1, 1 com PPNAD e tecidos controles (adrenal; testículo e pâncreas). Métodos: extração de DNA genômico, RNA e síntese de DNA complementar (cDNA); amplificação por PCR das regiões codificadoras dos genes MEN1 e PRKAR1A seguida por seqüenciamento automático. Pesquisa de LOH pela amplificação de microssatélites por PCR e análise pelo programa GeneScan. Quantificação da expressão do GIPR e do LHCGR por PCR em tempo real pelo método TaqMan e estudo de imunohistoquímica para GIPR nos tumores adrenocorticais. Resultados: identificação de 3 mutações (893+ 1G>A, W183X e A68fsX118) e dois polimorfirmos (S145S e D418D) no gene MEN1 e uma mutação (Y21X) no PRKAR1A. Ausência de LOH nos tecidos adrenais estudados. A expressão do GIPR e do LHCGR foi identificada em tecidos adrenais normais, tumorais e hiperplásicos. O nível de expressão do GIPR foi mais elevado nos tumores adrenocorticais malignos que nos benignos tanto no grupo pediátrico (mediana= 18,1 e 4,6, respectivamente; p <0,05), quanto no grupo adulto (mediana = 4,8 e 1,3 respectivamente; p <0,001). O nível de expressão do LHCGR, no grupo pediátrico, foi elevado tanto nos tumores benignos quanto nos malignos (mediana= 6,4 e 4,3, respectivamente). No grupo adulto os níveis de expressão deste receptor foram extremamente baixos nos tumores malignos em relação aos benignos (mediana= 0,06 e 2,3, respectivamente; p <0,001). A imunohistoquímica para o GIPR foi variável e não correlacionada à expressão do gene GIPR. Não houve diferença nos níveis de expressão do GIPR e do LHCGR nas hiperplasias do córtex adrenal. Conclusões: a presença de LOH e mutação em heterozigose composta do gene MEN1 e do PRKAR1A foram afastadas como mecanismos responsáveis pelo aumento adrenal tanto nos pacientes com MEN1 como no paciente com PPNAD. A hiperexpressão de GIPR está associada a malignidade nos tumores adrenocorticais nos grupos adulto e pediátrico e a baixa expressão de LHCGR está associada a malignidade nos tumores adrenocorticais somente no grupo adulto.
Introduction: The glucose- dependent insulinotropic peptide receptor (GIPR) and luteinizing hormone receptor (LHCGR) are G-protein coupled receptors with a wide tissue expression pattern. The aberrant expression of these receptors has been described in cases of ACTH-independent macronodular adrenal hyperplasia (AIMAH) and in some adenomas, resulting in the increase of adrenal cortex hormonal secretion (cortisol, androgens and aldosterone). The role of these receptors in other forms of adrenocortical hyperplasia, such as primary pigmented nodular adrenocortical disease (PPNAD), adrenal enlargement associated with multiple endocrine neoplasia type 1 (MEN1), and adrenocortical carcinoma has been scarcely investigated. Thus, the study of the expression of these receptors in patients with sporadical adrenocortical tumors, AIMAH, PPNAD and adrenal enlargement associated to MEN1 was considered important. Objectives: 1) Molecular study in patients with multiple endocrine neoplasia type 1 and PPNAD: mutation screening of MEN1 and PRKAR1A genes and analysis of the loss of heterozygosis (LOH) of these genes in the adrenal lesions of these patients. 2) To quantify the GIPR and LHCGR expression, in normal, tumor and hyperplasic tissue and to correlate the expression of these receptors with the adrenocortical tumor histology. Patients: 55 patients (30 adults) with adrenocortical tumors (37 adenomas and 18 carcinomas); 7 patients with AIMAH, 4 with MEN1, 1 with PPNAD and control tissue (adrenal, testis and pancreas). Methods: Extraction of genomic DNA, RNA and synthesis of complementary DNA (cDNA); PCR-amplification of the coding regions of MEN1 and PRKAR1A, followed by direct sequencing. LOH study using polymorphic marker amplification by PCR and GeneScan software analysis. Quantification of GIPR and LHCGR expression using realtime PCR -TaqMan method and GIPR immunohistochemistry study in adrenocortical tumors. Results: Identification of 3 mutations (893+ 1G>A, W183X and A68fsX118) and two polymorphic alterations (S145S and D418D) in MEN1 and a mutation (Y21X) in the PRKAR1A gene; LOH was not identified in adrenal tissue. The GIPR and LHCGR expression was identified in normal, tumor and hyperplasic adrenal tissues; the GIPR expression level was more elevated in malignant tumors compared to benign tumors in pediatric (median = 18.1 and 4.6, respectively; p <0.05) and adult patients (median = 4.8 and 1.3 respectively; p <0.001). The LHCGR expression in pediatric patients was elevated in benign as well as in malignant tumors (median = 6.4 and 4.3, respectively). In the adult group, the expression level of these receptors was extremely low in malignant tumors in relation to benign ones (median = 0.06 and 2.3, respectively; p <0.001). The GIPR immunohistochemistry was variable and did not correlate with GIPR gene expression. No difference between GIPR and LHCGR expression levels was observed in the different forms of hyperplasia. Conclusions: The presence of LOH and mutations in compound heterozygosis of MEN1 and PRKAR1A genes were ruled out as the mechanisms responsible for the adrenal enlargement in patients with multiple endocrine neoplasia type 1. GIPR overexpression is associated with malignant adrenocortical tumors in the adult and pediatric patients and low LHCGR expression is associated with malignant adrenocortical tumors only in the adult patients.