To see the other types of publications on this topic, follow the link: L 1506.
Journal articles on the topic 'L 1506'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'L 1506.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Oyanagi, Eri, Hiromi Yano, Yasuko Kato, Hirofumi Fujita, Kozo Utsumi, and Junzo Sasaki. "L-Carnitine suppresses oleic acid-induced membrane permeability transition of mitochondria." Cell Biochemistry and Function 26, no. 7 (October 2008): 778–86. http://dx.doi.org/10.1002/cbf.1506.
Full text
2
Carriazo Ruiz, José Ramón. "Terminología histórica y vocabulario marcado en el Libro de la expedición a la Especiería (1506/1508)." Cuadernos del Instituto Historia de la Lengua, no. 12 (January 12, 2023): 37–64. http://dx.doi.org/10.58576/cilengua.vi12.38.
Full textAbstract:
Este ensayo se estructura en dos partes –descripción delmanuscrito con signatura «Contratación, 3251, L. 1», conservado en lasección 3, Casa de Contratación, del Archivo General de Indias de Sevilla,y análisis individual de dieciocho formas documentadas tempranamenteen castellano en el manuscrito descrito– y tiene por objetivosprincipales dos: describir la etimología e historia lingüística del vocabularioseleccionado y relacionarlo con las circunstancias sociolingüísticas, decontacto entre lenguas y registros diversos, que rodearon su redaccióndel manuscrito en el emporio hispalense a principios del Quinientos.
3
POPOVA IRIKOVA, Teodora, Spyridon KINTZIOS, Stanislava GROZEVA, and Velichka RODEVA. "Pepper (Capsicum annuum L.) anther culture: fundamentalresearch and practical applications." TURKISH JOURNAL OF BIOLOGY 40 (2016): 719–26. http://dx.doi.org/10.3906/biy-1506-79.
Full text
4
Pretell-Vásquez, Carla, Luis Márquez-Villacorta, Raúl Siche, and María Hayayumi-Valdivia. "Efecto del ozono y tiempo de almacenamiento sobre las características fisicoquímicas de espárrago verde (Asparagus officinalis L.) mínimamente procesado." Ciencia & Tecnología Agropecuaria 21, no. 3 (September 15, 2020): 2–16. http://dx.doi.org/10.21930/rcta.vol21_num3_art:1506.
Full textAbstract:
A nivel mundial, Perú es uno de los principales productores de espárrago verde (Asparagus officinalis L.); este es un vegetal altamente perecible debido a su elevada velocidad de respiración y metabolismo, por lo que es muy importante conservar las características de calidad en los turiones, motivo por el cual se evaluó el efecto del ozono gaseoso (0 a 10 ppm) y tiempo de almacenamiento (0 a 30 días) sobre la pérdida de peso, luminosidad, firmeza, contenido de clorofila y contenido de lignina. Se utilizó la metodología de superficie de respuesta, aplicando un diseño compuesto central rotable. Los resultados indicaron que existió influencia significativa de las variables independientes sobre las características fisicoquímicas estudiadas, así como una adecuada bondad de ajuste del modelo de regresión cuadrático. Mediante la técnica de superposición de contornos se determinó que las condiciones óptimas para la mayor retención de firmeza (11,42 N), contenido de clorofila (12,33 mg/100 g) y contenido de lignina (7 mg/100 g) correspondieron a 6,98 ppm de ozono gaseoso hasta los 30 días de almacenamiento, con adecuadas características de calidad en los turiones.
5
ERŞEN BAK, Funda, and Nesime MEREV. "Ecological wood anatomy of Fraxinus L. in Turkey (Oleaceae):intraspecific and interspecific variation." TURKISH JOURNAL OF BOTANY 40 (2016): 356–72. http://dx.doi.org/10.3906/bot-1506-43.
Full text
6
ALP, Şevket, Mustafa USTA, Hikmet Murat SİPAHİOĞLU, and Abdullah GÜLLER. "First report of “Candidatus Phytoplasma solani” on a newhost marigold (Tagetes erecta L.)." TURKISH JOURNAL OF AGRICULTURE AND FORESTRY 40 (2016): 311–18. http://dx.doi.org/10.3906/tar-1506-58.
Full text
7
Cervantes, Virginia, Vicente Arriaga, and Julia Carabias. "La problemática socioambiental e institucional de la reforestación en la Región de la Montaña, Guerrero, México." Botanical Sciences, no. 59 (April 27, 2017): 67. http://dx.doi.org/10.17129/botsci.1506.
Full textAbstract:
The authors analyze the causes that have prevented the successful operation of reforestation programs in the La Montaña region (Guerrero State), Mexico. They reviewed the various regional development programs which have taken place in the last six decades and which have included the implementation of reforestation programs as part of their activities. The authors conclude that the meagre success that has characterized the reforestation efforts at La Montaña is due to one or a combination of several of the following factors: l] reforestation objectives not directed towards the restoration of the environment, 2] programs based on a very small number of the species, 3] technical deficiencies in the selection of species and sites for the plantations 4) small size of areas devoted to reforestation, 5] insufficient and intermittent funding for these programs, 6) lack of training of local peasant inhabitants and of institutional technicians, and 7) very limited social acceptance of reforestation programs.
8
Pawłowski, Zdzisław. "Ożywienie zmarłych w cyklu opowiadań o Eliaszu i Elizeuszu." Verbum Vitae 15 (January 14, 2009): 17–34. http://dx.doi.org/10.31743/vv.1506.
Full textAbstract:
The plot in the Elijah and Elisha cycle is based on the multilevel contest: between kings and prophets on a level of bistory, between drought and rain on a level of nature, between Baal, the god ofCanaanites and Yahweh, the God of Israel on a level of religion, and ultimately between death and life on a level of human existence. This last one is a main theme of two episodes in l Kings 17,8-24 and 2 Kings 4,8-37. In the first text, despite the life-sustaining miracle of inexhaustible supplies, the son of the widow from Zarephath, Baal's territory, dies. Thus it is no longer a question of finding water or food, or even a matter of preventing possible death from starvation. It is ratber a matter of overcoming actual death. Through Elijah's action of stretching bimself out upon the dead boy, he is restored to life and returned to his mother. In the second text there is no poor widow and ber son facing starvation, but a rich woman from Shunem with no children. Through Elisha's announcement she miraculously conceived and gave birth to son. However this child is bom only to die. With the death of the boy the real issue of the story is now: can the man of God revive the dead? The two stage action of the prophet results in the resuscitation of the boy. And again Yahweh, the God of Israel, appears to be the God of the living, not the God of the dead.
9
Guilardian, David. "L 'obituaire des grands chanoines du chapitre Sainte-Gudule de Bruxelles (1506): une première approche." Revue belge de philologie et d'histoire 74, no. 3 (1996): 695–705. http://dx.doi.org/10.3406/rbph.1996.4121.
Full text
10
Leroux, Virginie. "Les premières traductions de l’Iphigénie à Aulis d’Euripide, d’Érasme à Thomas Sébillet." Renaissance and Reformation 40, no. 3 (November 24, 2017): 243–64. http://dx.doi.org/10.33137/rr.v40i3.28743.
Full textAbstract:
En 1506, Érasme est le premier à traduire en latin des tragédies grecques entières, en l’occurrence deux tragédies d’Euripide, Hécube et Iphigénie à Aulis. S’il adopte pour l’Hécube une traduction vers à vers, il opte dans l’Iphigénie pour une traduction plus détaillée en veillant à produire dans la langue cible les effets de l’original. Dans son ouvrage sur L’Hécube d’Euripide en France, Bruno Garnier a montré comment la traduction latine d’Érasme a influencé la première traduction française de l’Hécube, attribuée à Guillaume Bochetel (1544). Cet article est consacré aux premières traductions de l’Iphigénie à Aulis et, en particulier, à celle de Thomas Sébillet qui se mesure à Érasme pour démontrer, contre Joachim Du Bellay, la capacité d’une traduction poétique à illustrer la langue française.
In 1506, Erasmus was the first person to translate complete Greek tragedies into Latin, in this case two tragedies by Euripides, Hecuba and Iphigenia at Aulis. Though he used a verse by verse translation for Hecuba, he opted in Iphigenia for a more detailed translation, taking care to reproduce in the target language the effects of the original. In his work on Euripides’ Hecuba in France, Bruno Garnier has shown how the Latin translation of Erasmus influenced the first French translation of Hecuba, attributed to Guillaume Bochetel (1544). This article addresses the first translations of Iphigenia at Aulis and in particular that of Thomas Sébillet. He pitted himself against Erasmus to demonstrate, contrary to Joachim Du Bellay, the capacity of a poetic translation to exemplify the French language.
11
MURATHAN, Zehra Tuğba, Mozhgan ZARIFIKHOSROSHAHI, and Nesibe Ebru KAFKAS. "Determination of fatty acids and volatile compounds in fruits of rosehip(Rosa L.) species by HS-SPME/GC-MS and Im-SPME/GC-MS techniques." TURKISH JOURNAL OF AGRICULTURE AND FORESTRY 40 (2016): 269–79. http://dx.doi.org/10.3906/tar-1506-50.
Full text
12
Nguir, Asma, Hajer Mabrouk, Wahiba Douki, Manel Ben Ismail, Hichem Ben Jannet, Guido Flamini, and M’hamed Ali Hamza. "Chemical composition and bioactivities of the essential oil from different organs of Ferula communis L. growing in Tunisia." Medicinal Chemistry Research 25, no. 3 (January 20, 2016): 515–25. http://dx.doi.org/10.1007/s00044-016-1506-1.
Full text
13
Karamanoğlu, Mehmet, Emre Birinci, Haci İsmail Kesik, and Alperen Kaymakcı. "Effect of treatment temperature on the initial performance of layers of water-based paints in heat-treated pine and beech wood." BioResources 17, no. 1 (January 11, 2022): 1494–506. http://dx.doi.org/10.15376/biores.17.1.1494-1506.
Full textAbstract:
Hardness, surface roughness, and adhesion strength were determined for water-based opaque paints applied to heat-treated wood material surfaces. For this purpose, Scotch pine (Pinus sylvestris L.) and beech (Fagus orientalis Lipsky) woods were used as experimental material. Specimens were subjected to heat treatment at 3 different temperatures (150, 180, and 210 °C) and 2 different periods (2 and 4 h) under laboratory conditions. Two-component water-based paints with commercial codes D17 and D45 were applied to the surfaces. The hardness, surface roughness, and adhesion strength values of painted samples were determined according to the applicable standards. The results showed that there were higher values of hardness and surface roughness of water-based paints in short-term heat treatment compared with long-term heat treatment. A general decrease in pine with D17 and D45 paints applied to the surfaces and in beech with D45 in adhesion strength was detected depending on the increasing heat treatment temperature and duration. An increase was observed in beech samples with D17 paint applied.
14
Denley, Peter. "Le Lauree dello Studio senese all'inizio del secolo XVI (1501–1506). By Giovanni Minnucci. (Quaderni di ‘Studi Senesi’, 55.) Pp. 152. Milan: Giuffrè, 1984. L. 13,000." Journal of Ecclesiastical History 37, no. 3 (July 1986): 496–97. http://dx.doi.org/10.1017/s0022046900021849.
Full text
15
Seo, Hee, Jae-Han Bae, Gayun Kim, Seul-Ah Kim, Byung Hee Ryu, and Nam Soo Han. "Suitability Analysis of 17 Probiotic Type Strains of Lactic Acid Bacteria as Starter for Kimchi Fermentation." Foods 10, no. 6 (June 21, 2021): 1435. http://dx.doi.org/10.3390/foods10061435.
Full textAbstract:
The use of probiotic starters can improve the sensory and health-promoting properties of fermented foods. This study aimed to evaluate the suitability of probiotic lactic acid bacteria (LAB) as a starter for kimchi fermentation. Seventeen probiotic type strains were tested for their growth rates, volatile aroma compounds, metabolites, and sensory characteristics of kimchi, and their characteristics were compared to those of Leuconostoc (Le.) mesenteroides DRC 1506, a commercial kimchi starter. Among the tested strains, Limosilactobacillus fermentum, Limosilactobacillus reuteri, Lacticaseibacillus rhamnosus, Lacticaseibacillus paracasei, and Ligilactobacillus salivarius exhibited high or moderate growth rates in simulated kimchi juice (SKJ) at 37 °C and 15 °C. When these five strains were inoculated in kimchi and metabolite profiles were analyzed during fermentation using GC/MS and 1H-NMR, data from the principal component analysis (PCA) showed that L. fermentum and L. reuteri were highly correlated with Le. mesenteroides in concentrations of sugar, mannitol, lactate, acetate, and total volatile compounds. Sensory test results also indicated that these three strains showed similar sensory preferences. In conclusion, L. fermentum and L. reuteri can be considered potential candidates as probiotic starters or cocultures to develop health-promoting kimchi products.
16
Grosjean, F., D. Bastianelli, A. Bourdillon, P. Cerneau, C. Jondreville, and C. Peyronnet. "Feeding value of pea (Pisum sativum, L.) 2. Nutritional value in the pig." Animal Science 67, no. 3 (December 1998): 621–25. http://dx.doi.org/10.1017/s1357729800033063.
Full textAbstract:
AbstractNineteen round white-feed peas (FP) varieties, six coloured-flowered peas (CP) varieties and four wrinkled white-flowered peas (WP) varieties were given to growing pigs in order to measure their feeding value. Mean values of energy apparent digestibility measured at the faecal level of FP, CP and WP were respectively 0·886, 0·812 and 0·823. Mean values for digestible energy were 16·34, 1506 and 15·60 M]l kg dry matter. Mean values of faecal apparent digestibility of protein were 0·840, 0·760 and 0·828. The lower energy and crude protein (CP) apparent digestibility of CP relative to FP can be explained by their higher fibre content and by the presence of condensed tannins whilst the lower energy and CP apparent digestibility in WP relative to FP can be explained by their higher fibre content, their lower starch content and their higher amylosel amylopectine ratio. Among the feed peas, there was no difference between peas with low trypsin inhibitor activity and peas with medium trypsin inhibitor activity.
17
Maleval, Maria do Amparo Tavares. "Gil Vicente e a arte de pregar: o Auto dos Mistérios da Virgem ou da Mofina Mendes." Revista do Centro de Estudos Portugueses 32, no. 47 (June 30, 2012): 163. http://dx.doi.org/10.17851/2359-0076.32.47.163-184.
Full textAbstract:
<p>Gil Vicente, considerado o ‘criador’ do teatro português, foi um grande conhecedor da arte de pregar medieval, que resultou da confluência da retórica clássica com a tradição exegeta e concionatória judaico-cristã. Chegou inclusive a escrever sermões sérios ou jocosos, mas sempre revestidos de caráter moralizante, como o ‘Sermão de Abrantes’, encomendado pela franciscana rainha D. Leonor, 1506. Em suas ‘moralidades’, como denominou as peças revestidas de caráter religioso, demonstrou claramente a utilização das técnicas e da finalidade da prédica, de doutrinação e conversão para uma vida virtuosa. Pretendemos observar, no ‘Auto dos Mistérios da Virgem’, que se popularizou como ‘Auto da Mofina Mendes’, re(a)presentado nas matinas do Natal de 1534 ao rei D. João III, os recursos retóricos que o aproximam do sermão, seu intuito de ensinar de forma agradável a doutrina e de fustigar os vícios da sociedade do seu tempo e do homem de todos os tempos.</p> <p>Considéré comme le ‘créateur’ du théâtre portugais, Gil Vicente fut un grand connaisseur de l’art médiéval de prêcher, au confluent de la rhétorique classique et de la tradition exégétique et concionatoire judéo-chrétiènne. Il a en outre écrit des sermons sérieux ou plaisantes, mais toujours revêtus d’un caractère moralisant, comme le ‘Sermão de Abrantes’, commandé par la reine franciscaine D. Leonor, en 1506. Dans ses ‘moralités’, comme il a dénommé les pièces à caractère religieux, il a démontré nettement l’utilisation des techniques et la finalité de la prédication, en tant que doctrine et conversion à une vie vertueuse. Nous avons l’intention d’observer, dans l’ ‘Auto dos Mistérios da Virgem’, plus connu comme l ‘Auto da Mofina Mendes’, représenté dans les matines du Noël de l’année 1534 au roi D. João III, les recours rhétoriques qui le rapprochent du sermon et comment s’y exprime le souci dagrémenter l’enseignement de la doctrine et de fustiger les vices de la société de son temps et de l’homme de tous les temps.</p>
18
De Nardi, Barbara, René Dreos, Lorenzo Del Terra, Chiara Martellossi, Elisa Asquini, Patrizia Tornincasa, Debora Gasperini, et al. "Differential responses of Coffea arabica L. leaves and roots to chemically induced systemic acquired resistance." Genome 49, no. 12 (December 2006): 1594–605. http://dx.doi.org/10.1139/g06-125.
Full textAbstract:
Coffea arabica is susceptible to several pests and diseases, some of which affect the leaves and roots. Systemic acquired resistance (SAR) is the main defence mechanism activated in plants in response to pathogen attack. Here, we report the effects of benzo(1,2,3)thiadiazole-7-carbothioic acid-s-methyl ester (BTH), a SAR chemical inducer, on the expression profile of C. arabica. Two cDNA libraries were constructed from the mRNA isolated from leaves and embryonic roots to create 1587 nonredundant expressed sequence tags (ESTs). We developed a cDNA microarray containing 1506 ESTs from the leaves and embryonic roots, and 48 NBS-LRR (nucleotide-binding site leucine-rich repeat) gene fragments derived from 2 specific genomic libraries. Competitive hybridization between untreated and BTH-treated leaves resulted in 55 genes that were significantly overexpressed and 16 genes that were significantly underexpressed. In the roots, 37 and 42 genes were over and underexpressed, respectively. A general shift in metabolism from housekeeping to defence occurred in the leaves and roots after BTH treatment. We observed a systemic increase in pathogenesis-related protein synthesis, in the oxidative burst, and in the cell wall strengthening processes. Moreover, responses in the roots and leaves varied significantly.
19
Komac, A., N. Gokcen, A. Yazici, and A. Cefle. "AB0794 Hopelessness in patients with ankylosing spondylitis." Annals of the Rheumatic Diseases 81, Suppl 1 (May 23, 2022): 1524.1–1524. http://dx.doi.org/10.1136/annrheumdis-2022-eular.1506.
Full textAbstract:
BackgroundAnkylosing spondylitis (AS) is a chronic inflammatory disease leading to loss of function that is strongly related to impaired psychological status. Therefore, depression and anxiety are frequently investigated in these patients (1). However, hopelessness, regarded as a valuable psychological factor characterized by negative expectations and negative emotional states, was not well studied in AS patients(2).ObjectivesThe aim of the study is to investigate the frequency of hopelessness in patients with AS and its relationship with clinical parameters and disease activity indices.MethodsThe study was designed as a prospective cross-sectional study. 113 AS patients were included in the study. Demographic data, clinical variables, laboratory results were recorded. Disease activity (ASDAS-CRP and ASDAS-ESR), patients’ functionality (BASFI, BASMI), enthesitis (Leeds enthesitis index) and quality of life (SF-36) were assessed. Hopelessness was evaluated by Beck hopelessness scale (BHS). The relation of BHS scores with the clinical variables was assessed. The strength of the correlations were regarded as very weak(0–0.19), weak(0.2–0.39), moderate(0.40–0.59), strong(0.6–0.79) and very strong(0.8-1). Multiple linear regression analysis was performed to find the association between BHS scores and other clinical variables.ResultsMinimal, mild, moderate, and severe hopelessness were observed in 46 (40.7%), 36 (31.9%), 22 (19.5%), and 9 (8.0%) patients, respectively. Disease duration (p=0.025), ASDAS-CRP (p=0.033), ASDAS-ESR (p=0.015), visual analogue scale (p=0.030), all SF-36 subscales (all p<0.025), BASFI (p=0.024), and BASMI (p=0.009) were statistically different among the groups. BHS scores were higher in patients with high and very high disease activity (p=0.027) (in pairwise comparison, inactive disease vs. high disease activity, p=0.035) (Figure 1). BHS scores showed weak correlation with ASDAS-CRP, ASDAS-ESR, visual analogue scale, BASMI, Leeds enthesitis index, and BASFI. Moreover, negative moderate correlations were detected between BHS scores and SF-36 subscales except social functioning and body pain, which were found weak correlation. In multiple linear regression analysis, BASMI-maximal intermalleolar distance, SF-36 energy, SF-36 mental health, and SF-36 general health were found associated with BHS scores (Table 1).Table 1.Multiple linear regression analysis to find predictors related to the Beck hopelessness scale scoresB95% CIpASDAS-CRP-0.063(-1.939) to 1.2820.687VAS-0.085(-0.722) to 0.3960.564BASMILateral spinal flexion0.311(-0.299) to 1.4790.191Tragus to wall distance0.157(-0.404) to 1.6020.239Modified Schober0.298(-0.114) to 1.3680.096Maximal intermalleolar distance0.2280.076 to 0.5570.010Cervical rotation0.092(-0.665) to 1.0850.635Total-0.730(-5.572) to 1.0420.177SF-36Physical function-0.024(-0.056) to 0.0460.840Role physical-0.114(-0.046) to 0.0170.364Role emotional-0.019(-0.029) to 0.0240.870Energy/fatigue-0.283(-0.125) to (-0.005)0.035Mental health-0.306(-0.142) to (-0.022)0.008Social functioning0.022(-0.033) to 0.0410.822Body pain0.182(-0.018) to 0.0860.192General health-0.344(-0.125) to (-0.030)0.002BASFI-0.085(-0.606) to 0.2480.408Figure 1.Beck hopelessness scale scores according to disease activity subgroupsConclusionHigher level of hopelessness is strongly related to higher disease activity in AS patients. Furthermore, higher BHS scores are negatively correlated with SF-36 subscales. Especially, lower energy and impaired mental health are associated with higher level of hopelessness.References[1]Zhang L, Wu Y, Liu S, Zhu W. Prevalence of Depression in Ankylosing Spondylitis: A Systematic Review and Meta-Analysis. Psychiatry Investig. 2019;16(8):565-574. doi:10.30773/pi.2019.06.05[2]Balsamo M, Carlucci L, Innamorati M, Lester D, Pompili M. Further Insights Into the Beck Hopelessness Scale (BHS): Unidimensionality Among Psychiatric Inpatients. Front Psychiatry. 2020;11:727. Published 2020 Jul 31. doi:10.3389/fpsyt.2020.00727Disclosure of InterestsNone declared
20
Gunu, A. S., and M. Musa. "Growth And Yield of Sorghum (Sorghum bicolor (L.) Moench) Varities in Sokoto Sudan Savanna of Nigeria." Journal of Applied Sciences and Environmental Management 25, no. 8 (November 30, 2021): 1513–18. http://dx.doi.org/10.4314/jasem.v25i8.35.
Full textAbstract:
Field trial was carried out during the 2019 rainy season (June to October) at the Dryland Teaching and Research Farm of the Faculty of Agriculture, Usmanu Danfodiyo University, Sokoto to determine the growth and yield of sorghum varieties in the study area. The treatments consisted of five (5) sorghum varieties (Samsorg 45, Samsorg 46, Janjari, Yartawa and Jardawa), the treatments were laid out in a Randomized Complete Block Design (RCBD) replicated three (3) times. Data were collected on the growth and yield of the crop. Janjari and Jardawa varieties were higher in plant height. Jardawa and Yartawa varieties were higher in number of leaves. Janjari and Yartawa varieties were higher in total dry weight. Janjari, Jardawa and Yartawa varieties were higher in harvest index. Yartawa variety was higher in leaf area, leaf area index and 1000-grain weight. Jardawa variety was higher in panicle length. Janjari variety was early in number of days to heading, flowering, and maturity and was higher in dry stalk weight. The grain yield (249 – 1506kg ha-1 ) was higher in Janjari and Yartawa varieties (1268 – 1506 kg ha-1). Based on the findings of this research, it could be concluded that Janjari and Yartawa varieties performed better than other varieties in the study area.
21
Prayoga, Nur Angga, Bambang Tri Rahardjo, and Tita Widjayanti. "KEANEKARAGAMAN JENIS SEMUT (HYMENOPTERA: FORMICIDAE) PADA EKOSISTEM TANAMAN TEBU PHT DAN KONVENSIONAL." Jurnal Hama dan Penyakit Tumbuhan 9, no. 3 (September 30, 2021): 78–84. http://dx.doi.org/10.21776/ub.jurnalhpt.2021.009.3.2.
Full textAbstract:
Pada budidaya tanaman tebu (Saccharum officinarium L.) seringkali terjadi hambatan sehingga dapat menurunkan hasil produksi, salah satunya ialah serangan hama. Semut (Hymenoptera: Formicidae) merupakan serangga musuh alami yang berperan sebagai predator. Tujuan dari penelitian ini yaitu untuk mengetahui jenis – jenis semut, peran, dan pengaruh perbedaan yang terdapat di ekosistem tanaman tebu PHT dan konvensional. Kegiatan penelitian ini dilaksanakan pada bulan Agustus – Oktober 2020. Tempat kegiatan pelaksanaan penelitian yaitu di Balai Penelitian Tanaman Pemanis dan Serat, Karangploso, Malang. Penelitian ini bersifat deskriptif kuantitatif dengan menggunakan metode Pitfall trap dan umpan tuna. Berdasarkan hasil penelitian semut yang ditemukan pada lahan pengamatan terdiri dari 4 subfamili dan 9 genus semut. Jumlah keseluruhan genus semut yang di dapat pada lahan PHT yaitu 1506 individu dan pada lahan Konvensional 1240 individu. Keanekaragaman pada lahan pengamatan dalam keadaan yang stabil dengan keanekaragaman dalam kategori sedang. Tingkat penyebaran jenis hampir merata. Kekayaan spesies pada kedua lahan rendah serta tidak ada spesies yang mendominasi pada lahan PHT dan konvensional. Peran semut yang ditemukan pada lahan pengamatan yaitu sebagai predator dan sebagai pencari makan (foragers).
22
Ely, C. M., K. M. Oddie, J. S. Litz, A. J. Rossomando, S. B. Kanner, T. W. Sturgill, and S. J. Parsons. "A 42-kD tyrosine kinase substrate linked to chromaffin cell secretion exhibits an associated MAP kinase activity and is highly related to a 42-kD mitogen-stimulated protein in fibroblasts." Journal of Cell Biology 110, no. 3 (March 1, 1990): 731–42. http://dx.doi.org/10.1083/jcb.110.3.731.
Full textAbstract:
The localization of the protein tyrosine kinase pp60c-src to the plasma membrane and to the membrane of secretory vesicles in neurally derived bovine chromaffin cells has suggested that tyrosine phosphorylations may be associated with the process of secretion. In the present study we have identified two cytosolic proteins of approximately 42 and 45 kD that become phosphorylated on tyrosine in response to secretagogue treatment. Phosphorylation of these proteins reached a maximum (3 min after stimulation) before maximum catecholamine release was observed (5-10 min after stimulation). Both secretion and tyrosine phosphorylation of p42 and p45 required extracellular Ca2+. Tyrosine-phosphorylated proteins of similar Mr have previously been identified in 3T3-L1 adipocytes stimulated with insulin (MAP kinase; Ray, L. B., and T. W. Sturgill. 1987. Proc. Natl. Acad. Sci. USA. 84:1502-1506) and in avian and rodent fibroblasts stimulated with a variety of mitogenic agents (Cooper, J. A., D. F. Bowen-Pope, E. Raines, R. Ross, and T. Hunter. 1982. Cell. 31:263-273; Nakamura, K. D., R. Martinez, and M. J. Weber. 1983. Mol. Cell. Biol. 3:380-390). Comparisons of the secretion-associated 42-kD protein of chromaffin cells with the 42-kD protein of Swiss 3T3 fibroblasts and 3T3-L1 adipocytes provide evidence that these three proteins are highly related. This evidence includes comigration during one-dimensional SDS-PAGE, cochromatography using ion exchange and hydrophobic matrices, similar isoelectric points, identical cyanogen-bromide peptide maps, and cochromatography of MAP kinase activity with the tyrosine-phosphorylated form of pp42. This protein(s), which appears to be activated in a variety of cell types, may serve a common function, perhaps in signal transduction involving a cascade of kinases.
23
Kellogg, Elizabeth, J. Richard Abbott, Kamaljit Bawa, Kanchi Gandhi, B. R. Kailash, K. N. Ganeshaiah, Uttam Babu Shrestha, and Peter Raven. "Checklist of the grasses of India." PhytoKeys 163 (October 18, 2020): 1–560. http://dx.doi.org/10.3897/phytokeys.163.38393.
Full textAbstract:
A checklist of the grasses of India is presented, as compiled from survey of all available literature. Of the twelve subfamilies of grasses, ten are represented in India. Most subfamilies have been examined by taxonomic experts for up-to-date nomenclature. The list includes 1506 species plus infraspecific taxa and presents information on types, synonyms, distribution within India, and habit. Twelve new combinations are made, viz. Arctopoa tibetica (Munro ex Stapf) Prob. var. aristulata (Stapf) E.A. Kellogg, comb. nov.; Chimonocalamus nagalandianus (H.B. Naithani) L.G. Clark, comb. nov.; Chionachne digitata (L.f.) E.A. Kellogg, comb. nov.; Chionachne wallichiana (Nees) E.A. Kellogg, comb. nov.; Dinebra polystachyos (R. Br.) E.A. Kellogg, comb. nov.; Moorochloa eruciformis (Sm.) Veldkamp var. divaricata (Basappa & Muniv.) E.A. Kellogg, comb. nov.; Phyllostachys nigra (Lodd. ex Lindl.) Munro var. puberula (Miq.) Kailash, comb. & stat. nov.; Tzveleviochloa schmidii (Hook. f.) E.A. Kellogg, comb. nov.; Urochloa lata (Schumach.) C.E. Hubb. var. pubescens (C.E. Hubb.) E.A. Kellogg, comb. nov.; Urochloa ramosa (L.) T.Q. Nguyen var. pubescens (Basappa & Muniy.) E.A. Kellogg, comb. nov.; Urochloa semiundulata (Hochst. ex A. Rich.) Ashalatha & V.J. Nair var. intermedia (Basappa & Muniy.) E.A. Kellogg, comb. nov.
24
Akhtar, Nudrat Sanzida, Mohan Kumar Biswas, and Dayaram. "Morphological characterization of Lentinulla edodes hybrid strains obtained by intraspecific mating." Ecology, Environment and Conservation 29 (2023): 08–12. http://dx.doi.org/10.53550/eec.2023.v29i02s.002.
Full textAbstract:
Mushroom production started in 1960s and expended rapidly in the 1990s but mushroom as a vegetable is yet to find regular place in the Indian agri-food landscape. Among various cultivated species of mushrooms, shiitake mushroom has a good demand among consumers particularly in northern India due to its numerous beneficial properties like its taste and medicinal value. Presently, the China and Japan are the bulk producers of this prized mushroom. The current study attempted to generate improved strains of L. edodes by using intraspecific hybridization. Each of the five parent monokaryotic mycelia (LE-1501, LE-1502, LE-1503, LE1504 and LE-1505) were mated with the remaining four monokaryons resulting in a total 10 mating. Out of 10, only 5 compatible mating strains (Hybrid Spore Pair 1-2, 1-4, 2-3, 3-4 and 4-5) were generated in which clamp connections were confirmed. The significant variations among the newly generated hybrids were identified by morphological visualization. Among five, only three hybrids are totally different from the parents. The strain HSP 1-2 expressed co-dominance by producing distorted, creamy white and honey brown pileus having white scars observed on some of the fruits with stumpy stipe. While hemispherical, light brown cap with flat, thin and irregular margin was the characteristics of HSP 2-3 and the strain HSP 4-5 produced distorted spherical, dull white cap with white scars uniformly distributed from outside. This research involved a successful initial attempt to use a broad range of analyses and breeding to generate superior hybrids of L. edodes.
25
Christenson, R. H., S. D. Studenberg, S. Beck-Davis, and F. A. Sedor. "Digoxin-like immunoreactivity eliminated from serum by centrifugal ultrafiltration before fluorescence polarization immunoassay of digoxin." Clinical Chemistry 33, no. 4 (April 1, 1987): 606–8. http://dx.doi.org/10.1093/clinchem/33.4.606.
Full textAbstract:
Abstract Digoxin determined in the Abbott "TDx" by fluorescence polarization immunoassay by the manufacturer's recommended method involving precipitation of protein with 5-sulfosalicylic acid (SSA) is subject to interference from endogenous compounds having digoxin-like immunoreactivity. Guided by the work of Graves et al. (Clin Chem 1986;32:1506-9), we eliminated interference caused by digoxin-like immunoreactivity by substituting ultrafiltration for precipitation with SSA to remove protein. Using the manufacturer's method, we quantified digoxin in serum from 53 patients in three clinically defined groups who were receiving no digoxin, finding apparent digoxin in excess of the 200 ng/L detection limit in 24% of the 17 pregnant women, 59% of the 17 renal-dialysis patients, and all of 19 neonatal cord-blood samples examined. No measurable digoxin immunoreactivity was observed by fluorescence polarization immunoassay for any of the 53 clinically defined patients after removal of protein by ultrafiltration. For 22 men for whom digoxin was prescribed, digoxin measurement after protein removal by SSA and by ultrafiltration correlated well (r = 0.98), with good proportionality (slope = 1.04). Analytical recovery of added digoxin from adulterated serum was 115% after SSA, but 100% after ultrafiltration. Thus, before this assay procedure, we recommend ultrafiltration, to remove digoxin-like interference.
26
Prolyotova, N. V. "SELECTIVE SYSTEM IN VITRO «FUNGI COLLETOTRICHUM LINI - LINEN» AS AN EFFICIENT WAY TO FIND OUT GENOTYPES RESISTANT TO THE POD SPOT." Bulletin of NSAU (Novosibirsk State Agrarian University), no. 2 (July 23, 2019): 42–50. http://dx.doi.org/10.31677/2072-6724-2019-51-2-42-50.
Full textAbstract:
The research aims at development of an effective selective agent in vitro system for founding linseed genotypes resistant to the pod spot. The authors see the object of research as varieties and lines of flax Linum usitatissimum L., which differ in their resistance to the pod spot. Fungi strains differed in their virulence. The authors applied methods of such scientists as Dospekhov and Kurchakova, methodological guidance on foundation, maintenance, storage and practical application of microorganisms, i.e. flax pathogens. This results in creation of selective in vitro system “Colletotrichum lini Manns et Bolley fungus – flax”. This system selects in vitro flax cells resistant to culture filtrate, from which it is possible to obtain regenerated plants resistant to the pathogen with greater efficiency. The authors enumerate the aminoacids that were found in the culture filtrates of the investigated pathogen strains; they are alanine, glycine, asparagine, cysteine, asparagine and glutamic acids, arginine and threonine. The authors outline the observed relationship between flax cell responsiveness and fungi pathogen in the environment of the fungius - anthracnose pathogen - on the value of the explant. Anthers cells in selection conditions were less resistant than those of immature embryos. The researchers observed the impact of flax genotype on cells ability to morphogenesis under selection conditions. Genotype cells L 957-8-7, Alexim, Pendzhab, Zaryanka had high morphogenetic activity. Morphogenetic capacities of genotypes L 1506-8-4 and Rosinka were rather low by the 2nd-3rd passages. When designing the scheme of flax selection in vitro for resistance to anthracnotism, 86 shoots were obtained, the check of which on the artificial infectious-provocative background showed that the genotypes differed in their resistance. The authors observed forms less resistant to the disease as well as resistant and medium resistant lines (at the level of 50 - 75%). The parameters of resistance in resistant and medium resistant genotypes were 12 - 37% higher than in the initial forms.
27
Salih, Maithem Naeem, and Alan Mickelson. "Influence of a Polyimide Coating Layer on Losses of Fabricated SOI Slot Waveguides." Photonics Letters of Poland 15, no. 2 (July 2, 2023): 15–17. http://dx.doi.org/10.4302/plp.v15i2.1190.
Full textAbstract:
We demonstrate experimentally and simultaneously the impact of the Polyimide (PI) coating layer on the coupling and propagation losses of the fabricated SOI slot waveguides at 1550 nm operation wavelength and TE polarization. Full Text: PDF References P. Dong, Y.K. Chen, G.H. Duan, and D.T. Neilson, "Silicon photonic devices and integrated circuits," Nanophot, 3, 215 (2014). CrossRef Q. Xu, V.R. Almeida, R.R. Panepucci, M. Lipson, "Experimental demonstration of guiding and confining light in nanometer-size low-refractive-index material," Opt. Lett., 29, 1626 (2004). CrossRef V.R. Almeida, Q. Xu, C.A. Barrios, M. Lipson, "Guiding and confining light in void nanostructure," Opt. Lett., 29, 1209 (2004). CrossRef A. Mickelson, "Silicon photonic slot guides for nonlinear optics," 2013 Int. Conf. Microw. Photonics, ICMAP 2013, (2013). CrossRef A. Martínez et al., "Ultrafast all-optical switching in a silicon-nanocrystal-based silicon slot waveguide at telecom wavelengths," Nano Lett., 10, 1506 (2010). CrossRef C. Koos et al., "All-optical high-speed signal processing with silicon-organic hybrid slot waveguides," Nat. Photonics., 3, 216 (2009). CrossRef Y. Li, K. Cui, X. Feng, Y. Huang, F. Liu, and W. Zhang, "Ultralow propagation loss slot-waveguide in high absorption active material," IEEE Photonics J., 6, 3 (2014). CrossRef Z. Wang, N. Zhu, Y. Tang, L. Wosinski, D. Dai, S. He, "Ultracompact low-loss coupler between strip and slot waveguides," Opt. Lett., 34, 1498 (2009). CrossRef
28
Zhou, Yucun, Weilin Zhang, Zheyu Luo, Nicholas Kane, and Meilin Liu. "(Invited) Novel Air Electrode and Catalyst Materials for High-Performance and Durable Regenerative Proton-Conducting Solid Oxide Cells." ECS Meeting Abstracts MA2022-02, no. 47 (October 9, 2022): 1752. http://dx.doi.org/10.1149/ma2022-02471752mtgabs.
Full textAbstract:
Regenerative solid oxide cells can operate in either a fuel cell mode or an electrolysis mode as needed. Recently, regenerative proton-conducting solid oxide cells (R-PSOCs) have attracted considerable attention due to their potential for efficient and low-cost power and fuel co-generation.1, 2 However, the performance and durability of R-PSOCs are still limited by the lack of highly active and robust air electrode/catalyst materials for dual-mode operation. In this presentation, we will highlight the critical scientific challenges facing the development of efficient and durable air electrode/catalyst materials for R-PSOCs as well as the strategies for dramatically enhancing electrode activity and durability. We will then present our recent progress in the development of new air electrodes 3, 4 as well as the mechanism of electrode reactions and degradation, as revealed by a combination of modeling, simulation, and in situ/operando characterization of electrode processes 5, 6. Catalytic activity, evolution of the surface chemistry, and contaminant (e.g., water and chromium) tolerance of both the conventional La0.6Sr0.4Co0.2Fe0.8O3−δ (LSCF) electrode and the newly developed PrBa0.8Ca0.2Co2O5+δ–BaCoO3−δ (PBCC–BCO) electrode will be discussed. Performance, long-term stability, and degradation mechanism of R-PSOCs using LSCF and PBCC–BCO air electrodes will be reported. We will further introduce our recent progress in the development of highly active and durable catalyst coatings for the air electrodes with significantly enhanced performance and durability under typical operating conditions with the presence of contaminants. Reference: L. Yang, S. Wang, K. Blinn, M. Liu, Z. Liu, Z. Cheng and M. Liu, Science, 2009, 326, 126-129. C. Duan, J. Huang, N. Sullivan and R. O'Hayre, Appl. Phys. Rev., 2020, 7, 011314. Y. Zhou, E. Liu, Y. Chen, Y. Liu, L. Zhang, W. Zhang, Z. Luo, N. Kane, B. Zhao and L. Soule, ACS Energy Lett., 2021, 6, 1511-1520. Y. Zhou, W. Zhang, N. Kane, Z. Luo, K. Pei, K. Sasaki, Y. Choi, Y. Chen, D. Ding and M. Liu, Adv. Funct. Mater., 2021, 2105386. J. H. Kim, S. Yoo, R. Murphy, Y. Chen, Y. Ding, K. Pei, B. Zhao, G. Kim, Y. Choi and M. Liu, Energy Environ. Sci., 2021, 14, 1506-1516. Y. Niu, Y. Zhou, W. Zhang, Y. Zhang, C. Evans, Z. Luo, N. Kane, Y. Ding, Y. Chen and X. Guo, Adv. Energy Mater., 2022, 2103783.
29
Stoyanova, Nikoleta, Mariya Spasova, Nevena Manolova, Iliya Rashkov, Mariana Kamenova-Nacheva, Plamena Staleva, and Maya Tavlinova-Kirilova. "Electrospun PLA-Based Biomaterials Loaded with Melissa officinalis Extract with Strong Antioxidant Activity." Polymers 15, no. 5 (February 21, 2023): 1070. http://dx.doi.org/10.3390/polym15051070.
Full textAbstract:
In the present study, the plant extract Melissa officinalis (M. officinalis) was successfully loaded in polymer fibrous materials on the basis of a biodegradable polyester–poly(L-lactide) (PLA) and biocompatible polyether–polyethylene glycol (PEG) by applying the electrospinning method. The optimal process conditions for the preparation of hybrid fibrous materials were found. The extract concentration was varied—0, 5 or 10 wt% in respect of the polymer weight, in order to study its influence on the morphology and the physico-chemical properties of the obtained electrospun materials. All the prepared fibrous mats were composed of defect-free fibers. The mean fiber diameters of the PLA, PLA/M. officinalis (5 wt%) and PLA/M. officinalis (10 wt%) were 1370 ± 220 nm, 1398 ± 233 nm and 1506 ± 242 nm, respectively. The incorporation of the M. officinalis into the fibers resulted in slight increase of the fiber diameters and in increase of the water contact angle values to 133°. The presence of the polyether in the fabricated fibrous material assisted the wetting of the materials imparting them with hydrophilicity (the value of the water contact angle become 0°). Extract-containing fibrous materials displayed strong antioxidant activity as determined by the 2,2-diphenyl-1-picryl-hydrazyl-hydrate free radical method. The DPPH solution color changed to yellow and the absorbance of the DPPH radical dropped by 88.7% and 91% after being in contact with PLA/M. officinalis and PLA/PEG/M. officinalis mats, respectively. These features revealed the M. officinalis—containing fibrous biomaterials promising candidates for pharmaceutical, cosmetic and biomedical use.
30
Ohlson, David, Anil C. Seth, Elena Gallo, Vivienne F. Baldassare, and Jenny E. Greene. "The 50 Mpc Galaxy Catalog (50 MGC): Consistent and Homogeneous Masses, Distances, Colors, and Morphologies." Astronomical Journal 167, no. 1 (December 22, 2023): 31. http://dx.doi.org/10.3847/1538-3881/acf7bc.
Full textAbstract:
Abstract We assemble a catalog of 15424 nearby galaxies within 50 Mpc with consistent and homogenized mass, distance, and morphological type measurements. Our catalog combines galaxies from HyperLeda, the NASA-Sloan Atlas, and the Catalog of Local Volume Galaxies. Distances for the galaxies combine best-estimates for flow-corrected redshift-based distances with redshift-independent distances. We also compile magnitude and color information for 11740 galaxies. We use the galaxy colors to estimate masses by creating self-consistent color—mass-to-light ratio relations in four bands; we also provide color transformations of all colors into Sloan g–i by using galaxies with overlapping color information. We compile morphology information for 13744 galaxies, and use the galaxy color information to separate early- and late-type galaxies. This catalog is widely applicable for studies of nearby galaxies and for placing these studies in the context of more distant galaxies. We present one application here: a preliminary analysis of the nuclear X-ray activity of galaxies. Out of 1506 galaxies within the sample that have available Chandra X-ray observations, we find that 291 have detected nuclear sources. Of the 291 existing Chandra detections, 249 have log(L X) > 38.3 and available stellar mass estimates. We find that the X-ray active fractions in early-type galaxies are higher than in late-type galaxies, especially for galaxy stellar masses between 109 and 1010.5 M ⊙. We show that these differences may be due at least in part to the increased astrometric uncertainties in late-type galaxies relative to early types.
31
Dallmeier, Dhayana, Michael Denkinger, Richard Peter, Kilian Rapp, Allan S. Jaffe, Wolfgang Koenig, and Dietrich Rothenbacher. "Sex-Specific Associations of Established and Emerging Cardiac Biomarkers with All-Cause Mortality in Older Adults: The ActiFE Study." Clinical Chemistry 61, no. 2 (February 1, 2015): 389–99. http://dx.doi.org/10.1373/clinchem.2014.230839.
Full textAbstract:
Abstract BACKGROUND N-terminal pro B-type natriuretic peptide (NT-proBNP) has strong prognostic value for all-cause mortality in the general population. High-sensitivity assays now allow detection of cardiac troponins even in asymptomatic populations. We examined the association between NT-proBNP, high-sensitivity cardiac troponin T (hs-cTnT), and hs-cTnI and all-cause mortality in older adults. METHODS We conducted a longitudinal cohort study [Activity and Function in the Elderly in Ulm (ActiFE Ulm)] including 1506 community-dwelling adults ≥65 years old with NT-proBNP, hs-cTnT, and hs-cTnI measured at baseline. We evaluated the associations between log-transformed biomarker concentrations and 4-year total mortality, accounting for possible confounders, with Cox proportional hazards models. RESULTS We observed 125 deaths among 1422 participants (median follow-up 4 years). We detected effect modification by sex for all biomarkers (all P values <0.05) expressed as hazard ratio (HR) for death per 1-unit increment of ln(biomarker concentration) in women (n = 618, 37 deaths) compared with men (n = 804, 88 deaths): HR 2.97 (95% CI 2.04–4.33) vs 1.73 (1.40–2.13) for NT-proBNP; 3.67 (2.31–5.81) vs 2.15 (1.61–2.87) for hs-cTnT; and 3.32 (2.13–5.18) vs 1.92 (1.55–2.38) for hs-cTnI. Among 777 participants with undetectable hs-cTnT (<5 ng/L), hs-cTnI remained associated with all-cause mortality in age- and sex-adjusted analysis. CONCLUSIONS NT-proBNP, hs-cTnT, and hs-cTnI were independently associated with all-cause mortality in older adults. The strength of these associations varied between men and women, emphasizing the need for additional sex-specific research among older people.
32
Aregbesola, Alex, Sari Voutilainen, Jyrki K. Virtanen, Jaakko Mursu, and Tomi-Pekka Tuomainen. "Gender difference in type 2 diabetes and the role of body iron stores." Annals of Clinical Biochemistry: International Journal of Laboratory Medicine 54, no. 1 (September 28, 2016): 113–20. http://dx.doi.org/10.1177/0004563216646397.
Full textAbstract:
Background Studies of gender difference in type 2 diabetes have been inconclusive. We investigated gender difference in type 2 diabetes and the contribution of body iron, as assessed by serum ferritin to this difference. Methods We performed cross-sectional ( n = 1707) and prospective ( n = 1506) analyses in males and females aged 53–73 years in 1998–2001. Type 2 diabetes diagnosis was determined by questionnaire, blood glucose measurements and record linkage to type 2 diabetes registers. Gender difference in type 2 diabetes and serum ferritin contribution to the difference was examined in multivariable logistic and Cox regression models. Gender difference in fasting plasma glucose and insulin and homeostasis model assessment of insulin resistance was examined in linear regression analysis. Results In the cross-sectional analysis, a total of 201 type 2 diabetes cases were observed (males = 111 [55.2%] vs. female = 90 [44.8%], P = 0.032), and in adjusted models, males had higher odds of type 2 diabetes (OR = 1.61, 95% CI 1.10 to 2.34); higher fasting plasma glucose (β = 0.28, 95% CI 0.15 to 0.41), fasting plasma insulin (β = 0.73, 95% CI 0.26 to 1.19) and homeostasis model assessment of insulin resistance (β = 0.11, 95% CI 0.04 to 0.17). In the prospective analysis, males had increased risk of type 2 diabetes (HR = 1.46, 95% CI 1.03 to 2.07). With serum ferritin introduction (100 µg/L, log-transformed) into the models, the type 2 diabetes prevalence (OR = 1.35, 95% CI 0.91 to 1.99) and incidence (HR = 1.38, 95% CI 0.96 to 1.97) were appreciably attenuated. Conclusions These data suggest a gender difference in type 2 diabetes, with a higher prevalence and increased type 2 diabetes risk in males. Body iron explains about two-fifths and one-fifth of the gender difference in type 2 diabetes prevalence and incidence, respectively.
33
SADAWARTI, MURLIDHAR J., R. K. SAMADHIYA, R. K. SINGH*, S. P. SINGH, TANUJA BUCKSETH, SANJAY RAWAL, VINAY SINGH, SUBHAS KATARE, SATYAJIT ROY, and S. K. CHAKRABARTI. "Standardization of agro-techniques for aeroponic potato (Solanum tuberosum) minitubers under generation-0." Indian Journal of Agricultural Sciences 90, no. 3 (June 22, 2020): 616–20. http://dx.doi.org/10.56093/ijas.v90i3.101499.
Full textAbstract:
Since, very less information is available regarding the agro-techniques of hi-tech seed potato minitubers production, therefore an experiment was conducted to evaluate planting geometry and different doses of nitrogen for multiplication of aeroponic minitubers of potato (Solanum tuberosum L.) under net house conditions of north-central plains of India. 30 cm × 15 cm (97.44) plant geometry and 150 kg N/ha (95.81) and 180 kg N/ha (96.98) N dose recorded significantly higher emergence %. Linear increase in plant height was recorded with 120, 150 and 180 kg N/ha dose over 75 kg N/ ha (44.1 cm). Planting geometry 45 cm × 10 cm (34.71) and N dose 150 kg N (35.71) recorded significantly lowest per cent of <3 g minituber by number. Planting geometry 45 cm × 10 cm (1722 thousand/ha) followed by 30 cm × 10 cm (1587 thousand/ha) recorded significantly highest total tuber number over 30 cm × 15 cm (1209 thousand/ ha). Among N dose, 120 kg N (1560 thousand/ha) and 180 kg N/ha (1506 thousand/ha) dose recorded significantly higher total tuber number over 150 kg N/ha dose. Among interaction 45 cm × 10 cm with 120 kg N/ha dose recorded significantly highest total tuber number (1823 thousand/ha) over other combinations. For weight of tubers, 45 cm ×10 cm planting density with 150 kg N/ha reported highest tuber weight (27.62 t/ha). Hence, for the aeroponic seed multiplication of the variety Kufri Lauvkar, planting geometry of 45 cm × 10 cm with plant population of 222222 plants/ha and N, P2O5 and K2O ratio of 150:60:100 kg/ha should be adopted for getting higher tuber number and weight/ha.
34
Kirschner, Jan, and Zdeněk Kaplan. "(1502–1507) Proposals to reject the names Juncus cymosus, J. radicans, Luzula capillaris, L. hyperborea, L. interrupta , and Rostkovia brevifolia ( Juncaceae )." TAXON 50, no. 4 (November 2001): 1193–97. http://dx.doi.org/10.2307/1224744.
Full text
35
Scharfman, Helen. "Upregulation of Multidrug Resistance Transporters in the Epileptic Brain." Epilepsy Currents 2, no. 6 (November 2002): 200. http://dx.doi.org/10.1111/j.1535-7597.2002.00076.x.
Full textAbstract:
Limbic Seizures Induce P-glycoprotein in Rodent Brain: Functional Implications for Pharmacoresistance Rizzi M, Caccia S, Guiso G, Richichi C, Gorter JA, Aronica E, Aliprandi M, Bagnati R, Fanelli R, D'Incalci M, Samanin R, Vezzani A J Neurosci 2002;22:5833–5839 The causes and mechanisms underlying multidrug resistance (MDR) in epilepsy are still elusive and may depend on inadequate drug concentration in crucial brain areas. We studied whether limbic seizures or anticonvulsant drug (AED) treatments in rodents enhance the brain expression of the MDR gene ( mdr) encoding a permeability glycoprotein (P-gp) involved in MDR to various cancer chemotherapeutic agents. We also investigated whether changes in P-gp levels affect AED concentrations in the brain. Mdr mRNA measured by reverse transcriptase–polymerase chain reaction (RT-PCR) increased by 85% on average in the mouse hippocampus 3–24 h after kainic acid–induced limbic seizures, returning to control levels by 72 h. Treatment with therapeutic doses of phenytoin (PHT) or carbamazepine (CBZ) for 7 days did not change mdr mRNA expression in the mouse hippocampus 1–72 h after the last drug administration. Six hours after seizures, the brain/plasma ratio of PHT was reduced by 30%, and its extracellular concentration estimated by microdialysis was increased by twofold compared with control mice. Knockout mice (mdr1a/b_/_) lacking P-gp protein showed a 46% increase in PHT concentrations in the hippocampus 1 and 4 h after injection compared with wild-type mice. A significant 23% increase was found in the cerebellum at 1 h and in the cortex at 4 h. CBZ concentrations were measurable in the hippocampus at 3 h in mdr1a/b_/_mice, whereas they were undetectable at the same interval in wild-type mice. In rats having spontaneous seizures 3 months after electrically induced status epilepticus, mdr1 mRNA levels were enhanced by 1.8-fold and fivefold on average in the hippocampus and entorhinal cortex, respectively. Thus changes in P-gp mRNA levels occur in limbic areas after both acute and chronic epileptic activity. P-gp alterations significantly affect AED concentrations in the brain, suggesting that seizure-induced mdr mRNA expression contributes to MDR in epilepsy. Overexpression of Multiple Drug Resistance Genes in Endothelial Cells from Patients with Refractory Epilepsy Dombrowski SM, Desai SY, Marroni M, Cucullo L, Goodrich K, Bingaman W, Mayberg MR, Bengez L, Janigro D Epilepsia 2001;42:1501–1506 Purpose It has been suggested that altered drug permeability across the blood-brain barrier (BBB) may be involved in pharmacoresistance to antiepileptic drugs (AEDs). To test this hypothesis further, we measured multiple drug resistance (MDR) gene expression in endothelial cells (ECs) isolated from temporal lobe blood vessels of patients with refractory epilepsy. ECs from umbilical cord or temporal lobe vessels obtained from aneurysm surgeries were used as comparison tissue. Methods cDNA arrays were used to determine MDR expression. MDR protein (MRP1) immunocytochemistry and Western blot analysis were used to confirm cDNA array data. Results We found overexpression of selected MDR and significantly higher P-glycoprotein levels in “epileptic” versus “control” ECs. Specifically, MDR1, cMRP/MRP2, and MRP5 were upregulated in epileptic tissue, whereas Pgp3/MDR3 levels were comparable to those measured in comparison tissue. The gene encoding cisplatin resistance-associated protein (hCRA-α) also was Conclusions Complex MDR expression changes may play a role in AED pharmacoresistance by altering the permeability of AEDs across the BBB. overexpressed in epileptic tissue. Immunocytochemical analysis revealed that MDR1 immunoreactivity was localized primarily in ECs; MRP1 protein levels also were significantly higher in epileptic tissue.
36
Mondal, Chayan, Kanak Saha, Rogier A. Windhorst, and Rolf A. Jansen. "Observed UV Continuum Slopes (β) of Galaxies at z = 0.40–0.75 in the GOODS-North Field." Astrophysical Journal 946, no. 2 (April 1, 2023): 90. http://dx.doi.org/10.3847/1538-4357/acc110.
Full textAbstract:
Abstract We estimate the UV continuum slope (β) of 465 galaxies (with luminosities of 0.028–3.3 L z = 0.5 * ) in the Great Observatories Origins Survey Northern field in the redshift range z = 0.40–0.75. We use two AstroSat/UVIT (N242W, N245M) bands, two Hubble Space Telescope (F275W, F336W) bands, and a KPNO (U) band to sample the UV continuum slope of selected galaxies between 1215 and 2600 Å. The mean (median) and 1σ scatter in the observed β are found to be −1.33 ± 0.07 ( − 1.32) and 0.60 within the considered redshift range. We do not find any significant evolution in the mean β within our redshift window. Our measurements add new data points to the global β–z relation in the least-explored redshift regime, further reinforcing the gradual reddening of galaxy UV continuum with cosmic time. We notice no strong consistent trend between β and M 1500 for the entire luminosity range −21 <M 1500 < − 15 mag. However, the majority of the most-luminous galaxies (M 1500 < − 19 mag) are found to have relatively redder slopes. Using UVIT, we detect galaxies as faint as M 1500 = − 15.6 mag (i.e., 0.028 L z = 0.5 * ). The faintest galaxies (M 1500 > − 16 mag) tend to be redder, which indicates they were less actively forming stars during this cosmic time interval. Our study highlights the unique capability of UVIT near-UV imaging to characterize the rest-frame far-UV properties of galaxies at redshift z ∼ 0.5.
37
Chistilina, A. N., Yu A. Petrova, E. F. Dorodneva, and I. M. Petrov. "Predictive role of the homeostatic model of insulin resistance (HOMA-IR) in the population of residents of light iodine endemia." Medical Science And Education Of Ural 21, no. 3 (2020): 25–31. http://dx.doi.org/10.36361/1814-8999-2020-21-3-25-31.
Full textAbstract:
TyumenStudy the gender aspects of the prognostic rank of the concentration of LP (a) and the high normal content of thyroid-stimulating hormone at risk for the development and progression of cardiovascular diseases in the population of mild iodine endemic residents according to a prospective observation (80 months). Materials and methods. 1501 people were examined, aged 49.25 ± 11.3 years (Me - 52 years, Q1-Q3 – 52; 59 years old), 29.91% of men (449/1501) and 70.09% of women (1052/1501) with excess body weight and obesity in 74.28% (1115/1502) and hypertension in 51.07% (766/1501). Results. In the group of study participants with IR ( ≥ 2.7), higher age, BMI, SBP, DBP, HDL cholesterol, TG, ApoA1, glucose, uric acid, CRP, FG and insulin. In general, in the population of inhabitants of mild iodine endemic, the risk of non-fatal cardiovascular events is associated with the presence of IR – χ2 = 4.36; p = 0.037. However, the prognostic significance of IR as a marker of CVR is confirmed exclusively in the group of females – χ2 = 5.7; p = 0.017, also significant strata are: age 51-55 – χ2 = 2.85; p = 0.092, age 56-60 years – χ2 = 10.68; p = 0.001, BMI ≥ 30 kg/m2 – χ2 = 4.46; p = 0.035, TG level < 1.7 mmol/L – χ2 = 5.19; p = 0.023, uric acid concentration < 360 mmol/l – χ2 = 4.83; p = 0.028. Conclusion. In the population of inhabitants of mild iodine endemicity, insulin resistance is associated with the risk of non-fatal cardiovascular events. At the same time, these associations are valid for females, persons in the age range 51-60 years old, obese patients, patients with a TG level of less than 1.7 mmol/L and a uric acid content of less than 360 mmol/L.
38
Vanderstraeten, Denis. "An accurate parallel block Gram-Schmidt algorithm without reorthogonalization." Numerical Linear Algebra with Applications 7, no. 4 (2000): 219–36. http://dx.doi.org/10.1002/1099-1506(200005)7:4<219::aid-nla196>3.0.co;2-l.
Full text
39
Criollo-Velásquez, Claudia Patricia, Johana Alixa Muñoz-Belalcazar, and Tulio César Lagos-Burbano. "Environmental offering and coffee cup quality (Coffea arabica L.) Var. Castillo in southern Colombia." Revista de Ciencias Agrícolas 37, no. 2 (December 31, 2020): 78–89. http://dx.doi.org/10.22267/rcia.203702.140.
Full textAbstract:
The determinant factors of coffee cup quality are highly variable and depend on their interaction with coffee production and benefit. This study aimed to analyze soil and climatic factors and their association with the cup quality of Castillo coffee variety of three to five years of age from production units in ecotypes 220A and 221A of the Department of Nariño. The study farms were located in three different altitudinal ranges: ≤1500 m, between 1501 and 1700 m, and >1700 m. Soil, climate, and coffee cup quality variables were analyzed through principal component analysis and cluster analysis. A low level of association was found between climatic and soil nutritional factors and coffee cup quality. Soil Mn, Fe, and Cu contents showed the highest association levels with cup quality, indicated by an average score of 80.89. The highest values of photosynthetically active radiation -PAR- and thermal amplitude were found in La Unión - Nariño, and these variables were associated with the group that obtained the highest cup quality score (82.58). Cup quality was not associated with elevation since the highest scores (85.5 and 82.33) were obtained from production units located at ≤1500 m.a.s.l. and >1700 m.a.s.l, respectively.
40
Li, Q. L., J. Y. Mo, S. P. Huang, T. X. Guo, Z. B. Pan, P. Ning, and T. Hsiang. "First Report of Leaf Spot Disease Caused by Glomerella magna on Lobelia chinensis in China." Plant Disease 97, no. 10 (October 2013): 1383. http://dx.doi.org/10.1094/pdis-03-13-0346-pdn.
Full textAbstract:
Lobelia chinensis is a perennial herbaceous plant in the family Campanulaceae that is native to China, where it grows well in moist to wet soils. It is commonly used as a Chinese herbal medicine. In May 2012, symptoms of leaf spot were observed on leaves of L. chinensis in Nanning, Guangxi Zhuang Autonomous Region, China. The leaf lesions began as small, water-soaked, pale greenish to grayish spots, which enlarged to gray to pale yellowish spots, 4 to 6 mm in diameter. At later stages, numerous acervuli appeared on the lesions. Acervuli were mostly epiphyllous, and 40 to 196 μm in diameter. On potato dextrose agar (PDA), a fungus was consistently recovered from symptomatic leaf samples, with a 93% isolation rate from 60 leaf pieces that were surface sterilized in 75% ethanol for 30 s and then in 0.1% mercuric chloride for 45 s. Three single-spore isolates were used to evaluate cultural and morphological characteristics of the pathogen. Setae were two to three septate, dark brown at the base, acicular, and up to 90 μm long. Conidia were long oblong-elliptical, guttulate, hyaline, and 11 to 20 × 4.1 to 6.3 μm (mean 15.2 × 5.1 μm). These morphological characteristics of the fungus were consistent with the description of Colletotrichum magna (teleomorph Glomerella magna Jenkins & Winstead) (1). The rDNA internal transcribed spacer (ITS) region of one isolate, LC-1, was sequenced (GenBank Accession No. KC815123), and it showed 100% identity to G. magna, GenBank HM163187.1, an isolate from Brazil cultured from papaya (2). Although KC815123 was identified as G. magna, it shows 99% identity to GenBank sequences from isolates of C. magna, and more research is needed to elucidate the relationships between these taxa, especially with consideration to host specificity. Pathogenicity tests were performed with each of the three isolates by spraying conidial suspensions (1 × 106 conidia/ml) containing 0.1% Tween 20 onto the surfaces of leaves of 30-day-old and 6- to 8-cm-high plants. For each isolate, 30 leaves from five replicate plants were treated. Control plants were treated with sterilized water containing 0.1% Tween 20. All plants were incubated for 36 h at 25°C and 90% relative humidity in an artificial climate chamber, and then moved into a greenhouse. Seven days after inoculation, gray spots typical of field symptoms were observed on all inoculated leaves, but no symptoms were seen on water-treated control plants. Koch's postulates were fulfilled by reisolation of G. magna from diseased leaves. To our knowledge, this is the first report of G. magna infecting L. chinensis worldwide. References: (1) M. Z. Du et al. Mycologia 97:641, 2005. (2) R. J. Nascimento et al. Plant Dis. 94:1506, 2010.
41
Crosnier, L., M. Drévillon, S. Ramos Buarque, and F. Soulat. "Three ocean state indices implemented in the Mercator-Ocean operational suite." ICES Journal of Marine Science 65, no. 8 (July 30, 2008): 1504–7. http://dx.doi.org/10.1093/icesjms/fsn122.
Full textAbstract:
Abstract Crosnier, L., Drévillon, M., Ramos Buarque, S., and Soulat, F. 2008. Three ocean state indices implemented in the Mercator-Ocean operational suite. – ICES Journal of Marine Science, 65: 1504–1507. We present three indices for the state of the ocean, all computed using the Mercator-Ocean analyses and ocean forecast system: an upwelling index based on sea surface temperature (SST), the tropical cyclone heat potential, showing the thermal energy available in the ocean to enhance or decrease the power of cyclones, and the Indian Ocean dipole mode index based on SST. Such indices are updated on a weekly or monthly basis.
42
Liu, Huan, Yangwen Jia, Cunwen Niu, Peng Hu, Junkai Du, Huidong Su, and Qinghui Zeng. "Evolution of Main Water Cycle Fluxes in the Karst Mountain Region of Southwest China." Water 12, no. 8 (August 12, 2020): 2262. http://dx.doi.org/10.3390/w12082262.
Full textAbstract:
Distributed hydrological simulation in karst regions has always been a challenging task because of their unique hydrogeological characteristics. The karst mountain region of southwest China (KMRSC), one of the largest continuous karst areas in the world, contributes to about 54 percent of water supply in the basins. In spite of its importance, we have a poor understanding of the evolution laws of hydrological cycle and water resources in KMRSC. We developed a physically-based, distributed hydrological model, called Water and Energy transfer Processes (WEP)-karst model, for KMRSC by introducing the equivalent porous medium approach to the WEP-L model, and dividing the modelling domain into 2021 sub-watersheds. The area of sub-watersheds ranges from 55 to 920 km2, with an average value of 170 km2. The model showed a good performance in simulating the monthly discharge at 18 representative hydrological stations, with the Nash–Sutcliffe efficiency (NSE) values ranging from 0.71 to 0.94, and the relative error (RE) values from −9.8% to 8.3% during the validation period (1980–2000). Then, we employed an in-depth analysis of the temporal and spatial variation of main water cycle fluxes, including precipitation, infiltration, evapotranspiration, blue water (i.e., river runoff), and green water (i.e., vegetation transpiration) over 1956–2015. In addition, the impact of climate change on these fluxes was evaluated under the median emission scenario (RCP4.5). The results showed that: (1) annual average precipitation of KMRSC reached 1506 mm, which is 2.4 times of the national average level, and about 47% (701 mm) of it contributed to river runoff. The infiltration and evapotranspiration were 862 and 870 mm, respectively. The transpiration from plants and trees accounted for 51% of the evapotranspiration. (2) Except for the green water, other fluxes experienced a significant decrease over the past 60 years. Blue water showed the largest interannual fluctuation and the strongest sensitivity to climate change. (3) Both precipitation and infiltration concentrated from May to August, and blue water increased notably from May to June and peaked in June. Blue water and precipitation were more likely to decrease in the future over 2021–2050 due to the climate change.
43
Revel-Vilk, Shoshana, Itamar Nitzan, Ada Goldfarb, Nilla Hemed, and Eyal Shteyer. "Low Activity of Cytochrome P450 1A2 (CYP1A2) Enzyme May Protect From Iron Accumulation in Children and Adults with Transfusion Depended β-Thalassemia Major." Blood 118, no. 21 (November 18, 2011): 2153. http://dx.doi.org/10.1182/blood.v118.21.2153.2153.
Full textAbstract:
Abstract Abstract 2153 In human, normal iron homeostasis fails to prevent the harmful accumulation of iron in patients who require regular blood transfusions. Some patients will progress to liver fibrosis and cirrhosis, but others, with the same degree of iron overload, would not express any liver damage. Cytochrome P450 1A2 (CYP1A2), a cytochrome enzyme with pivotal role in hepatic drug metabolism, was shown in a CYP1A2−/− mice to be essential for hepatic iron toxicity. The aim of this study was to assess the activity of CYP1A2 in relation to iron load in children and adults with transfusion-depended β-thalassemia major (TM) using the 13C-methacetin breath test. Methods: 13 C-methacetin continuous online breath test (MBT, BreathID® Exalenz Bioscience) was performed in children and adults with transfusion-depended TM. MBT parameters including PDR peak (percent dose recovered per hour), cumulative percentage of 13C recovery at 20 minutes (CPDR20) after ingestion of methacetin and time to peak PDR (TTP) were correlated with various clinical, blood and MRI measures. The t-test was used to assess difference of normally distributed continuous data, Mann-Whitney test was used to assess difference of non-normally distributed continuous data and the Fisher's exact test was used to assess differences of categorical data. The study was approved by the Institutional Review Board. Results: Thirty patients [Jewish Kurdistan origin (n=14), Arab origin (n=16)] were enrolled to the study. The median (range) age of participants was 30 (1–60) years. All patients were treated with regular blood transfusion and all but one patient, were treated with iron chelation therapy [Deferoxamine (n =4), Deferiprone (n=2), Deferasirox (n=15), Combinations (n=7)]. Time from starting regular transfusion ranged from 0.8–56 years. Mean red blood cell (RBC) transfused was 100 cc/kg/year. Plasma ferritin level < 1000 mcg/l was found in 14 patients, and was not associated with age, origin, time of initiation of regular blood transfusion and amount of RBC transfusion. The PDR peak and CPDR20 were significantly lower in patients with ferritin levels < 1000 mcg/l compared to those with ferritin levels > 1000 mcg/l (PDR peak, mean±SD: 24±8 vs. 31± 10, p=0.013; CPDR20: 3.9± 2 vs. 5.5± 2.2, p=0.045, t-test). During the study period, 21 patients had T2* MRI scans. Liver MRI was normal (T2* MRI > 6.3 milliseconds) in 8 patients, and was not associated with age, origin, time of initiation of regular blood transfusion and amount of RBC transfusion. As expected, plasma ferritin levels were significantly lower in patients with normal liver MRI (Ferritin, median (range): 376 (110–1506) vs.1349 (205–8223), p=0.008, Mann-Whitney test). Decreased activity of CYP1A2 (PDR peak < 20%/hour) was associated with normal liver MRI (Table 1). All patients with decreased activity of CYP1A2 and normal liver MRI were from Jewish Kurdistan origin. Conclusions: Our study is the first to show an association between low activity of CYP1A2 and low liver iron accumulation in transfusion depended TM patients. Similar to the murine model, this finding may suggest that primary low CYP1A2 activity protects from iron accumulation. The fact that CPY1A2 activity in most patients with liver iron accumulation is normal implies that decreasing dosage of various drugs is probably not warranted in patients with hepatic iron overload. Further larger studies and genetic testing are needed to confirm our observations. Disclosures: No relevant conflicts of interest to declare.
44
Pflaum, Christoph. "Algebraic analysis of multigrid algorithms." Numerical Linear Algebra with Applications 6, no. 8 (December 1999): 701–28. http://dx.doi.org/10.1002/(sici)1099-1506(199912)6:8<701::aid-nla181>3.0.co;2-l.
Full text
45
Nabben, Reinhard. "Book Review: Matrices of Sign-Solvable Linear Systems by R. A. Brualdi and B. L. Shader. Cambridge University Press, 1995, Cambridge, ISBN: 0 521 48296 8 (hardback) Price #30.00 (US$ 49.95)." Numerical Linear Algebra with Applications 4, no. 5 (September 1997): 439–40. http://dx.doi.org/10.1002/(sici)1099-1506(199709/10)4:5<439::aid-nla119>3.0.co;2-y.
Full text
46
Nikitin, Evgeny. "L. Martov and M. Gorky. To the 150th anniversary of the birth of L. Martov." OOO "Zhurnal "Voprosy Istorii" 2023, no. 11-1 (November 1, 2023): 80–105. http://dx.doi.org/10.31166/voprosyistorii202311statyi20.
Full textAbstract:
The article tells about the relationship between L. Martov and M. Gorky, which lasted a decade and a half. Martov's letters to Gorky, introduced into scientific circulation for the first time, help to understand them better. The writer tried to reform the Sovremennik magazine three times. Initially, under the editorship of A.V. Amfiteatrov. Then - under E.A. Lyatsky. The third time when the magazine was headed by N.N. Sukhanov. At the third attempt to reform, Martov became the author of “Sovremennik”. After the closure of the magazine in the fall of 1915, he and a number of other authors moved to the “Chronicle” that Gorky had just created. N.N. Sukhanov became Gorky's co-editor for The Chronicle. Then they edited “New Life” together. Martov was the author of the newspaper. He emigrated in September 1920. Gorky was forced to leave Russia a year later. Abroad, the writer and the politician together edited the magazine “Chronicle of the Revolution”, published by the Publishing House of Z.I. Grzhebin. At the request of Martov Gorky, he defended the Social Revolutionaries who found themselves in the dock in the summer of 1922, wrote letters to A.I. Rykov and A. France. As a result, none of the SRS were shot this time. Gorky attended the funeral of Martov, who died on April 4, 1923 due to a serious illness.
47
Crosslin, J. M. "First Report of Potato mop-top virus on Potatoes in Washington State." Plant Disease 95, no. 11 (November 2011): 1483. http://dx.doi.org/10.1094/pdis-06-11-0536.
Full textAbstract:
In April of 2011, approximately 10% of the tubers of potato (Solanum tuberosum L.) cv. Alturas, grown in central Washington State and collected from a commercial potato storage facility, were observed to have internal brown spots and arcs typical of infection by either Tobacco rattle virus (TRV) or Potato mop-top virus (PMTV). Ten tubers showing symptoms ranging from a few brown spots to large (2 cm) concentric arcs were tested by reverse transcription (RT)-PCR with primers specific for TRV (3) or PMTV (PMTV2 forward, AGAGCAGCCGTCGAGAATAG; PMTV3 reverse, TCGTCCACCTCTGCGAGTTG). Two symptomless tubers from the same lot were also tested. All symptomatic tubers tested negative for TRV, but eight of the symptomatic tubers were positive for PMTV, as evidenced by production of the expected 416-bp amplified DNA product. The symptomless tubers were negative for both viruses. The eight symptomatic tubers that were positive for PMTV by RT-PCR were also positive for PMTV by ELISA using a commercially available kit (Adgen, Ayr, Scotland). The symptomless tubers were negative for PMTV by ELISA. The 416-bp amplicons obtained with the PMTV primers from two tubers were cloned and three clones of each were sequenced. The consensus sequences for the two samples differed by only one nucleotide and sequences were deposited in GenBank as Accession Nos. JN132116 and JN132117. BLAST analysis showed the sequences were 99 to 100% identical to a portion of the coat protein gene of numerous PMTV isolates. These results confirm that PMTV is present in central Washington State. The virus has been known to affect potatoes in Maine for several years (2) and was recently confirmed in North Dakota (1). PMTV was reportedly found in potatoes grown in numerous locations in the United States, but the specific locations were not reported (4). PMTV is transmitted by the soilborne powdery scab pathogen, Spongospora subterranea, which is widespread in the region of the state where the virus-infected tubers were grown. The confirmation of PMTV in Washington State alerts growers, fieldmen, and diagnostic laboratories to the presence of this potentially serious virus in a major potato-production area of the United States. References: (1) N. David et al. Plant Dis. 94:1506, 2010. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) D. J. Robinson. J. Virol. Methods 40:57, 1992. (4) H. Xu et al. Plant Dis. 88:363, 2004.
48
Ardissino, Erminia. "Saggio per l'edizione critica dell'Ovidio Metamorphoseos Vulgare di Giovanni di Bonsignori: II “Proemio” e l' “Esordio”." Traditio 48 (1993): 107–71. http://dx.doi.org/10.1017/s0362152900012903.
Full textAbstract:
L'importanza del volgarizzamento e dell'allegorizzazione delle Metamorfosi ovidiane per opera di Giovanni di Bonsignori, meglio conosciuti con il titolo Ovidio Metamorphoseos Vulgare, che venne lora assegnato nelle edizioni a stampa, è dovuta alla larga diffusione che ebbero nel XV secolo e nei primi decenni del XVI. Terminato nel 1377, il testa ebbe una discreta divulgazione manoscritta e conobbe una prima stampa a Venezia nel 1497 “per Zoanne Rosso Vercellese ad instantia del nobile homo miser Lucantonio Zonta fiorentino” (ovvero Lucantonio Giunti), Sempre a Venezia “ad instantia del […] Lucantonio Zonta” seguirono una seconda edizione nel 1501 “per Christofolo de Pensa” e una terza nel 1508 “per Alexandro di Bandoni.” Nel 1517 e nel 1523 si ebbero ancora a Venezia altre due edizioni, ambedue “per Georgio de' Rusconi.” Nel 1519 fu pubblicato a Milano “in Minutiana officina,” per i fratelli da Legnano; nel 1520, ancora a Milano, “per Rocho et Fratello da Valle ad instantia de Miser Nicolò Da Gorgonzola.”
49
S K, MANJUNATHA, RAKESH KUMAR, HARDEV RAM, R. K. MEENA, M. R. YADAV, GOVIND MAKARANA, and UTTAM KUMAR. "Growth, yield and economics of fodder maize (Zea mays) as influenced by Jeevamrutha formulations under varying nutrient levels." Indian Journal of Agricultural Sciences 92, no. 5 (June 14, 2022): 607–10. http://dx.doi.org/10.56093/ijas.v92i5.124743.
Full textAbstract:
A split plot experiment was conducted at research farm of Agronomy Section, ICAR–National Dairy Research Institute, Karnal, Haryana during kharif 2018–19 to evaluate various jeevamrutha formulations under the varying nutrient levels in fodder maize (Zea mays L.). In main plot four nutrient levels [Control (0), 50, 75 and 100% RDF] and in sub-plot, five jeevamrutha formulations [Control (without jeevamrutha), water based jeevamrutha @1000 l/ha, water based jeevamrutha @1500 l/ha, whey based jeevamrutha @1000 l/ha and whey based jeevamrutha @1500 l/ha] were taken as treatments and replicated thrice. Better growth attributes, viz. plant height, number of leaves per plant, stem girth and leaf:stem ratio were observed with increased nutrient levels. Application of 50, 75 and 100% RDF resulted in 35.01, 61.21 and 74.19% higher green fodder yield (GFY) over control. Jeevamrutha (whey/water based) formulations significantly improved growth. Significantly higher dry matter yield (DMY) (11.65 t/ha) was obtained with 100% RDF. Whey based jeevamrutha formulation @1500 l/ha ((52.83 and 11.09 t/ha) closely followed by water based jeevamrutha formulation @1500 l/ha (51.38 and 10.79 t/ha) resulted in higher GFY and DMY, respectively. The highest gross returns and net returns were obtained in 100% RDF with whey based jeevamrutha @1500 l/ha (`94.89 and 70.32 × 103/ha, respectively). Maximum benefit:cost ratio (2.89) was recorded in 100% RDF and water based jeevamrutha formulation @1500 l/ha. Interaction effect between jeevamrutha formulation and nutrient levels suggested that application of jeevamrutha formulation @1500 l/ha in both forms (Whey and water) can save 25%nutrient dose.
50
Del Caño-Espinel, R., V. Posada-Franco, F. García-Bol, A. López-Moreno, A. Roldán-Valero, S. Castro-Merino, and M. del Caño-Espinel. "PROPOSAL FOR “RETURN TO SPORT” TESTS AFTER INJURY, SPECIFIC TO FOOTBALL." Orthopaedic Journal of Sports Medicine 6, no. 6_suppl3 (June 1, 2018): 2325967118S0004. http://dx.doi.org/10.1177/2325967118s00043.
Full textAbstract:
The decision to return to sport (RTS) after an injury is one of the most complicated in sports medicine, due to the posibility of reinjury.1 The return to sport tests allow one to set goals to assess the condition of the patient and establish certain criteria before returning to competition.2 These tests include: strength tests, jumping tests and stability tests, and are based on the “Limb Symetry Indexes” (LSI).3 Nevertheless, there are studies which indicate that this method of evaluation could overestimate knee function values, 4 and the need to include specific sport movements in the tests.5 OBJECTIVES: To design a specific RTS protocol for football which is objetivable, adaptable and easily-reproduced. A survey was conducted among 22 professional players (6 defenders, 8 midfielders and 8 forwards) of a second-division Spanish team, which compiled 24 basic football movements based on technique (individual, collective and defensive) and their key actions, according to the Royal Spanish Football Association (RFEF: Real Federación Española de Fútbol) 6, and in which they were asked: - the frequency of executing the action. - the perception of risk associated with the action. - the injuries suffered that were associated with the action. - the conditioning of their mode of play due to the perception of risk of injury. Dependant on the frequency of the action and according to the player’s position, it has been established: 12 common plays, 3 specific plays for defenders, 2 for midfielders and 3 for forwards. A play was identified with a high index of risk perception by the players: jumping off-balance due to contact from a rival. The study outlined the actions suffered by players with a greater injury index, which were confirmed by experts in sports medicine, who completed the protocol The injuries suffered by players did not condicionate significantly their play. An RTS protocol was created, based on the general and specific actions determined in this study, which will be objetived through video analysis among others and through 2 measurements, previously taken during pre-season. Sanders TL, Maradit Kremers H, Bryan AJ, Larson DR, Dahm DL, Levy BA, Stuart MJ, Krych AJ. Incidence of Anterior Cruciate Ligament Tears and Reconstruction: A 21-Year Population-Based Study. Am J Sports Med. 2016 Jun; 44(6):1502-7. Ardern CL, Glasgow P, Schneiders A, Witvrouw E, Clarsen B, Cools A, Gojanovic B, Griffin S, Khan KM, Moksnes H, Mutch SA, Phillips N, Reurink G, Sadler R, Silbernagel KG, Thorborg K, Wangensteen A, Wilk KE, Bizzini M. 2016 Consensus statement on return to sport from the First World Congress in Sports Physical Therapy, Bern. Br J Sports Med. 2016 Jul; 50(14):853-64. van Melick N, van Cingel RE, Brooijmans F, Neeter C, van Tienen T, Hullegie W, Nijhuis-van der Sanden MW. Evidence-based clinical practice update: practice guidelines for anterior cruciate ligament rehabilitation based on a systematic review and multidisciplinary consensus. Br J Sports Med. 2016 Dec; 50(24):1506-1515. Wellsandt E, Failla MJ, Snyder-Mackler L. Limb Symmetry Indexes Can Overestimate Knee Function After Anterior Cruciate Ligament Injury. J Orthop Sports Phys Ther. 2017 Mar 29:1-18. Hoog P, Warren M, Smith CA, Chimera NJ. FUNCTIONAL HOP TESTS AND TUCK JUMP ASSESSMENT SCORES BETWEEN FEMALE DIVISION I COLLEGIATE ATHLETES PARTICIPATING IN HIGH VERSUS LOW ACL INJURY PRONE SPORTS: A CROSS SECTIONAL ANALYSIS. Int J Sports Phys Ther. 2016 Dec; 11(6):945-953. Moreno, M. La técnica aplicada al alto rendimiento. Curso nivel-3 entrenador nacional de fútbol, técnico deportivo superior. 3ª ed. España: Real Federación Española de Fútbol, Escuela Nacional; 2003.