Academic literature on the topic 'Kombinace dat'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Kombinace dat.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Kombinace dat"

1

Rabušicová, Milada, and Klára Záleská. "Metodologické otázky srovnávací pedagogiky: podněty pro koncipování komparativních studií." Pedagogická orientace 26, no. 3 (October 15, 2016): 346–78. http://dx.doi.org/10.5817/pedor2016-3-346.

Full text
Abstract:
Cílem je v kritickém přehledu zhodnotit metodologické postupy, jež se objevily ve srovnávací pedagogice v průběhu jejího nedávného vývoje a jež jsou využívány aktuálně. Zdroje autorky hledaly převážně v zahraniční literatuře posledních dvou dekád. Metodologické otázky srovnávací pedagogiky se obvykle řeší v kategoriích účelů srovnávacích studií (deskripce, analýza, explanace, predikce), výzkumných paradigmat (kvalitativní, kvantitativní, kombinace), výzkumných designů (případové studie, large-scale surveys), různých teoretických a metodologických přístupů (pluralita metod a výzkumných technik), modelů komparace a šířky a hloubky záběru srovnávacích studií (lokální, regionální, globální), využívaných zdrojů (vlastní sběr dat, metaanalýza existujících dat, dokumenty), role výzkumníků a konečně jejich metodologických limitů. Účelem je poskytnout čtenáři obrázek o možných variantách, s nimiž může výzkumník vstupovat do designování své srovnávací studie, a to v některých případech i s příklady již realizovaných srovnávacích výzkumů.
APA, Harvard, Vancouver, ISO, and other styles
2

Widarma, Adi. "COMBINATION AES, RC4 AND ELGAMAL ALGORITHM IN HYBRID SCHEME FOR DATA SECURITY." Computer Engineering, Science and System Journal 1, no. 1 (January 31, 2016): 1–8. http://dx.doi.org/10.24114/cess.v1i1.4040.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Åberg, Carin. "Diskreta ljud: om DAB som radio." MedieKultur: Journal of media and communication research 17, no. 33 (September 4, 2001): 18. http://dx.doi.org/10.7146/mediekultur.v17i33.1190.

Full text
Abstract:
Er DAB (Digital Audio Broadcast) den revolution af radiomediet som det ofte er blevet påstået? I sin analyse af DAB forholder Carin Åberg sig kritisk til den måde DAB og det europæiske forskningsprojekt i di- gital distributionsteknik EUREKA-147 har været markedsført på, bl.a. med mulighed for at selv at sammensætte sit program, forme den lyd- profil man ønsker, modtage hi-fi lyd på højde med bedste cd-kvalitet uden interferens, kombinere lyd, tekst og billeder, og at få en række nye tjenester og et nærmest ubegrænset antal kanaler. I artiklen for- søger Carin Åberg at bestemme nærmere hvori det nye ved DAB egentlig består og hun diskuterer især, hvorvidt teknologien eller de potentielle brugsværdier er drivkraften i udviklingen og hvorvidt ind- førelsen af DAB i den sidste ende kan få fatale konsekvenser for radiomediet som vi kender det i dag.
APA, Harvard, Vancouver, ISO, and other styles
4

Midyanti, Dwi Marisa. "Combination of SOM-RBF for drought code prediction using rainfall and air temperature data." Jurnal Teknologi dan Sistem Komputer 8, no. 1 (November 18, 2019): 64–68. http://dx.doi.org/10.14710/jtsiskom.8.1.2020.64-68.

Full text
Abstract:
This study aims to predict Drought Code (DC) in Kabupaten Kubu Raya using a combination of SOM-RBF. The final weight value of SOM was used as a center on the RBF network. The input data variables are rainfall data and air temperature data for three days with three binary outputs to predict DC values. This study also observed the effect of the number of neurons, learning rates, and the number of iterations on the results of the SOM-RBF network training. The smallest MSE of training result from the SOM-RBF network was 0.159933 using 65 neurons in the hidden layer, learning rate 0.007, and epoch 45000. The detection accuracy of SOM-RBF was 91.34 % from 245 test data.
APA, Harvard, Vancouver, ISO, and other styles
5

Kusumawati, Yuliana, Erni Rustiani, and Almasyuhuri Almasyuhuri. "PENGEMBANGAN TABLET EFERVESEN KOMBINASI BROKOLI DAN PEGAGAN DENGAN KOMBINASI ASAM DAN BASA." Jurnal Fitofarmaka Indonesia 4, no. 2 (September 7, 2017): 231–37. http://dx.doi.org/10.33096/jffi.v4i2.266.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Škarohlíd, Marcel. "Investigation of options to compensate for fuel quality variation by a combination of several control interventions at once." Journal of Middle European Construction and Design of Cars 9, no. 3 (December 1, 2011): 34–46. http://dx.doi.org/10.2478/v10138-011-0018-9.

Full text
Abstract:
SHRNUTÍ Tematem tohoto članku je zkoumani možnosti kompenzace kolisani kvality paliva kombinaci několika regulačnich zasahů najednou. Takto jsou odvozeny pokyny, jak zajistit flexibilitu motoru ohledně paliva co nejefektivnějšim způsobem. Za potencialni regulačni parametry jsou uvažovany uhel předstihu zažehu, nastaveni plniciho tlaku a poměr recirkulace vyfukovych plynů. Matematicka simulace je použivana jako preferovany způsob zkoumani s cilem ziskat co nejvice obecne vysledky. Použivane simulačni nastroje byly kalibrovany pomoci experimentalnich dat z testovaneho motoru.
APA, Harvard, Vancouver, ISO, and other styles
7

Burhan, Asril, Marwati Marwati, Besse Hardianti, and Waode Ratnasari Hasan. "UJI ANTI INFLAMASI EKTRAK KOMBINASI TERIPANG PASIR (HOLOTHURIA SCABRA) DAN DAUN KERSEN (MUNTINGIA CALABURA L.) PADA TIKUS (RATTUS NORVEGICUS)." Jurnal Ilmiah Manuntung 5, no. 1 (June 19, 2019): 26. http://dx.doi.org/10.51352/jim.v5i1.204.

Full text
Abstract:
Teripang pasir (Holothuria scabra) dan daun kersen (Muntingia calabura L.) digunakan sebagai obat tradisional yang memiliki aktivitas antiinflamasi. Penelitian ini bertujuan untuk mengetahui aktivitas antiinflamasi dari kombinasi ekstrak etanol teripang pasir dan daun kersen terhadap penurunan udem pada kaki tikus yang telah diinduksi dengan karagenan 1%. Tikus kemudian dibagi menjadi 5 kelompok dan masing-masing kelompok terdiri dari 3 ekor tikus. Kelompok 1 sebagai kontrol positif, kelompok 2 sebagai kontrol negatif, kelompok 3 sebagai kombinasi ekstrak 1:1 (200 mg/kgBB:200 mg/kgBB), kelompok 4 sebagai kombinasi ekstrak 1:2 (200 mg/kgBB:400 mg/kgBB), kelompok 5 sebagai kombinasi ekstrak 2:1 (400 mg/kgBB:200 mg/kgBB), dan masing-masing kelompok diberikan secara peroral. Pada EK 2:1 memiliki efek antiinflamasi yang sama dengan kontrol positif dengan %DAI, yaitu 4,84%. Sedangkan pada EK 1:2 dengan %DAI 4,24% dan EK 1:1 dengan %DAI 1,81%.
APA, Harvard, Vancouver, ISO, and other styles
8

Meila, Okpri, and A. Triwildan ST Fatimah. "Analisis Efektivitas Biaya Kombinasi Direct Acting Antivirals (DAA) Pada Pasien Hepatitis C Di RSUD Jakarta Selatan." Pharmacoscript 2, no. 2 (February 29, 2020): 67–86. http://dx.doi.org/10.36423/pharmacoscript.v2i2.389.

Full text
Abstract:
Tatalaksana penyakit hepatitis C telah mengalami perubahan dari terapi berbasis PEG-interferonke terapi golongan Direct Acting Antiretroviral(DAA) seperti daclastavir, sofobusvir dan simeprevir. DAA terbukti memiliki efektifitas lebih tinggi dengan pencapaian Sustained Virological Response (SVR) di atas 95%, dengan penggunaan oral dan efek samping yang rendah, namun biaya terapi kombinasi DAA tetap tinggi. Ada beberapa pedoman tatalaksana terapi, namun belum diketahui terapi mana yang lebih efektif dan efisien pada golongan tertentu. Tujuan dari penelitian adalah untuk membandingkan cost effectivedalam penggunaan obat hepatitis Ckombinasi sofobusvir – daclastavir (S-D) dengan kombinasi sofobusvir – simeprevir (S-S). Metode penelitian ini menggunakan rancangan deskripsi analitik secara potong lintang dan pengambilan data dilakukan secara retrospektif dari rekam medis penderita hepatitis C sementara data rincian biaya pengobatan diperoleh dari bagian keuangan pasien rawat jalan di RSUD Tebet Jakarta Selatan periode Januari 2017 – Oktober 2018. Jumlah sampel sebanyak 62 pasien yang terdiri dari 31 pasien menggunakan kombinasi S-D dan 31 pasien menggunakan S-S. Parameter yang digunakan dalam penelitian ini hanya biaya pengobatan langsung (yang meliputi biaya pemeriksaan, biaya laboratorium dan biaya obat), sedangkan efektivitasnya menggunakan nilai sustained virological response(SVR -12). Hasil penelitian menunjukkan efektivitas terapi paling besar untuk mencapai nilai SVR-12 negatif adalah kombinasi sofobusvir - daclastavir yaitu sebanyak 31 pasien (100%), sedangkan kombinasi S-S hanya 29 pasien (93,55%) yang mencapai nilai SVR-12 negatif. Sementara efektivitas biaya berdasarkan nilai ACER pada kombinasi S-D dan kombinasi S-S secara berurutan adalah Rp. 29,037,937/pasien dan Rp. 40,686,453/pasien, sementara nilai ICER sebesar yaitu sebesar -Rp 4,511,792. Dapat disimpulkan bahwa kombinasi S-Dlebih cost effective dibandingkan kombinasi S-S
APA, Harvard, Vancouver, ISO, and other styles
9

Widiasa, I. Nyoman, A. A. Susanto, and B. Budiyono. "KOMBINASI ULTRAFILTRASI DAN DISSOLVED AIR FLOTATION UNTUK PEMEKATAN MIKROALGA." Reaktor 15, no. 1 (March 30, 2014): 43. http://dx.doi.org/10.14710/reaktor.15.1.43-50.

Full text
Abstract:
Abstrak Mikroalga merupakan mikroorganisme fotosintetik prokariotik atau eukariotik yang dapat tumbuh dengan cepat. Pemanfaatan mikroalga tidak hanya berorientasi sebagai pakan alami untuk akuakultur, tetapi terus berkembang untuk bahan baku produksi pakan ternak, pigmen warna, bahan farmasi (β-carotene, antibiotik, asam lemak omega-3), bahan kosmetik, pupuk organik, dan biofuel (biodiesel, bioetanol, biogas, dan biohidrogen. Studi ini bertujuan untuk menginvestigasi kombinasi ultrafiltrasi (UF) – dissolved air flotation (DAF) untuk pemekatan mikroalga skala laboratorium. Hasil penelitian menunjukkan bahwa penurunan fluks membran UF secara tajam sebagai akibat dari deposisi sel mikroalga terjadi pada 20 menit pertama proses filtrasi. Backwash pada interval 20 menit selama 10 detik dengan tekanan 1 bar memberikan pengendalian fouling yang efektif dalam nilai kestabilan fluks yang layak. Membran UF yang digunakan dapat memberikan selektivitas pemisahan biomassa mikroalga ~ 100%. Kualitas permeat sangat stabil, yaitu kekeruhan < 0,5 NTU, kandungan organik < 10 mg/L, dan warna < 10 PCU. Lebih lanjut, pemekatan retentat membran dengan DAF pada tekanan saturasi 6 bar dapat menghasilkan pasta mikroalga dengan konsentrasi 20 g/L. Koagulan PAC perlu ditambahkan kedalam umpan DAF dengan dosis 1,3–1,6 mg PAC/mg padatan tersuspensi. Kata Kunci: ultrafiltrasi; dissolved air flotation; pemanenan mikroalga; pemekatan mikroalga Abstract COMBINATION OF Ultrafiltration and Dissolved Air Flotation for Microalgae CONCENTRATION. Microalgae is a prokaryotic photosynthetic microorganism or eukaryotic microorganism that proliferate rapidly. Cultivation of the microalgae is not only oriented as natural food for aquacultures, but also developed for animal food, color pigment, pharmaceutical raw material (β-carotene, antibiotic, fatty acid omega-3), cosmetic raw material, organic fertilizer, and biofuels (biodiesel, bioethanol, biogas, and biohydrogen. This study is aimed to investigate the potential of combination of ultrafiltration (UF) and dissolved air flotation (DAF) for concentration of microalgae in laboratory scale. The experimental results showed that fluxes of the UF membrane decreased sharply due to deposition of microalgae biomass during first 20 minutes of filtration. Periodically backwash using the UF permeate (backwash interval = 20 minutes; backwash duration = 10 seconds; backwash pressure = 1 bar) gave an effective fouling control to maintain reasonable stable fluxes. In addition, the UF membrane gave separation of microalgae biomass ~ 100%. Permeate quality is strongly stable in which turbidity < 0.5 NTU, organic content < 10 mg/L, and color < 10 PCU. Moreover, concentration of the UF retentate by DAF under saturation pressure of 6 bars was able to produced microalgae feedstock having 20 g/L dry microalgae. PAC is required for DAF feed with dosage of 1.3–1.6 mg PAC/mg suspended solids.
APA, Harvard, Vancouver, ISO, and other styles
10

Dwinda, Rossy, Puji Harsono, and Enggar Apriyanto. "Respon Pertumbuhan Dan Hasil Tiga Varietas Sorgum Terhadap Pemberian Pupuk Kandang Dan Mikoriza." Naturalis: Jurnal Penelitian Pengelolaan Sumber Daya Alam dan Lingkungan 7, no. 1 (October 23, 2019): 51–58. http://dx.doi.org/10.31186/naturalis.7.1.9260.

Full text
Abstract:
Penelitian ini bertujuan untuk membandingkan pertumbuhan dan hasil tiga varietas sorgum pada lahan pesisir dan tiga kombinasi pupuk kandang + mikoriza, serta mengetahui pengaruh interaksi varietas dengan kombinasi pupuk kandang + mikoriza terhadap pertumbuhan dan hasil sorgum. Penelitian ini dilaksanakan pada bulan Mei-Juli 2017 di Desa Kandang Mas Kecamatan Kampung Melayu. Penelitian ini menggunakan rancangan acak kelompok lengkap faktorial dengan dua faktor yaitu varietas dan kombinasi pupuk kandang + mikoriza. Hasil penelitian menunjukkan bahwa pada lahan pesisir varietas numbu memiliki pertumbuhan dan hasil lebih tinggi dari varietas Kawali dan B100. Kombinasi pupuk kandang 10 ton/ha + mikoriza 10 gr/tanaman menghasilkan pertumbuhan dan hasil yang lebih tinggi dari kombinasi pupuk kandang 5 ton/ha + mikoriza 5 gr/tanaman dan kombinasi tanpa pupuk kandang dan mikoriza. Interaksi antara varietas sorgum dengan kombinasi pupuk kandang dan mikoriza menunjukkan bahwa kedua faktor tersebut memberikan pengaruh terhadap tinggi tanaman, diameter batang, berat kering pertanaman dan kadar gula sorgum.Kata Kunci : Lahan Pesisir, Varietas Sorgum, Pupuk Kandang, Mikoriza
APA, Harvard, Vancouver, ISO, and other styles

Dissertations / Theses on the topic "Kombinace dat"

1

Stránská, Petra. "Kombinace laserových a snímkových dat z mobilního mapovacího systému." Master's thesis, Vysoké učení technické v Brně. Fakulta stavební, 2021. http://www.nusl.cz/ntk/nusl-444257.

Full text
Abstract:
The diploma thesis describes the data integration of data from different 3D technologies, specifically data of close range photogrammetry, aerial photogrammetry using RPAS and terrestrial laser scanning. The thesis deals mainly with fotogrammetric processing in ContextCapture software and data integration in this software. The thesis also describes a construction of a calibration field. The points of the field were used as ground control points and check points during processing. The accuracy of the outputs was evaluated by statistical testing of the coordinate deviations of the control points. The result of the thesis is 3D model of one of the buildings located in the AdMaS research center.
APA, Harvard, Vancouver, ISO, and other styles
2

Chudán, David. "Association rule mining as a support for OLAP." Doctoral thesis, Vysoká škola ekonomická v Praze, 2010. http://www.nusl.cz/ntk/nusl-201130.

Full text
Abstract:
The aim of this work is to identify the possibilities of the complementary usage of two analytical methods of data analysis, OLAP analysis and data mining represented by GUHA association rule mining. The usage of these two methods in the context of proposed scenarios on one dataset presumes a synergistic effect, surpassing the knowledge acquired by these two methods independently. This is the main contribution of the work. Another contribution is the original use of GUHA association rules where the mining is performed on aggregated data. In their abilities, GUHA association rules outperform classic association rules referred to the literature. The experiments on real data demonstrate the finding of unusual trends in data that would be very difficult to acquire using standard methods of OLAP analysis, the time consuming manual browsing of an OLAP cube. On the other hand, the actual use of association rules loses a general overview of data. It is possible to declare that these two methods complement each other very well. The part of the solution is also usage of LMCL scripting language that automates selected parts of the data mining process. The proposed recommender system would shield the user from association rules, thereby enabling common analysts ignorant of the association rules to use their possibilities. The thesis combines quantitative and qualitative research. Quantitative research is represented by experiments on a real dataset, proposal of a recommender system and implementation of the selected parts of the association rules mining process by LISp-Miner Control Language. Qualitative research is represented by structured interviews with selected experts from the fields of data mining and business intelligence who confirm the meaningfulness of the proposed methods.
APA, Harvard, Vancouver, ISO, and other styles
3

Pulcmanová, Eva. "IFRS 3 Podnikové kombinace." Master's thesis, Vysoká škola ekonomická v Praze, 2008. http://www.nusl.cz/ntk/nusl-72002.

Full text
Abstract:
International Financial Reporting Standard IFRS 3 Business Combinations settles the rules of identifying, measuring, accounting and reporting for the business combinations. It decides, what is, or is not, a business combination, and explains different types of it. It asks an acquirer to use the acquisition method for accounting for the business combination at the date of acquisition. Especially to correctly recognize all the assets and liabilities acquired in the business combinations, to measure them at their fair value at the date of acquisition, to measure goodwill, and to report the information on business combination required in his financial statements. This thesis deals with the most important aspects of the business combinations, especially mergers. It explains also the most significant differences of the standard IFRS 3 Business combinations compared to the previous vision, and to some national legal regulations, and mentions also the probable development of the international accounting in the future. An attention is given also to the cross-border acquisitions. In its practical part, the thesis focuses to evaluation of fulfilling the requirements to disclose information on business combination in practice.
APA, Harvard, Vancouver, ISO, and other styles
4

Svízela, Josef. "Fúze obchodních společností v ČR - aspekty a přístupy v oceňování při fúzích." Master's thesis, Vysoká škola ekonomická v Praze, 2010. http://www.nusl.cz/ntk/nusl-75566.

Full text
Abstract:
Work is about corporation mergers in the first place in Czech Republic and about valuation issues. It brings comprehensive view into particular business areas in which are mergeres concerned. It is going about business-legal area, tax and accounting area. Particular sections about these areas are supplemented by the role of the expert in valuation and his opinion. Whole work is ilustrated by the exapmple from praxis.
APA, Harvard, Vancouver, ISO, and other styles
5

Dvořáková, Zuzana. "Účetní řešení fúzí obchodních společností s důrazem na oceňování." Master's thesis, Vysoká škola ekonomická v Praze, 2011. http://www.nusl.cz/ntk/nusl-85361.

Full text
Abstract:
This thesis is focused on mergers with an emphasis on valuation. It deals mainly with economic, legal, accounting and tax aspects. These aspects are enriched by the amendment of laws that come into legal force from 2012. The thesis is complemented by expert valuation process, without which most of the mergers could not be realized. Final part of this thesis describes concrete national merger of three companies stating the accounting treatment.
APA, Harvard, Vancouver, ISO, and other styles
6

Fritsche, Detlev. "Mit Prototyprekonstruktion zum Welthöchststand?" Saechsische Landesbibliothek- Staats- und Universitaetsbibliothek Dresden, 2014. http://nbn-resolving.de/urn:nbn:de:bsz:14-qucosa-140338.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Fritsche, Detlev. "Mit Prototyprekonstruktion zum Welthöchststand?: PC-Software in den letzten Jahren der DDR." Technische Universität Dresden, 2005. https://tud.qucosa.de/id/qucosa%3A27887.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Fujdiak, Radek. "Analýza a optimalizace datové komunikace pro telemetrické systémy v energetice." Doctoral thesis, Vysoké učení technické v Brně. Fakulta elektrotechniky a komunikačních technologií, 2017. http://www.nusl.cz/ntk/nusl-358408.

Full text
Abstract:
Telemetry system, Optimisation, Sensoric networks, Smart Grid, Internet of Things, Sensors, Information security, Cryptography, Cryptography algorithms, Cryptosystem, Confidentiality, Integrity, Authentication, Data freshness, Non-Repudiation.
APA, Harvard, Vancouver, ISO, and other styles
9

Křížková, Heda. "Diverzita řas z červeného sněhu v Evropě: kombinace molekulárních a morfologických dat." Master's thesis, 2017. http://www.nusl.cz/ntk/nusl-355816.

Full text
Abstract:
We can find a lot of microorganisms living in snow including psychrophilic snow algae from the order Chlamydomonadales (Chlorophyta). They are adapted to the extreme conditions in this habitat and can cause the phenomenon of coloured snow. The species Chlamydomonas nivalis (Bauer) Wille is the most commonly associated with red snow in alpine and polar regions during summer season worldwide. In the field material, we can find red spherical cells without flagella and any morphological characteristics suitable for species determination. Until now, this species has not been isolated into laboratory culture and its life cycle is unclear. Furthermore it has been shown that red coloured snow can be caused by more species which used to be determined as Chlamydomonas nivalis. The aim of this study was to collect samples of red snow from different parts of Europe, to describe the morphological variability of Chlamydomonas nivalis-like snow algae in relation to region of origin, to try to isolate laboratory strain of this species and to describe its position and distribution by phylogenetic analysis of laboratory strains and field samples. Red snow samples were collected from 30 European localities in Slovenian Alps, Romania, Dolomites, Ötztal, Wallis and Sarntal Alps, High Tauern, Ortler massif, in Norway,...
APA, Harvard, Vancouver, ISO, and other styles

Books on the topic "Kombinace dat"

1

Krakat, Klaus. Rechnergestützte Leitungsinformationssysteme in Kombinaten und Betrieben der DDR-Industrie. Berlin: A. Spitz, 1988.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Sabri, Muhammad. Presiden tersandera: Dampak kombinasi sistem presidensial dan multipartai dalam pemerintahan SBY-Boediono. Jakarta: RMBooks, 2012.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Citra, Lamtoro Gung Persada PT. Kombinasi jalan tol dan LRT (Light Rail Transit) utara-selatan di D.K.I Jakarta. [Jakarta]: Citra Lamtoro Gung Persada, 1995.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
4

Moyoretno, Bambang. Laporan akhir kegiatan pengembangan disain kombinasi batik dan tritik jumputan untuk pasar Okinawa. Yogyakarta: Departemen Perindustrian, Badan Penelitian dan Pengembangan Industri, Balai Besar Kerajinan dan Batik, 2006.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Buthmann, Reinhard. Kadersicherung im Kombinat VEB Carl Zeiss Jena: Die Staatssicherheit und das Scheitern des Mikroelektronikprogramms. Berlin: Ch. Links, 1997.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Ismudiono. Induksi kelahiran kembar melalui kombinasi teknik tran[s]fer embrio dan unseminasi [i.e. inseminasi] buatan. [Surabaya]: Lembaga Penelitian, Universitas Airlangga, 1995.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

Nandariyah. Perbedaan jenis tetua jantan dalam kombinasi persilangan terhadap hasil dan kualitas salak pondoh (Salacca edulis Rein W): Laporan penelitian. [Surakarta]: Fakultas Pertanian, Universitas Sebelas Maret, 1997.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Biermann, Wolfgang. Das Kombinat VEB Carl Zeiss Jena in den 80er Jahren: Vortragsreihe an der Friedrich-Schiller-Universität Jena mit 4 Vorträgen. Jena: Die Universität, 1985.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

Grace, Nani. Dukungan teknologi informasi dalam mempercepat proses eksternalisasi (tacit-eksplisit) dan kombinasi (eksplisit-eksplisit) pada lembaga litbang: Kasus LIPI : kegiatan penyebaran dan saling berbagi pengetahuan pada intra-LIPI. Jakarta: Lembaga Ilmu Pengetahuan Indonesia, Pusat Penelitian Perkembangan Iptek, 2005.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

Nedashkovsʹka, O. V., O. V. Nedashkovsʹka, and Dmytro Volodymyrovych Ilʹïnkov. Vstrecha s proshlym: Pami︠a︡tnyĭ alʹbom : DAK 1932-1934 gg., DAZ 1935-1990 gg., ZAlK 1991 g. Zaporoz︠h︡ʹe: RA "Tandem-U", 2007.

Find full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Kombinace dat"

1

Laraswati, Rini, Evan Purnama Ramdan, and Umi Kulsum. "Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.234.

Full text
Abstract:
Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.
APA, Harvard, Vancouver, ISO, and other styles
2

Setyoko, Hari, Bambang Sukamto, Fajar Wahyono, and Lilik Krismiyanto. "Kecernaan Lemak Kasar dan Bobot Karkas Ayam Broiler Akibat Penambahan Ekstrak Buah Mengkudu (Morinda citrifolia L.) dan Lactobacillus acidophilus." In Kedaulatan Pangan Nasional Melalui Pengembangan Potensi Ternak Lokal di Era Kenormalan Baru. Animal Science : Polije Proceedings Series, 2020. http://dx.doi.org/10.25047/proc.anim.sci.2020.19.

Full text
Abstract:
Penelitian ini bertujuan untuk mengetahui pengaruh penambahan kombinasi Ekstrak Buah Mengkudu (EBM) dan Lactobacillus acidophilus (LA) terhadap kecernaan lemak kasar, persentase lemak abdominal, dan bobot karkas ayam broiler. Rancangan penelitian yang digunakan adalah Rancangan Acak Lengkap (RAL) pola faktorial 3x3 dengan 9 perlakuan dan 3 ulangan (setiap unit percobaan berisi 7 ekor ayam broiler). Perlakuan yang diterapkan pada penelitian yaitu A1B1 = EBM 0,04% + LA 0%; A1B2 = EBM 0,04% + LA 0,6%; A1B3 = EBM 0,04% + LA 1,2%; A2B1 = EBM 0,08% + LA 0%; A2B2 = EBM 0,08% + LA 0,6%; A2B3 = EBM 0,08% + LA 1,2%; A3B1 = EBM 0,12% + LA 0%; A3B2 = EBM 0,12% + LA 0,6%; A3B3 = EBM 0,12% + LA 1,2%. Parameter yang diukur meliputi kecernaan lemak kasar, persentase lemak abdominal, dan bobot karkas ayam broiler. Hasil penelitian dianalisis ANOVA. Apabila terdapat perbedaan tingkat signifikansi maka dilakukan uji lanjut dengan Uji Jarak Berganda Duncan. Hasil menunjukkan bahwa penambahan kombinasi EBM dan LA berpengaruh nyata (p<0,05) terhadap kecernaan lemak kasar, persentase lemak abdominal, dan bobot karkas ayam broiler. Kesimpulan penelitian yaitu penambahan kombinasi ekstrak buah mengkudu pada taraf 0,12% dan Lactobacillus acidophilus 1,2% dapat meningkatkan kecernaan lemak kasar dan bobot karkas namun menurukan persentase lemak abdominal.
APA, Harvard, Vancouver, ISO, and other styles
3

Lestari, Shyntiya Ayu, Evan Purnama Ramdan, and Umi Kulsum. "Identifikasi Penyebab Penyakit Blas Padi Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.235.

Full text
Abstract:
Blas merupakan penyakit penting tanaman padi yang dapat menginfeksi bagian daun dan leher malai. Pengenalan penyebab penyakit penting dilakukan untuk menentukan pengendalian yang tepat. Penelitian ini akan mengidentifikasi penyebab penyakit blas padi pada kombinasi pola tanam SRI dan Jajar legowo. Penelitian dilaksanakan pada bulan Agustus sampai September 2020 di BBPOPT Jatisari, Karawang. Pengamatan lapang dilakukan pada pada 6 petak sawah dengan pola tanam berbeda, meliputi P1: SRI + jarwo 2:1, P2: SRI + jarwo 3:1, P3: SRI + jarwo 4:1, P4: SRI + jarwo 5:1, P5: SRI tanpa kombinasi jarwo, dan P6: Sistem tanam tegal (kontrol). Setiap petak kemudian dibagi menjadi 5 sub petak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Setiap petakan kemudian diamati gejala, kejadian, dan keparahan penyakit. Padi yang menunjukkan gejala blas kemudian di bawa ke Laboratorium Fitopatologi BBPOPT untuk diidentifikasi secara morfologi. Hasil penelitian menunjukkan bahwa gejala blas padi yang ditemukan berupa bercak coklat belah ketupat dengan tepi runcing. Pada bagian tengah bercak berwarna abu-abu dan warna coklat dan sedikit orange di bagian tepi bercak. Adapun persentasi kejadian dan keparahan penyakit berturut-turut sebesar 43.33-46.50% dan 26-28% dengan kategori serangan sedang. Identifikasi secara morfologi menunjukkan bahwa penyebab penyakit blas padi pada kombinasi pola tanam SRI dan jajar legowo adalah Pyricularia grisea yang dicirikan dengan konidia berbentuk oval, agak runcing dibagian ujung, memiliki 2 sampai 3 sekat, dan ujung pangkal konidia tumpul.
APA, Harvard, Vancouver, ISO, and other styles
4

"Respons Keragaan Produksi Telur Itik Alabio melalui Pemberian Artificial Light Metode Ahemeral Menggunakan Kombinasi Intensitas dan Warna Cahaya Monochromatic LED." In Teknologi Peternakan dan Veteriner Mendukung Kemandirian Pangan di Era Industri 4.0. Pusat Penelitian dan Pengembangan Peternakan, 2019. http://dx.doi.org/10.14334/pros.semnas.tpv-2019-p.747-755.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

"Respons Keragaan Produksi Telur Itik Alabio melalui Pemberian Artificial Light Metode Ahemeral Menggunakan Kombinasi Intensitas dan Warna Cahaya Monochromatic LED." In Teknologi Peternakan dan Veteriner Mendukung Kemandirian Pangan di Era Industri 4.0. Pusat Penelitian dan Pengembangan Peternakan, 2019. http://dx.doi.org/10.14334/pros.semnas.tpv-2019-p.759-770.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

"Uji Pendahuluan Kombinasi Tiga Jenis Ekstrak Tanaman sebagai Alternatif Antibiotik Growth Promoter terhadap Performans Ayam dan Jumlah Escherichia coli dalam Sekum Ayam." In Teknologi Peternakan dan Veteriner Mendukung Kemandirian Pangan di Era Industri 4.0. Pusat Penelitian dan Pengembangan Peternakan, 2019. http://dx.doi.org/10.14334/pros.semnas.tpv-2019-p.610-616.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Arisah, Hidayatul, Baiq Dina Mariana, and Marry Selvawajayanti. "Kajian Konsentrasi Media dan Hormon untuk Konservasi Apel In Vitro." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.220.

Full text
Abstract:
Konservasi tanaman tahunan seperti apel umumnya dilakukan di lapang. Namun, karena beberapa kendala yang dipicu oleh perubahan iklim dan serangan hama dan penyakit, diperlukan sistem konservasi yang lebih efisien, misalnya secara in vitro. Konservasi in vitro adalah alternatif untuk melestarikan tanaman yang diperbanyak secara klonal seperti apel. Penelitian ditujukan untuk melihat pengaruh perbedaan konsentrasi media dan ZPT untuk konservasi apel secara in vitro. Penelitian ini dilakukan di Laboratorium Terpadu Baltjestro dari Agustus hingga Desember 2018. Media yang diuji adalah Media MS dengankonsentrasi garam penuh (FS) dan setengah (HS) dengan penambahan BA. Aksesi yang diuji adalah K60, K66, K01, K84 dan batang bawah apel. Hasil penelitian menunjukkan bahwa media MS FS lebih baik dalam mempertahankan eksplan hidup daripada HS selama empat bulan konservasi tanpa subkultur. Kombinasi MS FS dan BA 0.1 mg L-1 memberikan hasil terbaik untuk konservasi apel untuk aksesi K01 dan K66.
APA, Harvard, Vancouver, ISO, and other styles
8

Megasari, S. W., and Winayati Winayati. "Analisis Karakteristik Beton dengan Kombinasi Bahan Tambah Plastiment-VZ dan Sikament-NN Pada Pekerjaan Rigid Pavement di Provinsi Riau." In SEMINAR NASIONAL Strategi Pengembangan Infrastruktur ke-3. ITP Press, 2017. http://dx.doi.org/10.21063/spi3.1017.117-124.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Fajaryanti, Yuli, Rahmat Ali Syaban, and Hari Prasetyo. "Peningkatan Produksi dan Mutu Benih Kacang Hijau Melalui Penggunaan Pupuk Kandang Ayam dan Mikroorganisme Lokal Daun Gamal." In Seminar, Expo dan Diskusi (SEEDs) Perbenihan Nasional 2017. Jember: AGROPROSS, National Conference Proceedings of Agriculture, 2017. http://dx.doi.org/10.25047/agropross.2017.54.

Full text
Abstract:
Pupuk kandang ayam dan larutan mikroorganisme lokal daun gamal dapat meningkatkan hasil panen kacang hijau. Penelitian dosis pupuk kandang ayam dan konsentrasi larutan mikro organisme lokal (MOL) daun gamal yang optimal untuk meningkatkan hasil panen kacang hijau sangat diperlukan. Penelitian dilaksanakan di Kebun Percobaan dan Laboratorium Teknologi Benih Politeknik Negeri Jember pada Agustus 2015 sampai Desember 2015. Tujuan penelitian mengetahui pengaruh dosis pupuk kandang ayam dan konsentrasi MOL daun gamal terhadap hasil panen kacang hijau varietas Vima-1. Penelitian menggunakan RAK Faktorial. Faktor pertama adalah dosis pupuk kandang ayam terdiri atas tiga taraf yaitu dosis 250, 500 dan 750 gram/polybag. Faktor kedua adalah konsentrasi larutan MOL daun gamal terdiri atas tiga taraf yaitu 60, 90 dan 120 ml/liter. Kombinasi perlakuan diulang tiga kali. Analisis menggunakan ANOVA, dilanjutkan dengan uji DMRT. Hasil penelitian menunjukkan terdapat pengaruh interaksi antara dosis pupuk kandang ayam dan (MOL) daun gamal terhadap bobot basah, bobot kering, jumlah polong, bobot biji per tanaman, sedangkan Berat 100 Butir, daya Kecambah, kecepatan tumbuh dan keserempakan tumbuh menunjukkan berbeda tidak nyata. Dosis pupuk kandang ayam 250 g/polybag dengan konsentrasi MOL daun gamal 120 ml/l menunjukkan bobot basah, bobot kering, jumlah polong tertinggi. Aplikasi pupuk kandang ayam dengan MOL daun gamal dapat meningkatkan berat 100 Butir, daya Kecambah, kecepatan tumbuh dan keserempakan tumbuh benih kacang hijau.
APA, Harvard, Vancouver, ISO, and other styles
10

Atmojo, Ragil Dwi, Hanggara Arifian, Arsyik Ibrahim, and Rolan Rusli. "AKTIVITAS PENURUNAN GULA DARAH KOMBINASI EKSTRAK DAUN KUMIS KUCING (ORTHOSIPHON ARISTATUS) DAN EKSTRAK DAUN INSULIN (TITHONIA DIVERSIVOLIA) TERHADAP MENCIT (MUS MUSCULUS)." In the 4th Mulawarman Pharmaceuticals Conferences. Fakultas Farmasi, Universitas Mulawarman, Samarinda, 2016. http://dx.doi.org/10.25026/mpc.v4i1.193.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "Kombinace dat"

1

Amzeri, Achmad. Evaluasi Nilai Heterosis dan Heterobeltiosis Pada Persilangan Dialel Tanaman Jagung Madura (Zea mays L.). Universitas Islam Madura, December 2016. http://dx.doi.org/10.21107/amzeri.2016.1.

Full text
Abstract:
Identifikasi heterosis dan heterobeltiosis pada persilangan dialel diantara galur inbrida Madura sangat dibutuhkan sebagai dasar untuk merakit varietas jagung hibrida yang sesuai untuk dikembangkan di Madura. Penelitian ini bertujuan mengidentifikasi kombinasi persilangan yang menunjukkan nilai heterosis dan heterobeltiosis terbaik untuk karakter kegenjahan, penunjang produksi dan produksi per hektar. Penelitian ini dilaksanakan di Kebun Percobaan Fakultas Pertanian Universitas Trunojoyo Madura. Bahan tanaman yang digunakan adalah 6 genotip galur inbred jagung madura (UTM 2, UTM 7, UTM 14, UTM 14, UTM 15, UTM 18, dan UTM 22), dan 30 hibrida hasil persilangan dialel penuh (full diallel cross) antar 6 genotip galur inbred. Rancangan percobaan yang digunakan adalah rancangan kelompok lengkap teracak (RKLT) faktor tunggal, yaitu genotipe dengan tiga ulangan sehingga terdapat 108 satuan percobaan. Karakter yang diamati adalah umur berbunga, umur panen, diameter tongkol, panjang tongkol, bobot 100 biji, dan produksi per hektar. Persilangan yang menghasilkan nilai heterosis dan heterosbeltiosis terbaik untuk umur genjah adalah UTM14 x UTM18, UTM15 x UTM2 dan UTM18 x UTM2. Hasil persilangan untuk karakter diameter tongkol, panjang tongkol dan berat 100 biji sebagian besar menghasilkan nilai heterosis dan heterobeltiosis bernilai positif. Pada karakter produksi per hektar nilai heterosis dan heterobeltiosis tertinggi pada persilangan UTM2 x UTM14 (214,742%) dan UTM2 x UTM18 (171,585%).
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography