Journal articles on the topic 'Jordan Brown'

Most of the forests of the Amazon basin grow on nutrient-poor soils (Jordan 1982). Despite this, these forests remain productive through a variety of nutrient conservation mechanisms and a very effective system of organic matter decomposition and nutrient cycling (Jordan 1982). When an area of forest is fragmented however, the remaining patches experience modified microclimatic conditions (Camargo & Kapos 1995, Didham & Lawton 1999), and changes in floristic composition (Laurance et al. 1998), which can affect the decomposer community (Didham et al. 1996, Souza & Brown 1994) and consequently the decomposition process.

Tomato brown rugose fruit virus (ToBRFV; genus, Tobamovirus, family, Virgaviridae) was first reported in 2015 infecting tomatoes grown under protected cropping in the Jordan Valley. Since then, ToBRFV has been detected in tomatoes grown in both protected and open fields across Jordan. The increased incidence of ToBRFV prompted this investigation of the potential role of natural weed hosts in the dissemination of ToBRFV. A survey was conducted in the Jordan Valley and highlands to determine possible reservoir hosts of ToBRFV in fields and greenhouse complexes in which tomatoes were grown. Detection of ToBRFV infection was made by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and further confirmation by reverse-transcription polymerase chain reaction (RT-PCR), followed by DNA cloning and sequencing, and bioassays. Thirty weed species belonging to twenty-six genera from sixteen families were tested. Twelve species belonging to eight families were infected of which ten species are newly reported hosts for ToBRFV. Seed transmission of ToBRFV in Solanum nigrum was confirmed in a grow-out experiment. To our knowledge, this is the first report of the natural occurrence of ToBRFV on weed hosts. Identification of natural reservoirs of ToBRFV can help to develop management practices focused on weed plant species to prevent ToBRFV transmission. The extent to which ToBRFV survives in diverse alternate weed host species outside tomato growing seasons in different world regions requires further research in order to establish the risk associated with the possible contribution of weeds as a reservoir for primary infections in tomato crops.

Review of: Free Play: Open Source Scripts Towards an Anti-Racist Tomorrow, Idris Goodwin, directed by Adam StevensCollideOscope Repertory Theatre Company, New York University, New York City, New York, Online (Zoom), 9‐11 October, 2020, with Michelle Buckle, Treasure Tannock, Brandon J. Elam, Barbara Bethea, Keynessa Nazaire, Jordan Stewart, Zahra Warner, Mary Morris, Vicky Castain, Daniel Brown, Chantal Georges and Jason Butler

Two new species of ophichthid eels, subfamily Ophichthinae, are described and illustrated from specimens collected from Myanmar by the R/V Dr. Fridtjof Nansen. Included are: Ophichthus nansen sp. nov., from 103–106 m depth, which is unique in its vertebral number (11-53-116), dorsal-fin origin (above mid-pectoral fin), jaw dentition (small, conical and mostly biserial), and coloration (dark gray-brown, fins black); and Ophichthus naga sp. nov., from 455–459 m depth, which is unique in its vertebral number (15-65-153), dorsal-fin origin (well behind pectoral fin), dentition (small, conical, biserial in upper jaw and uniserial in lower jaw and on vomer), and dark brown coloration. Also new to Myanmar are Ophichthus cephalozona Bleeker, 1864, and O. lithinus (Jordan & Richardson, 1908), which are diagnosed and treated herein.

Eight species are recognised in the Aphanius dispar group. Aphanius dispar from the Red and Mediterranean Sea basins, A. stoliczkanus from coastal areas of the Arabian/Persian Gulf, the northern Arabian Sea east to Gujarat in India, the Gulf of Oman and some endorheic basins in Iran and Pakistan, A. richardsoni from springs in the Dead Sea basin in Jordan and Israel, A. sirhani from the Azraq Oasis in Jordan, A. ginaonis from one spring in Iran, A. furcatus from few streams and springs in Iran and A. stiassnyae from one lake in Ethiopia. Aphanius kruppi, new species, from the Wadi al Batha drainage in northern Oman, is distinguished from adjacent A. stoliczkanus by having 9–14 brown or grey lateral bars on the flank in the male, a roundish, diamond-shaped or somewhat vertically-elongate blotch centred on the caudal-fin base in the female and 2–3 scale rows on the caudal-fin base. The available molecular genetic data for A. dispar reject the hypothesis of the presence of a single widespread coastal species in the Middle East and make it likely that two additional unidentified species occur in the Red Sea basin.

This study investigated gender differences in depression among volunteer undergraduates (N = 8,538) recruited from 17 Islamic countries. The Beck Depression Inventory II (Beck, Steer, & Brown, 1996), was used in its Arabic form for all groups except the Pakistan group, which used the English version. Results indicated that there are significant gender differences in 9 of the Islamic countries in which females tended to be higher in depression namely, Iraq, Syria, Egypt, Pakistan, Algeria, Oman, Qatar, Morocco, and Kuwait. However, males scored significantly higher than females in Saudi Arabia, while there are no significant gender differences in depression in Lebanon, Tunisia, Palestine, U.A. Emirates, Yemen, Jordan, and Sudan. The salient gender differences were interpreted in the light of a socialization process; especially sex-typing and gender roles.

The aim of this study is to examine politeness strategies employed in the interactions between Jordanians and the employees of the call-centre-customer service (CCCS) of a major telecommunications company in Jordan. It focuses on their linguistic behaviours upon requesting taking into account the variables of gender, and reasons for calling that may affect the choice of selecting an appropriate strategy. The data were collected from 20 participants through recording of naturally-occurring interactions. The theoretical framework of this study is based on Brown and Levinson’s (1987) model of politeness. The results of the study have shown that negative-politeness strategies dominate the scene in making requests as they were the most frequent ones which may indicate the preference of Jordanians for these strategies to other strategies. Furthermore, the results have shown that in certain cases gender variation had an impact on the choice of particular strategies.

An Arabic version of the second edition of the Beck Depression Inventory (BDI-II) in its complete form was developed by Ghareeb (2000). The BDI-II was administered to 18 Islamic groups and the English version of the BDI-II (Beck, Steer, & Brown, 1996) was administered to an additional Pakistani group. Co-efficient alphas were computed for samples of male and female undergraduates recruited from 19 Islamic countries: Palestine, Lebanon, Syria, Iraq, Jordan, Saudi Arabia, Kuwait, Qatar, Bahrain, United Arab Emirates, Oman, Yemen, Egypt, Sudan, Tunisia, Libya, Algeria, Morocco and Pakistan (n=600, 270, 479, 841, 943, 780, 781, 356, 230, 360, 333, 590, 735, 275, 291, 298, 300, 706 and 532 respectively). The corrected item-total scale correlations of the BDI-II ranged between .21 and 89, the inventory seems viable in the Arabic context. Its use in cross-cultural studies would be suitable.

Tomato brown rugose fruit virus (ToBRFV) was identified in Israel during October 2014 in tomato plants (Solanum lycopersicum). These plants, carrying the durable resistance gene against tomato mosaic virus, Tm-22, displayed severe disease symptoms and losses to fruit yield and quality. These plants were found infected with a tobamovirus similar to that discovered earlier in Jordan. This study was designed to screen and identify tomato genotypes resistant or tolerant to ToBRFV. The identified resistance and tolerance traits were further characterized virologically and genetically. Finally, DNA markers linked to genes controlling these traits were developed as tools to expedite resistance breeding. To achieve these objectives, 160 genotypes were screened, resulting in the identification of an unexpectedly high number of tolerant genotypes and a single genotype resistant to the virus. A selected tolerant genotype and the resistant genotype were further analyzed. Analysis of genetic inheritance revealed that a single recessive gene controls tolerance whereas at least two genes control resistance. Allelic test between the tolerant and the resistant genotype revealed that these two genotypes share a locus controlling tolerance, mapped to chromosome 11. This locus displayed a strong association with the tolerance trait, explaining nearly 91% of its variation in segregating populations. This same locus displayed a statistically significant association with symptom levels in segregating populations based on the resistant genotype. However, in these populations, the locus was able to explain only ~41% of the variation in symptom levels, confirming that additional loci are involved in the genetic control of the resistance trait in this genotype. A locus on chromosome 2, at the region of the Tm-1 gene, was finally found to interact with the locus discovered on chromosome 11 to control resistance.

Abstract This study examines Jordanian graduate students' complaints posted on a Facebook closed group and directed to the representatives of Student Union at Jordan University of Science and Technology to be transferred to the officials concerned. In line with Boxer (1993b), the study considers the students' complaints to be indirect speech acts, as the addressee(s) are not the source of the offense. Using a sample of 60 institutional complaining posts, the researchers have analysed the complaints in terms of their semantic formulas, politeness functions and correlations with the gender of the complainers. The students’ complaints are classified into six semantic formulas of which the act statement element is indispensable as the complaint is stated in it. The other five formulas, ordered according to their frequency, are opener, remedy, appreciative closing, justification and others. Despite the negative affect typically involved in the complaining act, the semantic formulas identified in this study are found to signal politeness and fit into Brown and Levinson’s (1987) pool of face-saving strategies rather than face-threatening acts. Specifically, when the graduate students direct their Facebook complaints to the students' representatives, they tend to offer camaraderie with them to be encouraged to pursue the problems specified in the complainers’ posts.

The research is to know the application of teaching English by Using “Presentation Practice Production” method and its effect on teachers and students in MI Masyhudiyah, Gresik, East Java. Qualitative research was used by combining questionnaire, interview and secondary data, teachers’ lesson plan of all English Teachers. The theory was based on (Larsen, 2003), (Jordan, Carlile, & Stack, 2008) and (Brown, 2000). The finding and discussion were, first, the application on teachers created: 1) the students tent to be more having bravery to do such a conversation in English, getting more focus and stable to have talks among. 2) The students got easily imitate and follow the English lesson by what the teacher taught in the classroom. Second, the effects on teachers were 1) teachers got the easiness in conveying the teaching materials in the classroom, improving the speaking skill, and getting more focus on teaching materials. 2) Teachers could see directly the results from the teaching at the day. The last, the effect on students are 1) Students could directly use the words, utterances and conversation at the day and more active, more focus and more perceptive in studying English. 2) The students were impressed by using English fingers.

Background Tomato brown rugose fruit virus (ToBRFV) is a highly infectious tobamovirus that causes severe disease in tomato (Solanum lycopersicum L.) crops. In Italy, the first ToBRFV outbreak occurred in 2018 in several provinces of the Sicily region. ToBRFV outbreak represents a serious threat for tomato crops in Italy and the Mediterranean Basin. Methods Molecular and biological characterisation of the Sicilian ToBRFV ToB-SIC01/19 isolate was performed, and a sensitive and specific Real-time RT-PCR TaqMan minor groove binder probe method was developed to detect ToBRFV in infected plants and seeds. Moreover, four different sample preparation procedures (immunocapture, total RNA extraction, direct crude extract and leaf-disk crude extract) were evaluated. Results The Sicilian isolate ToB-SIC01/19 (6,391 nt) showed a strong sequence identity with the isolates TBRFV-P12-3H and TBRFV-P12-3G from Germany, Tom1-Jo from Jordan and TBRFV-IL from Israel. The ToB-SIC01/19 isolate was successfully transmitted by mechanical inoculations in S. lycopersicum L. and Capsicum annuum L., but no transmission occurred in S. melongena L. The developed real-time RT-PCR, based on the use of a primer set designed on conserved sequences in the open reading frames3, enabled a reliable quantitative detection. This method allowed clear discrimination of ToBRFV from other viruses belonging to the genus Tobamovirus, minimising false-negative results. Using immunocapture and total RNA extraction procedures, the real-time RT-PCR and end-point RT-PCR gave the same comparable results. Using direct crude extracts and leaf-disk crude extracts, the end-point RT-PCR was unable to provide a reliable result. This developed highly specific and sensitive real-time RT-PCR assay will be a particularly valuable tool for early ToBRFV diagnosis, optimising procedures in terms of costs and time.

Introduction: Jordan is awarded huge areas in the north and western part of the country in which brown and green clay is dominant. This research focuses on the problems and behaviour of the green clay only. The main problem of the green clay is its high swelling pressure which is the main cause of excessive settlement and wall cracks in buildings, especially during the wet season. Methods: This study aims to investigate the engineering properties and behaviour of the green clay deposits in the Amman area, which will serve as a guide for both geotechnical and structural engineers when preparing the foundation design. Results: Based on the consolidation test, the investigated green clay showed high swelling pressure of 3.11 kg/cm2, liquid limit (LL) of 73%, plasticity index (PI) of 40%, the shrinkage limit (SL) of 12%, and liquidity index (LI) of 0.125. The moisture content at saturation is 35.14%, while the natural moisture content is 28%, dry density is 1407 kg/m3, cohesion (C) is 0.20 kg/cm2 and unconfined compressive strength is 1.05 kg/cm2. The XRD results of the clay size fraction have confirmed the presence of the expansive clay mineral smectite as the essential clay mineral together with kaolinite. Results provide a general understanding of the behaviour and properties of the green clay, and the regression analysis showed good correlations between the liquid limit and initial moisture content with the compression index and also between the initial void ratios with the swelling index. Conclusion: Changes in the volume are due to the unsaturation level of clay when provided with initial water content.

Sweet Spanish onion cultivars (Allium cepa L.) in northern Colorado displayed symptoms of postharvest bulb rot during September to November of 1999. This disease appears identical to that reported from infected onions in California in 1988 and is presumably associated with high temperature stress (1). Mature, firm bulbs harvested from scattered fields in Weld County exhibited a brownish discoloration and breakdown of inner scales. Gram negative, rod-shaped, cream-colored bacteria were consistently recovered from infected bulb tissue on nutrient agar. Physiological tests showed that the bacteria utilized glucose in an oxidative and fermentative manner and were catalase positive and oxidase negative. A representative strain was identified by Microbe Inotech Laboratories (St. Louis, MO) as Enterobacter cloacae (Jordan) Hormaeche & Edwards (2) using Biolog analysis, with a similarity index of 0.81. To confirm pathogenicity, a 0.5- to 1.0-ml suspension of bacteria (108 CFU/ml sdw) was injected into firm onion bulbs (7.5 to 10.0 cm diameter). After incubation for 14 days at 22°C in closed plastic bags in the dark, bulbs were cut in half and evaluated. Tan to brown discoloration and initial dry rot, similar to that observed postharvest, was observed in inoculated bulbs. The pathogen was reisolated from six of eight bulbs inoculated with the representative strain. No discoloration or disease developed on eight control bulbs injected with water. To our knowledge, this is the first report of E. cloacae from onion grown in Colorado. References: (1) A. L. Bishop and R. M. Davis. Plant Dis. 74:692, 1990. (2) Hormaeche and Edwards. Int. J. System. Bacteriol. 30:293, 1960.

SUMMARY Objective To compare in vivo the efficacy of enamel microabrasion alone or in combination with vital tooth bleaching for the management of tooth discoloration caused by fluorosis. Methods A total of 118 maxillary and mandibular fluorosed incisors and canines in 10 patients, scored from 1 to 7 according to the Tooth Surface Index of Fluorosis, were included in this study. All of the teeth were initially treated with enamel microabrasion (Opalustre, Ultradent Products Inc, South Jordan, UT, USA), and after 24 hours, an in-office bleaching technique (Opalescence Boost, Ultradent) was utilized (n=118). Standardized images of the teeth were taken using a digital camera prior to treatment and 24 hours after the enamel microabrasion and after the in-office bleaching therapy. The study groups were assigned according to evaluation time: a) after enamel microabrasion (Group 1) and b) after the combined approach (enamel microabrasion and in-office bleaching) (Group 2). Two calibrated and blinded examiners scored Group 1 and Group 2 images by comparing each with baseline images for “improvement in appearance,” “changes in brown stains,” and “changes in white opaque areas” using the visual analogue scales (VAS) that range from 1 to 7. “Patient satisfaction,” “tooth sensitivity,” and “gingival problems” were also recorded. The data were analyzed using two sample paired Wilcoxon signed-rank, Kruskal-Wallis, and Mann-Whitney U-tests (α=0.05). Results The combined therapy revealed significantly higher scores than the enamel microabrasion procedure in terms of all of the evaluated criteria (p<0.001). Enamel microabrasion provoked less tooth sensitivity but led to lower patient satisfaction scores than the combined therapy (p<0.001); however, in terms of gingival problems, no differences were found between both groups. Conclusion The combined therapy, including enamel microabrasion and in-office bleaching, was more effective than enamel microabrasion alone in the esthetic management of fluorosed teeth.

This study aimed to identify deaf people with Deaf with Waardenburg Syndrom Type II. In order to achieve the objectives of the study, the qualitative method was used for the one case study. The sample included (2) deaf students from all deaf schools in Jordan, who are between the ages of (9-10), and (Wechsler Intelligence Scale ,WISC-IV) was applied in the language of Performance Scales and Audiometry. The results of the study showed the presence of symptoms in Deaf people with Wardenberg syndrome type II in terms of: auditory sensory loss. The presence of a side shift to the inner corner of the eyes. Premature graying of hair on the front of the head in white and some on the eyelashes or on the eyebrow. The eyebrows are connected to each other. Dark blue or brown eyes with black and pigment color differences in the iris. The root of the nose is wide and the presence of the rabbit's lip. The results of the study also showed that there is an intense focus during communication in the sign language at the hands of the speaker due to the fact that the color contrast of the eyes led to a dispersion of the focus in the sign language. They also have a sense of the direction of light, which may adversely affect the process of visual communication of sign language. The results of the study also showed that the average hearing impairment was the highest category. The study recommends further studies and research related to the level of intelligence of deaf people with Type II syndrome, as well as studies related to visual perception in Deaf people with type 2 Wardenburg syndrome and the inclusion of this syndrome as an important part of the categories of hearing impairment.

Neolebouria tinkerbellae n.sp. (Trematoda: Opecoelidae) is described from specimens obtained from experimental infections in Platichthys stellatus (Pallas), Gasterosteus aculeatus Linnaeus, and Leptocottus armatus Girard. The metacercarial stage occurs in the heart muscle of Pandalus jordani Rathbun (smooth pink shrimp) from the Pacific coast of Canada and forms a translucent white cyst. A second, unidentified species of metacercaria found in P. jordani forms a cyst surrounded by a brown pigmented layer in the somatic musculature. Both metacercariae are described.

The undesirable discoloration or pitting of teeth due to fluorosis or developmental defects like amelogenesis imperfecta or enamel hypoplasia pose a challenge to the clinician to cater to the aesthetic requirements of patients. Fluorosis had been reported way back in 1901. There are treatment options depending upon individual cases as follows: microabrasion / macroabrasion, bleaching, composite restoration, veneers or full crowns. For the aesthetic enhancement of stains associated with mild to moderate fluorosis enamel microabrasion is the preferred treatment. This technique involves removal of entrapped stains by rubbing of slurry containing HCl acid and an abrasive agent on the stained enamel surface. But if the depth of the defect is more then microabrasion can be done in conjunction with bleaching or bonded restorations can be done to achieve optimal aesthetics. Casein phospopeptide - Amorphous calcium phosphate (CPP – ACP) can be topically applied after microabrasion which enhances remineralisation and prevents post-operative sensitivity. The present paper illustrates the management of mild to moderate dental fluorosis by microabrasion to remove stains on the enamel surface followed by remineralisation using CPP - ACP paste. An unaesthetic smile has psychological impact especially on young patients and lowers their confidence.1 Discoloration of the young permanent anterior teeth is mostly seen due to varying developmental defects. This could be due to extrinsic aetiology such as those caused by coffee, tea, red wine and tobacco or due to intrinsic aetiology. The intrinsic stains may be due to pre-eruptive or post-eruptive causes.2 Pre-eruptive causes of intrinsic stains include dentinogenesis imperfecta and fluorosis, whereas post-eruptive causes of intrinsic stains include tetracycline dentine staining or due to injuries.3 The excessive and chronic ingestion of fluoride during amelogenesis leads to fluorosis which can be skeletal or dental depending upon the intake.4,5 Dental fluorosis is characterized by white opaque flecks on teeth or yellow to brown discolorations with pitting on the enamel surface.6,7 The enamel microabrasion is an effective and non-invasive procedure for removing the stains limited to outer enamel layer.7,8 It uses a rubber cup along with abrasive materials and chemical solutions.9,10 Currently, many products are commercially available for enamel microabrasion such as Prema Compound (Premier Dental Products, Norristown, PA, USA) containing 15 % HCl and Opalustre (Ultradent, South Jordan, UT, USA) containing 6.6 % HCl and silicon carbide.7 (Table 1) Since these products are expensive, the prototype paste containing 18 % HCl and pumice, as described by Croll in 1986 is most commonly used in clinical practice.8

Abstract Background: Tumor mutation loads are a strong predictor of immunotherapy benefit. This is evidenced by studies on skin, lung, and colon cancer, where well-defined processes elicit high mutation burdens and checkpoint therapies often provoke strong anti-tumor immune responses. In comparison, only a small number of breast cancer patients have responded to checkpoint therapies such as anti-PD-L1 and anti-PD-1 monoclonal antibodies. Approximately one-fourth of primary breast cancer and one-third of metastatic tumors have a significant APOBEC mutation burden defined as C-to-T and C-to-G mutations in TCA or TCT trinucleotide motifs, and many tumors have >10,000 of these APOBEC signature single base substitution mutations. However, to our knowledge, systematic immunotherapy studies focusing on this unique, hypermutated subset of breast cancers have yet to be done. Methods: To address the potential relationship between different checkpoint therapies and APOBEC mutation burden, we created a panel of >30 mammary tumor cell lines derived from fully immune-proficient C57BL/6 animals. At least 6 of these cell lines are immortalized, readily engineered using standard molecular biology procedures, and capable of re-engraftment and tumor formation in immune proficient C57BL/6 animals. Two lines were engineered to inducibly express human APOBEC3A, subjected to 1- to 20-rounds of sublethal mutagenesis, and tested systematically for checkpoint therapy responsiveness. Results: Two cell lines were engineered to inducibly express APOBEC3A or a catalytic mutant (E72A). Clones were characterized for inducible APOBEC3A expression and associated DNA damage responses. After varying rounds of mutagenesis, clones were engrafted into the subcutaneous flank or mammary fat pad of C57BL/6 animals. Immunohistochemical and flow cytometry analysis revealed a robust intratumoral CD8 T cell population including a subset with PD-1 expression. Additionally, engrafted tumor cells expressed high levels PD-L1. Experiments are ongoing and immunotherapy responses will be presented. Conclusions: We have isolated a panel of C57BL/6 mammary tumor-derived cell lines and demonstrated re-engraftment into immunocompetent animals. These cell lines constitute a platform for studying the relationship between different mutagens including APOBEC and immunotherapy responses. Citation Format: Jordan Naumann, Michael Carpenter, Prokopios Argyris, William Brown, Reuben Harris. A panel of murine mammary tumor cell lines to study immune responses to epitopes created by different mutagens including human APOBEC3 enzymes [abstract]. In: Proceedings of the 2021 San Antonio Breast Cancer Symposium; 2021 Dec 7-10; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2022;82(4 Suppl):Abstract nr P5-01-10.

Downy mildew in basil was first reported from Uganda in 1933 (4). In 2004, it was reported from Italy (3) and, thereafter, from other countries around the world. In Israel, the disease was first observed in November 2011 in two greenhouses located in the northern part of the Jordan Valley. Within a month, second and third outbreaks of the disease occurred simultaneously near the southwest and southeast borders of Israel, 250 km from the initial disease outbreak. By the summer of 2012, the disease had appeared throughout the country, causing major economic damage. The causal agent, identified as Peronospora belbahrii (see below), produced chlorotic lesions on leaf blades with sporangia developing on the lower leaf surfaces. Lesions gradually turn necrotic, and infected leaves abscised. Sporangia were dark purple, oval, 30.4 ± 2.9 μm long × 21.4 ± 1.7 μm wide. Sporangiophores emerged from stomatal openings in a saturated atmosphere, were hyaline, 400 to 600 μm long, dichotomously branched, with three to five branches per sporangiophore, and bore a single sporangium on each branchlet tip. Oospores, seldom seen, were brown, round, and 46.2 ± 2.8 μm in diameter. Sporangia germinated directly, each producing a single germ tube that penetrated the periclinal wall of epidermal cells. PCR assays using sporangia and infected leaves as the template, and specific BAZ primers (1), produced a 134-bp band typical of P. belbahrii (1,2). Twenty isolates, collected from 12 locations in Israel from December 2011 to September 2012, were all sensitive to mefenoxam as the isolates did not cause symptoms on 15-leaf, potted basil plants (cv. Peri, Volcani Center, Israel) that were sprayed with 10 μg mefenoxam/ml (Ridomil Gold 48%, Syngenta, Basel, Switzerland) prior to inoculation. However, one isolate collected in early October 2012 from a severely infected plant in a greenhouse at Rehov in Bet-Shaan Valley, in which the plants had been treated with mefenoxam, was resistant to mefenoxan, showing abundant sporulation on leaves of potted basil plants that had been sprayed with 1,000 μg of mefenoxam/ml prior to inoculation. To our knowledge, this is the first report of the occurrence of downy mildew in basil in Israel. This is also the first global report of resistance to mefenoxam in P. belbahrii. References: (1) L. Belbahri et al. Mycol. Res. 109:1276, 2005. (2) R. Djalali et al. Mycol. Progress 11:961, 2012. (3) A. Garibaldi et al., Plant Dis. 89:683, 2004. (4) C. G. Hansford. Rev. Appl. Mycol. 12:421, 1933.

Abstract Date Presented 04/01/2022 This study explored the familiarity and use of sensory-based theories by OT practitioners across the United States. A cross-sectional survey design was used and resulted in 201 practitioner responses. Significant associations were found with familiarity of different theorists, theories, and assessments across geographical regions and degree level. This study contributes to the limited understanding of the use and familiarity with sensory-based theories. Primary Author and Speaker: Ranelle Nissen Additional Authors and Speakers: Jessica McHugh Contributing Authors: Alyssa Brown, Shannon Hegland, Emily Heumiller, Katelyn Nelson, Madison Snelling, Jordyn Vondrak

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5′ TTTGGAAAAGAACCTGACGAG 3′; CysCP5600R 5′ TTCATCAACAGATTGGCTGC 3′) and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production. References: (1) F. Akad et al. Plant Dis.92:648, 2008. (2) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

AbstractAfrotropical bark beetle genera in the tribe Micracidini are revised and an identification key provided. The new classification is based on phylogenetic analyses of five molecular markers (COI, EF-1α, 28S, PABP1, CAD) in combination with morphological characters. Five new genera are erected and one genus synonymized, resulting in a total of 11 valid genera: Lanurgus Eggers, 1920, Traglostus Schedl, 1938, Pseudomicracis Eggers, 1920 (=Saurotocis Wood, 1984 syn. nov.), Phloeocurus Wood, 1984, Afromicracis Schedl, 1959, Dendrochilus Schedl, 1959, Neomicracis Jordal gen. nov., Leiomicracis Jordal gen. nov., Diplotrichus Jordal gen. nov., Pseudolanurgus Jordal gen. nov., Microlanurgus Jordal gen. nov. The following new species are described to be included in the new genera: Leiomicracis aurea Jordal sp. nov., Neomicracis squamigera Jordal sp. nov., both from Tanzania, and Microlanurgus bicolor Jordal sp. nov. and Microlanurgus ater Jordal sp. nov., from Madagascar. The following new synonyms and new combinations are proposed: Afromicracis dubius (Schedl, 1950) (=Afromicracis angolensis Schedl, 1962 syn. nov.), Afromicacis elongatulus (Schedl, 1977) comb. nov.,Afromicracis jasminiae (Schedl 1957) comb. nov. (=Dendrochilus mikaniae Schedl 1957 syn. nov.), Afromicracis robustus (Schedl 1957) comb. nov. (=Dendrochilus arundinarius Schedl 1957 syn. nov., =Hypothenemus bambusae Browne, 1970 syn. nov., =Dendrochilus filum Schedl, 1977 syn. nov.) (all from Dendrochilus), Afromicracis setifer (Schedl 1957) comb. nov. (Mimiocurus), Lanurgus longipilis (Schedl, 1958) comb. nov., Lanurgus pubescens (Schedl, 1961) comb. nov. (both from Traglostus), Diplotrichus catenatus (Schedl, 1953) comb. nov.,Diplotrichus elongatus (Schedl, 1950) comb. nov.,Diplotrichus euphorbia (Schedl, 1961) comb. nov.,Diplotrichus gracilis (Schedl, 1958) comb. nov.,Diplotrichus minor (Schedl, 1950) comb. nov (=Lanurgus frontalis Schedl, 1953 syn. Nov.), Diplotrichus obesus (Schedl, 1953) comb. nov., Diplotrichus pygmaeus (Schedl, 1965) comb. nov., Diplotrichus rugosipes (Schedl, 1961) comb. nov., Diplotrichus subdepressus (Schedl, 1965) comb. nov., Diplotrichus widdringtoniae (Schedl, 1962) comb. nov. (all from Lanurgus), Diplotrichus ignotus (Schedl, 1965) comb. nov. (Pseudomicracis), Pseudolanurgus harunganae (Schedl, 1961) comb. nov. (=Lanurgus cribrellus Schedl, 1965 syn. nov.), Pseudolanurgus bugekeae (Schedl, 1957) comb. nov. (both from Pseudomicracis), Pseudolanurgus minutissimus (Schedl, 1961) comb. nov. (Lanurgus), Pseudomicracis dispar (Schedl, 1961) comb. nov., Pseudomicracis tomicoides (Schedl, 1961) comb. nov. (both from Saurotocis). The following taxa were transferred to genera in other tribes: Acanthotomicus intermedius (Schedl, 1977) comb. nov., Xylocleptes villiersi (Lepesme, 1942) comb. nov. (both from Dendrochilus); Eidophelus agnathus (Schedl, 1942) comb. nov., and Eidophelus ciliatipennis (Schedl, 1979) comb. nov. (all from Miocryphalus). The following five species were included in Karlseniusgen. nov. (Trypophloeini): Karlsenius klainedoxae (Schedl, 1957) comb. nov., Karlsenius nitidum (Schedl, 1965) comb. nov., Karlsenius nigrinum (Schedl, 1957) comb. nov., and Karlsenius attenuatus (Eggers, 1935) comb. nov. (from Miocryphalus), and Karlsenius ghanaensis (Schedl, 1977) comb. nov. (from Eidophelus). A time-tree and biogeographical analysis suggested that Madagascar was colonized only once in Micracidini, from East Africa soon after the origin of the tribe in late Cretaceous. Multiple re-colonisations from Madagascar to the mainland have contributed to further diversification of a tribe which is otherwise highly restricted in geographical distribution.

Is the ubiquity of contemporary popular music akin to a deliberate aggression to the hearing, making the listening experience devoid of any sense? If so, is there any strategy to morph this supposed confusion into meaningful stimuli? Relying on epistemology, we attempt at promoting the act of listening as a proper way of world-making and refer to Mark Reybrouck, Bruno Nettl, Steven Brown and Joseph Jordania—among others—to gather appropriate heuristic tools. In the last part of the essay, we advance the concept of timbral quotation as an additional means to grasp meaningful cues in the timbrical richness of contemporary popular compositions. We shall sustain the particular fitness of this tool especially with regard to nowadays’ Western popular music, more and more timbre-centered rather than harmony-centered.

The last few years have seen a number of advances in the understanding of genetic polymorphisms of caprine caseins, and especially in molecular characterization of the allelic variants and analysis of their frequencies in Spanish and other breeds (Grosclaude et al. 1994; Jordana et al. 1996). Although more is being discovered about the influence of these polymorphisms on the yield and characteristics of cheeses (Remeuf, 1993; Pirisi et al. 1994), little work has been done on the quantitation of different casein fractions of goats' milk throughout lactation. Measurements have been made using SDS-PAGE (Quiles et al. 1990) and cation- exchange FPLC (Brown et al. 1995), and Recio et al. (1997a) have demonstrated the potential of capillary electrophoresis (CE) for the analysis and quantitation of milk proteins. Use of CE has resulted in the development of rapid automated analysis with very high resolution, requiring very small sample and buffer volumes and with a significantly reduced amount of solvent waste.The aim of the present study was to determine the influence of herd and milking period on the contents of the various nitrogen and casein fractions, the latter being determined by CE, in milk from goats of the Murciana-Granadina breed.

A new species Anthrenus (Florilinus) loebli from Israel, Lebanon and Jordania is described, illustrated and compared with the similar species classified within the subgenus Florilinus Mulsant & Rey, 1868. The new species is characterized by oval eyes, eight-segmented antenna and subtriangular, occasionally triangular, scales on the dorsum. The yellowish/light brown scales are present on the anterior and terminal part of the elytra and create three irregular, transverse bands. Antennal segment eight are at least 4.8 to 5x longer than segment 7 in male, 2.1x longer in female. The new species is most similar to A. (F.) museorum (Linnaeus, 1761); A. (H.) fuscus Olivier, 1789 and A. (F.) flavidus Solsky, 1876. An identification key to externally similar species of the genus is given. The most distinctive taxonomic characteristics concern the male genitalia and antenna (in ratio of length of segments of antennal club) and are also described.

In May 2009, a stem rot of pepper (Capsicum annuum L.) occurred in a 20-ha field in Hacienda de Tarazona, Seville, in southern Spain. Affected plants appeared singly or were grouped in circular patches as much as 8 to 10 m in diameter. Early symptoms consisted of water-soaked lesions on crown and lower stem tissue in contact with the soil. Plant foliage became pale green and wilted, followed by a complete collapse of the plant. A dense white mycelial mat formed on the lower stem and crown with 1- to 2-mm-diameter, spherical, tan-to-dark brown sclerotia. Lower stem pieces of 12 plants with early disease symptoms were surface sterilized in 0.5% NaOCl, dried, transferred to acidified potato dextrose agar, and incubated at 25 ± 1°C in the dark. Fast-growing fungal colonies with white mycelium and abundant sclerotia developed after 6 to 10 days of incubation. On the basis of morphological characters, the fungus was identified as Sclerotium rolfsii Sacc. (2). To confirm the identity of the pathogen, the ribosomal DNA internal transcribed spacer was amplified and sequenced for two isolates (one of the two exact sequences was deposited as GenBank Accession No. GU080230). The sequence was 99% similar to sequences of Athelia rolfsii (S. rolfsii) in GenBank. Pathogenicity of two isolates was determined by placing two oat seeds colonized by each isolate 0.5 to 1 cm from the stem of 2-week-old pepper plants cv. Cristal (one plant per pot, eight replicates). Plants were incubated in a growth chamber maintained at 28 ± 1°C with a 14-h photoperiod of 360 μE·m–2·s–1 and 60 to 90% relative humidity for 10 days. By the sixth day, discoloration and blight of the foliage and stem was observed. Sclerotia formed around the crown and 88% of the plants died 7 days after inoculation. S. rolfsii was recovered from all affected pepper plants. Noninoculated control plants did not develop symptoms. In southern Spain, S. rolfsii is widely distributed in areas of sugar beet production (1). Because of the wide host range of the pathogen, southern blight could become an important disease of vegetable production in southern Spain. References: (1) R. Jordán-Ramírez et al. IOBC/WPRS Bull. 42:101. 2009. (2) J. E. M. Mordue. CMI Descriptions of Pathogenic Fungi and Bacteria. No. 410, 1974.

Physical activity is very important for early childhood, especially outdoor activities that add a lot of new experiences. This study aims to check the relationship of children's outdoor activities and parenting styles and children's social skills. The participants are 125 parents of early childhood who attend kindergarten. The research method is a descriptive study using the relational screening model. The results showed that there was a relationship between outside play and parenting style on the social skills of children in their childhood. Democratic parenting styles are found to promote children's social skills, while authoritative parenting styles have a negative correlation with interpersonal skills, the ability to express verbally, self-control, listening skills, emotional management and adaptation to change. In the sub-dimensions of anger management and adaptation to changing skills is a significant difference between authoritative parenting styles and not permissive parenting with children's social skills. Keywords: Early Childhood Social skills, Outdoor Activities, Parenting Styles Reference: Azlina, W., & S., Z. A. (2012). A Pilot Study: The Impact of Outdoor Play Spaces on Kindergarten Children. Procedia - Social and Behavioral Sciences, 38(December 2010), 275–283. https://doi.org/10.1016/j.sbspro.2012.03.349 Bento, G., & Dias, G. (2017). The importance of outdoor play for young childrenʼs healthy development. Porto Biomedical Journal, 2(5), 157–160. https://doi.org/10.1016/j.pbj.2017.03.003 Beyer, K., Bizub, J., Szabo, A., Heller, B., Kistner, A., Shawgo, E., & Zetts, C. (2015). Development and validation of the attitudes toward outdoor play scales for children. Social Science and Medicine, 133, 253–260. https://doi.org/10.1016/j.socscimed.2014.10.033 Boxberger, K., & Reimers, A. K. (2019). Parental correlates of outdoor play in boys and girls aged 0 to 12—A systematic review. International Journal of Environmental Research and Public Health, 16(2). https://doi.org/10.3390/ijerph16020190 Coleman, W. L., & Lindsay, R. L. (1992). Interpersonal disabilities: Social skill deficits in older children and adolescents: Their description, assessment, and management. Pediatric Clinics of North America, 39(3), 551–567. https://doi.org/10.1016/S0031-3955(16)38344-4 Cui, M., Janhonen-Abruquah, H., Darling, C. A., Carlos Chavez, F. L., & Palojoki, P. (2019). Helicopter Parenting and Young Adults’ Well-Being: A Comparison Between United States and Finland. Cross-Cultural Research, 53(4), 410–427. https://doi.org/10.1177/1069397118802253 Fjørtoft, I., & Sageie, J. (2000). The natural environment as a playground for children. Landscape description and analyses of a natural playscape. Landscape and Urban Planning, 48(1–2), 83–97. https://doi.org/10.1016/S0169-2046(00)00045-1 Ghanbari-Azarneir, S., Anbari, S., Hosseini, S.-B., & Yazdanfar, S.-A. (2015). Identification of Child-friendly Environments in Poor Neighborhoods. Procedia - Social and Behavioral Sciences, 201(February), 19–29. https://doi.org/10.1016/j.sbspro.2015.08.114 Giedd, J. N. (2012). The Digital Revolution and Adolescent Brain Evolution. Journal of Adolescent Health, 51(2), 101–105. https://doi.org/10.1016/j.jadohealth.2012.06.002 Hinkley, T., Brown, H., Carson, V., & Teychenne, M. (2018). Cross sectional associations of screen time and outdoor play with social skills in preschool children. PLoS ONE, 13(4), 1–15. https://doi.org/10.1371 Johnson, J. E., & Christie, J. F. (2009). Play and digital media. Computers in the Schools, 26(4), 284–289. https://doi.org/10.1080/07380560903360202 Junot, A., Paquet, Y., & Martin-Krumm, C. (2017). Passion for outdoor activities and environmental behaviors: A look at emotions related to passionate activities. Journal of Environmental Psychology, 53, 177–184. https://doi.org/10.1016/j.jenvp.2017.07.011 Kemple, K. M., Oh, J. H., Kenney, E., & Smith-Bonahue, T. (2016). The Power of Outdoor Play and Play in Natural Environments. Childhood Education, 92(6), 446–454. https://doi.org/10.1080/00094056.2016.1251793 Kol, S. (2016). The Effects of the Parenting Styles on Social Skills of Children Aged 5-6. Malaysian Online Journal of Educational Sciences, 4(2), 49–58. Kozina, Z., Repko, O., Kozin, S., Kostyrko, A., Yermakova, T., & Goncharenko, V. (2016). Motor skills formation technique in 6 to 7-year-old children based on their psychological and physical features (Rock climbing as an example). Journal of Physical Education and Sport, 16(3), 866–874. https://doi.org/10.7752/jpes.2016.03137 Larson, L. R., Szczytko, R., Bowers, E. P., Stephens, L. E., Stevenson, K. T., & Floyd, M. F. (2019). Outdoor Time, Screen Time, and Connection to Nature: Troubling Trends Among Rural Youth? Environment and Behavior, 51(8), 966–991. https://doi.org/10.1177/0013916518806686 Lindsey, G., Maraj, M., & Kuan, S. C. (2001). Access, Equity, and Urban Greenways: An Exploratory Investigation. Professional Geographer, 53(3), 332–346. https://doi.org/10.1111/0033-0124.00288 Louv, R. (2008). Last child in the woods: Saving our children from nature-deficit disorder. Chapel Hill, NC: Algonquin Books. Maynard, T., & Waters, J. (2007). Learning in the outdoor environment: A missed opportunity? Early Years, 27(3), 255–265. https://doi.org/10.1080/09575140701594400 Moreland, A. D., & McRae-Clark, A. (2018). Parenting outcomes of parenting interventions in integrated substance-use treatment programs: A systematic review. Journal of Substance Abuse Treatment, 89(August 2017), 52–59. https://doi.org/10.1016/j.jsat.2018.03.005 Moriguchi, Y., Zelazo, P. D., & Chevalier, N. (2016). Development of Executive Function During Childhood. https://doi.org/10.3389/978-2-88919-800-9 Mullenbach, L. E., Andrejewski, R. G., & Mowen, A. J. (2019). Connecting children to nature through residential outdoor environmental education. Environmental Education Research, 25(3), 365–374. https://doi.org/10.1080/13504622.2018.1458215 Norðdahl, K., & Einarsdóttir, J. (2015). Children’s views and preferences regarding their outdoor environment. Journal of Adventure Education and Outdoor Learning, 15(2), 152–167. https://doi.org/10.1080/14729679.2014.896746 Pinquart, M. (2016). Associations of Parenting Styles and Dimensions with Academic Achievement in Children and Adolescents: A Meta-analysis. Educational Psychology Review, 28(3), 475–493. https://doi.org/10.1007/s10648-015-9338-y Riany, Y. E., Cuskelly, M., & Meredith, P. (2016). Cultural Beliefs about Autism in Indonesia. International Journal of Disability, Development and Education, 63(6), 623–640. https://doi.org/10.1080/1034912X.2016.1142069 Riany, Y. E., Meredith, P., & Cuskelly, M. (2017). Understanding the Influence of Traditional Cultural Values on Indonesian Parenting. Marriage and Family Review, 53(3), 207–226. https://doi.org/10.1080/01494929.2016.1157561 Saltali, N. D., & Arslan, E. (2012). Parent ’ s Attitudes as a Predictor of Preschoolers ’ Social Competence and Introverted Behavior. Elementary Education Online, 11(3), 729–737. Schoeppe, S., Vandelanotte, C., Bere, E., Lien, N., Verloigne, M., Kovács, É., … Van Lippevelde, W. (2017). The influence of parental modelling on children’s physical activity and screen time: Does it differ by gender? European Journal of Public Health, 27(1), 152–157. https://doi.org/10.1093/eurpub/ckw182 Shi, Y. (2017). Explore Children’s Outdoor Play Spaces of Community Areas in High-density Cities in China: Wuhan as an Example. Procedia Engineering, 198(September 2016), 654–682. https://doi.org/10.1016/j.proeng.2017.07.118 Strasburger, V. C., Jordan, A. B., & Donnerstein, E. (2012). Children, Adolescents, and the Media:. Health Effects. Pediatric Clinics of North America, 59(3), 533–587. https://doi.org/10.1016/j.pcl.2012.03.025 Victoria J. Rideout, Foehr, M. A. U. G., & Roberts, D. F. (2010). GENERATION M2 Media in the Lives of 8- to 18-Year-Olds. In Theresa Boston (Ed.), Henry J. Kaiser Family Foundation. Boston: Henry J. Kaiser Family Foundation. Wang, S. hua, Zhang, Y., & Baillargeon, R. (2016). Young infants view physically possible support events as unexpected: New evidence for rule learning. Cognition, 157, 100–105. https://doi.org/10.1016/j.cognition.2016.08.021 Waters, J., & Rekers, A. (2019). Young Children ’ s Outdoor Play-Based Learning. 1–7. Webster-Stratton, C., Reid, J., & Hammond, M. (2001). Social skills and problem-solving training for children with early-onset conduct problems: Who benefits? Journal of Child Psychology and Psychiatry and Allied Disciplines, 42(7), 943–952. Retrieved from http://ovidsp.ovid.com/ovidweb.cgi?T=JS&PAGE=reference&D=emed5&NEWS=N&AN=2001380196 Wilkie, H. J., Standage, M., Gillison, F. B., Cumming, S. P., & Katzmarzyk, P. T. (2018). The home electronic media environment and parental safety concerns: relationships with outdoor time after school and over the weekend among 9-11 year old children. BMC Public Health, 18(1), 456. https://doi.org/10.1186/s12889-018-5382-0 Zajenkowska, A., Jankowski, K. S., Lawrence, C., & Zajenkowski, M. (2013). Personality and individual differences in responses to aggression triggering events among prisoners and non-prisoners. Personality and Individual Differences, 55(8), 947–951. https://doi.org/10.1016/j.paid.2013.07.467

A supertribe Setapiitae Legalov, supertrib. n. (type genus <em>Setapion</em> Balfour-Browne, 1944), four new tribes Acanthopygini Legalov, trib. n. (type genus <em>Acanthopygus</em> Montrouzier, 1861), Philippinauletini Legalov, trib. n. (type genus <em>Philippinauletes</em> Legalov, gen. n.), Setapiini Legalov, trib. n. (type genus <em>Setapion</em> Balfour-Browne, 1944), Apiomorphini Legalov, trib. n. (type genus <em>Apiomorphus</em> Wagner, 1912), new genus <em>Philippinauletes</em> Legalov, gen. n. (type species <em>Philippinauletes rubrauletiformis</em> Legalov, sp. n.), and new subgenus <em>Apiomorphilus</em> Legalov, subgen. n. (type species <em>Apiomorphus inermipes</em> Voss, 1931) of the genus <em>Apiomorphus</em> Wagner, 1912, <em>Orthorhynchoides</em> (<em>Guineorhinotia</em>) <em>telnovi</em> Legalov, sp. n., <em>Vossicartus kakumensis </em>Legalov, sp. n., <em>Philippinauletes rubrauletiformis</em> Legalov, sp. n., <em>Deneauletes lackneri</em> Legalov, sp. n., <em>Auletanus </em>(<em>Neauletes</em>) <em>palawanensis</em> Legalov, sp. n., <em>A. </em>(<em>N.</em>) <em>versicolor</em> Legalov, sp. n., <em>A. </em>(<em>N.</em>) <em>banggiensis</em> Legalov, sp. n., <em>A. </em>(<em>N.</em>) <em>kuscheli</em> Legalov, sp. n., <em>A. </em>(<em>N.</em>) <em>kurimansis</em> Legalov, sp. n., <em>A.</em> (<em>Stictauletes</em>) <em>mabilabolensis</em> Legalov, sp. n., <em>Macroauletes philippinensis</em> Legalov, sp. n., <em>M. luzonensis</em> Legalov, sp. n., <em>Auletobius </em>(<em>Auletobius</em>) <em>barligensis</em> Legalov, sp. n., <em>A. </em>(<em>A.</em>) <em>crockerensis</em> Legalov, sp. n., <em>A. </em>(<em>A.</em>) <em>emeljanovi</em> Legalov, sp. n., <em>A. </em>(<em>A.</em>) <em>indochinensis</em> Legalov, sp. n., <em>A. </em>(<em>A.</em>) <em>kapataganensis</em> Legalov, sp. n., <em>A. </em>(<em>A.</em>) <em>weigeli</em> Legalov, sp. n., <em>A. </em>(<em>Pseudometopum</em>) <em>hartmanni</em> Legalov, sp. n., <em>Pseudauletes </em>(<em>Eopseudauletes</em>) <em>parvus</em> Legalov, sp. n., <em>Pseudomesauletes </em>(<em>Pseudomesauletes</em>) <em>boettcheri</em> Legalov, sp. n., <em>P. </em>(<em>P.</em>) <em>luzonensis</em> Legalov, sp. n., <em>Lasioauletes insolitus</em> Legalov, sp. n., <em>Cyllorhynchites </em>(<em>Pseudocyllorhynus</em>) <em>limbourgi</em> Legalov, sp. n. are described. Trigonorhinini Valetnine, 1999, syn. n. is synonymized with Anthribini Billberg, 1820, Jordanthribini Morimoto, 1980, syn. n. with Proscoporhinini Lacordaire, 1866, Platyrhinini Bedel, 1882, syn. n. with Zygaenodini Lacordaire, 1866, Auletobiina Legalov, 2001, syn. n. and Guineauletina Legalov, 2003, syn. n. with Auletorhinina Voss, 1935, <em>Eosalacus</em> Legalov, 2007, syn. n. with <em>Pseudominurus</em> Voss, 1956, Acritorrhynchitina Legalov, 2007, syn. n. with Eugnamptini Voss, 1930, Chonostropheina Morimoto, 1962, syn. n. with Deporaini Voss, 1929, Anisomerinina Legalov, 2003, syn. n. with Temnocerina Legalov, 2003, Rhynchitallina Legalov, 2003, syn. n. with Rhynchitina Gistel, 1856, <em>Zherichiniletus</em> <em>cinerascens</em> Legalov, 2007, syn. n. and <em>Zh.</em> <em>luchti</em> Legalov, 2007, syn. n. with <em>Parauletanus</em> <em>kabakovi</em> (Legalov, 2003), <em>Stictauletoides</em> Legalov, 2007, syn. n., <em>Neauletoides</em> Legalov, 2007, syn. n., <em>Javaeletobius</em> Legalov, 2007, syn. n., <em>Auletanoides</em> Legalov, 2013, syn. n. with <em>Neauletes</em> Legalov, 2003, <em>Auletobius insularis</em> Voss, 1933, syn. n. with <em>Auletanus</em> (<em>Stictauletes</em>) <em>punctiger</em> (Voss, 1922), <em>Auletorhinus</em> Voss, 1935, syn. n. and <em>Zherichiniletoides</em> Legalov, 2007, syn. n. with <em>Auletobius</em> s. str., <em>Auletobius</em> <em>pumilio</em> Marshall, 1954, syn. n. with <em>Pseudomesauletes</em> (<em>Pseudomesauletes</em>) <em>gamoensis</em> (Marshall, 1954), Oxystomatina Alonso-Zarazaga, 1990, syn. n. with Toxorhynchina Scudder, 1893, Acratini Alonso-Zarazaga, Lyal, Bartolozzi et Sforzi, 1999, syn. n. with Ithystenina Lacordaire, 1866. The systematic position of Distenorrhinoidini Legalov, 2009, placem. n., <em>Parexillis</em> Jordan, 1904, placem. n., <em>Isanthribus</em> Holloway, 1982, placem. n., <em>Polycorynus</em> Schoenherr, 1839, placem. n., <em>Mecocerina</em> Jordan, 1895, placem. n., Ischnocerides Lacordaire, 1866, placem. n., <em>Sharpius</em> Holloway, 1982, placem. n., <em>Systellorhynchus</em> Blanchard, 1849, placem. n., Nessiarini Morimoto, 1972, placem. n., <em>Exillis</em> Pascoe, 1860, placem. n., <em>Phloeops</em> Lacordaire, 1866, placem. n., <em>Lagopezus</em> Dejean, 1834, placem. n., <em>Neoxenus</em> Valentine, 1999, placem. n., <em>Cyptoxenus</em> Valentine, 1982, placem. n., <em>Sicanthus</em> Valentine, 1989, placem. n., <em>Holostilpna</em> Jordan, 1907, placem. n., <em>Euxenulus</em> Valentine, 1960, placem. n., <em>Acaromimus</em> Jordan, 1907, placem. n., <em>Habroxenus</em> Valentine, 1989, placem. n., Auletanina Legalov, 2003, placem. n., <em>Parauletanus</em> <em>kabakovi</em> (Legalov, 2003), placem. n., <em>Auletobius</em> (<em>Auletobius</em>) <em>horaki</em> (Legalov, 2007), placem. n., Eosalacina Legalov, 2007, placem. n., Trichapiina Alonso-Zarazaga, 1990, placem. n., <em>Mythapion</em> Kissinger, 2005, placem. n., <em>Hecyrapion</em> Kissinger, 2005, placem. n., <em>Rhamnapion</em> Kissinger, 2005, placem. n., <em>Acarapion</em> Kissinger, 2005, placem. n., <em>Pystapion</em> Kissinger, 2005, placem. n., Stereodermina Sharp, 1895, placem. n., Atopobrentina Damoiseau, 1965, placem. n., Hoplopisthiina Senna et Calabresi, 1919, placem. n., <em>Schizotrachelus</em> Lacordaire, 1866, placem. n., Tychaeina Schoenfeldt, 1908, placem. n., Ithystenina Lacordaire, 1866, placem. n. and Pholidochlamydina Damoiseau, 1962, placem. n. are changed. Status of Phloeotragini Lacordaire, 1866, stat. res., Apolectini Lacordaire, 1866, stat. res., Cappadocini Alonso-Zarazaga et Lyal, 1999, stat. res., Valenfriesiini Alonso-Zarazaga et Lyal, 1999, stat. res., Homoeoderini Pierce, 1930, stat. res., <em>Australobelus</em> Legalov, 2009, stat. res., <em>Blackburnibelus</em> Legalov, 2009, stat. res., <em>Leabelus</em> Legalov, 2009, stat. res., <em>Pascoebelus</em> Legalov, 2009, stat. res., <em>Pseodorhinotia</em> Legalov, 2009, stat. res., <em>Tasmanobelus</em> Legalov, 2009, stat. res., <em>Germaribelus</em> Legalov, 2009, stat. res., Afrocorynini Voss, 1957, stat. res. , Hispodini Voss, 1957, stat. res., <em>Crowsonicar</em> Legalov, 2013, stat. res., <em>Daulaxius</em> Pascoe, 1887, stat. res., Vossicartini Legalov, 2003, stat. res., Parauletanini Legalov, 2007, stat. res., <em>Australetobius</em> Legalov, 2007, stat. res., <em>Longoauletes</em> Legalov, 2007, stat. res., <em>Micrauletes</em> Legalov, 2003, stat. res., <em>Pseudoparauletes</em> Legalov, 2001, stat. res., Eugnamptini Voss, 1930, stat. res., Synapiina Alonso-Zarazaga, 1990, stat. res. and Paussobrenthina Gestro, 1919, stat. res. are recovered. Changes of status for Montsecanomalinae Legalov, 2015, stat. n., <em>Neauletes</em> Legalov, 2003, stat. n., <em>Stictauletes</em> Voss, 1934, stat. n., Mecolenini Wanat, 2001, stat. n., Catapiini Alonso-Zarazaga, 1990, stat. n., Hephebocerina Lacordaire, 1866, stat. n., Pholidochlamydina Damoiseau, 1962, stat. n., Pholidochlamydina Damoiseau, 1962, stat. n. and <em>Protocylas</em> Pierce, 1941, stat. res. are made. New combinations for <em>Parauletanus</em> <em>kabakovi</em> (Legalov, 2003), comb. n., <em>Auletanus</em> (<em>Neauletes</em>) <em>baitetensis</em> (Legalov, 2007), comb. n., <em>A</em>. (<em>N</em>.) <em>drescheri</em> Voss, 1935, <em>A</em>. (<em>N</em>.) <em>madangensis</em> (Legalov, 2007), comb. n., <em>A</em>. (<em>N</em>.) <em>mindanaoensis</em> (Legalov, 2007), comb. n., <em>A</em>. (<em>N</em>.) <em>relictus</em> (Legalov, 2003), comb. n., <em>A</em>. (<em>N</em>.) <em>salomonicus</em> (Thompson, 1982), comb. n., <em>A</em>. (<em>N</em>.) <em>sumbaensis</em> (Legalov, 2013), comb. n., <em>A</em>. (<em>N</em>.) <em>tawitawensis</em> (Legalov, 2007), comb. n., <em>A</em>. (<em>N</em>.) <em>toxopeusi</em> (Voss, 1957), comb. n., <em>Auletanus</em> (<em>Stictauletes</em>) <em>punctiger</em> (Voss, 1922), comb. n., <em>Auletobius</em> (<em>Auletobius</em>) <em>horaki</em> (Legalov, 2007), comb. n., <em>Pseudominurus</em> (<em>Pseudominurus</em>) <em>reunionensis</em> (Legalov, 2007), comb. n. are established. A key to the families of Curculionoidea is given. The keys to subfamilies, supertribes, tribes and subtribes of Nemonychidae, Anthribidae, Belidae, Ithyceridae, Rhynchitidae and Brentidae, key to Oriental genera of tribe Parauletanini, key to genera of subtribe Auletorhinina, key to subgenera of genus <em>Auletanus </em>and key to subfamilies and genera of Brachyceridae are provided.

AbstractBecause of its extreme darkness, The nocturnal conspiracy of Claudius Civilis by Govert Flinck (16151660) and Jürgen Ovens (1623-1678) holds an isolated position within the decoration program with the Batavian revolt in the galleries of Amsterdam's former Town Hall. Of course the canvas depicts a nocturnal scene with light from only the fire and the moon, but in this painting the darkness dominates virtually everything. The rough, rather sketchy execution, whereby large parts of the canvas are left unpainted is also peculiar. Because of this appearance, some art historians have thought it an outrage that this 'painting with no value' should have replaced Rembrandt's masterpiece with the same subject. However, Flinck and Ovens – both pupils of Rembrandt – were painters of the first rank and there is nothing in the oeuvre of either master that is reminiscent of this rather unbalanced gallery painting. The question is therefore: to what does this piece owe its inaccessible appearance? This, of course, also relates to the manufacture-process and function of the canvas. Archival records and historical texts contain many relevant details on the paintings' genesis but have so far mainly given rise to confusion. The technical investigation, carried out during the 2007-2009 conservation campaign of the Batavian series, now demonstrates that the painting's extreme appearance traces back to both its peculiar genesis that is wholly different from that of the other gallery paintings and to its unfortunate conservation history. It was found that the piece was never intended to be a permanent decoration: the canvas is the one surviving remnant of a series of temporary festive decorations that Flinck had produced in the summer of 1659 in honour of the visit of Amalia van Solms and the Orange family to the Town Hall. Because of the painting's temporary nature, Flinck has modified his usual working procedures. Rather than taking sturdy, durable linen he chose a thin, fine canvas; and instead of applying to his canvas a reliable ground layer he painted on it directly. Flinck elected for fast-drying water-based paint (gum arabic) and worked with an extremely modest palette: he coloured his canvas with a thinned brown paint and on this base modelled his figures with only black contours and beige highlights. The original idea was that Flinck's temporary works would be replaced by permanent decorations from his hand, consisting of twelve paintings. But because of his untimely death in 1660, the commission was divided between Jordaens, Lievens and Rembrandt. Rembrandt's painting, to replace Flinck's work with the nocturnal conspiracy, was almost immediately removed, probably in the summer of 1662. When the Bishop of Cologne visited Amsterdam shortly afterwards, this empty space needed to be filled in a hurry and Flinck's old decoration was retrieved from storage. Jürgen Ovens was commissioned to 'work up [= finish] a sketch by Govert Flinck into a complete ordonnance'. Once again we seem to be dealing with a temporary decoration, for the modest sum of 48 guilders was all that Ovens was paid. The painter only did what was absolutely essential – after applying an isolating glue layer, he just added a few lines and touches of colour in oil paint here and there, all just enough to clarify Flinck's image, which was by then probably somewhat battered. The planned replacement of the Flinck/Ovens' canvas by a permanent painting never materialized; oppressed by a shortage of finance, the city governors decided in 1664 to postpone for five years all commissions or purchases of paintings for the Town Hall. This is why Flinck's canvas, dressed up a little by Ovens, has remained in the gallery to this day. Obviously, this painting, produced for a strictly temporary purpose, was never intended to have such a long 'life'. An ungrounded canvas painted with water-based paint is highly fragile and discolours as the fabric ages. But quite apart from this discolouration the dark and empty impression that the painting conveys today, is mainly due to earlier treatments by those who had no understanding of its unique characteristics. As archival records show, in the eighteenth century the canvas was lined twice using glue; a treatment that involved the use of considerable amounts of water. In addition, over the centuries the painting has been varnished several times and in the 1960's it was given a wax-resin lining. It is because these treatments, each of which is totally unsuitable for a water-based canvas, that the painting has acquired its present patchy and dark orange-brown appearance. Since nothing can be done to remedy the consequences of the lack of understanding of previous centuries - one cannot return to the painting's original appearance - the aim of the recent restoration was to achieve a balance between the aspects of the painting that stem from its unusual manufacture-process and the qualities that are the consequence of its conservation history.

The study aimed to identify the necessity of building a proposed vision to enhance the psychological and social support of orphans in care homes, and the researcher reviews in this study the definition of the study terms represented in psychological and social support and orphanages and care homes, as well as the difficulties and challenges facing orphan care institutions in providing psychological and social support to orphans The researcher used the descriptive desktop approach to identify the literature related to developing the proposed vision to enhance psychological and social support for orphans in care homes. The study showed that providing psychological and social support helps orphans Depositors in care homes to face life stresses and positive adaptation to the circumstance of loss and overcome difficulties before them in order to develop their psychological and social compatibility, as well as enable them through programs to explore their capabilities and develop their capabilities and raise their competencies. The study recommended providing orphan care institutions with the amenities, entertainment and educational games aimed at contributing to creating a positive atmosphere aimed at achieving psychological and social compatibility for the orphans in which they are placed1. Ibrahim, Zakaria (1973 AD) The Artist and the Man, Egypt: Dar Gharib for Printing and Publishing.2. Istiti, Tasnim, Muhammad Jamal. Hassan (2007 CE): Orphan's Rights in Islamic Jurisprudence, Master Thesis, College of Graduate Studies, An-Najah National University, Nablus, Palestine.3. Al-Buraq, Amna (2011): The needs of adults of unknown parentage after leaving institutions for orphans, the first Saudi conference for orphan care.4. Jalal, Nusseibeh (2017): Psychological care for Syrian refugee orphans, "a field study", Research Center for Studies, Syria.5. Al-Halibi, Khalid bin Saud (1425 AH): How can you contribute to developing the positive character of an orphan by making use of educational experiences, a working paper in a symposium entitled: “Future visions for orphan care in the Kingdom of Saudi Arabia,” Ministry of Social Affairs, Ministry Agency For Social Affairs, Social Affairs Office, Dammam, Tuesday 21/8/1425 AH corresponding to 5/10/20046. Hamzah, Ahmad (2011): The Effectiveness of an Integrated Counseling Program in Reducing Violence for a Sample of Orphaned Delinquent Children, The First Saudi Conference for Orphan Care.7. Al-Khayyat, Abdul Aziz (1981): Interdependent Society in Islam, 2nd Edition, Al-Risalah Foundation, AmmanAl-Sadhan, Abdullah bin Nasser (2001); Children without families, Obeikan Library, Riyadh.9. Al-Sulami, Musleh Salih (1415 AH), raising orphans in the Kingdom of Saudi Arabia, an evaluation study, an unpublished master's thesis, Department of Islamic Education, College of Education, Umm Al-Qura University, Makkah Al-Mukarramah.10. Al-Suwairi, Ali Abdullah; (2009 AD); “Psychological and Social Problems among Orphans in the Charitable Society of Makkah Al-Mukarramah”, Master Thesis, College of Education, Department of Psychology, Umm Al-Qura University, Makkah Al-Mukarramah.11. Amer, Adel (2004 AD); Orphan children have no legal and legal protection, a study published (in :) The House of Legal, Islamic and Human Sciences Forum, http://adel-amer.catsh.12. Al-Anani, Hanan Abdel-Hamid (2005): Development of Social, Religious and Ethical Concepts in Early Childhood, Jordan: House of Fikr.13. Al-Matrafi, Fawzia Muhammad Abdel Mohsen; (2001): “Study of the relationship between the nutritional status and meals provided to children of orphanages in Makkah Al-Mukarramah region for school-age children (12-6 years old)”, PhD Thesis, College of Education for Home Economics, Department of Nutrition and Food Sciences, Makkah Al-Mukarramah.14. Al-Nuwaiser, Khalid bin Abdulaziz, (2011): The role of national systems in protecting and caring for orphans' rights, The First Saudi Conference for Orphan Care.15. Browne, K. (2009). The Risk of Harm to Young Children in Institutional Care. Typeset by Grasshopper Design Company. Printed by Stephen Austin & Sons Ltd.16. Carter R. (2005). Family Matters: A study of institutional childcare in Central and Eastern Europe and the Former Soviet Union. London:Everychild.

<p><strong>List of abstracts and authors:</strong></p><p><strong>1. Antipsychotics in anxiety disorders</strong></p><p>Christer Allgulander</p><p><strong>2. Anxiety in somatic disorders</strong></p><p>Christer Allgulander</p><p><strong>3. Community rehabilitation of the schizophrenic patient</strong></p><p>Orlando Alonso Betancourt, Maricela Morales Herrera</p><p><strong>4. Dual diagnosis: A theory-driven multidisciplinary approach for integrative care</strong></p><p>David Blackbeard</p><p><strong>5. The emotional language of the gut - when 'psyche' meets 'soma'</strong></p><p>Helen Clark</p><p><strong>6. The Psychotherapy of bipolar disorder</strong></p><p>Franco Colin</p><p><strong>7. The Psychotherapy of bipolar disorder</strong></p><p>Franco Colin</p><p><strong>8. Developing and adopting mental health policies and plans in Africa: Lessons from South Africa, Uganda and Zambia</strong></p><p>Sara Cooper, Sharon Kleintjes, Cynthia Isaacs, Fred Kigozi, Sheila Ndyanabangi, Augustus Kapungwe, John Mayeya, Michelle Funk, Natalie Drew, Crick Lund</p><p><strong>9. The importance of relapse prevention in schizophrenia</strong></p><p>Robin Emsley</p><p><strong>10. Mental Health care act: Fact or fiction?</strong></p><p>Helmut Erlacher, M Nagdee</p><p><strong>11. Does a dedicated 72-hour observation facility in a district hospital reduce the need for involuntary admissions to a psychiatric hospital?</strong></p><p>Lennart Eriksson</p><p><strong>12. The incidence and risk factors for dementia in the Ibadan study of ageing</strong></p><p>Oye Gureje, Lola Kola, Adesola Ogunniyi, Taiwo Abiona</p><p><strong>13. Is depression a disease of inflammation?</strong></p><p><strong></strong>Angelos Halaris</p><p><strong>14. Paediatric bipolar disorder: More heat than light?</strong></p><p>Sue Hawkridge</p><p><strong>15. EBM: Anova Conundrum</strong></p><p>Elizabeth L (Hoepie) Howell</p><p><strong>16. Tracking the legal status of a cohort of inpatients on discharge from a 72-hour assessment unit</strong></p><p>Bernard Janse van Rensburg</p><p><strong>17. Dual diagnosis units in psychiatric facilities: Opportunities and challenges</strong></p><p>Yasmien Jeenah</p><p><strong>18. Alcohol-induced psychotic disorder: A comparative study on the clinical characteristics of patients with alcohol dependence and schizophrenia</strong></p><p>Gerhard Jordaan, D G Nel, R Hewlett, R Emsley</p><p><strong>19. Anxiety disorders: the first evidence for a role in preventive psychiatry</strong></p><p>Andre F Joubert</p><p><strong>20. The end of risk assessment and the beginning of start</strong></p><p>Sean Kaliski</p><p><strong>21. Psychiatric disorders abd psychosocial correlates of high HIV risk sexual behaviour in war-effected Eatern Uganda</strong></p><p>E Kinyada, H A Weiss, M Mungherera, P Onyango Mangen, E Ngabirano, R Kajungu, J Kagugube, W Muhwezi, J Muron, V Patel</p><p><strong>22. One year of Forensic Psychiatric assessment in the Northern Cape: A comparison with an established assessment service in the Eastern Cape</strong></p><p>N K Kirimi, C Visser</p><p><strong>23. Mental Health service user priorities for service delivery in South Africa</strong></p><p>Sharon Kleintjes, Crick Lund, Leslie Swartz, Alan Flisher and MHaPP Research Programme Consortium</p><p><strong>24. The nature and extent of over-the-counter and prescription drug abuse in cape town</strong></p><p>Liezl Kramer</p><p><strong>25. Physical health issues in long-term psychiatric inpatients: An audit of nursing statistics and clinical files at Weskoppies Hospital</strong></p><p>Christa Kruger</p><p><strong>26. Suicide risk in Schizophrenia - 20 Years later, a cohort study</strong></p><p>Gian Lippi, Ean Smit, Joyce Jordaan, Louw Roos</p><p><strong>27.Developing mental health information systems in South Africa: Lessons from pilot projects in Northern Cape and KwaZulu-Natal</strong></p><p>Crick Lund, S Skeen, N Mapena, C Isaacs, T Mirozev and the Mental Health and Poverty Research Programme Consortium Institution</p><p><strong>28. Mental health aspects of South African emigration</strong></p><p>Maria Marchetti-Mercer</p><p><strong>29. What services SADAG can offer your patients</strong></p><p>Elizabeth Matare</p><p><strong>30. Culture and language in psychiatry</strong></p><p>Dan Mkize</p><p><strong>31. Latest psychotic episode</strong></p><p>Povl Munk-Jorgensen</p><p><strong>32. The Forensic profile of female offenders</strong></p><p>Mo Nagdee, Helmut Fletcher</p><p><strong>33. The intra-personal emotional impact of practising psychiatry</strong></p><p>Margaret Nair</p><p><strong>34. Highly sensitive persons (HSPs) and implications for treatment</strong></p><p>Margaret Nair</p><p><strong>35. Task shifting in mental health - The Kenyan experience</strong></p><p>David M Ndetei</p><p><strong>36. Bridging the gap between traditional healers and mental health in todya's modern psychiatry</strong></p><p>David M Ndetei</p><p><strong>37. Integrating to achieve modern psychiatry</strong></p><p>David M Ndetei</p><p><strong>38. Non-medical prescribing: Outcomes from a pharmacist-led post-traumatic stress disorder clinic</strong></p><p>A Parkinson</p><p><strong>39. Is there a causal relationship between alcohol and HIV? Implications for policy, practice and future research</strong></p><p>Charles Parry</p><p><strong>40. Global mental health - A new global health discipline comes of age</strong></p><p>Vikram Patel</p><p><strong>41. Integrating mental health into primary health care: Lessons from pilot District demonstration sites in Uganda and South Africa</strong></p><p>Inge Petersen, Arvin Bhana, K Baillie and MhaPP Research Programme Consortium</p><p><strong>42. Personality disorders -The orphan child in axis I - Axis II Dichotomy</strong></p><p><strong></strong>Willie Pienaar</p><p><strong>43. Case Studies in Psychiatric Ethics</strong></p><p>Willie Pienaar</p><p><strong>44. Coronary artery disease and depression: Insights into pathogenesis and clinical implications</strong></p><p>Janus Pretorius</p><p><strong>45. Impact of the Mental Health Care Act No. 17 of 2002 on designated hospitals in KwaZulu-Natal: Triumphs and trials</strong></p><p>Suvira Ramlall, Jennifer Chipps</p><p><strong>46. Biological basis of addication</strong></p><p>Solomon Rataemane</p><p><strong>47. Genetics of Schizophrenia</strong></p><p>Louw Roos</p><p><strong>48. Management of delirium - Recent advances</strong></p><p>Shaquir Salduker</p><p><strong>49. Social neuroscience: Brain research on social issues</strong></p><p>Manfred Spitzer</p><p><strong>50. Experiments on the unconscious</strong></p><p>Manfred Spitzer</p><p><strong>51. The Psychology and neuroscience of music</strong></p><p>Manfred Spitzer</p><p><strong>52. Mental disorders in DSM-V</strong></p><p>Dan Stein</p><p><strong>53. Personality, trauma exposure, PTSD and depression in a cohort of SA Metro policemen: A longitudinal study</strong></p><p>Ugashvaree Subramaney</p><p><strong>54. Eating disorders: An African perspective</strong></p><p>Christopher Szabo</p><p><strong>55. An evaluation of the WHO African Regional strategy for mental health 2001-2010</strong></p><p>Thandi van Heyningen, M Majavu, C Lund</p><p><strong>56. A unitary model for the motor origin of bipolar mood disorders and schizophrenia</strong></p><p>Jacques J M van Hoof</p><p><strong>57. The origin of mentalisation and the treatment of personality disorders</strong></p><p>Jacques J M Hoof</p><p><strong>58. How to account practically for 'The Cause' in psychiatric diagnostic classification</strong></p><p>C W (Werdie) van Staden</p><p><strong>POSTER PRESENTATIONS</strong></p><p><strong>59. Problem drinking and physical and sexual abuse at WSU Faculty of Health Sciences, Mthatha, 2009</strong></p><p>Orlando Alonso Betancourt, Maricela Morales Herrera, E, N Kwizera, J L Bernal Munoz</p><p><strong>60. Prevalence of alcohol drinking problems and other substances at WSU Faculty of Health Sciences, Mthatha, 2009</strong></p><p>Orlando Alonso Betancourt, Maricela Morales Herrera, E, N Kwizera, J L Bernal Munoz</p><p><strong>61. Lessons learnt from a modified assertive community-based treatment programme in a developing country</strong></p><p>Ulla Botha, Liezl Koen, John Joska, Linda Hering, Piet Ooosthuizen</p><p><strong>62. Perceptions of psychologists regarding the use of religion and spirituality in therapy</strong></p><p>Ottilia Brown, Diane Elkonin</p><p><strong>63. Resilience in families where a member is living with schizophreni</strong></p><p>Ottilia Brown, Jason Haddad, Greg Howcroft</p><p><strong>64. Fusion and grandiosity - The mastersonian approach to the narcissistic disorder of the self</strong></p><p>William Griffiths, D Macklin, Loray Daws</p><p><strong>65. Not being allowed to exist - The mastersonian approach to the Schizoid disorder of the self</strong></p><p>William Griffiths, D Macklin, Loray Daws</p><p><strong>66. Risky drug-injecting behaviours in Cape Town and the need for a needle exchange programme</strong></p><p>Volker Hitzeroth</p><p><strong>67. Neuroleptic malignant syndrome in adolescents in the Western Cape: A case series</strong></p><p>Terri Henderson</p><p><strong>68. Experience and view of local academic psychiatrists on the role of spirituality in South African specialist psychiatry, compared with a qualitative analysis of the medical literature</strong></p><p>Bernard Janse van Rensburg</p><p><strong>69. The role of defined spirituality in local specialist psychiatric practice and training: A model and operational guidelines for South African clinical care scenarios</strong></p><p>Bernard Janse van Rensburg</p><p><strong>70. Handedness in schizophrenia and schizoaffective disorder in an Afrikaner founder population</strong></p><p>Marinda Joubert, J L Roos, J Jordaan</p><p><strong>71. A role for structural equation modelling in subtyping schizophrenia in an African population</strong></p><p>Liezl Koen, Dana Niehaus, Esme Jordaan, Robin Emsley</p><p><strong>72. Caregivers of disabled elderly persons in Nigeria</strong></p><p>Lola Kola, Oye Gureje, Adesola Ogunniyi, Dapo Olley</p><p><strong>73. HIV Seropositivity in recently admitted and long-term psychiatric inpatients: Prevalence and diagnostic profile</strong></p><p>Christina Kruger, M P Henning, L Fletcher</p><p><strong>74. Syphilis seropisitivity in recently admitted longterm psychiatry inpatients: Prevalence and diagnostic profile</strong></p><p>Christina Kruger, M P Henning, L Fletcher</p><p><strong>75. 'The Great Suppression'</strong></p><p>Sarah Lamont, Joel Shapiro, Thandi Groves, Lindsey Bowes</p><p><strong>76. Not being allowed to grow up - The Mastersonian approach to the borderline personality</strong></p><p>Daleen Macklin, W Griffiths</p><p><strong>77. Exploring the internal confirguration of the cycloid personality: A Rorschach comprehensive system study</strong></p><p>Daleen Macklin, Loray Daws, M Aronstam</p><p><strong>78. A survey to determine the level of HIV related knowledge among adult psychiatric patients admitted to Weskoppies Hospital</strong></p><p><strong></strong> T G Magagula, M M Mamabolo, C Kruger, L Fletcher</p><p><strong>79. A survey of risk behaviour for contracting HIV among adult psychiatric patients admitted to Weskoppies Hospital</strong></p><p>M M Mamabolo, T G Magagula, C Kruger, L Fletcher</p><p><strong>80. A retrospective review of state sector outpatients (Tara Hospital) prescribed Olanzapine: Adherence to metabolic and cardiovascular screening and monitoring guidelines</strong></p><p>Carina Marsay, C P Szabo</p><p><strong>81. Reported rapes at a hospital rape centre: Demographic and clinical profiles</strong></p><p>Lindi Martin, Kees Lammers, Donavan Andrews, Soraya Seedat</p><p><strong>82. Exit examination in Final-Year medical students: Measurement validity of oral examinations in psychiatry</strong></p><p>Mpogisheng Mashile, D J H Niehaus, L Koen, E Jordaan</p><p><strong>83. Trends of suicide in the Transkei region of South Africa</strong></p><p>Banwari Meel</p><p><strong>84. Functional neuro-imaging in survivors of torture</strong></p><p>Thriya Ramasar, U Subramaney, M D T H W Vangu, N S Perumal</p><p><strong>85. Newly diagnosed HIV+ in South Africa: Do men and women enroll in care?</strong></p><p>Dinesh Singh, S Hoffman, E A Kelvin, K Blanchard, N Lince, J E Mantell, G Ramjee, T M Exner</p><p><strong>86. Diagnostic utitlity of the International HIC Dementia scale for Asymptomatic HIV-Associated neurocognitive impairment and HIV-Associated neurocognitive disorder in South Africa</strong></p><p>Dinesh Singh, K Goodkin, D J Hardy, E Lopez, G Morales</p><p><strong>87. The Psychological sequelae of first trimester termination of pregnancy (TOP): The impact of resilience</strong></p><p>Ugashvaree Subramaney</p><p><strong>88. Drugs and other therapies under investigation for PTSD: An international database</strong></p><p>Sharain Suliman, Soraya Seedat</p><p><strong>89. Frequency and correlates of HIV Testing in patients with severe mental illness</strong></p><p>Hendrik Temmingh, Leanne Parasram, John Joska, Tania Timmermans, Pete Milligan, Helen van der Plas, Henk Temmingh</p><p><strong>90. A proposed mental health service and personnel organogram for the Elizabeth Donkin psychiatric Hospital</strong></p><p>Stephan van Wyk, Zukiswa Zingela</p><p><strong>91. A brief report on the current state of mental health care services in the Eastern Cape</strong></p><p>Stephan van Wyk, Zukiswa Zingela, Kiran Sukeri, Heloise Uys, Mo Nagdee, Maricela Morales, Helmut Erlacher, Orlando Alonso</p><p><strong>92. An integrated mental health care service model for the Nelson Mandela Bay Metro</strong></p><p>Stephan van Wyk, Zukiswa Zingela, Kiran Sukeri</p><p><strong>93. Traditional and alternative healers: Prevalence of use in psychiatric patients</strong></p><p>Zukiswa Zingela, S van Wyk, W Esterhuysen, E Carr, L Gaauche</p>

Climate change induced sea-level rise (SLR) is on its increase globally. Regionally the lowlands of China, Vietnam, Bangladesh, and islands of the Malaysian, Indonesian and Philippine archipelagos are among the world’s most threatened regions. Sea-level rise has major impacts on the ecosystems and society. It threatens coastal populations, economic activities, and fragile ecosystems as mangroves, coastal salt-marches and wetlands. This paper provides a summary of the current state of knowledge of sea level-rise and its effects on both human and natural ecosystems. The focus is on coastal urban areas and low lying deltas in South-East Asia and Vietnam, as one of the most threatened areas in the world. About 3 mm per year reflects the growing consensus on the average SLR worldwide. The trend speeds up during recent decades. The figures are subject to local, temporal and methodological variation. In Vietnam the average values of 3.3 mm per year during the 1993-2014 period are above the worldwide average. Although a basic conceptual understanding exists that the increasing global frequency of the strongest tropical cyclones is related with the increasing temperature and SLR, this relationship is insufficiently understood. Moreover the precise, complex environmental, economic, social, and health impacts are currently unclear. SLR, storms and changing precipitation patterns increase flood risks, in particular in urban areas. Part of the current scientific debate is on how urban agglomeration can be made more resilient to flood risks. Where originally mainly technical interventions dominated this discussion, it becomes increasingly clear that proactive special planning, flood defense, flood risk mitigation, flood preparation, and flood recovery are important, but costly instruments. Next to the main focus on SLR and its effects on resilience, the paper reviews main SLR associated impacts: Floods and inundation, salinization, shoreline change, and effects on mangroves and wetlands. The hazards of SLR related floods increase fastest in urban areas. This is related with both the increasing surface major cities are expected to occupy during the decades to come and the increasing coastal population. In particular Asia and its megacities in the southern part of the continent are increasingly at risk. The discussion points to complexity, inter-disciplinarity, and the related uncertainty, as core characteristics. An integrated combination of mitigation, adaptation and resilience measures is currently considered as the most indicated way to resist SLR today and in the near future.References Aerts J.C.J.H., Hassan A., Savenije H.H.G., Khan M.F., 2000. Using GIS tools and rapid assessment techniques for determining salt intrusion: Stream a river basin management instrument. Physics and Chemistry of the Earth, Part B: Hydrology, Oceans and Atmosphere, 25, 265-273. Doi: 10.1016/S1464-1909(00)00014-9. Alongi D.M., 2002. Present state and future of the world’s mangrove forests. Environmental Conservation, 29, 331-349. Doi: 10.1017/S0376892902000231 Alongi D.M., 2015. The impact of climate change on mangrove forests. Curr. Clim. Change Rep., 1, 30-39. Doi: 10.1007/s404641-015-0002-x. Anderson F., Al-Thani N., 2016. Effect of sea level rise and groundwater withdrawal on seawater intrusion in the Gulf Coast aquifer: Implications for agriculture. Journal of Geoscience and Environment Protection, 4, 116-124. Doi: 10.4236/gep.2016.44015. Anguelovski I., Chu E., Carmin J., 2014. Variations in approaches to urban climate adaptation: Experiences and experimentation from the global South. Global Environmental Change, 27, 156-167. Doi: 10.1016/j.gloenvcha.2014.05.010. Arustienè J., Kriukaitè J., Satkunas J., Gregorauskas M., 2013. Climate change and groundwater - From modelling to some adaptation means in example of Klaipèda region, Lithuania. In: Climate change adaptation in practice. P. Schmidt-Thomé, J. Klein Eds. John Wiley and Sons Ltd., Chichester, UK., 157-169. Bamber J.L., Aspinall W.P., Cooke R.M., 2016. A commentary on “how to interpret expert judgement assessments of twenty-first century sea-level rise” by Hylke de Vries and Roderik S.W. Van de Wal. Climatic Change, 137, 321-328. Doi: 10.1007/s10584-016-1672-7. Barnes C., 2014. Coastal population vulnerability to sea level rise and tropical cyclone intensification under global warming. BSc-thesis. Department of Geography, University of Lethbridge, Alberta Canada. Be T.T., Sinh B.T., Miller F., 2007. Challenges to sustainable development in the Mekong Delta: Regional and national policy issues and research needs. The Sustainable Mekong Research Network, Bangkok, Thailand, 1-210. Bellard C., Leclerc C., Courchamp F., 2014. Impact of sea level rise on 10 insular biodiversity hotspots. Global Ecology and Biogeography, 23, 203-212. Doi: 10.1111/geb.12093. Berg H., Söderholm A.E., Sönderström A.S., Nguyen Thanh Tam, 2017. Recognizing wetland ecosystem services for sustainable rice farming in the Mekong delta, Vietnam. Sustainability Science, 12, 137-154. Doi: 10.1007/s11625-016-0409-x. Bilskie M.V., Hagen S.C., Medeiros S.C., Passeri D.L., 2014. Dynamics of sea level rise and coastal flooding on a changing landscape. Geophysical Research Letters, 41, 927-934. Doi: 10.1002/2013GL058759. Binh T.N.K.D., Vromant N., Hung N.T., Hens L., Boon E.K., 2005. Land cover changes between 1968 and 2003 in Cai Nuoc, Ca Mau penisula, Vietnam. Environment, Development and Sustainability, 7, 519-536. Doi: 10.1007/s10668-004-6001-z. Blankespoor B., Dasgupta S., Laplante B., 2014. Sea-level rise and coastal wetlands. Ambio, 43, 996- 005.Doi: 10.1007/s13280-014-0500-4. Brockway R., Bowers D., Hoguane A., Dove V., Vassele V., 2006. A note on salt intrusion in funnel shaped estuaries: Application to the Incomati estuary, Mozambique.Estuarine, Coastal and Shelf Science, 66, 1-5. Doi: 10.1016/j.ecss.2005.07.014. Cannaby H., Palmer M.D., Howard T., Bricheno L., Calvert D., Krijnen J., Wood R., Tinker J., Bunney C., Harle J., Saulter A., O’Neill C., Bellingham C., Lowe J., 2015. Projected sea level rise and changes in extreme storm surge and wave events during the 21st century in the region of Singapore. Ocean Sci. Discuss, 12, 2955-3001. Doi: 10.5194/osd-12-2955-2015. Carraro C., Favero A., Massetti E., 2012. Investment in public finance in a green, low carbon economy. Energy Economics, 34, S15-S18. Castan-Broto V., Bulkeley H., 2013. A survey ofurban climate change experiments in 100 cities. Global Environmental Change, 23, 92-102. Doi: 10.1016/j.gloenvcha.2012.07.005. Cazenave A., Le Cozannet G., 2014. Sea level rise and its coastal impacts. GeoHealth, 2, 15-34. Doi: 10.1002/2013EF000188. Chu M.L., Guzman J.A., Munoz-Carpena R., Kiker G.A., Linkov I., 2014. A simplified approach for simulating changes in beach habitat due to the combined effects of long-term sea level rise, storm erosion and nourishment. Environmental modelling and software, 52, 111-120. Doi.org/10.1016/j.envcsoft.2013.10.020. Church J.A. et al., 2013. Sea level change. In: Climate change 2013: The physical science basis. Contribution of working group I to the fifth assessment report of Intergovernmental Panel on Climate Change. Eds: Stocker T.F., Qin D., Plattner G.-K., Tignor M., Allen S.K., Boschung J., Nauels A., Xia Y., Bex V., Midgley P.M., Cambridge University Press, Cambridge, UK. Connell J., 2016. Last days of the Carteret Islands? Climate change, livelihoods and migration on coral atolls. Asia Pacific Viewpoint, 57, 3-15. Doi: 10.1111/apv.12118. Dasgupta S., Laplante B., Meisner C., Wheeler, Yan J., 2009. The impact of sea level rise on developing countries: A comparative analysis. Climatic Change, 93, 379-388. Doi: 10.1007/s 10584-008-9499-5. Delbeke J., Vis P., 2015. EU climate policy explained, 136p. Routledge, Oxon, UK. DiGeorgio M., 2015. Bargaining with disaster: Flooding, climate change, and urban growth ambitions in QuyNhon, Vietnam. Public Affairs, 88, 577-597. Doi: 10.5509/2015883577. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, 2015. Enhancement of coastal protection under the context of climate change: A case study of Hai Hau coast, Vietnam. Proceedings of the 10th Asian Regional Conference of IAEG, 1-8. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, Lan Nguyen Chau, 2017. Climate change impacts on a large-scale erosion coast of Hai Hau district, Vietnam and the adaptation. Journal of Coastal Conservation, 21, 47-62. Donner S.D., Webber S., 2014. Obstacles to climate change adaptation decisions: A case study of sea level rise; and coastal protection measures in Kiribati. Sustainability Science, 9, 331-345. Doi: 10.1007/s11625-014-0242-z. Driessen P.P.J., Hegger D.L.T., Bakker M.H.N., Van Renswick H.F.M.W., Kundzewicz Z.W., 2016. Toward more resilient flood risk governance. Ecology and Society, 21, 53-61. Doi: 10.5751/ES-08921-210453. Duangyiwa C., Yu D., Wilby R., Aobpaet A., 2015. Coastal flood risks in the Bangkok Metropolitan region, Thailand: Combined impacts on land subsidence, sea level rise and storm surge. American Geophysical Union, Fall meeting 2015, abstract#NH33C-1927. Duarte C.M., Losada I.J., Hendriks I.E., Mazarrasa I., Marba N., 2013. The role of coastal plant communities for climate change mitigation and adaptation. Nature Climate Change, 3, 961-968. Doi: 10.1038/nclimate1970. Erban L.E., Gorelick S.M., Zebker H.A., 2014. Groundwater extraction, land subsidence, and sea-level rise in the Mekong Delta, Vietnam. Environmental Research Letters, 9, 1-20. Doi: 10.1088/1748-9326/9/8/084010. FAO - Food and Agriculture Organisation, 2007.The world’s mangroves 1980-2005. FAO Forestry Paper, 153, Rome, Italy. Farbotko C., 2010. Wishful sinking: Disappearing islands, climate refugees and cosmopolitan experimentation. Asia Pacific Viewpoint, 51, 47-60. Doi: 10.1111/j.1467-8373.2010.001413.x. Goltermann D., Ujeyl G., Pasche E., 2008. Making coastal cities flood resilient in the era of climate change. Proceedings of the 4th International Symposium on flood defense: Managing flood risk, reliability and vulnerability, 148-1-148-11. Toronto, Canada. Gong W., Shen J., 2011. The response of salt intrusion to changes in river discharge and tidal mixing during the dry season in the Modaomen Estuary, China.Continental Shelf Research, 31, 769-788. Doi: 10.1016/j.csr.2011.01.011. Gosian L., 2014. Protect the world’s deltas. Nature, 516, 31-34. Graham S., Barnett J., Fincher R., Mortreux C., Hurlimann A., 2015. Towards fair outcomes in adaptation to sea-level rise. Climatic Change, 130, 411-424. Doi: 10.1007/s10584-014-1171-7. COASTRES-D-12-00175.1. Güneralp B., Güneralp I., Liu Y., 2015. Changing global patterns of urban expoàsure to flood and drought hazards. Global Environmental Change, 31, 217-225. Doi: 10.1016/j.gloenvcha.2015.01.002. Hallegatte S., Green C., Nicholls R.J., Corfee-Morlot J., 2013. Future flood losses in major coastal cities. Nature Climate Change, 3, 802-806. Doi: 10.1038/nclimate1979. Hamlington B.D., Strassburg M.W., Leben R.R., Han W., Nerem R.S., Kim K.-Y., 2014. Uncovering an anthropogenic sea-level rise signal in the Pacific Ocean. Nature Climate Change, 4, 782-785. Doi: 10.1038/nclimate2307. Hashimoto T.R., 2001. Environmental issues and recent infrastructure development in the Mekong Delta: Review, analysis and recommendations with particular reference to large-scale water control projects and the development of coastal areas. Working paper series (Working paper No. 4). Australian Mekong Resource Centre, University of Sydney, Australia, 1-70. Hibbert F.D., Rohling E.J., Dutton A., Williams F.H., Chutcharavan P.M., Zhao C., Tamisiea M.E., 2016. Coral indicators of past sea-level change: A global repository of U-series dated benchmarks. Quaternary Science Reviews, 145, 1-56. Doi: 10.1016/j.quascirev.2016.04.019. Hinkel J., Lincke D., Vafeidis A., Perrette M., Nicholls R.J., Tol R.S.J., Mazeion B., Fettweis X., Ionescu C., Levermann A., 2014. Coastal flood damage and adaptation costs under 21st century sea-level rise. Proceedings of the National Academy of Sciences, 111, 3292-3297. Doi: 10.1073/pnas.1222469111. Hinkel J., Nicholls R.J., Tol R.S.J., Wang Z.B., Hamilton J.M., Boot G., Vafeidis A.T., McFadden L., Ganapolski A., Klei R.J.Y., 2013. A global analysis of erosion of sandy beaches and sea level rise: An application of DIVA. Global and Planetary Change, 111, 150-158. Doi: 10.1016/j.gloplacha.2013.09.002. Huong H.T.L., Pathirana A., 2013. Urbanization and climate change impacts on future urban flooding in Can Tho city, Vietnam. Hydrol. Earth Syst. Sci., 17, 379-394. Doi: 10.5194/hess-17-379-2013. Hurlimann A., Barnett J., Fincher R., Osbaldiston N., Montreux C., Graham S., 2014. Urban planning and sustainable adaptation to sea-level rise. Landscape and Urban Planning, 126, 84-93. Doi: 10.1016/j.landurbplan.2013.12.013. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, 2011. Climate change vulnerability and risk assessment study for Ca Mau and KienGiang provinces, Vietnam. Hanoi, Vietnam Institute of Meteorology, Hydrology and Environment (IMHEN), 250p. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, Ca Mau PPC, 2011. Climate change impact and adaptation study in The Mekong Delta - Part A: Ca Mau Atlas. Hanoi, Vietnam: Institute of Meteorology, Hydrology and Environment (IMHEN), 48p. IPCC-Intergovernmental Panel on Climate Change, 2014. Fifth assessment report. Cambridge University Press, Cambridge, UK. Jevrejeva S., Jackson L.P., Riva R.E.M., Grinsted A., Moore J.C., 2016. Coastal sea level rise with warming above 2°C. Proceedings of the National Academy of Sciences, 113, 13342-13347. Doi: 10.1073/pnas.1605312113. Junk W.J., AN S., Finlayson C.M., Gopal B., Kvet J., Mitchell S.A., Mitsch W.J., Robarts R.D., 2013. Current state of knowledge regarding the world’s wetlands and their future under global climate change: A synthesis. Aquatic Science, 75, 151-167. Doi: 10.1007/s00027-012-0278-z. Jordan A., Rayner T., Schroeder H., Adger N., Anderson K., Bows A., Le Quéré C., Joshi M., Mander S., Vaughan N., Whitmarsh L., 2013. Going beyond two degrees? The risks and opportunities of alternative options. Climate Policy, 13, 751-769. Doi: 10.1080/14693062.2013.835705. Kelly P.M., Adger W.N., 2000. Theory and practice in assessing vulnerability to climate change and facilitating adaptation. Climatic Change, 47, 325-352. Doi: 10.1023/A:1005627828199. Kirwan M.L., Megonigal J.P., 2013. Tidal wetland stability in the face of human impacts and sea-level rice. Nature, 504, 53-60. Doi: 10.1038/nature12856. Koerth J., Vafeidis A.T., Hinkel J., Sterr H., 2013. What motivates coastal households to adapt pro actively to sea-level rise and increased flood risk? Regional Environmental Change, 13, 879-909. Doi: 10.1007/s10113-12-399-x. Kontgis K., Schneider A., Fox J;,Saksena S., Spencer J.H., Castrence M., 2014. Monitoring peri urbanization in the greater Ho Chi Minh City metropolitan area. Applied Geography, 53, 377-388. Doi: 10.1016/j.apgeogr.2014.06.029. Kopp R.E., Horton R.M., Little C.M., Mitrovica J.X., Oppenheimer M., Rasmussen D.J., Strauss B.H., Tebaldi C., 2014. Probabilistic 21st and 22nd century sea-level projections at a global network of tide-gauge sites. Earth’s Future, 2, 383-406. Doi: 10.1002/2014EF000239. Kuenzer C., Bluemel A., Gebhardt S., Quoc T., Dech S., 2011. Remote sensing of mangrove ecosystems: A review.Remote Sensing, 3, 878-928. Doi: 10.3390/rs3050878. Lacerda G.B.M., Silva C., Pimenteira C.A.P., Kopp Jr. R.V., Grumback R., Rosa L.P., de Freitas M.A.V., 2013. Guidelines for the strategic management of flood risks in industrial plant oil in the Brazilian coast: Adaptive measures to the impacts of sea level rise. Mitigation and Adaptation Strategies for Global Change, 19, 104-1062. Doi: 10.1007/s11027-013-09459-x. Lam Dao Nguyen, Pham Van Bach, Nguyen Thanh Minh, Pham Thi Mai Thy, Hoang Phi Hung, 2011. Change detection of land use and river bank in Mekong Delta, Vietnam using time series remotely sensed data. Journal of Resources and Ecology, 2, 370-374. Doi: 10.3969/j.issn.1674-764x.2011.04.011. Lang N.T., Ky B.X., Kobayashi H., Buu B.C., 2004. Development of salt tolerant varieties in the Mekong delta. JIRCAS Project, Can Tho University, Can Tho, Vietnam, 152. Le Cozannet G., Rohmer J., Cazenave A., Idier D., Van de Wal R., de Winter R., Pedreros R., Balouin Y., Vinchon C., Oliveros C., 2015. Evaluating uncertainties of future marine flooding occurrence as sea-level rises. Environmental Modelling and Software, 73, 44-56. Doi: 10.1016/j.envsoft.2015.07.021. Le Cozannet G., Manceau J.-C., Rohmer J., 2017. Bounding probabilistic sea-level projections with the framework of the possible theory. Environmental Letters Research, 12, 12-14. Doi.org/10.1088/1748-9326/aa5528.Chikamoto Y., 2014. Recent Walker circulation strengthening and Pacific cooling amplified by Atlantic warming. Nature Climate Change, 4, 888-892. Doi: 10.1038/nclimate2330. Lovelock C.E., Cahoon D.R., Friess D.A., Gutenspergen G.R., Krauss K.W., Reef R., Rogers K., Saunders M.L., Sidik F., Swales A., Saintilan N., Le Xuan Tuyen, Tran Triet, 2015. The vulnerability of Indo-Pacific mangrove forests to sea-level rise. Nature, 526, 559-563. Doi: 10.1038/nature15538. MA Millennium Ecosystem Assessment, 2005. Ecosystems and human well-being: Current state and trends. Island Press, Washington DC, 266p. Masterson J.P., Fienen M.N., Thieler E.R., Gesch D.B., Gutierrez B.T., Plant N.G., 2014. Effects of sea level rise on barrier island groundwater system dynamics - ecohydrological implications. Ecohydrology, 7, 1064-1071. Doi: 10.1002/eco.1442. McGanahan G., Balk D., Anderson B., 2007. The rising tide: Assessing the risks of climate changes and human settlements in low elevation coastal zones.Environment and urbanization, 19, 17-37. Doi: 10.1177/095624780707960. McIvor A., Möller I., Spencer T., Spalding M., 2012. Reduction of wind and swell waves by mangroves. The Nature Conservancy and Wetlands International, 1-27. Merryn T., Pidgeon N., Whitmarsh L., Ballenger R., 2016. Expert judgements of sea-level rise at the local scale. Journal of Risk Research, 19, 664-685. Doi.org/10.1080/13669877.2015.1043568. Monioudi I.N., Velegrakis A.F., Chatzipavlis A.E., Rigos A., Karambas T., Vousdoukas M.I., Hasiotis T., Koukourouvli N., Peduzzi P., Manoutsoglou E., Poulos S.E., Collins M.B., 2017. Assessment of island beach erosion due to sea level rise: The case of the Aegean archipelago (Eastern Mediterranean). Nat. Hazards Earth Syst. Sci., 17, 449-466. Doi: 10.5194/nhess-17-449-2017. MONRE - Ministry of Natural Resources and Environment, 2016. Scenarios of climate change and sea level rise for Vietnam. Publishing House of Environmental Resources and Maps Vietnam, Hanoi, 188p. Montz B.E., Tobin G.A., Hagelman III R.R., 2017. Natural hazards. Explanation and integration. The Guilford Press, NY, 445p. Morgan L.K., Werner A.D., 2014. Water intrusion vulnerability for freshwater lenses near islands. Journal of Hydrology, 508, 322-327. Doi: 10.1016/j.jhydrol.2013.11.002. Muis S., Güneralp B., Jongman B., Aerts J.C.H.J., Ward P.J., 2015. Science of the Total Environment, 538, 445-457. Doi: 10.1016/j.scitotenv.2015.08.068. Murray N.J., Clemens R.S., Phinn S.R., Possingham H.P., Fuller R.A., 2014. Tracking the rapid loss of tidal wetlands in the Yellow Sea. Frontiers in Ecology and Environment, 12, 267-272. Doi: 10.1890/130260. Neumann B., Vafeidis A.T., Zimmermann J., Nicholls R.J., 2015a. Future coastal population growth and exposure to sea-level rise and coastal flooding. A global assessment. Plos One, 10, 1-22. Doi: 10.1371/journal.pone.0118571. Nguyen A. Duoc, Savenije H. H., 2006. Salt intrusion in multi-channel estuaries: a case study in the Mekong Delta, Vietnam. Hydrology and Earth System Sciences Discussions, European Geosciences Union, 10, 743-754. Doi: 10.5194/hess-10-743-2006. Nguyen An Thinh, Nguyen Ngoc Thanh, Luong Thi Tuyen, Luc Hens, 2017. Tourism and beach erosion: Valuing the damage of beach erosion for tourism in the Hoi An, World Heritage site. Journal of Environment, Development and Sustainability. Nguyen An Thinh, Luc Hens (Eds.), 2018. Human ecology of climate change associated disasters in Vietnam: Risks for nature and humans in lowland and upland areas. Springer Verlag, Berlin.Nguyen An Thinh, Vu Anh Dung, Vu Van Phai, Nguyen Ngoc Thanh, Pham Minh Tam, Nguyen Thi Thuy Hang, Le Trinh Hai, Nguyen Viet Thanh, Hoang Khac Lich, Vu Duc Thanh, Nguyen Song Tung, Luong Thi Tuyen, Trinh Phuong Ngoc, Luc Hens, 2017. Human ecological effects of tropical storms in the coastal area of Ky Anh (Ha Tinh, Vietnam). Environ Dev Sustain, 19, 745-767. Doi: 10.1007/s/10668-016-9761-3. Nguyen Van Hoang, 2017. Potential for desalinization of brackish groundwater aquifer under a background of rising sea level via salt-intrusion prevention river gates in the coastal area of the Red River delta, Vietnam. Environment, Development and Sustainability. Nguyen Tho, Vromant N., Nguyen Thanh Hung, Hens L., 2008. Soil salinity and sodicity in a shrimp farming coastal area of the Mekong Delta, Vietnam. Environmental Geology, 54, 1739-1746. Doi: 10.1007/s00254-007-0951-z. Nguyen Thang T.X., Woodroffe C.D., 2016. Assessing relative vulnerability to sea-level rise in the western part of the Mekong River delta. Sustainability Science, 11, 645-659. Doi: 10.1007/s11625-015-0336-2. Nicholls N.N., Hoozemans F.M.J., Marchand M., Analyzing flood risk and wetland losses due to the global sea-level rise: Regional and global analyses.Global Environmental Change, 9, S69-S87. Doi: 10.1016/s0959-3780(99)00019-9. Phan Minh Thu, 2006. Application of remote sensing and GIS tools for recognizing changes of mangrove forests in Ca Mau province. In Proceedings of the International Symposium on Geoinformatics for Spatial Infrastructure Development in Earth and Allied Sciences, Ho Chi Minh City, Vietnam, 9-11 November, 1-17. Reise K., 2017. Facing the third dimension in coastal flatlands.Global sea level rise and the need for coastal transformations. Gaia, 26, 89-93. Renaud F.G., Le Thi Thu Huong, Lindener C., Vo Thi Guong, Sebesvari Z., 2015. Resilience and shifts in agro-ecosystems facing increasing sea-level rise and salinity intrusion in Ben Tre province, Mekong Delta. Climatic Change, 133, 69-84. Doi: 10.1007/s10584-014-1113-4. Serra P., Pons X., Sauri D., 2008. Land cover and land use in a Mediterranean landscape. Applied Geography, 28, 189-209. Shearman P., Bryan J., Walsh J.P., 2013.Trends in deltaic change over three decades in the Asia-Pacific Region. Journal of Coastal Research, 29, 1169-1183. Doi: 10.2112/JCOASTRES-D-12-00120.1. SIWRR-Southern Institute of Water Resources Research, 2016. Annual Report. Ministry of Agriculture and Rural Development, Ho Chi Minh City, 1-19. Slangen A.B.A., Katsman C.A., Van de Wal R.S.W., Vermeersen L.L.A., Riva R.E.M., 2012. Towards regional projections of twenty-first century sea-level change based on IPCC RES scenarios. Climate Dynamics, 38, 1191-1209. Doi: 10.1007/s00382-011-1057-6. Spencer T., Schuerch M., Nicholls R.J., Hinkel J., Lincke D., Vafeidis A.T., Reef R., McFadden L., Brown S., 2016. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Global and Planetary Change, 139, 15-30. Doi:10.1016/j.gloplacha.2015.12.018. Stammer D., Cazenave A., Ponte R.M., Tamisiea M.E., 2013. Causes of contemporary regional sea level changes. Annual Review of Marine Science, 5, 21-46. Doi: 10.1146/annurev-marine-121211-172406. Tett P., Mee L., 2015. Scenarios explored with Delphi. In: Coastal zones ecosystems services. Eds., Springer, Berlin, Germany, 127-144. Tran Hong Hanh, 2017. Land use dynamics, its drivers and consequences in the Ca Mau province, Mekong delta, Vietnam. PhD dissertation, 191p. VUBPRESS Brussels University Press, ISBN 9789057186226, Brussels, Belgium. Tran Thuc, Nguyen Van Thang, Huynh Thi Lan Huong, Mai Van Khiem, Nguyen Xuan Hien, Doan Ha Phong, 2016. Climate change and sea level rise scenarios for Vietnam. Ministry of Natural resources and Environment. Hanoi, Vietnam. Tran Hong Hanh, Tran Thuc, Kervyn M., 2015. Dynamics of land cover/land use changes in the Mekong Delta, 1973-2011: A remote sensing analysis of the Tran Van Thoi District, Ca Mau province, Vietnam. Remote Sensing, 7, 2899-2925. Doi: 10.1007/s00254-007-0951-z Van Lavieren H., Spalding M., Alongi D., Kainuma M., Clüsener-Godt M., Adeel Z., 2012. Securing the future of Mangroves. The United Nations University, Okinawa, Japan, 53, 1-56. Water Resources Directorate. Ministry of Agriculture and Rural Development, 2016. Available online: http://www.tongcucthuyloi.gov.vn/Tin-tuc-Su-kien/Tin-tuc-su-kien-tong-hop/catid/12/item/2670/xam-nhap-man-vung-dong-bang-song-cuu-long--2015---2016---han-han-o-mien-trung--tay-nguyen-va-giai-phap-khac-phuc. Last accessed on: 30/9/2016. Webster P.J., Holland G.J., Curry J.A., Chang H.-R., 2005. Changes in tropical cyclone number, duration, and intensity in a warming environment. Science, 309, 1844-1846. Doi: 10.1126/science.1116448. Were K.O., Dick O.B., Singh B.R., 2013. Remotely sensing the spatial and temporal land cover changes in Eastern Mau forest reserve and Lake Nakuru drainage Basin, Kenya. Applied Geography, 41, 75-86. Williams G.A., Helmuth B., Russel B.D., Dong W.-Y., Thiyagarajan V., Seuront L., 2016. Meeting the climate change challenge: Pressing issues in southern China an SE Asian coastal ecosystems. Regional Studies in Marine Science, 8, 373-381. Doi: 10.1016/j.rsma.2016.07.002. Woodroffe C.D., Rogers K., McKee K.L., Lovdelock C.E., Mendelssohn I.A., Saintilan N., 2016. Mangrove sedimentation and response to relative sea-level rise. Annual Review of Marine Science, 8, 243-266. Doi: 10.1146/annurev-marine-122414-034025.

Abstract A new distribution map is provided for Tomato brown rugose fruit virus. Virgaviridae: Tobamovirus. Hosts: tomato (Solanum lycopersicum), pepper (Capsicum annuum). Information is given on the geographical distribution in Europe (Germany, Italy, Sicily, UK, England and Wales), Asia (China, Shandong, Israel, Jordan, Turkey), North America (Mexico, USA, California).

The case briefly describes the history of Electronic Data Systems (EDS) under Ross Perot and GM before turning to the beginning of a tumultuous decade in the late 1990s. As the turn of the century approached, EDS made critical strategic missteps such as missing opportunities in the Internet space, overlooking the onset of client-server computing, and failing to obtain major Y2K-related projects. The company attempted a turnaround by replacing the CEO with Dick Brown, whose leadership helped streamline the sprawling company. Despite initial successes, Brown's tenure ultimately ended in failure, due largely to his failure to recognize the growing Indian market and his willingness to buy business at the expense of the company's margin. The disastrous multibillion-dollar Navy & Marine Corp Intranet contract typified the type of high-profile transactions that Brown pursued, often boosting EDS's stock price in the short term while eroding its cash flow short term and its profitability over the long term. EDS management went through several stages of the turnaround process: the blinded phase, the inactive phase, and the faulty action phase, until Michael Jordan replaced Brown as CEO and enacted a three-tiered operational, strategic, and financial turnaround.EDS's near-decade of turnaround efforts takes students through every phase of the turnaround process and demonstrates that even initially successful turnaround efforts can become distracted, rendering them ineffective. The case will show both a failed turnaround and a subsequent successful one, while adding an international component with respect to EDS's overlooking an important, growing Indian market.

This article comments on the article in this volume entitled ‘Is Society Still Shackled with the Chains of a 1993 England?: Consent, Sado-masochism and R v Brown’ by Jordan Moulds. It argues that the defence of consent should not be circumscribed to the extent that it was in Brown for three reasons: the first is based on maintaining the coherence of the law; the second arises from the importance of valuing the liberty of individuals in cases where a statute is vague; and the third is found in the value of autonomy. This comment argues in Part I that the criminal law and tort law should set the same threshold at which consent will no longer afford a defence. Part II draws on the theories of Raz, Fuller and Marmor argues that the liberty of individuals should not be so easily sacrificed where the statute allegedly governing the impugned behaviour is vague; and Part III concludes that the common law position on consent in New Zealand serves as an example of an acceptable balance between the autonomy of the victim and the role that the criminal law has to play in reducing threats to peace and order.

The temporal distribution of an isolate of the dagger nematode attacking Aleppopine, Pinus halepensis grown in AL-Jubiha area in Jordan was investigated. A totalof eighteen samples were collected from rhizosphere about 30 cm deep in soil and50 cm away from the trunk of a Pine tree showing decline and brown needles asone sample per month starting in November 2014 until April 2016. Cobb sievingand gravity methods were used for the nematode isolation from rhizosoil. The soiltype is clay with 51 % porosity. The monthly air temperature, precipitation, andrelative humidity were monitored and tabulated. The results showed that thenumber of recovered nematodes ranged from 2 individuals /100 cm3 to 88individuals /100cm3 of rhizosoil. The lowest number was recovered on Octoberwhereas the highest numbers were recovered in December. The reason of declinein numbers may be due to a raise in temperature. The highest number may be dueto favorable temperature and soil moisture. The difference of nematode in samemonth in two different years may be due to the temperature and precipitations.

Tomato brown rugose fruit virus (ToBRFV) is a Tobamovirus that was first detected in Israel and Jordan following an outbreak of a new disease infecting tomatoes in 2014. Since then, the virus has been reported from all continents except Oceania and Antarctica. In response to the first finding of the virus in the Netherlands, the Dutch National Plant Protection Organization created a ToBRFV Nextstrain build (v1). In this report we announce 47 new (near) complete ToBRFV genomes and the generation of the new ToBRFV Nextstrain (v2) build containing 118 ToBRFV genomes with associated geographic and epidemiological data, which is available from https://nextstrain.nrcnvwa.nl/ToBRFV/20201206. Examples of utilization of the genomic sequences are presented, we report the first sequence from South-America and present a novel hypothesis on the possible ToBRFV center of origin.

Abstract A description is provided for Mycosphaerella henningsii. Information is included on the disease caused by the organism, its transmission, geographical distribution, and hosts. HOSTS: Manihot esculenta (cassava, manioc), M. glaziovii (manicoba, ceara rubber), M. palmata and, under laboratory conditions, Ipomoea sp. (36: 82). DISEASE: Brown leaf spot, sometimes referred to as leaf blight of cassava. At first the lesions start as small circular greenish yellow spots. These enlarge and become angular as they are delimited by the major leaf veins; on the upper leaf surface the spots are tan to light tan, 1-8 mm diam. with a dark brown slightly raised border. Minor leaf veins crossing the leaf spot are seen as black necrotic lines. In severe infections the leaf spots are surrounded by a yellow halo caused by a toxin produced by the advancing mycelium (Teri et al., 1977). On the lower leaf surface the spots are less distinct. Eventually the lesions may coalesce, and cause premature defoliation. GEOGRAPHICAL DISTRIBUTION: Generally found wherever cassava is cultivated (Teri, 1977). Africa: most countries; Asia: Jordan, Philippines, Sri Lanka, Thailand; North America: Dominican Republic, USA (Florida); South America: Bolivia, Brazil, Colombia, Peru, Venezuela. TRANSMISSION: Probably by wind-borne and water-splash dispersed conidia. During the dry season the fungus survives on the crop debris.