Journal articles on the topic 'Imperial Valley Virus'
To see the other types of publications on this topic, follow the link: Imperial Valley Virus.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 23 journal articles for your research on the topic 'Imperial Valley Virus.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Liu, H. Y., J. L. Sears, and R. T. Lewellen. "Occurrence of Resistance-Breaking Beet necrotic yellow vein virus of Sugar Beet." Plant Disease 89, no. 5 (May 2005): 464–68. http://dx.doi.org/10.1094/pd-89-0464.
Full textAbstract:
Rhizomania is an important virus disease of sugar beet and is caused by Beet necrotic yellow vein virus (BNYVV). During 2002-03, several sugar beet fields with cultivars partially resistant to BNYVV grown in the Imperial Valley of California were observed with severe rhizomania symptoms, suggesting that resistance conditioned by Rz1 had been compromised. Soil testing with sugar beet baiting plants followed by enzyme-linked immunosorbent assay (ELISA) was used to diagnose virus infection. Resistant varieties grown in BNYVV-infested soil from Salinas, CA, were ELISA-negative. In contrast, when grown in BNYVV-infested soil collected from the Imperial Valley, CA, all resistant varieties became infected and tested positive by ELISA. Based on host reaction, eight distinct BNYVV isolates have been identified from Imperial Valley soil (IV-BNYVV) by single local lesion isolation. Reverse transcription-polymerase chain reaction (RT-PCR) assays showed that the eight IV-BNYVV isolates did not contain RNA-5. Singlestrand conformation polymorphism banding patterns for the IV-BNYVV isolates were identical to A-type and different from P-type. Sequence alignments of PCR products from BNYVV RNA-1 near the 3′ end of IV-BNYVV isolates revealed that both IV-BNYVV and Salinas BNYVV isolates were similar to A-type and different from B-type. Our results suggest that the resistancebreaking BNYVV isolates from Imperial Valley likely evolved from existing A-type isolates.
2
Hagen, C., M. R. Rojas, M. R. Sudarshana, B. Xoconostle-Cazares, E. T. Natwick, T. A. Turini, and R. L. Gilbertson. "Biology and Molecular Characterization of Cucurbit leaf crumple virus, an Emergent Cucurbit-Infecting Begomovirus in the Imperial Valley of California." Plant Disease 92, no. 5 (May 2008): 781–93. http://dx.doi.org/10.1094/pdis-92-5-0781.
Full textAbstract:
Cucurbit leaf crumple virus (CuLCrV) is an emergent and potentially economically important bipartite begomovirus first identified in volunteer watermelon plants in the Imperial Valley of southern California in 1998. Field surveys indicated that CuLCrV has become established in the Imperial Valley; and field plot studies revealed that CuLCrV primarily infects cucurbits, including cantaloupe, squash, and watermelon. Full-length DNA-A and DNA-B clones of an Imperial Valley isolate of CuLCrV were obtained by polymerase chain reaction (PCR) with overlapping primers. These clones were infectious in various cucurbits and common bean (cv. Topcrop); symptoms included stunted growth and leaf crumple, curl, and chlorosis. CuLCrV was not sap-transmissible, and immunolocalization and DNA in situ hybridization studies revealed that it is phloem-limited. A CuLCrV agroinoculation system was generated, and host range studies revealed differential susceptibility in cucurbits, with squash, watermelon, cantaloupe, and honeydew melon being most to least susceptible, respectively. Germplasm screening studies identified a number of resistant cantaloupe and honeydew melon cultivars. The genome organization of this CuLCrV isolate (CuLCrV-CA) is similar to other bipartite begomoviruses, and phylogenetic analysis placed CuLCrV in the Squash leaf curl virus (SLCV) cluster of New World bipartite begomoviruses. A CuLCrV-specific PCR test was developed which allows for differentiation from other begomoviruses, including SLCV.
3
McCreight, James D., G. Weston Bohn, and Thomas W. Whitaker. "PMR Honeydew Muskmelon." HortScience 22, no. 1 (February 1987): 177. http://dx.doi.org/10.21273/hortsci.22.1.177.
Full textAbstract:
Abstract Greenflesh Honeydew (GFHD) musk-melon (Cucumis melo L.) is an erratic performer in the varied environments of Arizona, California (Imperial Valley and San Joaquin Valley), and Texas. The vines are susceptible to powdery mildew caused by Sphaero-theca fuliginea (Schlecht. ex. Fr.) Poll, and the cucurbit mosaic viruses including papaya ringspot virus (watermelon mosaic virus, see ref. 3), watermelon mosaic virus 2, and zucchini yellow mosaic virus. Common quality defects of the fruit include traces of net, nonuniform shapes and sizes, low soluble solids, thin flesh, the cavity becoming watery prior to best edibility, and poor flavor. This report describes PMR Honeydew, a recently released powdery mildew resistant honeydew breeding line.
4
McCreight, James D., and William M. Wintermantel. "Genetic Resistance in Melon PI 313970 to Cucurbit yellow stunting disorder virus." HortScience 46, no. 12 (December 2011): 1582–87. http://dx.doi.org/10.21273/hortsci.46.12.1582.
Full textAbstract:
Melon (Cucumis melo L.) is a fresh vegetable and dessert fruit that may also be cooked or dried, processed for juice and flavoring, and the seeds of which are a source of high-quality cooking oil and high protein seed meal. Melon production throughout many parts of the world is now threatened by the crinivirus Cucurbit yellow stunting disorder virus (CYSDV) in tropical and subtropical areas favorable to its whitefly vector. CYSDV is transmitted by the sweetpotato whitefly, Bemisia tabaci Gennadius, biotypes A, B, and Q. CYSDV first appeared on melon in the 1980s in the United Arab Emirates and emerged on melon in the Yuma, AZ, and Imperial Valley, CA, regions and western Mexico during the Fall season of 2006 followed by Florida in 2007. PI 313970, C. melo var. acidulus Naudin, a salad-type melon from India, expressed high-level resistance to CYSDV in Yuma and Imperial Valley in Fall 2006, but it was not immune; the virus was detected in asymptomatic plants. Inheritance of resistance to CYSDV in PI 313970 was studied in three naturally infected, replicated field tests in Imperial Valley during the Fall seasons of 2007 and 2008 and the Spring season of 2009. Resistance in PI 313970 was recessive: all F1 PI 313970 (PI) × susceptible ‘Top Mark’ (TM) and BCTM individuals were susceptible, and the F2 and BCPI segregated 3:1 and 1:1 susceptible to resistance, respectively. Frequency distributions of CYSDV symptom severity ratings suggested a single recessive gene in PI 313970 for resistance to CYSDV. PI 313970 was, however, observed to be variable for resistance; a few plants in each test expressed distinct symptoms of CYSDV infection and its frequency distributions overlapped those of ‘Top Mark’. This variation may represent genetic variation selectable for uniform reaction to infection by CYSDV or phenotypic variation in the resistant reaction. The genetic relationship between the genes for resistance to CYSDV in PI 313970 (recessive) and TGR-1551 (dominant) is not known.
5
Wintermantel, W. M., and E. T. Natwick. "First Report of Alfalfa mosaic virus Infecting Basil (Ocimum basilicum) in California." Plant Disease 96, no. 2 (February 2012): 295. http://dx.doi.org/10.1094/pdis-06-11-0516.
Full textAbstract:
Basil (Ocimum basilicum L.) plants collected from three fields in Imperial County, CA in May, 2011 were found to be exhibiting yellowing, chlorotic sectors and spots on leaves, resulting in unmarketable plants. Dodder (Cuscuta spp.) was present in one of the fields, but was not visibly associated with symptomatic plants. Total nucleic acid was extracted from four symptomatic and three asymptomatic basil plants, as well as from the dodder plant with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Nucleic acid extracts were tested by reverse transcription (RT)-PCR for the presence of Alfalfa mosaic virus (AMV) using primers designed to amplify a 350-nt region of the AMV coat protein gene (3). RT-PCR produced bands of the expected size in extracts from all symptomatic plants and the dodder sample. No amplification was obtained from symptomless plants. A 350-nt band amplified from one plant was gel-extracted, sequenced (TACGen, Richmond, CA), and confirmed to be AMV by comparison to sequences available in GenBank (Accession No. K02703). Although serological tests on an initial basil sample were negative for AMV by ELISA using antiserum produced against AMV by R. Larsen, USDA-ARS, Prosser, WA (unpublished), AMV was confirmed by ELISA and RT-PCR in symptomatic Nicotiana benthamiana, N. clevelandii, and Malva parviflora plants following mechanical transmission from basil source plants. The fields with AMV infections were located at opposite ends of the production region from one another, indicating widespread dispersal of AMV in the region. All AMV positive plants were adjacent to alfalfa. Two additional basil plantings in shade houses open to the outside environment did not have AMV symptomatic plants and were also confirmed negative by RT-PCR, but these plantings were at the extreme north end of Imperial Valley agriculture and well away from any alfalfa fields. At the time the basil plantations were sampled for AMV, no aphids were found in any plantations, but during the several weeks prior to finding the AMV-positive plants, cowpea aphid, Aphis craccivora Koch; pea aphid, Acyrthosiphon pisum Harris; blue alfalfa aphid, Acyrthosiphon kondoi Shinji; and spotted alfalfa aphid, Therioaphis maculata Buckton were colonizing Imperial Valley alfalfa fields, producing winged adults. AMV is transmitted by at least 14 aphid species (1), and most aphid populations increase during the late spring in this important desert agricultural region. The acquisition of AMV by dodder suggests the parasitic plant may serve as a vector of AMV within basil fields, although further study will be necessary for clarification. Significant acreage of basil is grown in the Imperial Valley. This acreage is surrounded by extensive and increasing alfalfa production totaling 55,442 ha (137,000 acres) in Imperial County and representing a 21% increase in acreage over 2009 for the same region (2). To our knowledge, this is the first report of basil infected by AMV in California. The proximity of basil production to such a large alfalfa production region warrants the need for enhanced efforts at aphid management in basil production to reduce vector populations and reduce transmission to basil crops. References: (1) E. M. Jaspars and L. Bos. Alfalfa mosaic virus. No. 229 in: Descriptions of Plant Viruses. Commonw. Mycol. Inst./Assoc. Appl. Biol., Kew, England, 1980. (2) C. Valenzuela. Imperial County California Crop and Livestock Report, 2010. (3) H. Xu and J. Nie. Phytopathology 96:1237, 2006.
6
Poole, Grant J., Hanu R. Pappu, Richard M. Davis, and Thomas A. Turini. "Increasing Outbreaks and Impact of Iris yellow spot virus in Bulb and Seed Onion Crops in the Imperial and Antelope Valleys of California." Plant Health Progress 8, no. 1 (January 2007): 50. http://dx.doi.org/10.1094/php-2007-0508-01-br.
Full textAbstract:
Outbreaks of IYSV were first observed in May 2003 in two Imperial County onion seed fields. In August, 2005, symptomatic onion plants were widespread in four fields in the Antelope Valley, Los Angeles County, CA. IYSV infection was confirmed by ELISA and RT-PCR. This was the first known recording of IYSV in Antelope Valley. Increasing incidence and impact of IYSV in a major onion-growing area highlights the need for research into developing managing options for this important disease of onion. Accepted for publication 22 January 2007. Published 8 May 2007.
7
Guzman, P., M. R. Sudarshana, Y. S. Seo, M. R. Rojas, E. Natwick, T. Turini, K. Mayberry, and R. L. Gilbertson. "A New Bipartite Geminivirus (Begomovirus) Causing Leaf Curl and Crumpling in Cucurbits in the Imperial Valley of California." Plant Disease 84, no. 4 (April 2000): 488. http://dx.doi.org/10.1094/pdis.2000.84.4.488c.
Full textAbstract:
During fall 1998, volunteer watermelons (Citrullus lunatus L. (Thunb.) Matsum. & Nakai) showing leaf curl, crumpling, and yellowing symptoms were found in a commercial honeydew melon (Cucumis melo L. subsp. melo Inodorus group) field in the Imperial Valley of California. The plants were infected with a begomovirus (family Geminiviridae, genus Begomovirus) based on (i) a positive response in squash blots probed with a general begomovirus DNA probe (1) and (ii) amplification of DNA-A (≈1.2 kb) and DNA-B (≈1.4 kb) fragments by polymerase chain reaction (PCR) with degenerate DNA-A (PAL1v1978/PAR1c496) and DNA-B (PBL1v2040/PBR1c970) primers, respectively (3). The DNA-A and -B fragments were cloned and sequenced (GenBank accession nos. AF224760 [DNA-A] and AF224761 [DNA-B]). The DNA-A and -B fragments had a nearly identical (99.5%) common region (CR) of 186 (DNA-A) and 187 (DNA-B) nucleotides, indicating they were from the same begomovirus. Database searches conducted with these sequences revealed no high degree of sequence identity (i.e., >90%) with other begomoviruses, including Squash leaf curl virus (SqLCV [2]) from southern California. The partial AC1 sequence (669 nt) was most identical to Tomato severe leaf curl virus (ToSLCV) from Guatemala (83%) and SqLCV (81%), the partial AV1 sequence (135 nt) was most identical to Tomato golden mosaic virus from Brazil (84%) and SqLCV (81%), and the CR was most identical to Squash yellow mottle virus from Costa Rica (81%), ToSLCV (81%), and SqLCV (77%). The partial BV1 sequence (465 nt) was most identical to Bean calico mosaic virus and SqLCV (72%), and the partial BC1 sequence (158 nt) was most identical to SqLCV (75%). Watermelon seedlings bombarded with a DNA extract from infected watermelon volunteers developed crumpling and distortion symptoms, whereas seedlings bombarded with gold particles alone developed no symptoms. Geminivirus infection in symptomatic seedlings was confirmed by PCR. These results suggest a new begomovirus caused the disease symptoms in the watermelon volunteers. Leaf crumpling and curling symptoms were not observed in spring melons in the Imperial Valley in 1999, but on 2 July and 17 August 1999, cantaloupe (C. melo L. subsp. melo Cantalupensis group), muskmelon (C. melo L. subsp. melo Cantalupensis group), and watermelon plants with leaf crumpling and yellowing were found. These plants were infected with the new begomovirus based on sequence analysis of PCR-amplified DNA-A fragments (97 to 98% identity for CR and partial AC1 sequence). A survey of fall melons, conducted 23 to 24 September 1999, revealed widespread symptoms of leaf curl and crumpling on new growth of muskmelon plants in all seven commercial fields examined (estimated incidence 25 to 50%) and on watermelon volunteers. No such symptoms were observed on leaves of honeydew melons. Symptomatic muskmelon and watermelon leaves, collected from eight locations throughout the Imperial Valley, were infected with the new begomovirus based on sequence analysis of PCR-amplified DNA-A fragments. Thus, a new begomovirus has emerged in the Imperial Valley; the name Cucurbit leaf crumple virus (CuLCrV) is proposed. References: (1) R. L. Gilbertson et al. Plant Dis. 75: 336, 1991. (2) S. G. Lazarowitz and I. B. Lazdins. Virology 180:58, 1991. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.
8
Wintermantel, William M., Robert L. Gilbertson, James D. McCreight, and Eric T. Natwick. "Host-Specific Relationship Between Virus Titer and Whitefly Transmission of Cucurbit yellow stunting disorder virus." Plant Disease 100, no. 1 (January 2016): 92–98. http://dx.doi.org/10.1094/pdis-11-14-1119-re.
Full textAbstract:
Cucurbit yellow stunting disorder virus (CYSDV; genus Crinivirus, family Closteroviridae) was identified in the melon (Cucumis melo) production regions of the desert southwestern United States in fall 2006. It is now well established in the region, where it is transmitted efficiently by the sweet potato whitefly, Bemisia tabaci biotype B (MEAM1). In order to evaluate the spread and establishment of the virus, nearly all spring and fall cucurbit fields planted in the Imperial Valley of California from 2007 to 2009 were surveyed and representative plants were tested for CYSDV infection. Incidence of CYSDV in spring melon fields was initially low and limited to a small number of fields in 2007 but increased to 63% of fields by spring 2009. Virus incidence in fall melon fields was 100% in each year. These results suggested that the virus had become established in native vegetation, weeds, and other crop species, and represented an increasing threat to melon production in the southwestern United States. Therefore, a select set of weed and crop species which grow or are cultivated in the Imperial Valley were evaluated as CYSDV reservoir hosts. For each species, we determined the capacity of CYSDV to accumulate, the relationship between virus titer in these source plants and transmission by whiteflies, as well as subsequent accumulation in inoculated cucurbit plants. Among these hosts, there was considerable variation in virus accumulation and transmission rates. Cucurbit hosts had the highest CYSDV titers, were efficient sources for virus acquisition, and showed a positive correlation between titer in source plants and transmission. Noncucurbit hosts had significantly lower CYSDV titers and varied in their capacity to serve as sources for transmission. CYSDV titers in some noncucurbit source plants, specifically common bean (Phaseolus vulgaris) and shepherd’s purse (Capsella bursa-pastoris), were not positively correlated with transmission, demonstrating that additional environmental, physical, or biochemical factors were involved. These results demonstrate that multiple factors influence the efficiency with which a host plant species will be a reservoir for vector transmission of virus to crops.
9
Liu, H. Y., and R. T. Lewellen. "Distribution and Molecular Characterization of Resistance-Breaking Isolates of Beet necrotic yellow vein virus in the United States." Plant Disease 91, no. 7 (July 2007): 847–51. http://dx.doi.org/10.1094/pdis-91-7-0847.
Full textAbstract:
Beet necrotic yellow vein virus (BNYVV) is the causal agent of rhizomania in sugar beet (Beta vulgaris). The virus is transmitted by the plasmodiophorid Polymyxa betae. The disease is controlled primarily by the use of partially resistant cultivars. During 2003 and 2004 in the Imperial Valley of California, partially resistant sugar beet cultivars with Rz1 allele seemed to be compromised. Field trials at Salinas, CA have confirmed that Rz1 has been defeated by resistance-breaking isolates. Distinct BNYVV isolates have been identified from these plants. Rhizomania-infested sugar beet fields throughout the United States were surveyed in 2004–05. Soil surveys indicated that the resistance-breaking isolates not only existed in the Imperial Valley and San Joaquin Valley of California but also in Colorado, Idaho, Minnesota, Nebraska, and Oregon. Of the soil samples tested by baited plant technique, 92.5% produced infection with BNYVV in ‘Beta 6600’ (rz1rz1rz1), 77.5% in ‘Beta 4430R’ (Rz1rz1), 45.0% in ‘Beta G017R’ (Rz2rz2), and 15.0% in ‘KWS Angelina’ (Rz1rz1+Rz2rz2). Analyses of the deduced amino acid sequence of coat protein and P-25 protein of resistance-breaking BNYVV isolates revealed the high percentage of identity with non-resistance-breaking BNYVV isolates (99.9 and >98.0%, respectively). The variable amino acids in P-25 proteins were located at the residues of 67 and 68. In the United States, the two amino acids found in the non-resistance-breaking isolates were conserved (AC). The resistance-breaking isolates were variable including, AF, AL, SY, VC, VL, and AC. The change of these two amino acids cannot be depended upon to differentiate resistance-breaking and non-resistance-breaking isolates of BNYVV.
10
Chen, L. F., E. Natwick, S. Cabrera, and R. L. Gilbertson. "First Report of Curly Top Disease of Basil Caused by Beet severe curly top virus in California." Plant Disease 98, no. 2 (February 2014): 286. http://dx.doi.org/10.1094/pdis-07-13-0686-pdn.
Full textAbstract:
In August 2012, symptoms of stunted growth and leaf epinasty, crumpling, and yellowing, were observed in basil plants (Ocimum basilicum) grown in a shadehouse in Calipatria in the Imperial Valley of California. Populations of the beet leafhopper (Circulifer tenellus) carrying curtoviruses (genus Curtovirus, family Geminiviridae) were detected in the Imperial Valley in May 2012. Together, this suggested a curtovirus etiology for this virus-like disease of basil. Total DNA extracts were prepared from leaves of nine representative symptomatic plants (BA1 through 9) and used in the PCR with the general curtovirus primer pair, BGv377 and BGc1509 (1,2). This primer pair directed the amplification of the expected ~1.1 kb DNA fragments from extracts prepared from all nine plants, and not from equivalent extracts from symptomless plants. The sequences of 1.1 kb fragments amplified from four plants (BA1 through 4) were determined, and BLAST analyses revealed 99% nucleotide sequence identities among these sequences, and 98% identities with the homologous region (V2/CP) of Beet severe curly top virus-Cfh (BSCTV-Cfh; GenBank Accession No. U02311). A second primer pair (BGv981 5′-AACGGTCAGGCTATGCCGTCTAC-3′ and BGc479 5′-GAAAGACCTCGCCTTCTTCTAGGG-3′) was designed to amplify the remainder of the viral genome. The expected size ~2.4 kb fragments were amplified from the extracts of the BA1 through 9 plants, and the fragments from the BA1 and 2 plants were cloned into the pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. Using the sequences of the overlapping PCR-amplified fragments, the complete viral genome sequences of the BA1 and BA2 isolates were determined. The BA1 and BA2 sequences were 2,934 bp and were 99% identical to each other and to the sequence of BSCTV-Cfh (3). To confirm the infectivity of BSCTV in basil, the BSCTV-Cfh infectious clone, which originated from California, was used for agroinoculation and leafhopper transmission experiments in basil plants (cvs. Sweet aroma and Genovese). Basil plants agroinoculated with the BSCTV-Cfh clone developed stunted growth and leaf crumpling and curling symptoms, similar to symptoms observed in the symptomatic plants from the Imperial Valley. The presence of viral DNA in symptomatic plants was confirmed by PCR with the BGv377/BGc1509 primer pair. Basil plants inoculated with an empty vector control did not develop symptoms, nor was curtovirus DNA amplified from these plants by PCR. Beet leafhoppers were given a 48-h acquisition access period on BSCTV-Cfh-infected sugarbeet plants, followed by a 48-h inoculation access period on healthy basil plants. These plants developed curly top symptoms approximately 21 days after inoculation, indicating that BSCTV was transmitted to basil by the beet leafhopper. Together, these results establish that the cause of the disease symptoms in basil in the Imperial Valley of California was BSCTV. This is the first report of curly top disease in basil, which is the second member of the mint family (Lamiaceae) known to be infected by a curtovirus. The stunted growth induced in basil by BSCTV has the potential to cause yield and economic loss, particularly in open field or screenhouse production when beet leafhopper populations are high. References: (1) L-F. Chen et al. Plant Dis. 94:99, 2010. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983. (3) D. C. Stenger. Mol. Plant-Micro. Interact. 7:154, 1994.
11
Seo, Y. S., Y. C. Zhou, T. A. Turini, C. G. Cook, R. L. Gilbertson, and E. T. Natwick. "Evaluation of Cotton Germ Plasm for Resistance to the Whitefly and Cotton Leaf Crumple (CLCr) Disease and Etiology of CLCr in California's Imperial Valley." Plant Disease 90, no. 7 (July 2006): 877–84. http://dx.doi.org/10.1094/pd-90-0877.
Full textAbstract:
Cotton (Gossypium hirsutum) entries were evaluated for resistance to the whitefly (Bemisia tabaci biotype B) and cotton leaf crumple (CLCr) disease during the 1999 to 2001 growing seasons in the Imperial Valley of California. Entries were evaluated for densities of whitefly adults and nymphs, and for CLCr, by visual rating and squash/dot blot hybridization analyses. Differences in whitefly densities were detected among entries, but none were highly resistant, nor was there any correlation with CLCr disease severity. Entries AP 4103 and AP 6101 had relatively low whitefly densities and were highly susceptible (high CLCr disease severity ratings and viral titers), whereas NK 2387C and DPX 1883 also had low whitefly densities but were highly resistant (no symptoms or detectable viral titers). Other entries showed moderate CLCr resistance, which was independent of whitefly density. Geminivirus DNA-A and DNA-B components were consistently detected in cotton leaves with CLCr symptoms by polymerase chain reaction (PCR) with degenerate begomovirus primers, and full-length DNA-A and DNA-B clones were obtained. Cotton seedlings inoculated with these cloned DNAs by particle bombardment developed CLCr symptoms, and progeny virus was whitefly-transmissible. Sequence analysis revealed that these clones comprised the genome of a California isolate of the bipartite begomovirus Cotton leaf crumple virus (CLCrV-CA). Thus, CLCr disease in the Imperial Valley is caused by CLCrV-CA, and cotton entries with high levels of resistance were identified.
12
McLain, Jennifer, Steven Castle, Gerald Holmes, and Rebecca Creamer. "Physiochemical Characterization and Field Assessment of Lettuce Chlorosis Virus." Plant Disease 82, no. 11 (November 1998): 1248–52. http://dx.doi.org/10.1094/pdis.1998.82.11.1248.
Full textAbstract:
Lettuce chlorosis virus (LCV) was purified and partially characterized, and polyclonal antisera were produced and used to assess disease in the field. The antisera reliably detected LCV by indirect enzyme-linked immunosorbent assay (ELISA) in Nicotiana benthamiana. In Western blots, the LCV antisera distinguished between LCV and lettuce infectious yellows virus (LIYV)-infected plants. LCV particle lengths in partially purified preparations, as observed by transmission electron microscopy, were variable, with the majority between 750 and 950 nm long. A single, high molecular weight dsRNA and several lower molecular weight dsRNAs were isolated from LCV-infected N. benthamiana. A single RNA isolated from purified virion preparations was estimated to be 8,625 nucleotides long and was suspected to be the genomic RNA of LCV. LCV was present in experimental field plots in Holtville, California, during the lettuce growing seasons of 1995 to 1997. The percentage of symptomatic plants and yield of lettuce heads treated with insecticide, as well as dsRNA and ELISA reactions for the plots, are reported. A dsRNA consistent in size with LCV was isolated from four weed species in the Imperial Valley of California.
13
Acosta-Leal, R., and C. M. Rush. "Mutations Associated with Resistance-Breaking Isolates of Beet necrotic yellow vein virus and Their Allelic Discrimination Using TaqMan Technology." Phytopathology® 97, no. 3 (March 2007): 325–30. http://dx.doi.org/10.1094/phyto-97-3-0325.
Full textAbstract:
Genetic resistance in sugar beet (Beta vulgaris) to Beet necrotic yellow vein virus (BNYVV), which causes the disease rhizomania, is conferred by the single dominant gene Rz1. However, since 2002, Rz1 cultivars grown in the Imperial Valley of California have been increasingly damaged by a new strain of BNYVV. Viral RNA 3 was extracted from asymptomatic and symptomatic sugar beets and, after amplification and sequencing of a region including the p25 cistron, two polymorphic sites, A67V and D135E, associated with the capability of the virus to overcome resistance were identified. Using the real-time reverse transcription-polymerase chain reaction allelic discrimination technique, TaqMan probes designed to detect the responsible nucleotide substitutions permitted the differentiation between wild type (WT) and resistance-breaking (RB) isolates. This method also allowed easy detection of mixed infections by giving a heterozygous call, which was verified by DNA sequencing of individual clones. The capability of this technology to typify numerous isolates facilitated the analysis of the spatial distribution of virus haplotypes in the field. Thus, RB variants were mostly baited from yellow strips with high incidence of rhizomania, whereas WT variants predominated in the surrounding green areas. Mixed infections were found mainly in green areas and transitional zones. The predominance of the RB isolates in yellow strips suggests that they have gained fitness in Rz1 cultivars and will eventually become the dominant haplotype.
14
Bag, S., J. Singh, R. M. Davis, W. Chounet, and H. R. Pappu. "Iris yellow spot virus in Onion in Nevada and Northern California." Plant Disease 93, no. 6 (June 2009): 674. http://dx.doi.org/10.1094/pdis-93-6-0674c.
Full textAbstract:
The disease caused by thrips-transmitted Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) has become a major constraint to bulb and seed onion crops in several parts of the country and the world (1,3). As part of an ongoing survey for IYSV incidence in onion in the western United States, commercial fields in Lyon County, Nevada and several commercial fields in the northern Californian counties of Colusa, San Benito, Sutter, and Yolo were surveyed during the summer of 2008. Symptomatic plants were found widespread in northern California, especially in seed-production fields. In Lyon County, NV, symptoms were observed only on volunteer onions in one commercial field. Symptoms on leaves and scapes included characteristic diamond-shaped lesions with or without green islands. Four samples from Nevada and fourteen from northern California were tested by double-antibody sandwich (DAS)-ELISA using a commercially available kit (Agdia Inc., Elkhart, IN). All tested samples were found positive in ELISA. IYSV infection was verified by reverse transcription (RT)-PCR. Total nucleic acids were prepared from symptomatic tissue, and primers specific to the small (S) RNA of IYSV were used to amplify an approximate 1.2-kb region of the S-RNA. This region included the complete nucleoprotein (N) gene (2). The amplicons from one sample each from Nevada and northern California were sequenced (GenBank Accession Nos. FJ713699 and FJ713700, respectively). Sequence analysis showed that the amplicons contained a single open reading frame of 822 bp, coding for a 273-amino acid N protein, and the gene shared 96 to 98% identity with known IYSV N gene sequences. To our knowledge, this is the first report of IYSV in onion in Nevada. In California, outbreaks of IYSV had been reported earlier in Imperial Valley and Antelope Valley in southern California (4), and the disease has been increasing in incidence in bulb and seed crops in northern California, as well. California and Nevada are major onion-producing states in the United States and regular surveys to determine the incidence and impact on yield are needed to develop an integrated disease management program. References: (1) D. H. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu and M. E. Matheron. Online publication. doi:10.1094/PHP-2008-0711-01-BR. Plant Health Progress, 2008. (4) G. J. Poole et al. Online publication. doi:10.1094/PHP-2007-0508-01-BR. Plant Health Progress, 2007.
15
Tamang, Prabin, Kaori Ando, William M. Wintermantel, and James D. McCreight. "QTL Mapping of Cucurbit yellow stunting disorder virus Resistance in Melon Accession PI 313970." HortScience 56, no. 4 (April 2021): 424–30. http://dx.doi.org/10.21273/hortsci15495-20.
Full textAbstract:
Cucurbit yellow stunting disorder virus (CYSDV) is a devastating viral disease of melon that can cause significant yield and quality losses. This disease has recently emerged as a major concern in the southwest United States and major melon-growing regions across the world. Coinfection of melon by Cucurbit chlorotic yellows virus (CCYV) was recognized in Imperial Valley and neighboring production areas of California and Arizona in 2018, but its importance remains largely unknown. Identifying and deploying CYSDV resistance from elite germplasm is an economical and effective way to manage the disease. A F2:3 population was developed from a cross of susceptible ‘Top Mark’ with CYSDV-resistant PI 313970, which was shown to possess a single recessive gene for resistance to CYSDV. The F2:3 population was phenotyped in the field in response to natural, mixed infections by the two viruses, CYSDV and CCYV in the Fall melon seasons of 2018 and 2019. Phenotypic data (foliar yellowing) from both years were not useful for mapping CYSDV resistance quantitative trait loci (QTL), as PI 313970 and CYSDV-resistant F2:3 plants exhibited yellowing symptoms from CCYV coinfection. QTL analysis of the relative titer of CYSDV calculated from reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) data identified one locus on chromosome 3 at the physical location of S5-28,571,859 bp that explained 20% of virus titer variation in 2018 but was undetected in 2019. A locus on chromosome 5 between S5-20,880,639 to S5-22,217,535 bp explained 16% and 35% of the variation in CYSDV titer in 2018 and 2019, respectively. One or both of the markers were present in six of 10 putative melon CYSDV resistance sources. Markers flanking the 2019 QTL were developed and can be used in marker-assisted breeding of CYSDV-resistant melons.
16
Gent, D. H., R. R. Martin, and C. M. Ocamb. "First Report of Iris yellow spot virus on Onion and Leek in Western Oregon." Plant Disease 91, no. 4 (April 2007): 468. http://dx.doi.org/10.1094/pdis-91-4-0468a.
Full textAbstract:
Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.
17
Kuo, Y. W., M. R. Rojas, R. L. Gilbertson, and W. M. Wintermantel. "First Report of Cucurbit yellow stunting disorder virus in California and Arizona, in Association with Cucurbit leaf crumple virus and Squash leaf curl virus." Plant Disease 91, no. 3 (March 2007): 330. http://dx.doi.org/10.1094/pdis-91-3-0330b.
Full textAbstract:
In August and September of 2006, melon plants (Cucumis melo L.) near Niland in California's Imperial Valley and near Yuma, AZ began exhibiting interveinal chlorosis and leaf mottling and spotting, symptoms resembling those resulting from infection by viruses of the genus Crinivirus, family Closteroviridae (4). Some plants also exhibited leaf crumpling and curling, symptoms characteristic of begomovirus (genus Begomovirus, family Geminiviridae) infection. Leaves of plants had large populations of silverleaf whitefly (Bemisia tabaci biotype B), a known vector of begomoviruses and some criniviruses. Leaf samples were collected from four plants from California and 13 plants from three separate fields in Arizona. Total RNA was extracted using RNeasy kits (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR using degenerate primers specific to the conserved polymerase region of a diverse group of criniviruses (3). The expected 500-bp RT-PCR product was amplified from RNA obtained from all the symptomatic melons, whereas no fragment was obtained from RNA extracted from leaves of healthy controls. The 500-bp fragment from four plants from California and five plants from Arizona was sequenced and found to be identical for all nine isolates (GenBank Accession No. EF121768). The sequenced region of the California and Arizona Cucurbit yellow stunting disorder virus (CYSDV) isolates was identical to that from a CYSDV isolate from Texas (GenBank Accession No. AY242077) and shared 99% identity with a CYSDV isolate from Spain (GenBank Accession No. AJ537493). Subsequent RT-PCR analysis of RNA from these nine plants, with primers specific to the capsid protein (CYScp1F 5′ GCACGGTGACCAAAAGAAG 3′ and CYScp1R 5′ GAA-CATTCCAAAACTGCGG 3′) and HSP70h (CYShspF 5′ TGATGTATG-ACTTCGGAGGAGGAAC 3′ and CYShspR 5′ TCAGCGGACAAA-CCACCTTTC 3′) genes of CYSDV, was used to further confirm virus identity. The expected fragments, 202 and 175 bp, respectively, were amplified from all nine samples, but not from healthy controls. DNA extracts also were prepared from these nine melon samples from California and Arizona, and PCR assays were conducted for the begomoviruses Cucurbit leaf crumple virus (CuLCrV) and Squash leaf curl virus (SLCV) (2). The four plants from California showed crumpling, curling, and yellowing symptoms; all were infected with SLCV and one with CuLCrV. The five plants from Arizona showed mostly yellowing symptoms; five were infected with SLCV and two with CuLCrV. These results demonstrate begomovirus and crinivirus co-infection. The economic impact of mixed infections with CYSDV and begomoviruses remains to be determined. Incidence of CYSDV in melon was directly correlated with incidence of its vector, B. tabaci. Host range information has demonstrated that the primary hosts of CYSDV are members of the Cucurbitaceae (1). A number of experimental hosts have been documented; however, the extensive vegetable production in the southwestern United States warrants further study on the potential for the establishment of local reservoirs in both crop and weed species in the area. The virus causes economic losses worldwide for curcurbit production. References: (1) A. Celix et al. Phytopathology 86:1370, 1996. (2) R. Gilbertson. Ann. Rep. CA Melon Res. Board, 2001. (3) R. Martin et al. Acta Hortic. 656:137, 2004. (4) G. Wisler et al. Plant Dis. 82:270. 1998.
18
Beszédes, József. "Die Frührömische Einheimische Siedlung Von Budapest-Lágymányos (Budapest, XI Bezirk) •." Acta Archaeologica Academiae Scientiarum Hungaricae 71, no. 2 (November 30, 2020): 575–604. http://dx.doi.org/10.1556/072.2020.00014.
Full textAbstract:
In the past two decades, the number of archaeological explorations significantly increased in the densely built-up 11th district of Budapest, the area called Lágymányos. The recent excavations not once of large extent reveal a much more detailed picture of the Roman city structure and topography of the area that belongs to the vicinity of Aquincum, south of the Gellérthegy.Considering the information obtained from previous smaller scale excavations (i.e. Kende Str. 8–10, Gellért Square) and the more recent excavations of a larger extent (Skála Department Store, Bercsényi Rd.) we may come to the conclusion that the area south of Gellérthegy called Lagymányos today was occupied by an indigenous Celtic vicus of the early imperial period. The composition of the findings of the different sites was almost identical. There was a strong indigenous (Celtic) component along with products of “provincial” ceramic production of the 1st and the 2nd century AD. The amount of imported ware found was insignificant in all sites. Excavated building structures (pit-houses, storage pits, ceramic kilns, industrial workshops) show the characteristics of a village-like settlement. According to Samian ware finds the settlement evolved in the Claudian era, flourished under the Flavians, slowly depopulated in the 2nd century, and was abandoned by its last inhabitants in the Severan era at the latest. Part of its population likely moved to this area from the native settlement of Tabán ceased under Tiberius.The slow dissolution of the settlement refers to its inhabitants leaving the area because of economical reasons. The municipium of Aquincum starting to flourish in the mid 2nd century offering a better living for the inhabitants. The antique name of the vicus is not known. In terms of topography, the vicus of Lágymányos evolved in a favourable position. The southern slopes of Gellérthegy were a safe place to settle at, besides there were excellent quality clay sources along the Danube. A wide valley leads in the direction of today’s Budaörs through which trade and transportation could easily be carried out.In the last one and a half decades several significant indigenous vici were excavated in the area of Budapest (BudaörsKamaraerdei-dűlő, Biatorbágy-Kukorica-dűlő, Páty-Malom-dűlő). The distance of these vici from one another is approximately equally about 6 kms. A group of sites (Kelenhegyi Rd. 27, Mányoki Str. 16, and the southern slopes of Gellérthegy) are linked to cemeteries instead of settlements. The majority of names on the epitaphs and the clothing and jewelry depicted on the steles dating back to the period between the last third of the 1st and the beginning of the 2nd century refer to the native Celtic population (one exception being Valerius Crescens who probably passed away as a veteranus). The vessels unearthed at Mányoki u. 16. referring to a cremation burial can also easily be fitted into the series of cemeteries of the early imperial age. Accordingly, a cemetery that belonged to the above vicus lied on the southern, south-western slopes of the Gellérthegy.In conclusion, it is ascertainable, that after cross-checking data from the sporadic, mosaic-like excavation sites of Lágymányos, we localized an unknown (or interpreted otherwise previously) early Roman (1st–2nd century AD) indigenous vicus south of the Gellérthegy. The approximate extent of the vicus’ cemetery and several burials and steles are also known implying this being a complex settlement, not a potter’s workshop or a temporary settlement as it was previously believed.
19
Hasegawa, Daniel K., Laura Jenkins Hladky, William M. Wintermantel, Alexander I. Putman, Apurba K. Barman, Stephanie Slinski, John Palumbo, and Bindu Poudel. "First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California." Plant Disease, January 27, 2022. http://dx.doi.org/10.1094/pdis-09-21-2118-pdn.
Full textAbstract:
Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.
20
Mondal, Shaonpius, Laura L. Jenkins Hladky, Patricia L. Fashing, James Donald McCreight, Thomas A. Turini, and William M. Wintermantel. "First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California." Plant Disease, May 19, 2021. http://dx.doi.org/10.1094/pdis-01-21-0184-pdn.
Full textAbstract:
In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F – 5’ AAGAGCGGCAGCTACAATAC 3’, CABYV RdRp-R – 5’ TGCCACATTCCGGTTCATAG 3’), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.
21
Kavalappara, Saritha Raman, Hayley Milner, Alton N. Sparks, Cecilia McGregor, William M. Wintermantel, and Sudeep Bag. "First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia." Plant Disease, January 8, 2021. http://dx.doi.org/10.1094/pdis-11-20-2429-pdn.
Full textAbstract:
Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.
22
Jailani, A. Abdul Kader, Fanny Iriarte, Robert Hochmuth, Sylvia M. Willis, Mark W. Warren, Kishore K. Dey, Maria Velez-Climent, John McVay, Sudeep Bag, and Mathews L. Paret. "First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA." Plant Disease, August 22, 2021. http://dx.doi.org/10.1094/pdis-03-21-0639-pdn.
Full textAbstract:
Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.
23
Ramachandran, Vanitharani, Nathan Wyatt, Eric Rivera Santiago, Hunter Barth, Mark Bloomquist, John Weiland, and Melvin Bolton. "First report of Tomato bushy stunt virus naturally infecting sugar beet in the United States." Plant Disease, November 6, 2022. http://dx.doi.org/10.1094/pdis-11-22-2530-pdn.
Full textAbstract:
Sugar beet (Beta vulgaris L.) is an important crop grown for its sucrose content used in sugar production around the world. Tomato bushy stunt virus (TBSV) is an RNA virus that belongs to the Tombusvirus genus of the family Tombusviridae (Hearne et al., 1990). The virus was first isolated from tomato, and it is known to infect a wide range of plants (Smith, 1935; Martelli et al., 1988; Hafez et al., 2010). In 1980, a natural infection of TBSV was reported in sugar beet leaves with chlorotic and necrotic ring spots and line pattern symptoms based on serological affinity to TBSV anti-sera in Czechoslovakia (Novak and Lanzova, 1980). In March 2021, sugarbeet plants showing stunted and bushy growth with yellowing and necrotic leaves were observed in a production field in the Imperial Valley of California. Harvested roots exhibited stunted and abnormal growth compared to roots from healthy plants (sFig. 1A). These symptoms prompted a screen for potential infection by TBSV. Root-tissue harvested from the symptomatic sugar beet was initially screened using a TBSV double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA; Agdia, Inc., Elkhart, IN), which reacted positive for TBSV. To obtain the full-length sequence of TBSV and potentially other viruses in the sample, total RNA isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA) from the root-tissue was subjected to high-throughput sequencing (HTS). Libraries were prepared using the TruSeq Stranded Total RNA Library Prep kit (Illumina, San Diego, CA) and sequenced using Illumina NovoSeq 6000 paired-end platform (Novogene, Sacramento, CA). A total of 52 million reads were obtained after removing the adapters and reads mapping to the host genome. These high-quality reads were de novo assembled into 75,891 contigs that are larger than 500 base pairs using the SPAdes assembler (Bankevitch et al., 2012; Prjibelski et al., 2020). The resulting contigs were searched for matching sequences to known viruses using the NCBI non-redundant database. A single contig of 4770 nts representing the full-length genome of TBSV was generated (Accession number OP477335), which showed 100% coverage to previously reported TBSV isolates ‘statice’ (AJ249740.1) and ‘nipplefruit’ (AY579432.1) with 92.19% and 91.25% nucleotide sequence identities, respectively, and thus confirming the presence of TBSV in sugar beet root-tissue. However, it showed 74% coverage with only 87% nucleotide identity to a previously reported Lettuce necrotic stunt virus (LNSV) from sugar beet, a tombusvirus that was re-classified as Moroccan pepper virus (MPV) due to high degree (>97%) of sequence identity (Obermeier et al., 2001; Wintermantel and Anchieta, 2012; Wintermantel and Hladky, 2013). The coat protein is conserved within species in tombusvirus, and it plays a significant role by providing serological relationships to tombusvirus taxonomy. The coat protein of TBSV-isolate of this study shared 98.45% and 96.91% identities at amino acid level with TBSV ‘nipplefruit’ (AY579432.1) and TBSV ‘statice’ (AJ249740.1) isolates, respectively. In contrast, it showed only 61.56% identity with the coat protein of MPV as shown in the phylogenetic tree indicating that the TBSV-isolate reported here is different from MPV (sFig. 2). To confirm the presence of TBSV, reverse-transcription (RT)-PCR was performed using the total RNA isolated from the root-tissue with primers (VR306: 5’-CGCTCACGAGCCCAGCATCCTTGA-3’ and VR297: 5’-ACACCGCCACAGGAGCCATGATTG-3’) designed based on the HTS data to amplify a portion of the TBSV genome. Sequencing of the RT-PCR product confirmed the presence of TBSV sequence with 99.1% identity to the TBSV-isolate identified in this study. Further, mechanical inoculation of total RNA isolated from the symptomatic sugar beet roots produced local lesions and systemic necrosis symptoms on the leaves of Chenopodium quinoa (sFig. 1B). Sequencing of the amplicon obtained using RT-PCR with primers VR306 and VR297 confirmed the presence of TBSV in C. quinoa. In addition to TBSV, several viral contigs representing Beet necrotic yellow vein virus were identified in the root-tissue indicating mixed infection in the field. To our knowledge, this is the first report that documents the occurrence of TBSV in sugar beet in the United States. Since TBSV is a soil-borne virus, our findings indicate the need for further studies focused on the frequency and coexistence of the TBSV with BNYVV in sugar beet production fields to understand the disease complexity resulting from potential mixed infections.