Journal articles on the topic 'Imido functionality'
To see the other types of publications on this topic, follow the link: Imido functionality.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Imido functionality.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Cheng, Cheng-Hung, Pao-Tao Yu, Kuo-Chen Ma, Yu-Chun Wang, Shin-Mou Wu, and Chao-Ming Chiang. "Capture of Bridging Imido and Azavinylidene Intermediates Engaged in Nitrogen Functionality Changes from Primary Azide to Nitrile on a Copper Surface." Journal of Physical Chemistry C 117, no. 40 (September 26, 2013): 20784–90. http://dx.doi.org/10.1021/jp407434z.
Full text
2
Romero-Jimenez, Rosa, Vicente Escudero-Vilaplana, Esther Chamorro-De-Vega, Arantza Ais-Larisgoitia, Maria Elena Lobato Matilla, Ana Herranz-Alonso, and Maria Sanjurjo. "The Characteristics and Functionalities of Mobile Apps Aimed at Patients Diagnosed With Immune-Mediated Inflammatory Diseases: Systematic App Search." Journal of Medical Internet Research 24, no. 3 (March 4, 2022): e31016. http://dx.doi.org/10.2196/31016.
Full textAbstract:
Background Immune-mediated inflammatory diseases (IMIDs) are systemic conditions associated with a high social and health impact. New treatments have changed the prognosis of IMIDs and have increased patient autonomy in disease management. Mobile apps have enormous potential to improve health outcomes in patients with IMIDs. Although a large number of IMID apps are available, the app market is not regulated, and functionality and reliability remain uncertain. Objective Our aims are to review available apps for patients with IMIDs or caregivers and to describe the main characteristics and functionalities of these apps. Methods We performed an observational, cross-sectional, descriptive study of all apps for patients with IMIDs. Between April 5 and 14, 2021, we conducted a search of the App Store (iOS) and Play Store (Android) platforms. We used the names of the different IMIDs as search terms. The inclusion criteria were as follows: content related to IMIDs, English or Spanish language, and user population consisting of patients and health care consumers, including family and caregivers. The variables analyzed were as follows: app name, type of IMID, platform (Android or iOS), country of origin, language, category of the app, cost, date of the last update, size, downloads, author affiliation, and functionalities. Results We identified 713 apps in the initial search, and 243 apps met the criteria and were analyzed. Of these, 37% (n=90) were on Android, 27.2% (n=66) on iOS, and 35.8% (n=87) on both platforms. The most frequent categories were health and well-being/fitness apps (n=188, 48.5%) and medicine (n=82, 37.9%). A total of 211 (82.3%) apps were free. The mean time between the date of the analysis and the date of the most recent update was 18.5 (SD 19.3) months. Health care professionals were involved in the development of 100 (41.1%) apps. We found differences between Android and iOS in the mean time since the last update (16.2, SD 14.7 months vs 30.3, SD 25.7 months) and free apps (85.6% vs 75.8%; respectively). The functionalities were as follows: general information about lifestyles, nutrition, or exercises (n=135, 55.6%); specific information about the disease or treatment (n=102, 42%); recording of symptoms or adverse events (n=51, 21%); agenda/calendar (n=44, 18.1%); reminder medication (n=41, 16.9%); and recording of patient-reported outcomes (n=41, 16.9%). A total of 147 (60.5%) apps had more than one functionality. Conclusions IMID-related apps are heterogeneous in terms of functionality and reliability. Apps may be a useful complement to IMID care, especially inpatient education (their most frequent functionality). However, more than half of the IMID apps had not been developed by health care professionals or updated in the last year.
3
Gordon, John C., Garth R. Giesbrecht, David L. Clark, P. Jeffrey Hay, D. Webster Keogh, Rinaldo Poli, Brian L. Scott, and John G. Watkin. "The First Example of a μ2-Imido Functionality Bound to a Lanthanide Metal Center: X-ray Crystal Structure and DFT Study of [(μ-ArN)Sm(μ-NHAr)(μ-Me)AlMe2]2(Ar = 2,6-iPr2C6H3)1." Organometallics 21, no. 22 (October 2002): 4726–34. http://dx.doi.org/10.1021/om0206960.
Full text
4
Rajakumar, Perumal, Ramar Padmanabhan, Chandrasekaran Ramprasath, Narayanasamy Mathivanan, Vaidhyanathan Silambarasan, and Devadasan Velmurugan. "Synthesis, Antimicrobial Activity, and Molecular Docking Study of Some Novel Cyclophanes with Imino Intra-Annular Functionality." Australian Journal of Chemistry 66, no. 1 (2013): 84. http://dx.doi.org/10.1071/ch12326.
Full textAbstract:
The synthesis and structural characterisation of novel imino cyclophanes incorporating various spacer units is described. All the imino cyclophanes exhibit comparable antibacterial activity against Gram positive (Bacillus subtillus, Staphylococcus aureus) and Gram negative (Escherchia coli, Klebsiella pneumonia) bacterial strains. The imino cyclophanes also exhibit good antifungal activity against human pathogenic fungus, Candida albicans.
5
Gui, Dayong, Si Yu, Weijian Xiong, Xueqing Cai, Canqun Liu, and Jianhong Liu. "Liquid crystal functionalization of graphene nanoplatelets for improved thermal and mechanical properties of silicone resin composites." RSC Advances 6, no. 42 (2016): 35210–15. http://dx.doi.org/10.1039/c6ra01858k.
Full text
6
Hay, J. N., B. Woodfine, and M. Davies. "Toughening of Epoxy Resins by Polyimides Synthesized from Bisanilines." High Performance Polymers 8, no. 1 (March 1996): 35–56. http://dx.doi.org/10.1088/0954-0083/8/1/003.
Full textAbstract:
A range of thermoplastic polyimides has been synthesized and used to modify a DGEBA-DDS epoxy thermoset. The influence of polyimide end-group functionality and particle size has been examined. Increases in fracture toughness of up to three times that of the neat resin have been achieved, together with no loss of modulus. Thermal capability is little affected across the range of modifying polyimides. The influence of copoly(imide–imide)s has also been studied. Morphological examination has revealed a range of structures in the blends, including some which are unusual. A particulate toughening mechanism is proposed for one high fracture toughness system.
7
Aegurla, Balakrishna, Nisha Jarwal, and Rama Krishna Peddinti. "Denitrative imino-diaza-Nazarov cyclization: synthesis of pyrazoles." Organic & Biomolecular Chemistry 18, no. 31 (2020): 6100–6107. http://dx.doi.org/10.1039/d0ob01200a.
Full textAbstract:
This iodine-catalysed expedient process furnished functionally-rich pyrazoles regioselectively in ethanol under aerobic conditions. The cascade reaction for the pyrazole formation proceeds through enamine–imino diaza-Nazarov 4π-electrocyclization.
8
Aegurla, Balakrishna, and Rama Krishna Peddinti. "The diaza-Nazarov cyclization involving a 2,3-diaza-pentadienyl cation for the synthesis of polysubstituted pyrazoles." Organic & Biomolecular Chemistry 15, no. 45 (2017): 9643–52. http://dx.doi.org/10.1039/c7ob01949a.
Full textAbstract:
Functionally-rich pyrazoles in a cascade reaction from in situ generated hydrazones and acetophenones under aerobic conditions were synthesized through novel enamine–imino diaza-Nazarov 4π-electrocyclization which is supported by DFT calculations.
9
Ji, Jian-Xin, Jing Wu, Lijin Xu, Chiu-Wing Yip, Kim Hung Lam, and Albert S. C. Chan. "Catalytic asymmetric addition reactions leading to carbon-carbon bond formation: Phenyl and alkenyl transfer to aldehydes and alkynylation of α-imino esters." Pure and Applied Chemistry 78, no. 2 (January 1, 2006): 267–74. http://dx.doi.org/10.1351/pac200678020267.
Full textAbstract:
Optically active tertiary aminonaphthol ligands were obtained by a new, convenient procedure and were found to catalyze the enantioselective alkenyl and phenyl transfer to aldehydes in high yields and excellent enantiomeric excesses (ee's). The catalytic asymmetric introduction of alkynyl functionality to α-amino acid derivatives was realized by the direct addition of terminal alkynes to α-imino ester in the presence of chiral copper(I) complex under mild reaction conditions.
10
Maity, Ranjan, Paola E. Neri, Ines Tagoug, Li Ren, Jiri Slaby, Victor H. Jimenez-Zepeda, Peter Duggan, Justin Simms, and Nizar J. Bahlis. "Cereblon (CRBN) Splice Isoform Lacking Exon 10 Attenuates Lenalidomide-Mediated Degradation of Aiolos and Is Upregulated in Immunomodulatory Drugs (IMiDs) Resistant Myeloma (MM) Patients." Blood 124, no. 21 (December 6, 2014): 639. http://dx.doi.org/10.1182/blood.v124.21.639.639.
Full textAbstract:
Abstract Background: IMiDs cytotoxicity in MM cells is mediated through their binding to CRBN within the cullin ring (CRL4) ligase. This binding triggers the ubiquitylation and proteasomal degradation of IKZF1/3. CRBN thalidmomide binding domain (TBD) was mapped to its C-terminus and the crystal structure of the CRBN-IMiDs bound complex identified several aa within exons 10 and 11 as essential for the IMiDs glutarimide ring binding to CRBN. Several groups including ours have reported that loss of CRBN is associated with resistance to IMiDs, however this does not appear to be the sole mechanism of resistance in primary MM cells. Furthermore, and while CRBN mutants (Y384A and W386A) are defective for IMiDs binding, acquisition of CRBN mutation is a rare event in MM patients suggesting alternative mechanisms of resistance. Thirteen splice variants of CRBN are reported (ensembl.org), however to date it is unclear whether these isoforms are expressed as proteins and their contribution to IMiDs resistance is yet to be defined. Methods and Results: In this study we investigated whether expression of full length CRBN (FL-CRBN) relative to its variants lacking the TBD and particularly the splice variant CRBN-005 (ENST00000424814) lacking exon 10, contribute to IMiDs resistance. RNA-seq analysis was performed on CD138 sorted cells in 15 paired patients samples obtained sequentially prior to lenalidomide treatment initiation and after development of resistance. Transcriptome sequence data was generated by RNA-seq with a minimum of 70x106 reads per sample. Filtered Fastq files were processed with the splice aligner TopHat against hg19. Of interest, splice isoforms of CRBN including isoforms lacking exon 10 and to a lesser extent exon 8 were identified in nearly all patients, albeit with at variable frequency. Splicing almost universally involved the full length of exon 10 including aa W382 and H378 that are now recognized to bind the 2 carbonyls residues on the IMiDs glutarimide ring and hence required for IMiDs binding to CRBN. Of note, mutation analysis of these 30 samples using the GATK RNAseq pipeline did not identify any mutations within CRBN exons 10 or 11. Furthermore, exome sequencing of CD138 cells from 10 additional lenalidomide resistant patients did not identify any CRBN SNVs or indels confirming the rarity of this event. In order to assess the contribution of FL-CRBN transcript and/or its splice variant (CRBN-005) to IMiDs sensitivity, we first confirmed by qRT-PCR (n=26, amplicons with 2 sets of primers overlapping exons 8-9 and exons 10-11) that low pre-treatment CRBN levels was significantly associated with shorter PFS (p=0.008) to lenalidomide. We next compared FL-CRBN (probe spanning exons 10-11) and CRBN-005 (Taqman probe spanning exons 9-11 junction) mRNA expression (qRT-PCR) in paired samples (n=21 patients - 42 pairs) collected immediately pre-treatment and at the time of progression post-lenalidomide. In 9/21 (42.8%), a significant reduction (2-ΔΔCT < 0.75) in the FL-CRBN amplicon levels was observed between the paired pre- and post-treatment samples. The ratio of spliced CRBN-005 to full length CRBN (CRBN-005 / FL-CRBN) was significantly higher (1.3 to 54 fold) at the time of relapse in 11/21 (52.3%), including 5 patients where CRBN-FL transcript levels were unchanged. Lastly, to confirm whether CRBN-005 expresses a stable protein and to evaluate its role in IMiDs resistance, we cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into pcDNA3 plasmid and transfected them in HEK293T cells. The Δ10-CRBN and WT-CRBN plasmids expressed a ~ 45 and 51 kDa proteins respectively that were detectable by western blotting with CRBN65 antibody (Celgene). Functionally, we co-transfected HEK293T cells with a lentiviral plasmid expressing Aiolos and the Δ10-CRBN or WT-CRBN plasmids. While treatment of WT-CRBN expressing cells with lenalidomide resulted in full loss of Aiolos, the expression of Δ10-CRBN significantly mitigated this effect. Conclusions: Study of the transcriptome of paired pre- and post-IMIDs in myeloma primary cells confirms the expression of CRBN-005 splice isoform lacking the IMiDs binding domain and reveals its enrichment in a subset of IMiDs resistance patients. Functionally we have demonstrated a novel mechanism of IMiDs resistance where the spliced isoform CRBN-005 acts as a dominant negative blocking IMiDs binding the CRL4 E3 ligase. Disclosures Bahlis: Celgene: Honoraria, Research Funding.
11
Eliseev, Ivan I., Nadezhda A. Bokach, Matti Haukka, and Irina A. Golenya. "cis-Dichlorido(dimethyl sulfoxide-κS)(N,N,N′,N′-tetramethylguanidine-κN′′)platinum(II)." Acta Crystallographica Section E Structure Reports Online 69, no. 2 (January 19, 2013): m117—m118. http://dx.doi.org/10.1107/s160053681300130x.
Full textAbstract:
In the title compound,cis-[PtCl2(C5H13N3)(C2H6OS)], the four-coordinate PtIIatom is bonded to one N atom of theN,N,N′,N′-tetramethylguanidine ligand, one dimethyl sulfoxide S atom and two chloride ligands, forming acis-square-planar geometry. The bond lengths and angles of the N—Pt—Cl functionality are typical for imine dichloridoplatinum(II) complexes. The H atom of the imino group is oriented towards the O atom of the sulfoxide group of a neighboring molecule and forms an N—H...O hydrogen bond.
12
Acosta-Colman, I., M. Vazquez, S. Cabrera-Villalba, A. Ayala-Lugo, M. E. Acosta, I. Arevalo de Guillen, V. Jolie, et al. "AB0015 STUDY OF VDR AND VDBP GENES AS CANDIDATE SUSCEPTIBILITY GENES FOR THE DEVELOPMENT OF IMMUNE-MEDIATED DISEASES IN THE PARAGUAYAN POPULATION." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 1042.2–1042. http://dx.doi.org/10.1136/annrheumdis-2021-eular.4299.
Full textAbstract:
Background:Immune Mediated Inflammatory Diseases (IMIDs) are complex diseases that are believed to have a strong interaction between the genome and the environment as part of their aetiology. In studies using the candidate gene strategy, genetic variation in a gene where functionality has been associated with the pathophysiology of the disease under study is being analyzed. In the last decade, polymorphisms of the vitamin D receptor (VDR) and VDBP genes have been more emphatically studied in IMIDs in different populations, but the results reported have not yet been conclusive.Objectives:To identify an association between vitamin D receptor (VDR) and vitamin D-binding protein (VDBP) gene polymorphisms, and IMIDs in Paraguayan patients.Methods:Association study of VDR (SNPs rs731236, rs7975232, rs2228570) and VDBP (rs4588) gene polymorphisms with susceptibility to IMIDs in Paraguayan population. A total of 399 patients with IMIDs (i.e. Systemic Lupus Erythematosus (SLE), Scleroderma (ES), Rheumatoid Arthritis (RA), and Cutaneous Psoriasis (CPS) and 100 hypernormal controls (HC) from the same population were included in this study. Genotyping was performed using Taqman real-time PCR-based technology (Life Technologies, USA). Statistical analysis was performed using Rv3.0.1 statistical language software (www.R-project.org). A p value ≤ 0.05 was used for statistical significance.Results:A total of 399 individuals, 100 controls and 299 patients (99 RA, 100 SLE, 50 ES, and 50 PSO) were included. Seventy-six percent were female and 24% were male. The mean age was 43.7±14 years. Four SNPs were genotyped: rs731236, rs7975232, rs2228570, rs4588. The HWE test was not statistically significant for any of the 4 SNPs considered (P>0.05), confirming the quality of genotyping and the absence of technical bias. (Table 1).Table 1.Genotyping of SNPs of the VDR and VDBP gene in Paraguayan population with IMIDs.SNPIMIDMinor AlleleMajor AlleleMAFControlMAFCaseORIC.LIC.Hp allelicP.Geneticrs731236SLEGA0.50.40.640.420.970.0350.08rs731236RAGA0.50.410.690.461.050.0710.12rs731236SSGA0.50.420.710.421.180.180.37rs731236CPSGA0.50.380.60.361.010.0490.042rs2228570SLEAG0.360.381.140.741.740.60.45rs2228570RAAG0.360.310.830.531.280.40.56rs2228570SSAG0.360.361.020.61.7310.057rs2228570CPSAG0.360.391.160.681.960.610.83rs7975232SLECA0.360.320.820.531.260.40.072rs7975232RACA0.360.290.720.461.120.140.064rs7975232SSCA0.360.220.490.270.880.0120.0064rs7975232CPSCA0.360.411.210.722.030.450.016rs4588SLETG0.230.271.240.7720.420.48rs4588RATG0.230.220.930.561.530.810.84rs4588SSTG0.230.210.890.471.650.770.76rs4588CPSTG0.230.291.370.762.430.260.53Conclusion:There is evidence of nominal association between VDR SNPs: rs731236 (in SLE and CPS), and rs7975232 (in SS and CPS) and the presence of IMIDs disease in Paraguayan patients.Disclosure of Interests:None declared
13
Millar, Graeme J., Sara J. Couperthwaite, Daniel B. Wellner, David C. Macfarlane, and Scott A. Dalzell. "Removal of fluoride ions from solution by chelating resin with imino-diacetate functionality." Journal of Water Process Engineering 20 (December 2017): 113–22. http://dx.doi.org/10.1016/j.jwpe.2017.10.004.
Full text
14
Kaur, Ramanpreet, Raj Gautam, Suryanarayan Cherukuvada, and Tayur N. Guru Row. "Do carboximide–carboxylic acid combinations form co-crystals? The role of hydroxyl substitution on the formation of co-crystals and eutectics." IUCrJ 2, no. 3 (April 10, 2015): 341–51. http://dx.doi.org/10.1107/s2052252515002651.
Full textAbstract:
Carboxylic acids, amides and imides are key organic systems which provide understanding of molecular recognition and binding phenomena important in biological and pharmaceutical settings. In this context, studies of their mutual interactions and compatibility through co-crystallization may pave the way for greater understanding and new applications of their combinations. Extensive co-crystallization studies are available for carboxylic acid/amide combinations, but only a few examples of carboxylic acid/imide co-crystals are currently observed in the literature. The non-formation of co-crystals for carboxylic acid/imide combinations has previously been rationalized, based on steric and computed stability factors. In the light of the growing awareness of eutectic mixtures as an alternative outcome in co-crystallization experiments, the nature of various benzoic acid/cyclic imide combinations is established in this paper. Since an additional functional group can provide sites for new intermolecular interactions and, potentially, promote supramolecular growth into a co-crystal, benzoic acids decorated with one or more hydroxyl groups have been systematically screened for co-crystallization with one unsaturated and two saturated cyclic imides. The facile formation of an abundant number of hydroxybenzoic acid/cyclic carboximide co-crystals is reported, including polymorphic and variable stoichiometry co-crystals. In the cases where co-crystals did not form, the combinations are shown invariably to result in eutectics. The presence or absence and geometric disposition of hydroxyl functionality on benzoic acid is thus found to drive the formation of co-crystals or eutectics for the studied carboxylic acid/imide combinations.
15
Fedko, Nadiia F., Valeriy F. Anikin, and Vira V. Veduta. "The synthesis of N-substituted 4-fluoro-1,8-naphthalimides." Journal of Organic and Pharmaceutical Chemistry 20, no. 3 (November 21, 2022): 25–30. http://dx.doi.org/10.24959/ophcj.22.263203.
Full textAbstract:
Aim. To synthesize 4-fluoro-1,8-naphthalic acid imide and its derivatives substituted in the imide ring.Results and discussion. 4-Fluoro-1,8-naphthalimide was obtained using acenaphthene as the starting material. N-alkyl-4-fluoro-1,8-naphthalimides were synthesized via the phase transfer catalytic alkylation of 4-fluoro-1,8-naphthalimide with haloalkanes. Imidation of 4-fluoro-1,8-naphthalic anhydride with aminoacids resulted in the formation of N-carboxyalkyl-1,8-naphthalimides. These substances can be considered as potential fluorescent labels capable of binding to amino groups of various biological molecules as they contain carboxylic functionality in their structure.Experimental part. The structure of the compounds synthesized was confirmed by FT-IR, 1H NMR and 13C NMR spectroscopy, and mass-spectrometry.Conclusions. It has been shown that 4-fluoro-1,8-naphthalinedicarboxylic acid imide can be obtained following the synthetic route “acenaphthene – 5-fluoroacenaphthene – 4-fluoro-1,8-naphthalic anhydride – 4-fluoro-1,8-naphthalimide”. 4-Fluoro-1,8-naphthalimide can be alkylated by butyl iodide and octyl bromide using tetraalkylammonium salts as a phase transfer catalyst resulted in N-butyl-4-fluoro-1,8-naphthalimide and N-octyl-4-fluoro-1,8-naphthalimide. As a result, N-carboxyalkyl-4-fluoro-1,8-naphthalimides have been obtained for the first time by aminolysis of 4-fluoro-1,8-naphthalic anhydride with glycine, β-alanine and 6-aminocaproic acid.
16
Fostier, Karel, Jurgen Corthals, Carlo Heirman, Joeri L. Aerts, Kris Thielemans, Rik Schots, and Brenda De Keersmaecker. "Immunomodulatory Drugs Restore Effector Cell Immune Functions In Myeloma Patients With Low Disease Burden After Autologous Stem Cell Transplantation." Blood 122, no. 21 (November 15, 2013): 3214. http://dx.doi.org/10.1182/blood.v122.21.3214.3214.
Full textAbstract:
Abstract The micro-environment in multiple myeloma (MM) is highly immunosuppressive with increased numbers of regulatory T cells (Tregs) and myeloid derived suppressor cells (MDSCs) favoring tumorcell survival and hampering immunotherapeutic strategies such as dendritic cell vaccination. Immunomodulatory drugs (IMiDs) are known to enhance T- and NK-cell function. In this study we evaluated the effects of low dose (0.5 microM) lenalidomide (Len) and pomalidomide (Pom) on the functionality of CD8+ and CD4+ T cells, MDSCs, Tregs and ex-vivo generated mononuclear derived dendritic cells (moDCs) obtained from MM patients after first autologous stem cell transplantation (ASCT). Peripheral blood mononuclear cell fractions were obtained by leukapheresis from 9 MM patients (age 29-62 years), in very good partial response (4/9) or complete response (5/9) after ASCT. The magnitude of cytokine release (mean +/- standard error of the mean, in ng/ml) by purified CD8+ T cells after 144 hours stimulation with anti-CD3/anti-CD28 coated microbeads was significantly increased after addition of Len and Pom to the culture medium, respectively : IFN-gamma (217.5 +/- 62.1 and 437.1 +/- 137.1** vs 66.4 +/- 21.0) , TNF-alpha (21.4 +/- 5.4 and 44.9 +/- 9.4*** vs 4.9 +/- 1.7) and IL-2 (5.3 +/- 2.7 and 12.7 +/- 6.6 vs 1.9 +/- 1.7 ng/ml) (** p< 0.01, *** p< 0.001). We also evaluated the number of different types of cytokines/chemokines on a per cell basis by intracellular flow cytometry staining for IFN-gamma, TNF-alpha, IL-2 and MIP-1beta and observed increased polyfunctionality of CD8+ and CD4+ T cells. After 72 h of stimulation with anti-CD3/CD28 microbeads the number of single, double, triple or quadruple functional CD8+ T cells increased from 5.96 %, 2.82 %, 0.1 %, 0 % (culture medium alone) to 9.68 %, 7.57 %, 0.41%, 0.03 % (Len) and 12.57 %, 8.96 %, 0.81 %, 0.03 % (Pom), respectively. A similar observation was made for CD4+ T cells. A significant percentage, median 5.7 % (4.0-7.2 %) of CD4+ CD25high CD127low (Tregs) was found in the CD4+ T cell population in 8 out of 9 patients, demonstrating the highly suppressive immune environment in myeloma patients even with low disease burden. Effector T cells (Teffs) were stimulated with anti-CD3/CD28 microbeads and cocultured at varying ratios with purified Tregs. After 144 h of coculture, Len and Pom reduced the suppressive effects of Tregs on Teffs proliferation and IFN-gamma and TNF-alpha production (see figure). A similar effect was observed for MDSC but did not reach statistical significance (data not shown). TriMix DCs (moDCs matured by electroporation with mRNA encoding TLR4, CD40L and CD70) and cytokine matured moDCs were cocultured with autologous CD4+ and CD8+ T cells and anti-CD3 microbeads. Adding IMiDs resulted in more polyfunctional CD4+ and CD8+ T cells with both types of DCs but effects were most pronounced with the TriMix variant. Our study shows that Len and Pom restore effector cell functions in myeloma patients with low tumor burden after ASCT. These findings provide a immunomechanistic explanation for IMiD-based maintenance therapy. They also offer a rationale to combine IMiD-based maintenance with immunotherapeutic approaches such as dendritic cell vaccination in this particular setting. Disclosures: No relevant conflicts of interest to declare.
17
Avetisyan, A. A., A. G. Alvandzhyan, and K. S. Avetisyan. "Synthesis of new unsaturated derivatives of functionally substituted 2-imino-2,5-dihydrofurans." Russian Journal of Organic Chemistry 47, no. 3 (March 2011): 433–36. http://dx.doi.org/10.1134/s1070428011030183.
Full text
18
O’Harra, Kathryn E., Danielle M. Noll, Irshad Kammakakam, Emily M. DeVriese, Gala Solis, Enrique M. Jackson, and Jason E. Bara. "Designing Imidazolium Poly(amide-amide) and Poly(amide-imide) Ionenes and Their Interactions with Mono- and Tris(imidazolium) Ionic Liquids." Polymers 12, no. 6 (May 30, 2020): 1254. http://dx.doi.org/10.3390/polym12061254.
Full textAbstract:
Here we introduce the synthesis and thermal properties of a series of sophisticated imidazolium ionenes with alternating amide-amide or amide-imide backbone functionality, and investigate the structural effects of mono(imidazolium) and unprecedented tris(imidazolium) ionic liquids (ILs) in these ionenes. The new set of poly(amide-amide) (PAA) and poly(amide-imide) (PAI) ionenes represent the intersection of conventional high-performance polymers with the ionene archetype–presenting polymers with alternating functional and ionic elements precisely sequenced along the backbone. The effects of polymer composition on the thermal properties and morphology were analyzed. Five distinct polymer backbones were synthesized and combined with a stoichiometric equivalent of the IL 1-benzyl-3-methylimidazolium bistriflimide ([Bnmim][Tf2N]), which were studied to probe the self-assembly, structuring, and contributions of intermolecular forces when IL is added. Furthermore, three polyamide (PA) or polyimide (PI) ionenes with simpler xylyl linkages were interfaced with [Bnmim][Tf2N] as well as a novel amide-linked tris(imidazolium) IL, to demonstrate the structural changes imparted by the inclusion of functional, ionic additives dispersed within the ionene matrix. This work highlights the possibilities for utilizing concepts from small molecules which exhibit supramolecular self-assembly to guide creative design and manipulate the structuring of ionenes.
19
Erzina, Dina R., Ilya A. Zamilatskov, Nadezhda M. Kurochkina, Gelii V. Ponomarev, and Victor A. Tafeenko. "Structural explanation of the spectral features of the nonsymmetrical complex {2,3,7,8,12,13,17,18-octaethyl-5-[(methylimino)methyl]porphyrinato-κ4N21,N22,N23,N24}palladium(II)." Acta Crystallographica Section C Structural Chemistry 73, no. 2 (January 11, 2017): 68–71. http://dx.doi.org/10.1107/s2053229616020465.
Full textAbstract:
The features of porphyrins defining their functionality are related to their conformational flexibility. The degree of nonplanarity of metalloporphyrins depends directly on the number of substituents, their size and their location. The introduction of substituents in themesopositions of β-substituted porphyrins increases the steric interaction and leads to distortions of the porphyrin core. Increasing the distortion of the porphyrin core would augment the bathochromic (red) shift of the electronic absorption spectra. A new nonsymmetrical 2,3,7,8,12,13,17,18-octaethyl-5-[(methylimino)methyl]porphyrin complex of palladium(II), [Pd(C38H47N5)], was synthesized and characterized by NMR, mass spectrometry and X-ray analysis. The features of the electronic absorption spectrum of the synthesized complex are explained by the planarity of the porphyrin core and the π-system of the imino group orthogonal to it.
20
Avetisyan, A. A., A. G. Alvandzhyan, and K. S. Avetisyan. "Synthesis of functionally substituted 2-imino-3-aryl-2,5-dihydrofurans and their chemical reactiosns." Russian Journal of Organic Chemistry 47, no. 2 (February 2011): 308–11. http://dx.doi.org/10.1134/s107042801102028x.
Full text
21
Avetisyan, A. A., A. G. Alvandzhyan, and K. S. Avetisyan. "ChemInform Abstract: Synthesis of New Unsaturated Derivatives of Functionally Substituted 2-Imino-2,5-dihydrofurans." ChemInform 42, no. 37 (August 18, 2011): no. http://dx.doi.org/10.1002/chin.201137096.
Full text
22
Neri, Paola, Ranjan Maity, Jonathan J. Keats, Ines Tagoug, Justin Simms, Daniel Auclair, Sagar Lonial, and Nizar J. Bahlis. "Cereblon Splicing of Exon 10 Mediates IMiDs Resistance in Multiple Myeloma: Clinical Validation in the CoMMpass Trial." Blood 128, no. 22 (December 2, 2016): 120. http://dx.doi.org/10.1182/blood.v128.22.120.120.
Full textAbstract:
Abstract Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival. Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot). Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. Figure Figure. Disclosures Neri: Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.
23
Mata, D., N. Scharnagl, S. V. Lamaka, E. Malheiro, F. Maia, and M. L. Zheludkevich. "Validating the early corrosion sensing functionality in poly (ether imide) coatings for enhanced protection of magnesium alloy AZ31." Corrosion Science 140 (August 2018): 307–20. http://dx.doi.org/10.1016/j.corsci.2018.05.034.
Full text
24
Han, Mingyang, Zheng Zuo, Yanping Ma, Gregory A. Solan, Xinquan Hu, Tongling Liang, and Wen-Hua Sun. "Bis(imino)-6,7-dihydro-5H-quinoline-cobalt complexes as highly active catalysts for the formation of vinyl-terminated PE waxes; steps towards inhibiting deactivation pathways through targeted ligand design." RSC Advances 11, no. 63 (2021): 39869–78. http://dx.doi.org/10.1039/d1ra07279j.
Full text
25
Avetisyan, A. A., A. G. Alvandzhyan, and K. S. Avetisyan. "ChemInform Abstract: Synthesis of Functionally Substituted 2-Imino-3-aryl-2,5-dihydrofurans and Their Chemical Reactions." ChemInform 42, no. 34 (July 28, 2011): no. http://dx.doi.org/10.1002/chin.201134097.
Full text
26
Neri, Paola E., Ines Tagoug, Li Ren, Ranjan Maity, Justin Simms, Peter Duggan, Victor H. Jimenez-Zepeda, et al. "Transcriptome Profiling of Lenalidomide Treated Myeloma Patients Identifies an Interferon Signature Gene Response and a Novel IRF4/MYC Independent Mechanism of Resistance." Blood 124, no. 21 (December 6, 2014): 170. http://dx.doi.org/10.1182/blood.v124.21.170.170.
Full textAbstract:
Abstract Background: Immunomodulatory (IMiDs) drugs are now recognized as modifiers of the degrons targeted by the CLR4-CRBN E3 ligase. Lenalidomide binding to CRBN promotes the proteasomal degradation to the B cell specific zinc finger transcription factors Ikaros (IKZF1) and Aiolos (IKZF3) and the transcriptional repression of IRF4 and MYC. Loss of CRBN thalidomide binding domain as well as the expression of mutants IKZF1Q146H or IKZF3Q147H confer resistance to IMiDs in vitro; however these events are rare in primary MM cells. In addition over-expression of IRF4 only partially protects MM cells from the anti-proliferative effects of IMiDs suggesting that a yet unidentified Aiolos dependent mechanism(s) regulate IMiDs sensitivity. Methods and Results: In order to identify novel mechanisms of resistance to IMiDs we profiled the transcriptome of IMiDs treated patients (sensitive and resistant), MM cell line (MM1S) exposed to lenalidomide and Aiolos silenced MM cells (OPM2). In primary samples, RNA-seq analysis was performed on paired CD138 selected cells sequentially collected from patients’ BM prior to lenalidomide treatment initiation (n=15) and at the time of acquired resistance (n=12) or ongoing response to therapy (n=3). Transcriptome sequence data was generated on the Ion Torrent Proton platform with a minimum of 70x106 reads per sample. Filtered Fastq files were mapped with the TopHat2 splice aligner against hg19. DESeq2 was used to detect differentially expressed (DE) genes. Amongst lenalidomide sensitive patients a total of 870 genes were identified as differentially expressed (FDR <0.1) between the pre- and post-lenalidomide paired samples. Functional annotation of these DE genes using DAVID revealed enrichment of genes involved in immune mediated responses (Gene-Ontology). Of interest interferon γ (IFNγ) was upregulated 3.3 fold in the post-lenalidomide sensitive cohort and 20.4% of the DE genes are type I and II interferon regulated genes (Interferome v2.01). A similar Interferon type of response was also observed in MM1S (Len-sensitive MM cell line) and post Aiolos knockdown of OPM2 cells but not in the lenalidomide resistant cohort. Notably, while several genes that are required for the induction of an interferon response (IL1α, IL1β, TBK1, NLRP3) were upregulated post-lenalidomide in the sensitive cohort, they were downregulated in resistant patients. Of particular interest, two genes that play a key role in modulating IFN response were differentially expressed in the Len resistant cohort: 1) NLRP4 a member of the nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) was significantly upregulated in lenalidomide resistant patients. NLRP4 negatively regulates type I IFN signaling by targeting the kinase TBK1 for proteasomal degradation and is also recognized to suppress autophagy through Beclin1; 2) NFKBIZ (IkBζ), an atypical IkB kinase required for the induction of IFN response was significantly reduced in lenalidomide-resistant patients. Validation of this lenalidomide induced IFN response was carried out in vitro in MM cells exposed to lenalidomide 10 μM for 24 and 72 hours. A significant increase in IFN stimulated genes (ISGs) such as XAF1, DDX58, IFIT3 was observed following lenalidomide treatment. Similar changes were observed in Aiolos knockdown MM cells. Functionally, silencing of NFKBIZ (through lentiviral shRNA or transient siRNA expression) in MM1S cells resulted in 30% reduction in lenalidomide induced cell death and supressed p21 upregulation but had no effect on the downregulation Aiolos, IRF4 and MYC. Similarly stable overexpression of NLRP4 in MM cells, conferred resistance to lenalidomide. Conclusions: Through comparative transcriptome profiling of lenalidomide resistance and sensitive patients we have identified an Aiolos-dependent induction of interferon stimulated genes as a novel mechanisms of IMiDs mediated cytotoxicity and identified NLRP4 and NFKBIZ as potential mediators of IMiDs resistance. Disclosures Bahlis: Celgene: Honoraria, Research Funding.
27
ZONG, YUN, ULRIKE HEES, WOLFGANG KNOLL, and JÜRGEN RÜHE. "PHOTOREACTIVE THIN FILMS OF AZOBENZENE-DERIVATIZED POLY(AMIC ACID) AND POLY(IMIDE) LANGMUIR–BLODGETT–KUHN MULTILAYER ASSEMBLIES." Journal of Nonlinear Optical Physics & Materials 11, no. 04 (December 2002): 367–89. http://dx.doi.org/10.1142/s0218863502001127.
Full textAbstract:
Various poly(amic acid)s with azobenzene-chromophore sidegroups have been synthesized and structurally and functionally characterized. Their amphiphilic properties allowed us to prepare stable monomolecular layers at the water/air interface of a Langmuir trough, and to transfer these highly organized monolayers to solid supports via the Langmuir–Blodgett–Kuhn deposition protocol. The resulting multilayer assemblies were investigated by surface plasmon- and waveguide-optical techniques, by X-ray reflectometry, and by UV-vis and IR spectroscopies. Thermal imidization of the assemblies resulted in functional poly(imide) multilayers that still could undergo photoisomerization reactions in their azobenzene sidegroups. The kinetic parameters of this trans-cis and cis-trans isomerization, respectively, as well as, the resulting control of the alignment of a liquid crystal in contact to these "command layers" were evaluated.
28
M, Shoaib. "Synthesis, Antibacterial and Antifungal Properties of Cyclohexane Tosyloxyimine Derivative." Open Access Journal of Microbiology & Biotechnology 4, no. 3 (2019): 1–4. http://dx.doi.org/10.23880/oajmb-16000150.
Full textAbstract:
Due to increasing antimicrobial resistance, functionally substituted cyclohexane derivatives are being explored as potential antimicrobial agents. Reaction of diethyl 4 - hydroxy - 6 - (hyd - roxyimino) - 4 - methyl - 2 - phenylcyclohexane - 1,3 - dicarboxylate with 4 - toluene sulfonyl chloride in boiling acetone in the presence of equimolar triethylamine resulted in formation of diethyl - 4 - hydroxy - 4 - methyl - 2 - phenyl - 6 - ((tosyloxy)imino) cyclohexane - 1,3 - dicarboxylate. The structure of novel compound was characterized by 1 H and 13 C NMR spectra and elemental analysis was performed. Agar well diffusion assay was used to screen novel compound against Gram - positive bacteria, Gram - negative bacteria and fungi. Test compound showed better antimicrobial properties against Gram - negative bac teria as compared to Gram - positive bacteria and fungi. Acinetobacter baumannii BDU - 32 was found to be most sensitive bacteria while Candida pseudotropicalis BDU MA88 was found to be most sensitive yeast.
29
McGregor, Nicholas G. S., Johan P. Turkenburg, Kristian B. R. Mørkeberg Krogh, Jens Erik Nielsen, Marta Artola, Keith A. Stubbs, Herman S. Overkleeft, and Gideon J. Davies. "Structure of a GH51 α-L-arabinofuranosidase from Meripilus giganteus: conserved substrate recognition from bacteria to fungi." Acta Crystallographica Section D Structural Biology 76, no. 11 (October 16, 2020): 1124–33. http://dx.doi.org/10.1107/s205979832001253x.
Full textAbstract:
α-L-Arabinofuranosidases from glycoside hydrolase family 51 use a stereochemically retaining hydrolytic mechanism to liberate nonreducing terminal α-L-arabinofuranose residues from plant polysaccharides such as arabinoxylan and arabinan. To date, more than ten fungal GH51 α-L-arabinofuranosidases have been functionally characterized, yet no structure of a fungal GH51 enzyme has been solved. In contrast, seven bacterial GH51 enzyme structures, with low sequence similarity to the fungal GH51 enzymes, have been determined. Here, the crystallization and structural characterization of MgGH51, an industrially relevant GH51 α-L-arabinofuranosidase cloned from Meripilus giganteus, are reported. Three crystal forms were grown in different crystallization conditions. The unliganded structure was solved using sulfur SAD data collected from a single crystal using the I23 in vacuo diffraction beamline at Diamond Light Source. Crystal soaks with arabinose, 1,4-dideoxy-1,4-imino-L-arabinitol and two cyclophellitol-derived arabinose mimics reveal a conserved catalytic site and conformational itinerary between fungal and bacterial GH51 α-L-arabinofuranosidases.
30
Neri, Paola. "Enhancer Deregulation in Myeloma." Blood 132, Supplement 1 (November 29, 2018): SCI—38—SCI—38. http://dx.doi.org/10.1182/blood-2018-99-109523.
Full textAbstract:
Abstract The complexity of gene expression regulation is the result of a composite interplay between promoters, enhancers and other cis-acting regulatory elements bound by transcription factors (TFs) that controls the transcriptional activity of genes. Primary tumor cells, in comparison to their healthy counterparts, are known to display altered enhancer repertoires that are associated with tumor-specific transcription. Large groups of transcriptional enhancers cluster together to form super-enhancers (SEs). These elements have been shown to control genes that are important for maintaining cell identity but are also frequently associated with oncogenes as well as translocations that result in aberrant gene expression in cancer. Immunoglobulin (IGH, IGL, IGK) and non-immunoglobulin (PVT1, FAM46C, DUSP22, etc.) enhancers hijacking by variable genes (MYC, MAF, CCND1/2/3, MMSET, IRF4) is a recognized oncogenic driver event in multiple myeloma (MM). However, the identity of the TFs or transcriptional regulatory complexes binding and regulating the activity of these enhancers remains to be fully elucidated and may yield valuable therapeutic targets. In this regard, the bromodomain and extra-terminal (BET) inhibitors have emerged as promising molecules for the treatment of hematologic malignancies. BET family proteins are chromatin adaptors, functionally linked to important pathways for cellular viability and cancer signaling. In particular, BRD4 has a direct role in the transcription regulation of different genes involved in the cell cycle progression and cellular viability. The BET inhibitor JQ1 selectively inhibits BRD4 by competitively binding to the acetyl-lysine recognition pocket of BET bromodomains from chromatin leading to the inhibition of MYC transcription in a dose- and time-dependent manner. Thus, BRD4 has been recently described as a therapeutic target for MM, among other hematologic diseases. Constitutive activation of MYC signaling is detected in more than 60% of patient-derived MM cells and can be involved in the pathogenesis of MM through different mechanisms. One of the most common somatic genomic aberrations in early and late-stage MM is rearrangement or translocation of MYC. Regardless of whether MYC rearrangements occur at early or late stages of MM pathogenesis, MYC rearrangements may provide one of several critical events contributing to increased autonomy and a more aggressive phenotype. Moreover promiscuous rearrangements of the MYC locus are known to hijack enhancers and super-enhancers to dysregulate MYC expression in MM and are involved in its pathogenesis. The development of the immunomodulatory drugs (IMiDs) has contributed significantly to improve the outcomes of MM patients. They possess pleiotropic anti-MM properties and through CRBN binding they induce Ikaros and Aiolos ubiquitylation and proteasomal degradation with an ensuing transcriptional repression of MYC and IRF4, two essential factors for myeloma cells survival. However, is not clear how IKZF1/IKZF3 regulate MYC transcription and how myeloma cells acquire resistance to IMIDs, "beyond CRBN". In addition, acquired resistance to IMIDs and the loss of the transcriptional repression of MYC are nearly universal and occur in spite of sustained IKZF1/3 degradation suggesting that transcriptional rewiring may be sustaining hijacked enhancers activity and transcription of driver oncogenes. In this contest we have recently demonstrated that IMiDs are repressors of IKZF1/3-depedent oncogenic enhancers. Transcriptional plasticity with expression of extra-lineage TFs such as the ETS family member ETV4 sustains oncogenic enhancers in MM overcoming IKAROS and AIOLOS dependency and promoting IMiDs resistance. Therefore defining TFs occupancy and their circuitry at enhancers identifies "non-canonical" (aberrant) myeloma TFs dependency that may be linked to potential therapeutic targets. Disclosures Neri: Janssen: Consultancy, Honoraria; Celgene: Consultancy, Honoraria.
31
Shimizu, Makoto, Takafumi Nishi, and Akihiro Yamamoto. "Facile Double NucleophilicAddition of Thiols and Tetraallyltin to Latent 2-AlkynalsUsing in situ Hydrolysis of the Imino Functionality Promoted by Tin(IV)Chloride Pentahydrate." Synlett, no. 10 (2003): 1469–73. http://dx.doi.org/10.1055/s-2003-40857.
Full text
32
Cui, Guiying, Kazi S. Rahman, Daniel T. Infield, Christopher Kuang, Chengyu Z. Prince, and Nael A. McCarty. "Three charged amino acids in extracellular loop 1 are involved in maintaining the outer pore architecture of CFTR." Journal of General Physiology 144, no. 2 (July 14, 2014): 159–79. http://dx.doi.org/10.1085/jgp.201311122.
Full textAbstract:
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) bears six extracellular loops (ECL1–6); ECL1 is the site of several mutations associated with CF. Mutation R117H has been reported to reduce current amplitude, whereas D110H, E116K, and R117C/L/P may impair channel stability. We hypothesized that these amino acids might not be directly involved in ion conduction and permeation but may contribute to stabilizing the outer vestibule architecture in CFTR. We used cRNA injected oocytes combined with electrophysiological techniques to test this hypothesis. Mutants bearing cysteine at these sites were not functionally modified by extracellular MTS reagents and were blocked by GlyH-101 similarly to WT-CFTR. These results suggest that these three residues do not contribute directly to permeation in CFTR. In contrast, mutants D110R-, E116R-, and R117A-CFTR exhibited instability of the open state and significantly shortened burst duration compared with WT-CFTR and failed to be locked into the open state by AMP-PNP (adenosine 5′-(β,γ-imido) triphosphate); charge-retaining mutants showed mainly the full open state with comparably longer open burst duration. These interactions suggest that these ECL1 residues might be involved in maintaining the outer pore architecture of CFTR. A CFTR homology model suggested that E116 interacts with R104 in both the closed and open states, D110 interacts with K892 in the fully closed state, and R117 interacts with E1126 in the open state. These interactions were confirmed experimentally. The results suggest that D110, E116, and R117 may contribute to stabilizing the architecture of the outer pore of CFTR by interactions with other charged residues.
33
Himiniuc, Loredana, Razvan Socolov, Vlad Ghizdovat, Maricel Agop, Emil Anton, Bogdan Toma, Lacramioara Ochiuz, Decebal Vasincu, Ovidiu Popa, and Viviana Onofrei. "Infectious Inflammatory Processes and the Role of Bioactive Agent Released from Imino-Chitosan Derivatives Experimental and Theoretical Aspects." Polymers 14, no. 9 (April 30, 2022): 1848. http://dx.doi.org/10.3390/polym14091848.
Full textAbstract:
The paper focuses on the development of a multifractal theoretical model for explaining drug release dynamics (drug release laws and drug release mechanisms of cellular and channel-type) through scale transitions in scale space correlated with experimental data. The mathematical model has been developed for a hydrogel system prepared from chitosan and an antimicrobial aldehyde via covalent imine bonds. The reversible nature of the imine linkage points for a progressive release of the antimicrobial aldehyde is controlled by the reaction equilibrium shifting to the reagents, which in turn is triggered by aldehyde consumption in the inhibition of the microbial growth. The development of the mathematical model considers the release dynamic of the aldehyde in the scale space. Because the release behavior is dictated by the intrinsic properties of the polymer–drug complex system, they were explained in scale space, showing that various drug release dynamics laws can be associated with scale transitions. Moreover, the functionality of a Schrödinger-type differential equation in the same scale space reveals drug release mechanisms of channels and cellular types. These mechanisms are conditioned by the intensity of the polymer–drug interactions. It was demonstrated that the proposed mathematical model confirmed a prolonged release of the aldehyde, respecting the trend established by in vitro release experiments. At the same time, the properties of the hydrogel recommend its application in patients with intrauterine adhesions (IUAs) complicated by chronic endometritis as an alternative to the traditional antibiotics or antifungals.
34
Chen, C. C., W. J. Guo, and K. J. Isselbacher. "Rat intestinal trehalase. Studies of the active site." Biochemical Journal 247, no. 3 (November 1, 1987): 715–24. http://dx.doi.org/10.1042/bj2470715.
Full textAbstract:
Rat intestinal trehalase was solubilized, purified and reconstituted into proteoliposomes. With octyl glucoside as the solubilizing detergent, the purified protein appeared as a single band on SDS/polyacrylamide-gel electrophoresis with an apparent molecular mass of 67 kDa. Kinetic studies indicated that the active site of this enzyme can be functionally divided into two adjacent regions, namely a binding site (with pKa 4.8) and a catalytic site (with pKa 7.2). Other findings suggested that the catalytic site contains a functional thiol group, which is sensitive to inhibition by N-ethylmaleimide, Hg2+ and iodoacetate. Substrate protection and iodoacetate labelling of the thiol group demonstrated that only a protein of 67 kDa was labelled. Furthermore, sucrose and phlorizin protected the thiol group, but Tris-like inhibitors did not. Structure-inhibition analysis of Tris-like inhibitors, the pH effect of Tris inhibition and Tris protection of 1-(3-dimethylaminopropyl)-3-ethylcarbodi-imide inactivation permitted characterization and location of a separate site containing a carboxy group for Tris binding, which may also be the binding region. On the basis of these findings, a possible structure for the active site of trehalase is proposed.
35
Asandulesa, Mihai, Corneliu Hamciuc, Aurel Pui, Constantin Virlan, Gabriela Lisa, Andreea Irina Barzic, and Bogdan Oprisan. "Cobalt Ferrite/Polyetherimide Composites as Thermally Stable Materials for Electromagnetic Interference Shielding Uses." International Journal of Molecular Sciences 24, no. 2 (January 5, 2023): 999. http://dx.doi.org/10.3390/ijms24020999.
Full textAbstract:
The progress of the automated industry has introduced many benefits in our daily life, but it also produces undesired electromagnetic interference (EMI) that distresses the end-users and functionality of electronic devices. This article develops new composites based on a polyetherimide (PEI) matrix and cobalt ferrite (CoFe2O4) nanofiller (10–50 wt%) by mixing inorganic phase in the poly(amic acid) solution, followed by film casting and controlled heating, to acquire the corresponding imide structure. The composites were designed to contain both electric and magnetic dipole sources by including highly polarizable groups (phenyls, ethers, -CN) in the PEI structure and by loading this matrix with magnetic nanoparticles, respectively. The films exhibited high thermal stability, having the temperature at which decomposition begins in the interval of 450–487 °C. Magnetic analyses indicated a saturation magnetization, coercitive force, and magnetic remanence of 27.9 emu g−1, 705 Oe, and 9.57 emu g−1, respectively, for the PEI/CoFe2O4 50 wt%. Electrical measurements evidenced an increase in the conductivity from 4.42 10−9 S/cm for the neat PEI to 1.70 10−8 S/cm for PEI/CoFe2O4 50 wt% at 1 MHz. The subglass γ- and β-relaxations, primary relaxation, and conductivity relaxation were also examined depending on the nanofiller content. These novel composites are investigated from the point of view of their EMI shielding properties, showing that they are capable of attenuating the electric and magnetic parts of electromagnetic waves.
36
Chourasia, Aparajita Hoskote, Leah Fung, Brooke McElwee, Normand Richard, Imelda Lam, Eduardo Torres, Paul Erdman, et al. "Targeting AML: The Development of Two Functionally and Mechanistically Distinct Classes of Cereblon-Mediated Protein Homeostatic Modulators." Blood 134, Supplement_1 (November 13, 2019): 3361. http://dx.doi.org/10.1182/blood-2019-131872.
Full textAbstract:
Targeting disease-relevant proteins by exploiting the cells' very own protein homeostasis machinery is the next generation drug discovery platform that has come center stage for treatment of hematological malignancies. We present our novel and unique Protein Homeostatic Modulators (PHMsTM) - that promote ubiquitination and subsequent proteasomal degradation of known substrates as well as neosubstrates via Cereblon - as therapeutic candidates for acute myeloid leukemia (AML). Specifically, we report the discovery of two functionally and mechanistically distinct classes of Cereblon-mediated PHMsTM from phenotypic screens of our proprietary PHM®library. Unlike classical IMiDs, our oncology candidates, BTX508 and BTX1119 demonstrate significant cytotoxicity with IC50s in low-nanomolar range in a panel of AML cell lines. BTX508 is a purely cytotoxic compound that does not display immune modulatory activity. In contrast, BTX1119 is not only cytotoxic, but is also immunomodulatory in that it inhibits inflammatory cytokines such as IL-1β, IL-6 and TNF-α as well as induces IL-2, an indicator of T cell activation. BTX1119's immune modulatory activity is a 100-fold more potent when compared to Pomalidomide. The distinct functional activities exhibited by BTX508 and BTX1119 is a result of strategically engineered substrate degradation profiles. Importantly, BTX508 and BTX1119 exhibit a large safety window wherein the concentrations at which they target AML cells do not affect normal healthy cells such as liver epithelial cells or lung fibroblasts. To further establish BTX508 as a clinical candidate for AML, we performed in vivo efficacy studies in the MV-4-11 human AML xenograft model using athymic nude mice. A single daily dose of BTX508 results in a significant reduction in tumor volume. BTX508 exhibits significant oral bioavailability, thus making it a promising clinical candidate for treatment of AML as well as other potential hematological malignancies. With regard to BTX1119, we believe that incorporation of both the potent cytotoxic and immunomodulatory properties into a single molecule holds great therapeutic promise; however, to evaluate the synergistic potential of this combination will require use of a humanized mouse model - this work is ongoing. Disclosures No relevant conflicts of interest to declare.
37
Barrio Garcia, Santiago, Umair Munawar, Thorsten Stuehmer, Hermann Einsele, and K. Martin Kortüm. "Molecular Resistance Mechanisms in Multiple Myeloma." Blood 132, Supplement 1 (November 29, 2018): 471. http://dx.doi.org/10.1182/blood-2018-99-118700.
Full textAbstract:
Abstract Mechanisms of drug resistance in Multiple Myeloma (MM) are poorly understood. Mutations and/or changes in the protein expression of the CRBN pathway and proteasome subunits have been identified to induce resistance to IMiDs and PIs. However, only few patients are affected by these alterations. To determine the specific genomic fingerprint of MM relapse we selected 57 MM patients from the CoMMpass trial (version IA11) that have genomic data of paired samples available (diagnosis/relapse). 35 of them have also sequential FISH-seq data. We focused on acquired mutations in first relapse and filtered all mutations and genetic alterations already present at diagnosis. Doing so, we found 1.274 mutations, representing an average of 23 new mutations/patient (range; 2-76). Of interest, 66% of the acquired mutations were present in a sub-clonal level (Variant read frequency (VRF) < 25%). Most common mutations include known hotspots of the RAS pathway (NRAS 12%, KRAS 7% and BRAF 4%). Notably, all 7 NRAS mutations in relapse were located at Q61K, suggesting a functional role of disease progression for this specific and known hotspot location. In total 5 of 35 cases (14%) with FISH-seq data developed a 17p13 deletion in relapse. Of these, three patients acquired a bi-allelic alteration in addition to a preexisting TP53 mutation and one developed a biallelic inactivation of TP53 (VRF = 100%), through parallel acquisition of del17p and TP53 mutation. Gain of 1q21 was observed in relapse in 5 of 35 (14%) cases, and one 1q gain was lost from diagnosis to relapse. Two cases (4%) presented mutations in IMiD treatment related genes, with two mutations in the CRBN pathway. One harbored a missense mutation in the Lenalidomide (LEN) degron sequence of IKZF3 (G159A) (VRF = 36%), known to be essential for the IMiD action in vitro, 45 months after continuous exposition to LEN . The other case presented two subclonal frameshift mutations in CUL4B (VRF = 5% and 32%), detected after more than three years of LEN containing therapy. We functionally validated in vitro LEN resistance through CRISPR/Cas9 knockout of CUL4B, suggesting a resistance inducing effect of the acquired CUL4B mutations. Six cases (11%) harbored acquired mutations in proteasome subunit genes (PSMC2, PSMC6, PSMD8, PSME4, PSMB9 (two mutations)), all of them had undergone prior proteasome inhibitor (PI) containing therapy. We validated earlier the 19S protein subunits PSMC6 and PSMC2 (KO and/or point mutations) as inducers of PI resistance in vitro, thus we hypothesize contribution to resistance induction / disease progression through these 19s mutations. Remarkably ubiquitin (E3, E2 and SUBs) and histone related genes (histones and histone methylases and deacetylases) were found mutated in 51% and 19% of the relapsed patients. Genes for drug transporters (ATP-binding cassette (ABC) and Solute Carrier (SLC) transporters) were hit in 32% of cases and genes for mucins (previously related with genotoxic agents and immunotherapy resistance) in 19%. Notably, RRBP1 presented 10 mutations in 6 patients (11%) with the mutations clustering within 30 amino-acids (aa) of exons 9 and 10 and 3 hotspots (2 patients each) in aa Q426P, K430R and Q436P. RRBP1 is involved in the binding of the ribosome to the endoplasmic reticulum (ER) and is related with the unfolded protein response and ER stress via GRP78. All the patients with RRBP1 mutations were pretreated with PI inhibitors and exhibited worst survival outcome affecting PFS (Pval<0.001) and OS (Pval=0.0016) in this limited dataset. The mutations were detected on average 433 days (range: 258-568) after diagnosis. Five of the 6 patients died on average 180 days after RRBP1 mutation detection (range: 18-446) further suggesting high risk features of such acquired mutations. In summary, we observe clonal selection of known high-risk related alterations like TP53 mutations, 17p deletions or 1q13 in early relapse data of the CoMMpass trial. Furthermore we identify RRBP1 mutations as a new acquired high-risk biomarker of MM. Alterations are specifically related to subclonal selection by therapy, thus we suggest that the definition of high-risk disease in MM needs to be revisited and should also include clonal selection processes under anti-tumor therapy. Figure. Figure. Disclosures No relevant conflicts of interest to declare.
38
Mallakpour, Shadpour, and Amin Zadehnazari. "A convenient strategy to functionalize carbon nanotubes with ascorbic acid and its effect on the physical and thermomechanical properties of poly(amide–imide) composites." Journal of Solid State Chemistry 211 (March 2014): 136–45. http://dx.doi.org/10.1016/j.jssc.2013.12.021.
Full text
39
Shimizu, Makoto, and Takafumi Nishi. "Double Nucleophilic Addition of Azide and Tetraallyltin to the Latent α,β-Unsaturated Aldehydes Using in situ Hydrolysis of the Imino Functionality Promoted by Tin(IV) Chloride Pentahydrate." Synlett, no. 5 (2004): 0889–91. http://dx.doi.org/10.1055/s-2004-820023.
Full text
40
Park, Sungmi, Benjamin J. Bivona, and Lisa M. Harrison-Bernard. "Lack of contribution of nitric oxide synthase to cholinergic vasodilation in murine renal afferent arterioles." American Journal of Physiology-Renal Physiology 314, no. 6 (June 1, 2018): F1197—F1204. http://dx.doi.org/10.1152/ajprenal.00433.2017.
Full textAbstract:
We have previously reported significant increases in neuronal nitric oxide synthase (NOS) immunostaining in renal arterioles of angiotensin type 1A receptor (AT1A) knockout mice, and in arterioles and macula densa cells of AT1A/AT1B knockout mice. The contribution of nitric oxide derived from endothelial and macula densa cells in the maintenance of afferent arteriolar tone and acetylcholine-induced vasodilation was functionally determined in kidneys of wild-type, AT1A, and AT1A/AT1B knockout mice. Acetylcholine-induced changes in arteriolar diameters of in vitro blood-perfused juxtamedullary nephrons were measured during control conditions, in the presence of the nonspecific NOS inhibitor, Nω-nitro-l-arginine methyl ester (NLA), or the highly selective neuronal NOS inhibitor, N5-(1-imino-3-butenyl)-l-ornithine (VNIO). Acetylcholine (0.1 mM) produced a significant vasoconstriction in afferent arterioles of AT1A/AT1B mice (−10.9 ± 5.1%) and no changes in afferent arteriolar diameters of AT1A knockout mice. NLA (0.01–1 mM) or VNIO (0.01–1 μM) induced significant dose-dependent vasoconstrictions (−19.8 ± 4.0% 1 mM NLA; −7.8 ± 3.5% 1 μM VNIO) in afferent arterioles of kidneys of wild-type mice. VNIO had no effect on afferent arteriole diameters of AT1A knockout or AT1A/AT1B knockout mice, suggesting nonfunctional neuronal nitric oxide synthase. These data indicate that acetylcholine produces a significant renal afferent arteriole vasodilation independently of nitric oxide synthases in wild-type mice. AT1A receptors are essential for the manifestation of renal afferent arteriole responses to neuronal nitric oxide synthase-mediated nitric oxide release.
41
Hepler, J. R., and T. K. Harden. "Guanine nucleotide-dependent pertussis-toxin-insensitive stimulation of inositol phosphate formation by carbachol in a membrane preparation from human astrocytoma cells." Biochemical Journal 239, no. 1 (October 1, 1986): 141–46. http://dx.doi.org/10.1042/bj2390141.
Full textAbstract:
The efficacy of muscarinic-receptor agonists for stimulation of inositol phosphate formation and Ca2+ mobilization in intact 1321N1 human astrocytoma cells is correlated with their capacity for formation of a GTP-sensitive high-affinity binding complex in membranes from these cells [Evans, Hepler, Masters, Brown & Harden (1985) Biochem. J. 232, 751-757]. These observations prompted the proposal that a guanine nucleotide regulatory protein serves to couple muscarinic receptors to the phospholipase C involved in phosphoinositide hydrolysis in 1321N1 cells. Inositol phosphate (InsP) formation was measured in a cell-free preparation from 1321N1 cells to provide direct support for this idea. The formation of InsP3, InsP2 and InsP1 was increased in a concentration-dependent manner (K0.5 approximately 5 microM) by guanosine 5′-[gamma-thio]triphosphate (GTP[S]) in washed membranes prepared from myo-[3H]inositol-prelabelled 1321N1 cells. Both GTP[S] and guanosine 5′-[beta gamma-imido]triphosphate (p[NH]ppG) stimulated InsP formation by 2-3-fold over control; GTP, GDP and GMP were much less efficacious. Millimolar concentrations of NaF also stimulated the formation of inositol phosphates in membrane preparations from 1321N1 cells. In the presence of 10 microM-GTP[S], the muscarinic cholinergic-receptor agonist carbachol stimulated (K0.5 approximately 10 microM) the formation of InsP above that achieved with GTP[S] alone. The effect of carbachol was completely blocked by atropine. The order of potency of nucleotides for stimulation of InsP formation in the presence of 500 microM-carbachol was GTP[S] greater than p[NH]ppG greater than GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate Gi (the inhibitory guanine nucleotide regulatory protein), had no effect on InsP formation in the presence of GTP[S] or GTP[S] plus carbachol. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not Gi is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells.
42
Aumann, Rudolf, Xiaolin Fu, Dominik Vogt, Roland Fröhlich, and Olga Kataeva. "Organic Syntheses via Transition Metal Complexes. 118.1Retro-Fischer Reaction Induced by a β-Imino Functionality of (Alkyl,ethoxy)carbene Complexes (M = W, Cr): Efficient Access toC-Enamino andN-Enamino Carbene Complexes." Organometallics 21, no. 13 (June 2002): 2736–42. http://dx.doi.org/10.1021/om0200499.
Full text
43
Al-Omran, Fatima, Mervat Mohammed Abdel Khalik, Adel Abou-Elkhair, and Mohammed Hilmy Elnagdi. "Studies With Functionally Substituted Heteroaromatics: A Novel Route for the Synthesis of 1-Aryl-6-oxopyridazinones, 1-Arylpyridazine-6-imines and 1-Aryl-6-imino-4-pyridazinals." Synthesis 1997, no. 01 (January 1997): 91–94. http://dx.doi.org/10.1055/s-1997-1512.
Full text
44
Zhang, S., J. D. McCarter, Y. Okamura-Oho, F. Yaghi, A. Hinek, S. G. Withers, and J. W. Callahan. "Kinetic mechanism and characterization of human β-galactosidase precursor secreted by permanently transfected Chinese hamster ovary cells." Biochemical Journal 304, no. 1 (November 15, 1994): 281–88. http://dx.doi.org/10.1042/bj3040281.
Full textAbstract:
Chinese hamster ovary cell clones permanently transfected with the cDNA for human lysosomal beta-galactosidase secrete the enzyme precursor into the cell medium, from which it is purified to apparent homogeneity in a single step by affinity chromatography. The purified precursor is fully active, displays the same pH optimum and Km values as the mature placental enzyme, and has an intact C-terminus. The intact enzyme when chromatographed on a Sephacryl S-200 molecular-sieve column elutes as a 105,500 Da monomer, whereas on SDS/PAGE gels the polypeptide migrates as an 88 kDa polypeptide. A time course of digestion with glycopeptide-N-glycanase shows the gradual conversion of the precursor from an 88 to a 72 kDa protein, suggesting the presence of five N-linked oligosaccharides in the protein. The precursor is readily taken up in a mannose-6-phosphate-dependent manner into beta-galactosidase-deficient, GM1-gangliosidosis fibroblasts, and the enzyme activity is returned to normal levels. We show that the stereochemical course of enzymic hydrolysis involves the retention of the beta-configuration at the anomeric centre, suggesting a double-displacement mechanism. Furthermore, the enzyme is rapidly and irreversibly inactivated in the presence of the mechanism-based inactivator 2,4-dinitrophenyl-2-deoxy-2-fluoro-beta-D-galactopyranoside, which implicates a covalent intermediate. The enzyme is also inactivated by 1-ethyl-3(3-dimethylamino-propyl)carbodi-imide and by phenylglyoxal, which implicates carboxylate and arginine residues respectively in the active site. We conclude that the beta-galactosidase precursor is functionally identical to the mature lysosomal form of the enzyme and serves as an excellent enzyme source for investigation of structure-function relationships in the protein.
45
Ammer, H., and R. Schulz. "Alterations in the expression of G-proteins and regulation of adenylate cyclase in human neuroblastoma SH-SY5Y cells chronically exposed to low-efficacy μ-opioids." Biochemical Journal 295, no. 1 (October 1, 1993): 263–71. http://dx.doi.org/10.1042/bj2950263.
Full textAbstract:
Western-blot analysis of human neuroblastoma SH-SY5Y cells (mu- and delta-receptors) revealed the presence of the following G-protein subunits: Gi alpha 1, Gi alpha 2, Gs alpha, G(o) alpha, Gz alpha, and G beta, a pattern resembling that observed in central nervous tissue. Chronic treatment of differentiated [all-trans-retinoic acid (10 microM; 6 days)] SH-SY5Y cells with D(-)-morphine (10 microM; 3 days) significantly increased the abundance of all G-protein subunits identified. Co-incubation of morphine-exposed cells together with naloxone (10 microM; 3 days) or the mu-selective opioid antagonist CTOP (10 microM; 3 days), but not with the delta-selective antagonist ICI-174,864 (10 microM; 3 days), completely abolished this effect, suggesting that the increase in G-protein abundance is specifically mediated by mu-receptors. Moreover, the biologically inactive enantiomer L(+)-morphine (10 microM; 3 days) failed to produce a similar effect. G-protein up-regulation developed in a time- and dose-dependent manner and is most likely due to enhanced protein synthesis de novo, since concomitant treatment of the cells with cycloheximide (100 micrograms/ml; 3 days) prevented this effect. Chronic treatment with the low-efficacy mu-selective opioid peptide morphiceptin (10 microM; 3 days), but not with the highly potent mu-agonist DAGO (0.1 microM; 3 days) produced a comparable increase in G-protein abundance. Coincident with quantitative effects on G-protein levels in morphine-tolerant/dependent SH-SY5Y cells, we found elevated levels of basal, forskolin (1 microM)- and prostaglandin-E1 (1 microM)-stimulated adenylate cyclase activities. Reconstitution experiments using S49 cyc- lymphoma-cell membranes suggest that this increase is most likely due to elevated levels of functionally intact Gs. Chronic treatment with both morphine and DAGO induces high degrees of tolerance in this cell line. However, the intrinsic activity of G1 was unchanged, as assessed in functional studies with low-nanomolar concentrations of guanosine 5′-[beta gamma- imido]triphosphate. Our data demonstrate that chronic treatment of SH-SY5Y cells with low-efficacy mu-opioids increases G-protein abundance, a phenomenon which might contribute to the biochemical mechanisms underlying opioid tolerance/dependence.
46
Potter, Lincoln R., and Tony Hunter. "A Constitutively “Phosphorylated” Guanylyl Cyclase-linked Atrial Natriuretic Peptide Receptor Mutant Is Resistant to Desensitization." Molecular Biology of the Cell 10, no. 6 (June 1999): 1811–20. http://dx.doi.org/10.1091/mbc.10.6.1811.
Full textAbstract:
Dephosphorylation of the natriuretic peptide receptor-A (NPR-A) is hypothesized to mediate its desensitization in response to atrial natriuretic peptide (ANP) binding. Recently, we identified six phosphorylation sites within the kinase homology domain of NPR-A and determined that the conversion of these residues to alanine abolished the ability of the receptor to be phosphorylated or to be activated by ANP and ATP. In an attempt to generate a form of NPR-A that mimics a fully phosphorylated receptor but that is resistant to dephosphorylation, we engineered a receptor variant (NPR-A-6E) containing glutamate substitutions at all six phosphorylation sites. Consistent with the known ability of negatively charged glutamate residues to substitute functionally, in some cases, for phosphorylated residues, we found that NPR-A-6E was activated 10-fold by ANP and ATP. As determined by guanylyl cyclase assays, the hormone-stimulated activity of the wild-type receptor declined over time in membrane preparations in vitro, and this loss was blocked by the serine/threonine protein phosphatase inhibitor microcystin. In contrast, the activity of NPR-A-6E was more linear with time and was unaffected by microcystin. The nonhydrolyzable ATP analogue adenosine 5′-(β,γ-imino)-triphosphate was half as effective as ATP in stimulating the wild-type receptor but was equally as potent in stimulating NPR-A-6E, suggesting that ATP is required to keep the wild-type but not 6E variant phosphorylated. Finally, the desensitization of NPR-A-6E in whole cells was markedly blunted compared with that of the wild-type receptor, consistent with its inability to shed the negative charge from its kinase homology domain via dephosphorylation. These data provide the first direct test of the requirement for dephosphorylation in guanylyl cyclase desensitization and they indicate that it is an essential component of this process.
47
AL-OMRAN, F., M. M. ABDEL KHALIK, A. ABOU-ELKHAIR, and M. H. ELNAGDI. "ChemInform Abstract: Studies with Functionally Substituted Heteroaromatics: A Novel Route for the Synthesis of 1-Aryl-6-oxopyridazinones, 1-Arylpyridazine-6- imines and 1-Aryl-6-imino-4-pyridazinals." ChemInform 28, no. 23 (August 3, 2010): no. http://dx.doi.org/10.1002/chin.199723182.
Full text
48
Neer, E. J., L. G. Wolf, and D. M. Gill. "The stimulatory guanine-nucleotide regulatory unit of adenylate cyclase from bovine cerebral cortex ADP-ribosylation and purification." Biochemical Journal 241, no. 2 (January 15, 1987): 325–36. http://dx.doi.org/10.1042/bj2410325.
Full textAbstract:
Hormonal stimulation of adenylate cyclase from bovine cerebral cortex is mediated by a guanine-nucleotide regulatory protein (Gs). This protein contains at least three polypeptides: a guanine nucleotide-binding alpha s component and a beta X gamma component, which modulates the function of alpha s. The alpha s component from many tissues can be ADP-ribosylated with cholera toxin, but has been unusually difficult to modify in brain. We have improved incorporation of ADP-ribose by including isonicotinic acid hydrazide to inhibit the potent NAD glycohydrolase activity of brain. ADP-ribosylation is further improved by addition of detergent to render the substrates accessible and 20 mM-EDTA to chelate metal ions. Although Mg2+ is absolutely required for activation of adenylate cyclase by the GTP analogue guanosine 5′-[beta gamma-imido]triphosphate (p[NH]ppG), it is not obligatory for p[NH]ppG-stimulated ADP-ribosylation by cholera toxin. Under these conditions, the ADP-ribosylation of brain membranes is not enhanced by a cytosolic protein. We find that there are two major sizes of brain alpha s, which we have named ‘alpha sL’, with an apparent Mr of 42,000-45,000, and ‘alpha sH’ with an apparent Mr of 46,000-51,000 depending on the gel-electrophoretic system used. The alpha sL and alpha sH components can incorporate different amounts of ADP-ribose depending on the reaction conditions, so that one or the other may appear to predominate. Thus we show that incomplete ADP-ribosylation by cholera toxin is not a good indication of the relative amounts of alpha s units. Functionally, however, both forms of alpha s appear to be similar. Both forms associate with the catalytic unit of adenylate cyclase, but neither of them does so preferentially. There is an excess of each of them over the amount associated with catalytic unit. We have now substantially purified Gs from brain by a modification of the method of Sternweis et al. [(1981) J. Biol. Chem. 256, 11517-11526] as well as by a new, simplified, procedure. On SDS/polyacrylamide-gel electrophoresis, the purified brain Gs contains both the 45 and 51 kDa alpha s polypeptides revealed by ADP-ribosylation and a beta X gamma component. Activation of purified alpha s by guanine nucleotides or fluoride can be reversed by addition of purified beta X gamma component. The activated form of purified brain Gs has an Mr of 49,000 as determined by hydrodynamic measurements, which is consistent with the idea that the active form of brain Gs is the dissociated one.
49
Hesterberg, Rebecca S., and Pearlie K. Epling-Burnette. "Genetic Ablation of Cereblon (CRBN) Increases Long-Lived Memory T Cells." Blood 126, no. 23 (December 3, 2015): 3440. http://dx.doi.org/10.1182/blood.v126.23.3440.3440.
Full textAbstract:
Background: Immunomodulatory drugs (IMiDs) consist of thalidomide and derivatives, pomalidomide and lenalidomide. IMiDs target the E3 ubiquitin ligase substrate receptor, cereblon (CRBN), which forms a complex with DDB1-Cul4A, to induce anti-proliferative effects in tumor cells and increase the activation of T cells. Using crbn deficient T-cells, we have shown that CRBN is a negative regulator of T cell activation in mice. Dynamic changes in the T-cell repertoire occur after thymic involution. With the reduction of thymic output with age, there is a loss of naïve T-cells in the peripheral blood, and the accumulation of a memory-like T-cell population that arises through homeostatic proliferation. In this study, we demonstrate the role of CRBN in peripheral homeostatic regulation during aging. Methods: In this study, C57BL6 crbn -/- mice were housed in pathogen-free conditions to limit foreign antigen exposure. Splenocytes were stained with T cell markers to define various memory populations from 3, 8, 10 and 13 month old crbn -/- and age-matched wild-type mice. Expression of CD8, CD44, CD127 (IL-7 receptor) and KLRG1 were determined by flow cytometry. CD44-CD127+ KLRG1- CD8+ T cells were considered naive in this analysis. Consistent with previous reports, CD44+ CD127+ KLRG1- T cells represent long-term memory T-cells while CD44+CD127-KLRG1+ T cells are effector memory cells. To better understand age-related changes in the thymus, the thymus was dissected and the absolute number of thymocytes was determined by trypan blue staining. Thymic subpopulations were defined using CD4 and CD8 as single positive, double positive, and double negative cells in 13 month old crbn -/- and WT mice. We further characterized double negative (DN) populations using CD44 and CD25 to define DN1, DN2, DN3, and DN4. Results: Splenocytes in 3 and 8 month old crbn -/- and WT mice have no significant differences in CD44+ memory cells, naïve cells (p=0.7850 and p=0.5061) or recently activated cells [CD69+ or CD25+]. Changes related to thymic involution in WT mice become evident at 10 months of age. Crbn -/- mice exhibit a similar percentage and absolute number of total memory cells (p=0.8194) at 10 months of age, as defined by CD44 expression. Evaluation of long-lived versus short-lived sub-populations of memory cells in these older mice showed that crbn deficiency is associated with significantly more CD44+ CD127+ KLRG1- CD8+ [long-lived] memory T cells compared to WT mice (p<0.001). Evaluation of the thymus revealed no difference in absolute numbers of thymocytes in younger mice. Moreover, crbn deficient mice have normal distribution of SP, DP, and DN populations, with only slight changes in DN1, DN2, DN3, and DN4 subpopulations. Absolute numbers of thymocytes, however, were significantly higher in the crbn -/- mice at 10 months of age compared to age-matched controls (p=0.0182). Conclusions: The fate of developing T cells is regulated by positive and negative selection in the thymus where the coordination and selection of self-tolerant repertoire is maintained. Age-related changes caused by thymic involution impacts the protective responses of these cells against foreign pathogens and tumor cells. Our data show that the genetic germline depletion of crbn leads to an increase in long-lived memory T cells in naturally aged animals. Universally in cancer patients, and especially in MDS, the lymphocyte compartment is characterized by premature age-related changes due possibly to reduction in lymphopoiesis at the stem cell level or due to chronic antigen stimulation. Given that the CD44+ CD127+ KLRG1- population is significantly higher in aged crbn -/- mice, these mice may be more resistant to viral infection and or development of malignancy. The mechanism responsible for this phenotypic difference could be due to cell intrinsic signaling or metabolic properties. However, a role for CRBN in thymic epithelial cells must also be considered given the use of germline deficient animals in this study. Taken together, we have demonstrated that ablation of crbn results in an increase in long-lived CD8+ T cells during aging, which suggests that targeting CRBN and/or treating with lenalidomide may functionally improve memory T cell capacity in the elderly. Disclosures No relevant conflicts of interest to declare.
50
Alb, Miriam, Jörg Tamihardja, Erdwine Klinker, Martin Schreder, Stefan Knop, Hermann Einsele, Thomas Hünig, Andreas Rosenwald, Michael Flentje, and Stephan Mielke. "Boost of Immune Responses Against NY-ESO-1 Following Local Radiation Therapy in Patients with Multiple Myeloma: A Potential Contribution to Tumor Immunosurveillance." Blood 128, no. 22 (December 2, 2016): 4512. http://dx.doi.org/10.1182/blood.v128.22.4512.4512.
Full textAbstract:
Abstract Introduction Local radiation therapy (RT) is commonly employed to treat bone lesions and/or extramedullary manifestations of multiple myeloma (MM) or solitary bone plasmacytoma (SBP). Besides providing sufficient control of local tumor growth, radiation therapy may also contribute to broader anti-tumor immunity by generating off-site cellular immune responses. Here, we put a focus on tumor-associated antigens (TAAs) well known for their expression in MM such as Wilms' Tumor Protein 1 (WT1), New York esophageal squamous cell carcinoma 1 (NY-ESO-1), human telomerase reverse transcriptase (hTERT), mucin 1 (MUC1), and preferentially expressed antigen of melanoma (PRAME) and assessed CD8-mediated immune responses before and during radiation. Methods We prospectively recruited HLA-A*02:01-positive patients with multiple myeloma or solitary plasmacytoma requiring local radiation therapy for bone and extramedullary lesions in this scientific, non-interventional study, supported by a grant of the Wilhelm Sander Foundation, Germany, and approved by our local ethical committee. All patients provided written informed consent. Immune responses against HLA-A*02:01-restricted peptides of WT1, NY-ESO-1, hTERT, MUC1, and PRAME were assessed at three different time points: prior to RT, end of RT and six to eight weeks after RT. CD8+ T lymphocytes were isolated from peripheral blood and stimulated with irradiated, peptide-pulsed T2 cells (174 x CEM.T2; ATCC® CRL-1992™). After extraction of total RNA, Interferon gamma (IFNγ) mRNA expression was analyzed by RT-qPCR. IFNγ mRNA levels were normalized to CD8 mRNA levels. IFNγ mRNA expression of cells stimulated with the irrelevant melanoma antigen Glycoprotein 100 (gp100) served as calibrator. An expression level of 2.0 or more as compared to gp100 was considered as a positive result. Furthermore, an intracellular cytokine staining assay to detect IFNγ release in peptide-stimulated cells was employed to confirm PCR results on a protein level. Peptide-pulsed T2 cells also served as targets in CD107a degranulation assays. Results To date, 19 patients including 16 MM and three SBP patients received fractionated local RT with or without concomitant systemic therapy. 13 patients were previously untreated; three patients received prior allogeneic and five prior autologous hematopoietic stem cell transplantation. At baseline, positive immune responses were frequently detected against NY-ESO-1 (10 out of 17 assessed patients; 58.8%) but interestingly not against hTERT, WT1, MUC1 or PRAME (see Figure). Consequently, baseline immune responses against NY-ESO-1 were significantly higher (p<0.001) as compared to all other TAAs investigated (Kruskal Wallis test). These median response levels against NY-ESO-1 further increased in the course of radiation therapy and were confirmed by flow cytometry on a protein level. The functionality and specificity of these responses could be demonstrated in degranulation assays suggesting the ability to deliver efficient anti-tumor immunity. Conclusions Immunity against NY-ESO-1 was preexisting in the majority of patients and was undergoing marked expansion under local radiotherapy. This phenomenon was not found for any other TAA investigated suggesting that NY-ESO-1 carries a unique immunogenicity justifying most recent attempts to employ NY-ESO-1 as a target for genetically engineered T lymphocytes. Finally, this tumor-specific immunity is likely to contribute to immunosurveillance of multiple myeloma additionally supported by immune modulatory drugs applied for treatment such as IMiDs and proteasome inhibitors. FIgure FIgure. Disclosures Knop: Takeda: Consultancy. Einsele:Celgene: Consultancy, Honoraria, Speakers Bureau; Janssen: Consultancy, Honoraria, Speakers Bureau; Novartis: Consultancy, Honoraria; Amgen: Consultancy, Honoraria, Speakers Bureau. Mielke:MSD: Consultancy, Other: Travel grants; Gilead: Other: Travel grants; Novartis: Consultancy; Celgene: Other: Travel grants, Speakers Bureau; JAZZ Pharma: Speakers Bureau.