Journal articles on the topic 'ID. Knowledge representation'

Cross-modal person re-identification (Re-ID) is critical for modern video surveillance systems. The key challenge is to align cross-modality representations conforming to semantic information present for a person and ignore background information. This work presents a novel convolutional neural network (CNN) based architecture designed to learn semantically aligned cross-modal visual and textual representations. The underlying building block, named AXM-Block, is a unified multi-layer network that dynamically exploits the multi-scale knowledge from both modalities and re-calibrates each modality according to shared semantics. To complement the convolutional design, contextual attention is applied in the text branch to manipulate long-term dependencies. Moreover, we propose a unique design to enhance visual part-based feature coherence and locality information. Our framework is novel in its ability to implicitly learn aligned semantics between modalities during the feature learning stage. The unified feature learning effectively utilizes textual data as a super-annotation signal for visual representation learning and automatically rejects irrelevant information. The entire AXM-Net is trained end-to-end on CUHK-PEDES data. We report results on two tasks, person search and cross-modal Re-ID. The AXM-Net outperforms the current state-of-the-art (SOTA) methods and achieves 64.44% Rank@1 on the CUHK-PEDES test set. It also outperforms by >10% for cross-viewpoint text-to-image Re-ID scenarios on CrossRe-ID and CUHK-SYSU datasets.

Existing person re-identification (Re-ID) methods mostly prepare all training data in advance, while real-world Re-ID data are inherently captured over time or from different locations, which requires a model to be incrementally generalised from sequential learning of piecemeal new data without forgetting what is already learned. In this work, we call this lifelong person Re-ID, characterised by solving a problem of unseen class identification subject to continuous new domain generalisation and adaptation with class imbalanced learning. We formulate a new Generalising without Forgetting method (GwFReID) for lifelong Re-ID and design a comprehensive learning objective that accounts for classification coherence, distribution coherence and representation coherence in a unified framework. This design helps to simultaneously learn new information, distil old knowledge and solve class imbalance, which enables GwFReID to incrementally improve model generalisation without catastrophic forgetting of what is already learned. Extensive experiments on eight Re-ID benchmarks, CIFAR-100 and ImageNet show the superiority of GwFReID over the state-of-the-art methods.

This paper considers the fragment ∃∀SO of second-order logic. Many interesting problems, such as conformant planning, can be naturally expressed as finite domain satisfiability problems of this logic. Such satisfiability problems are computationally hard (ΣP2) and many of these problems are often solved approximately. In this paper, we develop a general approximative method, i.e., a sound but incomplete method, for solving ∃∀SO satisfiability problems. We use a syntactic representation of a constraint propagation method for first-order logic to transform such an ∃∀SO satisfiability problem to an ∃SO(ID) satisfiability problem (second-order logic, extended with inductive definitions). The finite domain satisfiability problem for the latter language is in NP and can be handled by several existing solvers. Inductive definitions are a powerful knowledge representation tool, and this moti- vates us to also approximate ∃∀SO(ID) problems. In order to do this, we first show how to perform propagation on such inductive definitions. Next, we use this to approximate ∃∀SO(ID) satisfiability problems. All this provides a general theoretical framework for a number of approximative methods in the literature. Moreover, we also show how we can use this framework for solving practical useful problems, such as conformant planning, in an effective way.

"The knowledge of children with a mild intellectual disability (ID) is less complex and poorer than that of their peers in the intellectual norm (IN). The aim of this study was to characterize knowledge about anger in children with mild intellectual disabilities. The study used the authoring tool to measure children’s knowledge of emotions, including anger. This tool facilitated the exploration of the cognitive representation of the basic emotions available in three codes (which perform the functions of perception, expression, and understanding) and the interconnections between them. Children in the intellectual norm (N = 30) and children with mild intellectual disabilities (N = 30) participated in the study. The results mainly indicated differences in how anger was understood by particular groups, to the detriment of children with a disability. The results were largely determined by the child’s level of organization of knowledge about anger and accompanying mental operations. "

Facebook is an online platform where people form a self-presentation and construct an identity through a personal ID or profile. Use of this social website fully depicts the norms and perceptions of patriarchal society. This study aims to explore the waymen of society speaks to the women as well as the speaking of women with other women that reflects an idea of women in Pakistani society on Facebook through quantitative study. The Analysis revealed that the women, in Pakistani society in particular and elsewhere in general is linguistically expressed as a being that is not equal to men in intellect, bodily strength, wisdom, knowledge, forbearance and bravery thus dubbed as timid, weak, sexy, fool, cute hot and so on by society as a whole.

AbstractWe introduce fixpoint definitions, a rule-based reformulation of fixpoint constructs. The logic FO(FD), an extension of classical logic with fixpoint definitions, is defined. We illustrate the relation between FO(FD) and FO(ID), which is developed as an integration of two knowledge representation paradigms. The satisfiability problem for FO(FD) is investigated by first reducing FO(FD) to difference logic and then using solvers for difference logic. These reductions are evaluated in the computation of models for FO(FD) theories representing fairness conditions and we provide potential applications of FO(FD).

For good performance, most existing electrocardiogram (ECG) identification methods still need to adopt a denoising process to remove noise interference beforehand. This specific signal preprocessing technique requires great efforts for algorithm engineering and is usually complicated and time-consuming. To more conveniently remove the influence of noise interference and realize accurate identification, a novel temporal-frequency autoencoding based method is proposed. In particular, the raw data is firstly transformed into the wavelet domain, where multi-level time-frequency representation is achieved. Then, a prior knowledge-based feature selection is proposed and applied to the transformed data to discard noise components and retain identity-related information simultaneously. Afterward, the stacked sparse autoencoder is introduced to learn intrinsic discriminative features from the selected data, and Softmax classifier is used to perform the identification task. The effectiveness of the proposed method is evaluated on two public databases, namely, ECG-ID and Massachusetts Institute of Technology-Biotechnology arrhythmia (MIT-BIH-AHA) databases. Experimental results show that our method can achieve high multiple-heartbeat identification accuracies of 98.87%, 92.3%, and 96.82% on raw ECG signals which are from the ECG-ID (Two-recording), ECG-ID (All-recording), and MIT-BIH-AHA database, respectively, indicating that our method can provide an efficient way for ECG biometric identification.

Intelligent learning diagnosis is a critical engine of intelligent tutoring systems, which aims to estimate learners’ current knowledge mastery status and predict their future learning performance. The significant challenge with traditional learning diagnosis methods is the inability to balance diagnostic accuracy and interpretability. Although the existing psychometric-based learning diagnosis methods provide some domain interpretation through cognitive parameters, they have insufficient modeling capability with a shallow structure for large-scale learning data. While the deep learning-based learning diagnosis methods have improved the accuracy of learning performance prediction, their inherent black-box properties lead to a lack of interpretability, making their results untrustworthy for educational applications. To settle the abovementioned problem, the proposed unified interpretable intelligent learning diagnosis framework, which benefits from the powerful representation learning ability of deep learning and the interpretability of psychometrics, achieves a better performance of learning prediction and provides interpretability from three aspects: cognitive parameters, learner-resource response network, and weights of self-attention mechanism. Within the proposed framework, this paper presents a two-channel learning diagnosis mechanism LDM-ID as well as a three-channel learning diagnosis mechanism LDM-HMI. Experiments on two real-world datasets and a simulation dataset show that our method has higher accuracy in predicting learners’ performances compared with the state-of-the-art models and can provide valuable educational interpretability for applications such as precise learning resource recommendation and personalized learning tutoring in intelligent tutoring systems.

The learning materials are knowledge, behavior, and competence that students must learn to achieve the established standards of competence. A learning method is used as lesson materials presented to students in the class, both individually and in groups. These are essential learning components to discuss, for the right learning methods will make it easier for students to receive the given learning materials. It aims to know the material's content and the methods of learning Nahwu book Qawa 'id Al-Asasiyyah Li Al-Lughah Al-Arabiyyah. The study is a library study (library research), a descriptive-analytical nature, Focusing on the aspects of selection, graduations, presentations, and repetitions in the material presented. The study's result is that the book Qawa 'id Al-Asasiyyah Li Al-Lughah Al-Arabiyyah uses deductive methods in its Nahwu learning methods. From the selection aspect, the book's vocabulary has a purpose to Apply Nahwu to Arabic verse, verse The Quran, and specific themed readings. From the gradations' aspect, in the gradations aspect typology of straight gradations, only a few subchapters use varying shades. As for the aspect of the presentation, the learning representation aspects more on an I 'rab analysis on a fair reading text of a manuscript, a magazine newspaper, a Qur 'an, and so on. Then on the aspect of the rehearsal, using a matter of evaluation tools. There is a supplement of I 'rab to reinforce the subject of qawa'id. Keywords:The learning materials, Nahwu learning method, Book Qawa 'id Al-Asasiyyah Li Al-LughahAl-Arabiyyah. Abstrak Materi pembelajaran merupakan pengetahuan, perilaku, dan kemahiran yang harus dipelajari oleh siswa untuk mencapai standar kompetensi yang ditetapkan. Metode pembelajaran dimanfaatkan guru sebagai alat penyajian materi pelajaran kepada siswa di dalam kelas baik secara individu maupun kelompok. Dua hal tersebut merupakan komponen pembelajaran yang penting untuk dibahas, karena metode pembelajaran yang tepat akan memudahkan siswa dalam menerima materi pembelajaran yang diberikan. Penelitian ini bertujuan untuk mengetahui isi materi dan metode pembelajaran Nahwu kitab Qawa’id al-Asasiyyah li al-Lughah al-‘Arabiyyah. Jenis penelitian adalah kajian pustaka (library research) yang bersifat deskriptif – analitis, dengan fokus kajian pada aspek seleksi, gradasi, presentasi dan repetisi dalam penyajian materi. Hasil dari penelitian ini adalah bahwa kitab Qawa’id al-Asasiyyah li al-Lughah al-‘Arabiyyah menggunakan metode deduktif (qiyasi) dalam metode pembelajaran Nahwunya. Dari aspek seleksi, kosakata kitab memiliki tujuan untuk mengaplikasikan ilmu Nahwu pada syair Arab, ayat Al-Qur’an dan bacaan bertema tertentu. Dari aspek gradasi, secara umum kitab ini menggunakan tipologi gradasi lurus, hanya pada beberapa sub bab menggunakan gradasi putar. Sedangkan dari aspek presentasi, strategi pembelajaran yang digunakan pada kitab lebih berfokus pada analisis i’rab pada sebuah teks bacaan baik berupa naskah, koran majalah, Al-Qur’an, dan lain lain. Kemudian pada aspek repetisi, menggunakan alat evaluasi yang berupa soal-soal dan latihan. Selain berupa soal dan latihan, ada suplemen berupa i’rab untuk menguatkan materi tentang qawa’id. Kata kunci: Materi, Metode Pembelajaran Nahwu, Kitab Qawa’id al-Asasiyyah li al-Lughah al-‘Arabiyyah.

The finger vein recognition system uses blood vessels inside the finger of an individual for identity verification. The public is in favor of a finger vein recognition system over conventional passwords or ID cards as the biometric technology is harder to forge, misplace, and share. In this study, the histogram of oriented gradients (HOG) features, which are robust against changes in illumination and position, are extracted from the finger vein for personal recognition. To further increase the amount of information that can be used for recognition, different instances of the finger vein, ranging from the index, middle, and ring finger are combined to form a multi-instance finger vein representation. This fusion approach is preferred since it can be performed without requiring additional sensors or feature extractors. To combine different instances of finger vein effectively, score level fusion is adopted to allow greater compatibility among the wide range of matches. Towards this end, two methods are proposed: Bayesian optimized support vector machine (SVM) score fusion (BSSF) and Bayesian optimized SVM based fusion (BSBF). The fusion results are incrementally improved by optimizing the hyperparameters of the HOG feature, SVM matcher, and the weighted sum of score level fusion using the Bayesian optimization approach. This is considered a kind of knowledge-based approach that takes into account the previous optimization attempts or trials to determine the next optimization trial, making it an efficient optimizer. By using stratified cross-validation in the training process, the proposed method is able to achieve the lowest EER of 0.48% and 0.22% for the SDUMLA-HMT dataset and UTFVP dataset, respectively.

For researchers, early childhood educators, and art educators, the contribution of this article is to expand meaning in drawing activities. Perspective in reading pictures using visual culture theory, especially visual grammar. This study aims to share knowledge and experiences in reading early childhood pictures from different perspectives. This research method uses a qualitative descriptive approach through visual material data collection techniques and analysis of three metafunctions. The objects of research are three pictures of children aged 7-8 years, namely the works of winners of the I-III children's painting competition held by PP-IPTEK TMII in 2018. Aspects of the representation structure, interaction system, and composition of each image are analyzed. The research findings conclude that the ideational function of the three images shows a narrative structure of representation and raises the discourse of resistance to the actual situation. The interpersonal function of the three images places the image maker in the real world and as an object of display impersonally. The textual functions of the three images position social life on other planets as a reflection of hope for real social life.Keywords: children's drawings, visual culture, visual system, three metafunctions References: Butler, S., Gross, J., & Hayne, H. (1995). The Effect of Drawing on Memory Performance in Young Children. Developmental Psychology, 12. https://doi.org/10.1037/0012-1649.31.4.597 Creswell, J. W. (2015). Educational research: Planning, conducting, and evaluating quantitative and qualitative research (Fifth edition). Pearson. de Lautour, N. (2020). The Visual Arts and Children’s Thinking and Theorising in Early Childhood. Www.Elp.Co. Nz/Articles, 13. Driessnack, M., & Furukawa, R. (2012). Arts-based data collection techniques used in child research. Journal for Specialists in Pediatric Nursing, 17(1), 3–9. https://doi.org/10.1111/j.1744-6155.2011.00304.x Elliot W, E., & D. Day, M. (2004). Handbook of Research and Policy in Art Education (1st Edition). Routledge. Everts, H., & Withers, R. (2006). A Practitioner Survey of Interactive Drawing Therapy as Used in New Zealand. 16. Freedman, K. J., & Stuhr, P. L. (2004). Curriculum Change for the 21st Century: Visual Culture in Art Education. Funch, B. S. (1996). The aesthetic experience as a transcendent phenomenon. Nordisk Psykologi, 48(4), 266–278. https://doi.org/10.1080/00291463.1996.11863884 Gernhardt, A., Rübeling, H., & Keller, H. (2013). “This Is My Family”: Differences in Children’s Family Drawings Across Cultures. Journal of Cross-Cultural Psychology, 44(7), 1166–1183. https://doi.org/10.1177/0022022113478658 Hirsh-Pasek, K., Zosh, J. M., Golinkoff, R. M., Gray, J. H., Robb, M. B., & Kaufman, J. (2015). Putting Education in “Educational” Apps: Lessons from the Science of Learning. Psychological Science in the Public Interest, 16(1), 3–34. https://doi.org/10.1177/1529100615569721 Hwang, G.-J., Lai, C.-L., & Wang, S.-Y. (2015). Seamless flipped learning: A mobile technology-enhanced flipped classroom with effective learning strategies. Journal of Computers in Education, 2(4), 449–473. https://doi.org/10.1007/s40692-015-0043-0 Jolley, R. P. (2009). Children and Pictures: Drawing and Understanding. Wiley. https://books.google.co.id/books?id=QpGS9s9zqMoC Kellogg, R. (1973). Misunderstanding Children’s Art. Art Education, 26(6), 7–9. https://doi.org/10.1080/00043125.1973.11652137 Knight, L. (2008). Communication and Transformation through Collaboration: Rethinking Drawing Activities in Early Childhood. Contemporary Issues in Early Childhood, 9(4), 306–316. https://doi.org/10.2304/ciec.2008.9.4.306 Kress, G. R., van Leeuwen, T., & Van Leeuwen, D. H. S. S. T. (1996). Reading Images: The Grammar of Visual Design. Routledge. https://books.google.co.id/books?id=vh07i06q-9AC Kucirkova, N. (2017). IRPD—A framework for guiding design-based research for iPad apps. British Journal of Educational Technology, 48(2), 598–610. https://doi.org/10.1111/bjet.12389 Lowenfeld, V. (1949). Creative and Mental Growth. Macmillan. https://books.google.co.id/books?id=x7tRAQAAMAAJ Mamur, N. (2012). The Effect of Modern Visual Culture on Children’s Drawings. Procedia - Social and Behavioral Sciences, 47, 277–283. https://doi.org/10.1016/j.sbspro.2012.06.651 Moerdisuroso, I. (2017). Social Semiotics and Visual Grammar: A Contemporary Approach to Visual Text Research. International Journal of Creative and Arts Studies, 1(1), 80. https://doi.org/10.24821/ijcas.v1i1.1574 Nielsen, A. M. (2012). Forskeres arbejde med oplevelser af børns tegninger som forskningsmetode [The researcher’s work with children’s experiences of drawing as a research method]. Psyke & Logos. Papadakis, S., & Kalogianakis, M. (2020). A Research Synthesis of the Real Value of Self-Proclaimed Mobile Educational Applications for Young Children. In Mobile Learning Applications in Early Childhood Education (pp. 1–19). IGI Global. https://doi.org/10.4018/978-1-7998-1486-3.ch001 Quaglia, R., Longobardi, C., Iotti, N. O., & Prino, L. E. (2015). A new theory on children’s drawings: Analyzing the role of emotion and movement in graphical development. Infant Behavior and Development, 39, 81–91. https://doi.org/10.1016/j.infbeh.2015.02.009 Santrock, J. W. (2011). Educational Psychology. McGraw-Hill Medical Publishing. https://books.google.co.id/books?id=M8S4kgEACAAJ Vygotski, L. S. (2004). Imagination and Creativity in Childhood. Journal of Russian & East European Psychology, 42(1), 7–97. https://doi.org/10.1080/10610405.2004.11059210

Significant language development differences occur in preschoolers, resolving these differences is a key objective of preschool education because young children's language abilities at the start of school, particularly their vocabulary abilities, are a strong predictor of later academic ability. Storytelling is one of the methods used to teach English, it makes the learning environment more interesting, energetic, and conversational. This study aims to examine storytelling in increasing children's vocabulary. The research method is a case study that uses observation, interviews, and documentation as data collection tools. The participants are an English teacher and seven children aged 4-5 years. Although, many early childhoods English teachers state that one of the weaknesses of children in learning English is a lack of vocabulary mastery because it can hamper the learning process. The findings show that storytelling is effective in increasing children's vocabulary. Vocabulary is the foundation for improving children's ability to speak English, both orally and in writing. Second language vocabulary is important to learn and develop for the quality of early childhood learners in language education. Keywords: early childhood, vocabulary, storytelling References: Agosto, D. E. (2016). Why Storytelling Matters: Unveiling the Literacy Benefits of Storytelling. Children and Libraries, 14(2), 21. https://doi.org/10.5860/cal.14n2.21 Chubb, J., Missaoui, S., Concannon, S., Maloney, L., & Walker, J. A. (2022). Interactive Storytelling for Children: A Case-Study of Design and Development Considerations for Ethical Conversational AI. Int. J. Child-Comp. Interact., 32(C). https://doi.org/10.1016/j.ijcci.2021.100403 Dewi, E. N. F., Hasanah, N., & Nurul, M. F. (2022). Enhancing Students’ Vocabulary Through Story Telling. EDULEC JOURNAL: Education, Language, and Culture. Egan, K. (1989). Teaching as Story Telling: An Alternative Approach to Teaching and Curriculum in the Elementary School. University of Chicago Press. https://books.google.com.mt/books?id=zNdLGAPzQT8C Ekawati, A. D. (2022). The Implementation of Total Physical Response (TPR) to Improve Student’s English Vocabulary During Pandemic. English Journal, 16(1). Fadli, M. R. (2021). Understand the design of qualitative research methods. humanics, [Memahami desain metode penelitian kualitatif]. Humanika, 21(1). Isik, M. A. (2016). The Impact of Storytelling on Young Ages. European Journal of Language and Literature Studies Articles, 2, 3. Kaur, A., Young, D., & Kirkpatrick, R. (2016). English Education Policy in Thailand: Why the Poor Results? In R. Kirkpatrick (Ed.), English Language Education Policy in Asia (Vol. 11, pp. 345–361). Springer International Publishing. https://doi.org/10.1007/978-3-319-22464-0_16 Khudhair, N. K., & Alnoori, B. S. M. (2017). Investigating EFL Preparatory School Teachers’ Perceptions Toward Using Storytelling Technique. Route Educational and Social Science Journal, 4(6). Kristiawan, D., Ferdiansyah, S., & Picard, M. (2022). Promoting Vocabulary Building, Learning Motivation, and Cultural Identity Representation through Digital Storytelling for Young Indonesian Learners of English as a Foreign Language. Ling, N. S., & Abdul Aziz, A. (2022). The Effectiveness of Game-based Learning Strategies on Primary ESL Learners’ Vocabulary Learning. International Journal of Academic Research in Progressive Education and Development, 11(2), Pages 845-860. https://doi.org/10.6007/IJARPED/v11-i2/13266 Malik, H., Humaira, M. A., Komari, A. N., Fathurrochman, I., & Jayanto, I. (2021). Identification of barriers and challenges to teaching English at an early age in Indonesia: An international publication analysis study. Linguistics and Culture Review, 5(1), 217–229. https://doi.org/10.21744/lingcure.v5n1.1485 McKay, P., & Guse, J. (2007). Five-Minute Activities for Young Learners. Cambridge University Press. https://books.google.co.id/books?id=BWKXLgrSv6gC Mufida, A., & Abidin, M. R. (2021). Designing a Board Game as a Media for Learning English for Children Aged 6-10 Years [Perancangan Board Game Sebagai Media Pembelajaran Bahasa Inggris Anak Usia 6-10 Tahun]. Jurnal Barik, 2(3). https://ejournal.unesa.ac.id/index.php/JDKV/ Noom-ura, S. (2013). English-Teaching Problems in Thailand and Thai Teachers’ Professional Development Needs. English Language Teaching, 6(11), p139. https://doi.org/10.5539/elt.v6n11p139 Pertiwi, A. B., Rahmawati, A., & Hafidah, R. (2021). English Vocabulary Learning Methods in Early Childhood [Metode Pembelajaran Kosakata Bahasa Inggris Pada Anak Usia Dini]. Kumara Cendekia, 9(2), 95. https://doi.org/10.20961/kc.v9i2.49037 Rahiem, M. D. H. (2021). Storytelling in early childhood education: Time to go digital. International Journal of Child Care and Education Policy, 15(1), 4. https://doi.org/10.1186/s40723-021-00081-x Stargatt, J., Bhar, S., Bhowmik, J., & Al Mahmud, A. (2022). Digital Storytelling for Health-Related Outcomes in Older Adults: Systematic Review. J Med Internet Res, 24(1), e28113. https://doi.org/10.2196/28113 Sunyakul, N., & Teo, A. (2020). Primary School English Teachers’ Application of Knowledge/Skills from Boot Camp to Their Classroom Teaching Practices and Factors Hindering Their Application. 13(1). Tarigan, H. G. (1986). Menulis sebagai suatu keterampilan berbahasa. Angkasa. https://books.google.co.id/books?id=XXoBtwAACAAJ Thornbury, S. (2002). How to teach vocabulary. Pearson educational. https://books.google.co.id/books?id=5qLkoAEACAAJ Udaya, M. (2022). Using Semantic Maps as A Teaching Strategy for Vocabulary Development. European Journal of English Language Teaching, 6(5). https://doi.org/10.46827/ejel.v6i5.4095 Zu, Y., Cheng, Z., Sun, Q., & Zhao, H. (2021). On the Problems and Countermeasures in English Vocabulary Teaching in Junior Middle Schools. 568.

Person re-identification, or simply re-id, is the task of identifying again a person who has been seen in the past by a perception system. Multiple robotic applications, such as tracking or navigate-and-seek, use re-identification systems to perform their tasks. To solve the re-id problem, a common practice consists in using a gallery with relevant information about the people already observed. The construction of this gallery is a costly process, typically performed offline and only once because of the problems associated with labeling and storing new data as they arrive in the system. The resulting galleries from this process are static and do not acquire new knowledge from the scene, which is a limitation of the current re-id systems to work for open-world applications. Different from previous work, we overcome this limitation by presenting an unsupervised approach to automatically identify new people and incrementally build a gallery for open-world re-id that adapts prior knowledge with new information on a continuous basis. Our approach performs a comparison between the current person models and new unlabeled data to dynamically expand the gallery with new identities. We process the incoming information to maintain a small representative model of each person by exploiting concepts of information theory. The uncertainty and diversity of the new samples are analyzed to define which ones should be incorporated into the gallery. Experimental evaluation in challenging benchmarks includes an ablation study of the proposed framework, the assessment of different data selection algorithms that demonstrate the benefits of our approach, and a comparative analysis of the obtained results with other unsupervised and semi-supervised re-id methods.

Dental treatment for anxious or fearful intellectually disabled children/adolescents (IDCA) may present great challenges, due to deficits in cognitive, intellectual, language, and social abilities, in conjunction with limited adaptive behavior. In many cases, it is necessary for the Dentist to implement advanced behavioral control techniques. Inclusive Dentistry (ID) considers profoundly each patient’s individual interests and likes, including the social and family situations, for choosing the respective personalized plan –contemplating potential risks and benefits– for the behavior control, in order to obtain the maximal possible cooperation of the patient in the dental chair. Through ID, the Pediatric Dental Practitioner aims to alleviate the anxiety and fear of IDCA in the clinical setting, in such a way that these patients are positively motivated, on a long-term basis, for current and future oral care, both at the dental office and at home. This management approach may be a time-consuming method or require more effort by the dentist, but it reaps benefits when applied for many mild-to-moderate (and some severe) IDCA. The Practitioner must possess the knowledge, in-depth understanding, and professional training for the adequate use of ID during the behavioral management of anxious or fearful IDCA. The aim of the present report was to describe four representative clinical cases of IDCA at our Clinic, managed under the philosophical principles of ID.

Abstract Background Antibiotic stewardship continues to be health concern that physicians often acknowledge, but whose real-life practices do not reflect that awareness. There is a wide range of opinions on the efficacy of the type of modality that is most effective to teach stewardship. Our project addresses resident needs specifically, with coverage in four topics—proper antibiotic dosing, IV to PO transitioning, duplicate coverage, and antibiotic time outs. Methods Categorical Internal Medicine residents in PGY 1-3 were sent an optional 48-question Likert survey querying needs in the above four topics. Results General Demographics. Resident response was 35%, with equal representation from all PGY years. Over half reported no ID or stewardship elective exposure and 74% agreed they could benefit from further education on stewardship (Figure 1). Proper Dosing Educational Needs. Of residents, 68% reported feeling confident about where to find information on dosing antibiotics for a given condition/organism (Figure 2a), but only 37% were comfortable with establishing an initial dose. When a range was suggested, 55% of respondents admitted to at least “sometimes, often, or always” choosing the highest suggested dose by default. IV to PO transition. Residents preferred (76%) and used (89%) IV antibiotics by default in an inpatient setting. Nearly 45% of respondents reported “sometimes or rarely” feeling comfortable in making an IV to PO transition, and 40% “often or always” avoid PO transition until discharge (Figure 2b). Duplicate Coverage. Over 70% of residents reported they “sometimes, rarely, or never” felt confident in stopping double coverage themselves when started by the primary team (Figure 3a). Antibiotic Time Out. Only 17% of respondents had heard of an antibiotic timeout, and only 8% have ever used one (Fig.3b); 80% of residents had no structured way to review usage and 53% reported “sometimes or often” forgetting about assessing for de-escalation daily. Figure 1. Resident Demographics Our anonymous, optional survey attracted a 35% response rate from the categorical residents at our suburban program spread over two tertiary hospitals with >1200 beds total. Most had not received prior training in infectious disease or stewardship, yet most recognized antibiotic overuse and resistance as a major, ongoing problem. Figure 2. Resident responses on proper dosing and IV to PO questions. (A) Residents appear most uncomfortable with initial antibiotic dosing and seeking additional sources for best dosage when commonly used sources suggest a range of possible doses. (B) Majority of residents preferred and used IV antibiotics, and commonly transitioned to PO only at patient discharge. Some residents reported discomfort with establishing equivalent IV to PO transition dosages. Figure 3. Resident responses to questions regarding duplication of therapy and antibiotic time outs. (A) Though many could and had recognized duplication of therapy on the wards, several participants reported at least some discomfort in independently stopping double coverage. (B) Most residents had not heard of or utilized an antibiotic time-out or any other structured method to re-assess their antibiotic use on daily rounds. As such, 41% of respondents admitted they would likely just continue initial, broad-spectrum therapy. Conclusion Our analysis aimed to establish resident educational needs in four major topics in stewardship. Gaps in knowledge include timing transition from IV to PO, initial antibiotic dosing, stopping double-coverage, and lack of awareness of timeouts. This needs assessment will be used to build an antibiotic stewardship curriculum for IM residents. Disclosures All Authors: No reported disclosures

AbstractObjectivesTo identify aetiological factors in anaemia and to explore knowledge, perceptions and attitudes towards anaemia.DesignTwo cross-sectional surveys and sixteen focus group discussions.SettingThe two regions with the highest prevalence of anaemia in Tunisia, Greater Tunis (GT) and the South West (SW).SubjectsTwo representative samples of 687 (GT) and 729 (SW) women of reproductive age; 108 women were included in focus group discussions.ResultsAmong anaemic women, 63·4 % in the GT region and 80·2 % in the SW displayed iron deficiency (ID). Genetic haemoglobinopathies accounted for 10·0 % and 3·6 % of the cases of anaemia in the two regions, respectively. After adjustment for confounders, the major factors for iron-deficiency anaemia were low dietary Fe intake (OR = 5·0, 95 % CI 3·0, 8·4), drinking tea after eating (OR = 3·4, 95 % CI 2·0, 5·7) and pica (OR = 2·1, 95 % CI 1·1, 3·9). Most of the women related anaemia to the following causes: malnutrition, lack of hygiene, and their heavy workload and responsibilities in the household. Many women connected anaemia with hypotension. Few established a relationship between ID and anaemia. They had confidence in their doctor for treatment, but many complained they were not given sufficient information. Low dietary Fe intake, inappropriate food practices and inadequate perceptions contribute to the aetiology of anaemia in women.ConclusionsThese results point out to the need for a strategy combining food fortification, Fe supplementation for pregnant women, nutritional education for the general public and at-risk specific target groups, and training of health professionals.

ObjectivesTo understand the influence of the white coat on patient satisfaction, opinions about medical clothing, perception about confidence, empathy and medical knowledge and the satisfaction and comfort level of physicians in consultation.SettingAn interventional study was conducted with a representative sample of the population attending primary care in central Portugal.ParticipantsThe sample was composed by 286 patients divided into two groups exposed or not to a doctor wearing a white coat. The first and last patients in consultation every day for 10 consecutive days were included.InterventionsEvery other day the volunteer physicians consulted with or without the use of a white coat. At the end of the consultation, a questionnaire was distributed to the patient with simple questions with a Likert scale response, the Portuguese version of the ‘Trust in physician’ scale and the Jefferson Scale of Patient Perceptions of Physician Empathy - Portuguese Version (JSPPPE-VP scale). A questionnaire was also distributed to the physician.OutcomesPlanned and measured primary outcomes were patient satisfaction, trust and perception about empathy and secondary outcomes were opinion about medical clothing, satisfaction and comfort level of physicians in consultation.ResultsThe sample was homogeneous in terms of sociodemographic variables. There were no statistically significant differences between the groups in terms of satisfaction, trust, empathy and knowledge perceived by the patients. There were differences in the opinion of the patients about the white coat, and when the physician was wearing the white coat this group of patients tended to think that this was the only acceptable attire for the physician (p<0.001). But when the family physician was in consultation without the white coat, this group of patients tended to agree that communication was easier (p=0.001).ConclusionsThere was no significant impact of the white coat in patient satisfaction, empathy and confidence in the family physician.Trial registration numberClinicalTrials.gov ID number: NCT03965416.

This article describes how sequential data modeling is a relevant task in Cybersecurity. Sequences are attributed temporal characteristics either explicitly or implicitly. Recurrent neural networks (RNNs) are a subset of artificial neural networks (ANNs) which have appeared as a powerful, principle approach to learn dynamic temporal behaviors in an arbitrary length of large-scale sequence data. Furthermore, stacked recurrent neural networks (S-RNNs) have the potential to learn complex temporal behaviors quickly, including sparse representations. To leverage this, the authors model network traffic as a time series, particularly transmission control protocol / internet protocol (TCP/IP) packets in a predefined time range with a supervised learning method, using millions of known good and bad network connections. To find out the best architecture, the authors complete a comprehensive review of various RNN architectures with its network parameters and network structures. Ideally, as a test bed, they use the existing benchmark Defense Advanced Research Projects Agency / Knowledge Discovery and Data Mining (DARPA) / (KDD) Cup ‘99' intrusion detection (ID) contest data set to show the efficacy of these various RNN architectures. All the experiments of deep learning architectures are run up to 1000 epochs with a learning rate in the range [0.01-0.5] on a GPU-enabled TensorFlow and experiments of traditional machine learning algorithms are done using Scikit-learn. Experiments of families of RNN architecture achieved a low false positive rate in comparison to the traditional machine learning classifiers. The primary reason is that RNN architectures are able to store information for long-term dependencies over time-lags and to adjust with successive connection sequence information. In addition, the effectiveness of RNN architectures are shown for the UNSW-NB15 data set.

At present, two viruses affecting kiwifruit (Actinidia spp.), Actinidia virus A (AcVA) and Actinidia virus B (AcVB), both belonging to the genus Vitivirus in the family Betaflexiviridae, have been reported from New Zealand (2). The infected trees showed leaf vein chlorosis, flecking, and ringspots. China is the largest commercial kiwifruit producer. During field investigations in the growing season of 2013, symptoms of leaf chlorosis or ringspots, similar to those caused by AcVA and AcVB (1), were observed on some kiwifruit (Actinidia chinensis) plants in Hubei Province in the central China. Leaf samples were collected from three symptomatic and two symptomless plants of two A. chinensis cultivars. Total nucleic acids were extracted from the samples using a CTAB-based protocol described by Li et al. (3) and used as template in RT-PCR for the detection of AcVA and AcVB. Each virus was detected using two sets of primers reported by Blouin et al. (1). Primer sets AcVA 1F/1R and AcVA5F/5R were used for the AcVA detection, and AcVB1F/1R and AcVB5F/Viti3'R were used for the AcVB detection. AcVA was detected in three symptomatic plants (ID: Ac-HN-1, Ac-HN-3, and Ac-HN-5), and AcVB was detected in two symptomatic plants (ID: Ac-HN-1 and Ac-HN-3) and in one symptomless plant (ID: Ac-HN-2). Neither virus was detected in the second symptomless plant (ID: Ac-HN-4). Samples Ac-HN-1 and Ac-HN-3 had mixed infection of AcVA and AcVB, and sample Ac-HN-2 had the latent infection of AcVB. The sequenced 283-bp RT-PCR amplicons of the replicase-encoding gene from AcVA isolates AC-HN-3 and AC-HN-5 using AcVA1F/1R shared 90.8% nucleotide (nt) identity with the corresponding sequence of the New Zealand AcVA isolate (GenBank Accession No. JN427014.1). The 269-bp fragments of the RNA-binding protein-encoding gene obtained by using AcVA5F/5R shared 85.5 to 85.9% nt identities with the corresponding sequence of JN427014.1. The AcVB5F/Viti3'R products of 365 to 369 bp from three AcVB isolates shared 85.5 to 88.6% nt identities with the corresponding sequence of the New Zealand AcVB isolate. The representative sequences were submitted to GenBank with accession numbers KJ696776 and KJ696777 for the 269-bp fragments of AcVA-HN-1 and AcVA-HN-3, and KJ696778 and KJ696779 for the 365-bp and 369-bp fragments of AcVB-HN-1 and AcVB-HN-2, respectively. In addition, 12 and 14 out of 42 kiwi samples (excluding HN-1 to HN-5) collected randomly were positive for AcVA and AcVB as detected by RT-PCR. Meanwhile, the sample affected by AcVA-HN-5 was subjected to deep sequencing of the small RNAs (sRNAs) for complete survey of the infecting viruses. De novo assembly of sRNAs generated four sequence contigs, with lengths ranging from 161 to 285 nt, matching to ORFs 1 to 3 of the genome of the New Zealand AcVA isolate with significant nucleotide (91 to 95%) and amino acid (80 to 94%) similarities, and some other contigs from a new virus (unpublished). The result further confirmed AcVA infection in the kiwi plant. To our knowledge, this is the first report of both AcVA and AcVB outside of New Zealand. The Chinese isolates of the two viruses are distinct from those reported from New Zealand. The results provide valuable information for improving the viral sanitary status of the kiwifruit germplasm in China. References: (1) A. G. Blouin et al. Arch. Virol. 157:713, 2012. (2) A. G. Blouin et al. J. Plant Pathol. 95:221, 2013. (3) R. Li et al. J. Virol. Methods 154:48, 2008.

IntroductionAdolescence is a sensitive life stage during which tobacco, alcohol and cannabis are used as ways to learn and adopt roles. There is a great deal of interest in substance use (SU) prevention programmes for young people that work to change representations of these products and help with mobilisation of life skills. Unfortunately, few existing programmes are evidence-based.In France, a programme called Expériences Animées (EA, Animated Experiences) has been developed, inspired by life skills development programmes that have been proven to be successful. The EA programme uses animated short movies and talks with high school and secondary school pupils about the use of psychoactive substances and addictions. By allowing life skills mobilisation and modifying representations and beliefs about SU, it is aimed at delaying initiation of use of psychoactive substances, preventing adolescents from becoming regular consumers, reducing the risks and harms related to the use of these substances and opening the way for adapted support measures.We are interested in understanding how, under what circumstances, through which mechanisms and among which adolescents the EA programme works. Therefore, we have developed the ERIEAS study (‘Evaluation Réaliste de l’Intervention Expériences Animées en milieu Scolaire’; Realist Evaluation of the EA Intervention in Schools).Methods and analysisEA will be conducted in 10 schools. A multi-case approach will be adopted with the aim of developing and adjusting an intervention theory. The study comes under the theory-driven evaluation framework. The investigation methodology will include four stages: (i) elaboration of a middle-range theory; (ii) data collection for validating/adjusting the theory; (iii) data analysis; and (iv) refinement and adjustment of the middle-range theory and definition of the programme’s key functions.Ethics and disseminationThe study will provide evidence-based results to health authorities to help in the rollout of health promotion strategies in schools. It will provide knowledge about the strategic configurations most suitable for leading to life skills mobilisation and change young people’s representations about SU. The project will be carried out with full respect of current relevant legislation (eg, the Charter of Fundamental Rights of the European Union) and international conventions (eg, Helsinki Declaration). It follows the relevant French legislation of the research category on interventional research protocol involving the human person. The protocol was approved by the Comité et Protection des Personnes (CPP), that is, Committee for the Protection of Persons CPP SUD-EST VI n°: AU 1525 and was reported to the Agence Française de Sécurité Sanitaire des Produits de Santé (ANSM) that is, the French National Agency for the Safety of Health Products. It is in conformity with reference methodology MR003 of Bordeaux University Hospital (CNIL n° 2 026 779 v0).Trial registration detailsThis research has been registered on ClinicalTrials.gov (No. NCT04110626).The research project is registered in the European database ID-RCB (No. 2019-A01003-54).

IntroductionAntimicrobial resistance is a significant worldwide problem largely driven by selective pressure exerted through antibiotic use. Preserving antibiotics requires identification of opportunities to safely reduce prescriptions, for example in the management of mild common infections in the community. However, more information is needed on how infections are usually managed and what proportion lead to consultation and antibiotic use. The aim of this study is to quantify consultation and prescribing patterns in the community for a range of common acute infection syndromes (respiratory, gastrointestinal, skin/soft tissue, mouth/dental, eye and urinary tract). This will inform development of interventions to improve antibiotic stewardship as part of a larger programme of work, Preserving Antibiotics through Safe Stewardship.Methods and analysisThis will be an online prospective community cohort study in England. We will invite 19 510 adults who previously took part in a nationally representative survey (the Health Survey for England) and consented to be contacted about future studies. Adults will also be asked to register their children. Data collection will consist of a baseline registration survey followed by weekly surveys sent by email for 6 months. Weekly surveys will collect information on symptoms of common infections, healthcare-seeking behaviour and use of treatments including antibiotics. We will calculate the proportions of infection syndromes that lead to General Practitioner consultation and antibiotic prescription. We will investigate how healthcare-seeking and treatment behaviours vary by demographics, social deprivation, infection profiles and knowledge and attitudes towards antibiotics, and will apply behavioural theory to investigate barriers and enablers to these behaviours.Ethics and disseminationThis study has been given ethical approval by the University College London Research Ethics Committee (ID 11813/001). Each participant will provide informed consent upon registration. We will disseminate our work through publication in peer-reviewed academic journals. Anonymised data will be made available through the UK Data Service (https://www.ukdataservice.ac.uk/).

Introduction: Living donor kidney transplantation is the preferred method of treating kidney failure. The donor agrees to undergo an elective procedure for the benefit of the recipient. Aim: To assess the attitude toward living kidney donation and to investigate the factors that contribute to kidney donation willingness. Methods: A cross-sectional study was carried out between December 2020 and February 2021. The study covered a representative group of 953 Poles aged 18−77, living in all Polish voivodships. The relationship between sociodemographic factors, personal values (Personal Values List), the total score of life satisfaction (Satisfaction with Life Scale) and the willingness to donate a kidney to another human was assessed using a logistic regression model. Results: The most frequently chosen personal values were: good health; physical and mental fitness; love and friendship; knowledge and wisdom. The most frequently chosen symbols of happiness were: good health, successful family life, being needed by others. The median satisfaction with life for the entire group was 20 [16; 24]. Voluntary donation of a kidney to another human being i.e., family, friends, strangers were more often declared by women (OR = 1.21; Cl95%: 1.03−1.42), for whom the most important symbol of happiness was a life full of adventures, travels (OR = 1.39; Cl95%: 1.06−1.82) and the most important personal value was goodness and tenderness (OR = 1.21; Cl95%: 1.05−1.40). Total scores of The Satisfaction with Life Scale correlated positively with the willingness to voluntarily donate a kidney (OR = 1.03; Cl95%: 1.003−1.06), while age correlated negatively (OR = 0.99; Cl95%: 0.98−0.99). Conclusions: Respondents who declare their willingness to be a living kidney donor are mainly female, for which the most important symbol of happiness is a life full of adventures and travel, and the most important values are personal goodness and tenderness. The desire to donate a kidney to another person decreases with age and grows with life satisfaction. Trial registration: ClinicalTrials.gov (ID: NCT04789122).

In the late summer and early winter of 2008 and 2009, leaf and shoot blight and cankers with reddish and brownish necrotic tissue on mature branches of Cotoneaster horizontalis were investigated in landscape areas of Konya province in Turkey. Disease incidence was estimated at 2%. Bacteria were consistently isolated from the lesions on leaves and shoots on nutrient sucrose agar medium. Twelve representative bacterial strains were isolated and characterized as gram-negative, rod-shaped, mucoid, fermentative, yellow-orange on MS medium, positive for levan formation and acetoin production, no growth at 36°C, positive for gelatin hydrolysis, and negative for indole, urease, oxidase, arginine dehydrolase, reduction of nitrate, and acid production from lactose and inositol (2). Two reference strains of Erwinia amylovora (EaP28 and NCPPB 2791) obtained from the culture collection unit of Selcuk University were used as positive controls. All strains induced a hypersensitive response in tobacco (Nicotiana tobaccum cv. White Burley). All strains were identified as E. amylovora on the basis of amplification of a 1 kb DNA fragment with a species-specific primer set, A/B (1) by PCR, and fatty acid methyl ester profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE) with similarity indices ranging from of 83 to 96%. Pathogenicity tests were performed by injecting 20 μl of a bacterial suspension (108 CFU ml–1) into the shoot tips of 3-year-old C. horizontalis seedlings. Leaf and shoot blighting symptoms were observed within 10 to 15 days, but no symptoms were observed on control plants treated with sterile water. The bacterium was reisolated from the lesions on leaves and shoots and identified as described above. To our knowledge, this is the first report of E. amylovora on cotoneaster in Turkey. Control measures are needed to prevent any further spread of the bacterium to new landscape areas. References: (1) S. Bereswill et al. Appl. Environ. Microbiol. 58:3522, 1992. (2) A. L. Jones and K. Geider. Page 40 in: Laboratory Guide for Identification of Plant Pathological Bacteria, 2001.

In late winter and spring of 2006 and 2008, leaf spots with yellow halos were observed on dwarf schefflera (Schefflera arboricola cvs. Gold Capella, Trinette, and Green Gold) that were grown as potted plants in two commercial ornamental greenhouses in Adana and Mersin, Turkey. Average disease incidence was assessed as 10% during the term of the study. Isolations were made from leaf spots symptoms on King's medium B. Bacteria consistently isolated from diseased tissues formed green fluorescent colonies on the medium. Ten representative bacterial strains were examined and found to be gram negative, rod shaped, and aerobic, levan, pectolytic, and arginine dihydrolase negative, and oxidase positive. They all induced a hypersensitive response in tobacco (Nicotiana tabacum cv. Samsun). All strains were identified as Pseudomonas cichorii with similarity indices of 79 to 99% based on fatty acid methyl ester (FAME) profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE). Pathogenicity of the strains was confirmed on five dwarf schefflera plants by leaf tissue infiltration with bacterial suspensions (107 CFU ml–1) in sterile distilled water. P. cichorii NCPPB 3802 and sterile water were used as positive and negative controls, respectively. The same symptoms as those observed in the commercial greenhouses were observed on dwarf schefflera leaves within 12 to 15 days after inoculation. The bacteria were reisolated from the inoculated plants and identified as the same as the original strain by conventional tests and FAME analysis. Negative control plants remained disease free. Occurrence of bacterial leaf spot caused by P. cichorii on vegetable crops in Turkey (1,3) and dwarf schefflera in other countries (2) has been reported previously, but to our knowledge, this is the first report of the observation of P. cichorii on dwarf schefflera in Turkey. References: (1) Y. Aysan et al. Plant Pathol. 52:782. 2003. (2) A. R. Chase and D. D. Brunk. Plant Dis. 68:73, 1984. (3) F. Sahin et al. Acta Hortic. 695:93, 2005.

Leaf lesions and root rot symptoms typical of soybean sudden death syndrome (SDS) caused by Fusarium virguliforme O'Donnell & T. Aoki were observed in commercial soybeans (Glycine max (L.) Merr.) in southern Michigan. Leaf symptoms ranged from chlorotic spots to severe interveinal chlorosis and necrosis, no foliar pathogens were noted. In 2008, isolates were collected from Berrien and St. Joseph counties. In 2009, isolates were collected from Cass, St. Joseph, Van Buren, Allegan, and Monroe counties. Pieces of roots with root rot symptoms were washed prior to surface disinfestation with 70% ethanol for 30 s and 0.5% NaOCl for 1 min and incubated on water agar (WA) in petri plates amended with 50 μg/ml of chloramphenicol for the production of sporodochia. Alternatively, spores were collected directly from nondisinfested roots expressing blue sporodochia. Single-spore cultures were derived by streaking macroconidia with a bacterial loop onto 3% WA + chloramphenicol and incubated overnight. With a dissecting microscope, single germinated macroconidia were collected with a sterile 0.2-mm-diameter insect pin and transferred to potato dextrose agar (PDA). Cultures on PDA grew slowly and developed blue-to-purple masses of sporodochia typical of F. virguliforme descriptions and similar to a representative isolate, Mont-1, grown alongside (1,2). Size of macroconidia from the six representative isolates, one from each county (including isolates derived from surface-disinfested and nondisinfested roots), and Mont-1 were determined to be within the range for F. virguliforme (42 to 56 × 5 to 6 μm), with an average of four septa per macroconidia. Identity of the representative isolates was confirmed by partial DNA sequencing of both strands of the internal transcribed spacer (ITS) region of the ribosomal RNA gene, translation elongation factor 1-α, and β-tubulin loci. All six representative isolates were identical in each of the three loci and matched with 100% similarity F. virguliforme accessions in GenBank and Fusarium-ID database searches, except for the β-tubulin locus in which a single nucleotide insertion was noted (Accession Nos. HM453328–HM453330). Sequences were 98 to 99% similar to other SDS Fusarium spp. not yet recorded in the United States. Koch's postulates were performed in the greenhouse according to Malvick and Bussey (3). Infested sorghum seed (~20 g) was placed 2 cm below soybean seed of susceptible cv. Williams 82 in plastic pots. Noninfested sorghum seed was used as a negative control and sorghum infested with Mont-1 as a positive control. Chlorotic spots developed 2 weeks after establishing the trial, and 3 to 4 weeks postinoculation, severe SDS symptoms of foliar interveinal chlorosis and necrosis and severe root rot developed. Koch's postulates were completed by reisolating F. virguliforme from a subset of infected plants. In addition, an isolate of F. virguliforme collected in 2008 was used to inoculate a 2009 field trial in East Lansing, MI with no history of SDS. Typical SDS symptoms developed in the field trial and F. virguliforme was isolated from a symptomatic plant that was identified as described above. Despite being reported across the majority of soybean-producing states, to our knowledge, this is the first confirmation and distribution report for SDS in Michigan. References: (1) T. Aoki et al. Mycoscience 46:162, 2005. (2) G. L. Hartman et al. Plant Dis. 81:515, 1997. (3) D. K. Malvick and K. E. Bussey. Can. J. Plant Pathol. 30:467, 2008.

Loving the environment is a character that must be instilled in children from an early age. This study aims to describe how efforts to instil love for the environment in preschool. This research uses a collaboration action research method with the intervention of providing information and motivation about the importance of environmental education for ECE educators. The participants were the ECE community represented by eleven ECE teachers in the Tangerang, Sawangan Bogor, Medan, and Batam areas. Data collection was carried out by focus group discussions and interviews as well as the delivery of information related to learning and environmental literacy for children through online meetings. Content analysis was used to interpret the data in this study. The findings of this study indicate that the provision of information and motivation to eleven ECE teachers can make the eleven teachers form the spirit and knowledge of teachers to develop learning and teaching environmental literacy in early childhood classes. The teachers are also trying to green the school environment by planting trees and making various learning activities with the children to get to know and love the environment better. Keywords: ECE educators training, environmental literacy, environmental education References: Bryman, A. (2021). Social Research Methods. Oxford University Press. https://books.google.co.id/books?id=kDZwzgEACAAJ Burdette, H. L., & Whitaker, R. C. (2005). Resurrecting Free Play in Young Children: Looking Beyond Fitness and Fatness to Attention, Affiliation, and Affect. Archives of Pediatrics & Adolescent Medicine, 159(1), 46–50. https://doi.org/10.1001/archpedi.159.1.46 Chu, H., Lee, E. A., Ryung Ko, H., Hee Shin, D., Nam Lee, M., Mee Min, B., & Hee Kang, K. (2007). Korean Year 3 Children’s Environmental Literacy: A prerequisite for a Korean environmental education curriculum. International Journal of Science Education, 29(6), 731–746. https://doi.org/10.1080/09500690600823532 Corraliza, J., Universidad Autónoma de Madrid., Collado, S., & Universidad de Zaragoza. (2019). Ecological Awareness and Children’s Environmental Experience. Papeles Del Psicólogo - Psychologist Papers, 40(2). https://doi.org/10.23923/pap.psicol2019.2896 Dada, D. O., Eames, C., & Calder, N. (2017). Impact of Environmental Education on Beginning Preservice Teachers’ Environmental Literacy. Australian Journal of Environmental Education, 33(3), 201–222. Cambridge Core. https://doi.org/10.1017/aee.2017.27 Denzin, N. K., & Lincoln, Y. S. (2012). Collecting and Interpreting Qualitative Materials. SAGE Publications. https://books.google.me/books?id=5Z8gAQAAQBAJ Disinger, J. F., & Roth, C. E. (1992). Environmental education research news. Environmentalist, 12(3), 165–168. https://doi.org/10.1007/BF01267599 Ernst, J., & Burcak, F. (2019). Young Children’s Contributions to Sustainability: The Influence of Nature Play on Curiosity, Executive Function Skills, Creative Thinking, and Resilience. Sustainability, 11(15). https://doi.org/10.3390/su11154212 Eugenio-Gozalbo, M., Aragón, L., & Ortega-Cubero, I. (2020). Gardens as Science Learning Contexts Across Educational Stages: Learning Assessment Based on Students’ Graphic Representations. Frontiers in Psychology, 11. https://www.frontiersin.org/articles/10.3389/fpsyg.2020.02226 Evans, G. W., Otto, S., & Kaiser, F. G. (2018). Childhood Origins of Young Adult Environmental Behavior. Psychological Science, 29(5), 679–687. https://doi.org/10.1177/0956797617741894 Ewert, A., Place, G., & Sibthorp, Ji. (2005). Early-Life Outdoor Experiences and an Individual’s Environmental Attitudes. Leisure Sciences, 27(3), 225–239. https://doi.org/10.1080/01490400590930853 Friedman, S., Masterson, M. L., Wright, B. L., Bredekamp, S., & Willer, B. (2021). Developmentally Appropriate Practice in Early Childhood Programs Serving Children from Birth Through Age 8, Fourth Edition (Fully Revised and Updated). National Association for the Education of Young Children. https://books.google.co.id/books?id=Kb-vzQEACAAJ Gifford, R., & Nilsson, A. (2014). Personal and social factors that influence pro-environmental concern and behaviour: A review. International Journal of Psychology, 49(3), 141–157. https://doi.org/10.1002/ijop.12034 Jørgensen, K.-A. (2016). Bringing the jellyfish home: Environmental consciousness and ‘sense of wonder’ in young children’s encounters with natural landscapes and places. Environmental Education Research, 22(8), 1139–1157. https://doi.org/10.1080/13504622.2015.1068277 Kaiser, F. G., Brügger, A., Hartig, T., Bogner, F. X., & Gutscher, H. (2014). Appreciation of nature and appreciation of environmental protection: How stable are these attitudes and which comes first? European Review of Applied Psychology-Revue Europeenne De Psychologie Appliquee, 64, 269–277. Kaya, V., & Elster, D. (2019). A Critical Consideration of Environmental Literacy: Concepts, Contexts, and Competencies. Sustainability, 11(6), 1581. https://doi.org/10.3390/su11061581 Kidman, G., & Casinader, N. (2019). Developing Teachers’ Environmental Literacy through Inquiry-based Practices. EURASIA Journal of Mathematics, Science and Technology Education, 15(6). https://doi.org/10.29333/ejmste/103065 Kim, G., Vaswani, R. T., Kang, W., Nam, M., & Lee, D. (2017). Enhancing Ecoliteracy through Traditional Ecological Knowledge in Proverbs. Sustainability, 9(7). https://doi.org/10.3390/su9071182 Larimore, R. (2016). Defining Nature-Based Preschools. The International Journal of Early Childhood Environmental Education, 4(1), 5. Lincoln, Y. S., Guba, E. G., & Publishing, S. (1985). Naturalistic Inquiry. SAGE Publications. https://books.google.co.id/books?id=2oA9aWlNeooC López-Alcarria, A., Gutiérrez-Pérez, J., & Poza-Vilches, F. (2014). Preschool Education Professionals as Mediators of Environmental Health Education. 6th International Conference on Intercultural Education “Education and Health: From a Transcultural Perspective", 132, 639–646. https://doi.org/10.1016/j.sbspro.2014.04.366 Miles, M. B., Huberman, A. M., & Saldaña, J. (2014). Qualitative data analysis: A methods sourcebook (Third edition). SAGE Publications, Inc. Mills, G. E. (2011). Action Research: A Guide for the Teacher Researcher. Pearson. https://books.google.co.id/books?id=-d1XAAAAYAAJ Olgan, R., & Kahri̇Man-Öztürk, D. (2011). An Investigation in the Playgrounds of Public and Private Preschools in Ankara. Education and Science, 36(161), 13. Otto, S., Evans, G. W., Moon, M. J., & Kaiser, F. G. (2019). The development of children’s environmental attitude and behavior. Global Environmental Change, 58, 101947. https://doi.org/10.1016/j.gloenvcha.2019.101947 Otto, S., Kaiser, F. G., & Arnold, O. (2014). The Critical Challenge of Climate Change for Psychology. European Psychologist, 19(2), 96–106. https://doi.org/10.1027/1016-9040/a000182 Pe’er, S., Goldman, D., & Yavetz, B. (2007). Environmental Literacy in Teacher Training: Attitudes, Knowledge, and Environmental Behavior of Beginning Students. The Journal of Environmental Education, 39(1), 45–59. https://doi.org/10.3200/JOEE.39.1.45-59 Phillipson-Mower, T., & Adams, A. D. (2010). Environmental Education Service-Learning in Science Teacher Education. In A. M. Bodzin, B. Shiner Klein, & S. Weaver (Eds.), The Inclusion of Environmental Education in Science Teacher Education (pp. 65–79). Springer Netherlands. https://doi.org/10.1007/978-90-481-9222-9_5 Rosa, C. D., Profice, C. C., & Collado, S. (2018). Nature Experiences and Adults’ Self-Reported Pro-environmental Behaviors: The Role of Connectedness to Nature and Childhood Nature Experiences. Frontiers in Psychology, 9. https://www.frontiersin.org/articles/10.3389/fpsyg.2018.01055 Roth, C. E. (1992). Environmental Literacy: Its Roots, Evolution and Directions in the 1990s. ERIC/CSMEE Publications. https://books.google.co.id/books?id=8ZA6HQAACAAJ Schutte, A. R., Torquati, J. C., & Beattie, H. L. (2017). Impact of Urban Nature on Executive Functioning in Early and Middle Childhood. Environment and Behavior, 49(1), 3–30. https://doi.org/10.1177/0013916515603095 Shallcross, T., O’Loan, K., & Hui, D. (2000). Developing a School Focused Approach to Continuing Professional Development in Sustainability Education. Environmental Education Research, 6(4), 363–382. https://doi.org/10.1080/713664694 Spano, G., D’Este, M., Giannico, V., Carrus, G., Elia, M., Lafortezza, R., Panno, A., & Sanesi, G. (2020). Are Community Gardening and Horticultural Interventions Beneficial for Psychosocial Well-Being? A Meta-Analysis. International Journal of Environmental Research and Public Health, 17(10). https://doi.org/10.3390/ijerph17103584 Ulrich Müller, Viviene A. Temple, Beverly Smith, Kimberly Kerns, Kayla Ten Eycke, Jeff Crane, & John Sheehan. (2017). Effects of Nature Kindergarten Attendance on Children’s Functioning. Children, Youth and Environments, 27(2), 47–69. JSTOR. https://doi.org/10.7721/chilyoutenvi.27.2.0047 Veisi, H., Lacy, M., Mafakheri, S., & Razaghi, F. (2019). Assessing environmental literacy of university students: A case study of Shahid Beheshti University in Iran. Applied Environmental Education & Communication, 18(1), 25–42. https://doi.org/10.1080/1533015X.2018.1431163 Wals, A. E. J., & Benavot, A. (2017). Can we meet the sustainability challenges? The role of education and lifelong learning. European Journal of Education, 52(4), 404–413. https://doi.org/10.1111/ejed.12250 Wilson, R. A. (1996). Environmental Education Programs for Preschool Children. The Journal of Environmental Education, 27(4), 28–33. https://doi.org/10.1080/00958964.1996.9941473

Multiple annual cankers were observed on the upper main stems of bitternut hickory (Carya cordiformis) exhibiting top dieback in Indiana, Iowa, Minnesota, New York, Ohio, and Wisconsin during a 2006 to 2008 survey of declining hickory. The top-killed trees had normal-sized, green leaves below and the cankers were oval, sunken, and bounded by heavy callus that seemed to arrest further canker expansion. Fusarium solani was consistently isolated from the margins of inner bark lesions or discolored sapwood of the cankers. When cultured on potato dextrose agar, the isolates grew rapidly with abundant aerial mycelium. On carnation leaf agar, thick-walled macroconidia with 4 to 5 septa were produced in cream, blue-green, or blue sporodochia. Macroconidia were generally cylindrical with a blunt or rounded apical cell and a rounded or foot-shaped basal cell. Microconidia were oval to kidney shaped with 0 to 1 septa and were produced in false heads on elongate monophialides. Chlamydospores were formed singly or in pairs. These morphological characteristics are consistent with descriptions of F. solani (2). The identities of 42 representative isolates were confirmed by sequencing the translation elongation factor (tef) 1-α gene. BLAST analysis of the sequences from each isolate against the GenBank and FUSARIUM-ID database found 98 to 100% similarities to F. solani isolates (GenBank Accession Nos. DQ246841, DQ247025, DQ247282, and DQ247436 and FUSARIUM-ID isolate FD01041). Two haplotypes (BB and BC) were distinguished based on the tef 1-α gene sequences that differed by 10 bp. Pathogenicity tests were conducted with two isolates of each haplotype on asymptomatic C. cordiformis (12 to 21 cm in diameter) in forest stands. In May 2009 in Wabasha County, MN, 0.1-ml spore suspensions (1 × 104 macroconidia/ml) or sterile water was placed in one of three holes (0.6 cm in diameter) drilled to the cambium of 12 trees. The holes were sealed with moist cotton and moldable putty. A duplicate trial, but with BB and BC isolates from Wisconsin, was initiated in Chippewa County, WI in June 2009. The extent of inner bark necrosis was assessed 13 months after inoculation in both sites. Inoculations with F. solani in Minnesota resulted in inner bark lesions with average lengths of 20 and 30 mm for the BB and BC haplotypes, respectively. In Wisconsin, BB and BC haplotypes caused inner bark lesions with average lengths of 34 and 38 mm, respectively. While sunken or open cankers were found for all the BC isolate inoculations, relatively small and callus-bounded cankers were found for BB isolate inoculations. All control wounds were callus-closed with average wound lengths of 12 and 23 mm in Minnesota and Wisconsin, respectively. The same haplotype of F. solani used for inoculation was recovered from each canker as confirmed by analysis of tef 1-α gene sequences. F. solani was not obtained from control wounds. To our knowledge, this is the first report of a canker caused by F. solani on bitternut hickory (1). The same fungus has been previously reported to cause cankers on stems of other hardwood tree genera in the eastern United States and Canada. We hypothesize that numerous main-stem cankers caused by F. solani lead to top dieback of bitternut hickory. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006.

During 2008 and 2009, a new disease on blackberry (Rubus fruticosus cv. Chester) causing leaf and shoot blight and cankers with brown discoloration of necrotic tissues on mature branches was observed in Isparta and Konya provinces of Turkey. Disease incidence was estimated to be 4% for the two years. Isolations were made from lesions on leaves and shoots on nutrient sucrose agar (NSA) medium. Bacteria consistently isolated from the diseased tissues were identified on the basis of biochemical, physiological (2), and molecular tests (1). Eleven representative bacterial strains were gram-negative, rod-shaped, mucoid, fermentative, yellow-orange on Miller and Scroth (MS) medium, positive for levan formation and acetoin production, no growth at 36°C, positive for gelatin hydrolysis, and negative for esculin hydrolysis, indole, urease, catalase, oxidase, arginine dehydrolase, reduction of nitrate, acid production from lactose, and inositol. Two reference strains of Erwinia amylovora (EaP28 and NCPPB 2791) obtained from the culture collection unit of Selcuk University were used as positive controls. All strains induced a hypersensitive response in tobacco (Nicotiana tobaccum cv White Burley) 24 h after inoculation with a 108 CFU/ml bacterial suspension in water. All strains were identified as E. amylovora using the species-specific primers set A/B (1), which amplified a 1-kb DNA fragment in PCR, and fatty acid methyl ester (FAME) profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE) with similarity indices ranging from of 79 to 99%. Pathogenicity was confirmed by injecting bacterial suspensions (108 CFU/ml–1) in sterile distilled water into the shoot tips of 2-year-old R. fruticosus cv. Chester and the first blighting symptoms were observed on leaves within 3 days and also 10 days later after inoculation on shoots. Sterile distilled water was used as a negative control. No symptoms were observed on control plants. All tests were repeated three times. The bacterium was reisolated from inoculated plants and identified as. E. amylovora. To our knowledge, this is the first report of E. amylovora on blackberry in Turkey. Phytosanitary measures are needed to prevent any further spread of the bacterium to new blackberry areas. References: (1) S. Bereswill et al. App. Environ. Microbiol. 58:3522, 1992. (2) A. L. Jones and K. Geider. Lab. Guide for Identification of Plant Pathological Bacteria, 40, 2001.

Citrus is an important crop in Tunisia and over 98% of trees of all varieties are grafted on sour orange rootstock. Since September 2010, unusual wilt symptoms have been observed in Takilsa, Bni-Khaled, and Manzel Bouzalfa fields that eventually caused tree death. The disease was observed on 10- to 25-year-old trees of sweet orange (Citrus sinensis) ‘Washington Navel’ and on ‘Clementine’ tangerines (C. tangerina) ‘Cassar,’ ‘Hernandina,’ and ‘MA3,’ all grafted on sour orange (C. aurantum) ‘Bigarade Gou Tou.’ The most conspicuous symptoms were wilting of sections of the canopy, chlorosis and epinasty of young leaves, and discoloration of vascular tissue. No root rot was observed. The problem was widespread with a disease incidence of 45 to 67%. Similar symptoms were described by Timmer et al. (2) on Mexican lime (C. aurantiifolia) nursery plants and some other species of citrus. Three representative isolates of Fusarium oxysporum Schlechtend.:Fr. from crown were single-spored and identified by the production of characteristic, three- to five-celled, sickle-shaped macroconidia with foot-shaped basal cells, ellipsoid microconidia borne in false heads on short monophialides, and chlamydospores in culture (1). The internal transcribed spacer (ITS) region of rDNA and the elongation factor (TEF 1-α) were amplified with primers ITS1/ITS4 and (TEF1/TEF2), respectively. GenBank accessions of ITS region are KC282838, KC282839, and KC282840, for TEF 1-α region are KF531633, KF537336, and KF537337, showed 99% homology with isolates of F. oxysporum in Fusarium-ID data. Pathogenicity tests were conducted on 7-month-old seedlings of sour orange using 10 plants for each of the three isolates. Prior to inoculation, roots were scraping with a sterile scalpel and plants were dipped in a conidial suspension of F. oxysporum (106 conidia ml–1) for 10 min. Each seedling was planted in a separate pot containing 0.7 liter of sterile soil. Non-inoculated plants with scraped roots dipped in sterile distilled water served as controls. Plants were irrigated and placed in a greenhouse at 24 ± 2°C and 12-h photoperiod. One month after inoculation, leaf chlorosis was observed and 2 months later, 90% of inoculated plants presented a severe wilt. Symptoms on infected plants were similar to those observed in the field. F. oxysporum was successfully re-isolated from the stems, thereby completing Koch's postulates. Genomic DNA was isolated from the re-isolations and PCR amplification of the ITS region was performed with the same primers. There was 100% nucleotide identity with sequences of the original isolates. To our knowledge, this is the first report of fusarium wilt of citrus trees in Tunisia. The pathogen may represent a new form species because previously, the disease was only reported from lime and lemon. References: (1) J. F. Leslie and B. A. Summerell. Page 256 in: The Fusarium Laboratory Manual. Blackwell Publishing Professional, Hoboken, NJ, 2006. (2) L. W. Timmer et al. Phytopathology 72:698, 1982.

Opium poppy (Papaver somniferum L.) is an economically important pharmaceutical crop in Spain. Approximately 8,000 ha are cultivated annually in southern and central Spain. To improve yields, opium poppy cultivation is expanding to more humid or irrigated areas of Spain. In the springs of 2005 and 2007, we observed poppy plants with wilt and stem rot symptoms in irrigated, commercial opium poppy (cv. Nigrum) at Carmona and Écija, which are in Seville Province in southern Spain. Closer observations of affected plants revealed darkening and water soaking of the leaves and stem at the soil level, wilting of the lower leaves or the entire plant, and dark brown discoloration of stem vascular tissues and pith of the plant. Severely affected plants became completely rotten and collapsed. Isolations from symptomatic tissues on nutrient agar consistently yielded bacterial colonies. Pure cultures of four representative bacterial strains (two per each of affected field and year of isolation) were used in triplicate for a comparative analysis of biochemical and physiological traits in the ‘carotovora’ group of Erwinia (1) with known isolates of Pectobacterium carotovorum subsp. carotovorum, P. carotovorum subsp. atrosepticum, and Dickeya chrysanthemi. The isolates from opium poppy were gram negative, facultatively anaerobic, oxidase negative, catalase positive, grew at 37°C, and did not produce gas from D-glucose. Acid was produced from D(+)-arabinose, lactose, and D(+)-trehalose, but not from α-D-methylglucoside. In addition, the opium poppy bacterial isolates caused soft rot on potato slices within 24 h at 25°C and did not induce a hypersensitive reaction on tobacco leaves. Use of the Biolog GN microplates and the OmniLog ID 1.2 system identified the four poppy isolates as P. carotovorum (showing a 66.7% similarity with the subsp. carotovorum). Pathogenicity of poppy isolates was tested on three 6-week-old opium poppy plants (cv. Nigrum) by injecting 100 μl of a bacterial suspension containing 108 CFU/ml in the basal stem. Plants that served as controls were injected with sterile water. Plants were incubated in a growth chamber adjusted to 28°C, 90% relative humidity, and a 14-h photoperiod of fluorescent light of 360 μE·m-2·s-1. Severe symptoms of soft rot and darkening developed on stems of inoculated plants within 3 to 5 days after inoculation. No symptoms developed on control plants. Bacterial strains reisolated from inoculated plants were identified as P. carotovorum on the basis of the Biolog system, as well as biochemical and physiological characters. To our knowledge, this is the first report of P. carotovorum causing soft rot of commercial opium poppy crops in Spain and elsewhere. The presence of this bacterial pathogen to irrigated crops and humid areas may pose an important constraint on the yield of opium poppy crops in Spain. References: (1) R. S. Dickey and A. Kelman. Pages 44-59 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988.

Fire blight, caused by Erwinia amylovora (Burr.) Winslow et al., affects plants in the Rosaceae family, which includes trees and shrubs in orchards, nurseries, and landscape plantations. During the springs and summers of 2008 and 2010, dying branches, necrotic leaves attached to shoots, and blighted twigs of meadowsweet (Spirea prunifolia) were observed at three different locations of landscape areas in Konya Province, Turkey. Disease incidence was approximately 1% on the plants during the surveys. Initial symptoms of reddish to brownish streaks on the shoots of infected plants were observed in spring. Nine representative bacterial strains were isolated from the lesions on shoots of seven meadowsweet plants on nutrient sucrose agar (NSA) medium and identified as E. amylovora on basis of biochemical, physiological (2,3) and molecular tests (1). Bacteria were gram-negative, rod shaped, aerobic, fermentative, yellow-orange on Miller and Scroth medium (2), positive for levan formation and acetoin production, did not grow at 36°C, positive for gelatin hydrolysis, and negative for esculin hydrolysis, indole, urease, catalase, oxidase, arginine dehydrolase, reduction of nitrate, acid production from lactose, and inositol. All strains were hypersensitive response-positive on tobacco (Nicotiana tabacum var. White Burley) plants. All strains were identified as E. amylovora using the species-specific primers set, A/B (1), by PCR assay, and by fatty acid methyl ester (FAME) profiles determined by Sherlock Microbial Identification System software (TSBA 6 v. 6.00; Microbial ID, Newark, DE) with similarity indices ranging from of 79 to 99%. Pathogenicity was tested by injecting of petioles and actively growing three shoot tips of 2-year-old S. prunifolia seedlings cv. number 29 using a 0.46 mm-diameter hypodermic needle with bacterial suspensions containing 108 CFU mL–1 in sterile distilled water (SDW) Plants were inoculated with each of the nine bacterial strains and two references strains, Ea29 and NCPPB 2791 (Selcuk University, Department of Plant Protection, Konya, Turkey). Symptoms resembling those associated with natural infection appeared on the inoculated plants 7 days after inoculation. Plants inoculated with SDW served as a negative control treatment, and no symptoms were observed on these plants. All tests were repeated three times with the same results. Bacterial re-isolations were attempted from the control plants as well as shoots and leaves inoculated with the two reference strains and the nine bacteria identified as E. amylovora. Bacteria isolated from inoculated plants were identified as E. amylovora using the biochemical, physiological, and molecular tests described above, but this bacterium was not isolated from the control plants. Phytosanitary measures must be taken to avoid spread of the pathogen to ornamentals in new landscape areas in Turkey. This report is important because infected Spirea spp. can be a potential inoculum source for other rosaceous ornamentals. To our knowledge, this is the first report of the occurrence of fire blight on meadowsweet in Turkey. References: (1) S. Bereswill et al. Appl. Environ. Microbiol. 58:3522, 1992. (2) A. L. Jones and K. Geider. Laboratory Guide for Identification of Plant Pathogenic Bacteria, pp. 40-55. American Phytopathological Society, St. Paul, MN, 2001. (3) R. A. Lelliott and D. E. Stead. Methods for Diagnosis of Bacterial Diseases of Plants (Methods in Plant Pathology). Oxford, UK, 1987.

In October 2010, 2-year-old papaya (cv. Hawaii) trees with high incidence of stem rot were observed during a survey conducted in Rio Grande do Norte state, northeastern Brazil. Stems showing reddish brown-to-dark brown symptoms were collected and small pieces (4 to 5 mm) of necrotic tissues were surface sterilized for 1 min in 1.5% NaOCl, washed twice with sterile distilled water, and plated onto potato dextrose agar (PDA) amended with 0.5 g liter–1 streptomycin sulfate. Plates were incubated at 25°C with a 12-h photopheriod for 4 days. Pure cultures with white, fluffy aerial mycelia were obtained by subculturing hyphal tips onto PDA. Identification was made using morphological characteristics and DNA based molecular techniques. Colonies grown on PDA and Spezieller Nährstoffarmer agar (SNA) for 10 days at 25°C with a 12-h photoperiod were used for morphological identification (3). The fungus produced cream sporodochia and two types of spores: microconidia were thin-walled, hyaline, ovoid, one-celled, and 6.8 to 14.6 × 2.3 to 4.2 μm; macroconidia were thick walled, hyaline, slightly curved, 3- to 5-celled, and 25.8 to 53.1 × 3.9 to 5.7 μm. Fifty spores of each type were measured. Rounded, thick-walled chlamydospores were produced, with two to four arranged together. On the basis of morphological characteristics (1), three fungal isolates (CMM-3825, CMM-3826, and CMM-3827) were identified as Fusarium solani (Mart.) Sacc. and were deposited in the Culture Collection of Phytopathogenic Fungi of the Universidade Federal Rural de Pernambuco (Recife, Brazil). Single-spore isolates were obtained and genomic DNA of the isolates was extracted and a portion of the translation elongation factor 1-alpha (EF1-α) gene of the isolates was amplified and sequenced (2). When compared with sequences available in the GenBank and Fusarium-ID databases, DNA sequences of the three isolates shared 99 to 100% sequence identity with F. solani species complex (GenBank Accession Nos. JF740784.1, DQ247523.1, and DQ247017.1). Representative sequences of the isolates were deposited in GenBank (Accession Nos. JQ808499, JQ808500, and JQ808501). Pathogenicity tests were conducted with four isolates on 3-month-old papaya (cv. Hawaii) seedlings. Mycelial plugs taken from the margin of actively growing colonies (PDA) of each isolate were applied in shallow wounds (0.4 cm in diameter) on the stem (center) of each plant. Inoculation wounds were wrapped with Parafilm. Control seedlings received sterile PDA plugs. Inoculated and control seedlings (10 each) were kept in a greenhouse at 25 to 30°C. After 2 weeks, all inoculated seedlings showed reddish brown necrotic lesions in the stems. No symptoms were observed in the control plants. The pathogen was successfully reisolated from symptomatic plants to fulfill Koch's postulates. To our knowledge, this is the first report of F. solani species complex causing papaya stem rot in Brazil. Papaya is an important fruit crop in the northeastern Brazil and the occurrence of this disease needs to be taken into account in papaya production. References: (1) C. Booth. Fusarium Laboratory Guide to the Identification of the Major Species. CMI, Kew, England, 1977. (2) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (3) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006.

Abstract All people have a right to equal healthcare without discrimination on the basis of disabilities. In practice, however, health inequalities still remain. Ideally we would define future public health having sufficient attention to minority groups and their specific needs. One of these groups is people with intellectual disabilities (ID), defined by severe limitations in adaptive and functional behaviour. As a result of these limitations, people with ID suffer from worse health, higher hospitalisation rates and higher premature mortality compared to people without ID. In reducing these health inequalities acquiring accurate information on disease epidemiology in people with ID compared to those without ID is crucial. However, this crucial information is still lacking. This workshop will dive into disease epidemiology in people with ID by highlighting different aspects of health and the difficulties that arise when researching people with ID. First, It has been proven difficult to identify ID in existing data sources. ID-diagnoses in medical records are not too reliable, physicians do not always recognise IDs, or people are embarrassed of their ID-diagnosis. By gaining information on received services or supports specifically for people with ID a more complete representation of the ID-population is gained. Second, prevalence rates on chronic diseases in people with ID are often inconsistent across the literature, probably due to different age and sex patterns of chronic diseases and chronic comorbidities compared to people without ID, but these patterns are often not taken into account. By reporting on chronic disease prevalence and comorbidity patterns in people with versus without ID, a novel insight is gained in comparative epidemiology of chronic diseases of people with and without ID. Third, although it is known that people with mild ID suffer more mental health disorders dan people with no ID, exact prevalence rates and data on the care provided to these people in mental health services is missing. A retrospect database study performed in Dutch mental health care gives insight in this knowledge gap, not only for those people whom are recorded with their mild ID in these mental health services, but also for those people who were not recorded as such. Fourth, the current pandemic of a novel infectious disease stresses the strong need for accurate knowledge of disease epidemiology, particularly concerning high-risk groups such as people with ID. A large-scale registration of COVID-19 in people with ID living in residential settings was developed in the Netherlands, to provide necessary insight in the medical impact of COVID-19 among people with ID and inform policy makers and care providers on specific risks and consequences of COVID-19 in the ID population as compared with the general population. Key messages Insight in disease epidemiology and disease care in people with intellectual disabilities compared to people without intellectual disabilities is crucial in reducing health inequalities. Although it is difficult to identify all people with intellectual disabilities in data sources, using multiple methods and data sources results in a more complete overview of this group of people.

<p>Semantic network is so far an effective way for knowledge representation, especially if the matter deals with complexity of terminologies and concepts, which are not standalone, but connected by various relations. One among these fields of knowledge is philosophy, and one fact that the study students of university always face with difficulties when address the system of terminologies and concepts of philosophy. In practice, various tools are using by teachers for helping students understand philosophy terminologies and concepts, i.e. using mindmap tools. In this paper, we suggest a use of semantic network as a tool for representation of key terminologies in philosophy of Marxism that have been teaching in Vietnamese universities. For this purpose, the authors of the paper carefully investigate all materials of appropriate learning; make a selection and classification for setting up of terminologies; build a semantic network of these terminologies for a conceptional model. An effort is providing to design one software system with semantic updating, selecting and representing. These results are under the project “Studying and building semantic network of concepts in philosophy discipline for teaching and researching activities” ID: QG.18.46, in a University of Social Sciences and Humanities of Hanoi National University. <p> </p><p><strong> Article visualizations:</strong></p><p><img src="/-counters-/edu_01/0720/a.php" alt="Hit counter" /></p>

<span id="docs-internal-guid-5ecda03a-7fff-4511-8377-3818966e9cd8"><span>The cognitive level between teachers and students is clearly different in problem-solving. In the mathematics context, especially the function problem was only in geometric expression form, for knowledge construction and student's learning should use their cognitive level capacity. Not only the solving process is based on that, but also learning should be efficient for all students, and analyzing those processes is the purpose of identification inefficient issues in this study. This investigative study was held on three respondents purposively selected from a science program of senior high school in West Jakarta, Indonesia. This study found that in the solving process, all students chose to construct an algebraic representation of the function by organizing concepts relevant to fragmented conceptualization. The process has held to apply each concept procedurally. There has been a resource and that is one concept of the domain of function, so the completion is an inefficient process because all three students were ignoring it to use. All three process for solving to the student’s academic culture, most common for emphasizing in learning related to the problem and their cognitive capacity.</span></span>

Abstract Background Many randomized controlled trials fail to reach their target sample size. When coupled with the omission and underrepresentation of disadvantaged groups in randomized controlled trials, many trials fail to obtain data that accurately represents the true diversity of their target population. Policies and practices have been implemented to increase representation of disadvantaged groups in many randomized controlled trials, with some trials specifically targeting such groups. To our knowledge, no systematic review has quantified the enrollment metrics and effectiveness of inclusion and retention strategies in randomized controlled trials focused on disadvantaged populations specifically. Methods We will conduct a systematic search across EMBASE, MEDLINE, Web of Science, and CINAHL as well as grey literature, conference proceedings, research monographs, and Google Scholar from inception onwards. We will include randomized controlled trials where at least 50% of enrolled participants are considered to be disadvantaged, as per the RCT authors’ definition and in line with our inclusion criteria. Two independent researchers per article will conduct preliminary title and abstract screening, subsequent full text review, and data extraction for the selected trials, with a third reviewer available to resolve conflicts. We will assess the quality of all included studies using specific criteria regarding data reporting, external validity, and internal validity. We will combine all selected studies and conduct a narrative synthesis to assess enrollment metrics. If there is sufficient homogeneity and sufficient trials comparing recruitment strategies within disadvantaged populations, we will conduct a random effects meta-analysis to evaluate the effectiveness of strategies designed to maximize the inclusion of disadvantaged populations in randomized controlled trials. Discussion The findings of this systematic review will establish baseline recruitment and enrollment metrics of trials targeting disadvantaged populations to elucidate the scope of the challenge of recruiting such populations. We hope that our findings will promote future research on the distinct barriers that may prevent disadvantaged populations from participating in health intervention research, will encourage more trials exploring effective, tailored recruitment strategies, and will establish a foundation to track future progress in the recruitment of disadvantaged populations. Trial registrations PROSPERO ID: CRD42020152814

In this paper, I will be looking at how the news media may be both helpful (‘good’) and a hindrance (‘bad’) to lesbian and gay parents. While I acknowledge the incommensurable differences between the experiences of lesbian parents and gay parents, I do believe that representations of both lesbian and gay parents in the media tend to focus on any similarities that exist between (and within) the two groups, rather than looking at the important differences. I would suggest that this is the result of the hetero-normative assumptions that inform the news media, which take heterosexual parents to be the norm from which all other parents differ. Such normative assumptions thus suggest that it is important to look at how particular moral frameworks are employed in both pro- and anti-gay news media reports of lesbian and gay parents, the implication being that the former may not necessarily be better than the latter. As lesbian and gay parents, we may thus do ourselves a disservice by uncritically accepting that ‘positive’ media accounts are useful in our fight for rights. ‘Good Parents’ and the ‘Rhetoric of Pseudoscience’ One of the most central aspects of representations of lesbian and gay parents in the news media is the use of ‘scientific proof’ to legitimate lesbian and gay parenting. Some examples include: Significant, reliable social scientific evidence indicates that lesbian and gay parents are as fit, effective and successful as heterosexual parents (Judith Stacey reported in http://www.lethimstay.com/wrong_socscience_expert.html). Because many beliefs about lesbian and gay parents and their children are open to empirical test, psychological research can evaluate their accuracy (American Psychological Association [APA], 1995, http://www.apa.org/pi/parent.html). Scientific findings debunk the myth that gay men cannot be nurturing parents (http://www.familypride.org/issues/myths.htm). A comprehensive international review of 25 years of research into lesbian and gay parenting… shows convincingly that the children of lesbian and gay parents do not demonstrate any important differences from those of heterosexual parents (Gay & Lesbian Rights Lobby, 2002, http://www.glrl.org.au/issues/parenting.htm). One particular strategy of legitimation evident in these extracts demonstrates what Kitzinger has termed the ‘rhetoric of pseudoscience’ – disproving your opponents claims to truth by demonstrating their ‘bad science’ (see also Riggs, “Politics”). Thus, in the examples above, ‘significant, reliable social scientific evidence’ is contrasted with ‘debunk[ed]… myth[s]’. Another example of this is provided in Stacey’s claim that: Paul Cameron is the primary disreputable and discredited figure in this [anti-lesbian and gay parenting] literature. He was expelled from the APA… for unethical scholarly practices, such as selective, misleading representations of research and making claims that could not be substantiated (http://www.lethimstay.com/wrong_socscience_expert.html). Here, Stacey uses the authority of ‘good’ social scientific research in order to disprove the claims of ‘bad’ ‘disreputable and discredited figure[s]’. In so doing, while she seeks to support lesbian and gay parents in our fight for rights, she also perpetuates the notion that scientific knowledge is the appropriate arbiter of what counts as ‘good parenting’. This is reinforced in the statement of the APA, which suggests that ‘many beliefs about lesbian and gay parents and their children are open to empirical test’. While this is intended to demonstrate the importance of using psychological research to ‘evaluate [the] accuracy’ of such beliefs, it also demonstrates the risks that we run when using science to determine what will count as ‘truth’ (Clarke; Riggs, “Politics”, “On Whose Terms”). Thus, while psychological knowledge in the extracts above is deployed in support of lesbian and gay parents, we only need to look back 30-odd years to see a vastly different story. It is as recently as that that same-sex attraction was classified as a pathology in the American Psychiatric Association’s Diagnostic and Statistical Manual of Mental Disorders (DSM-II). Thus, as Joshua Gamson (76) suggests, that which is considered ‘“normal” is often a synonym for “power”’. In this regard, the power that is evoked through the use of scientific discourse in news media may also be used against lesbian and gay parents. For example, Bill Maier, a clinical psychologist and vice president of the (right-wing and, anti-gay) Focus on the Family Institute is reported as saying that: Every responsible psychologist in the APA should be ashamed; the organization is obviously more concerned with appeasing its powerful gay lobby than it is with retaining any semblance of moral and ethical duty (Baptist Press News, http://www.bpnews.net/bpnews.asp?ID=18784). Here morality and ethics are constructed as being a priori oriented towards the values of the heterosexual majority. Even if lesbian and gay rights activists are to counter this with ‘proof’ of the normality of lesbians and gay men, this does little to destabilise the hegemony of scientific knowledge and its ability to define what counts as moral and ethical. Indeed, Maier draws attention to a very important point – while organisations such as the APA may seek to use psychological knowledge to refute anti-gay claims, they do so without challenging the ideological assumptions that underpin it. As a result, the APA (and those who use psychological knowledge in pro-accounts more generally) are left open to accusations of bias and wilful ignorance of a system of law that is based upon the values of white, heterosexual, middle-class men (Bernstein). ‘Taking Sides’: Is There Any Difference? This leads me to ask the following question: Do we as lesbians and gay men actually want to be ‘good parents’? How might our location within this position only serve to erase the unique experiences of parenting and families that we share? Eldridge suggests that what appear as debates over social issues may more accurately be described as ‘one-sided debates’, wherein the ‘opposing parties’ are actually arguing very similar points. This is particularly evident in debates over lesbian and gay parenting, as both those for and those against lesbian and gay parents often uncritically accept the notions of ‘science’ that inhere to the debates. For example, in the previous section we saw Stacey claim that anti-gay researchers have questionable ethics, just as Maier suggested that the support for lesbian and gay issues given by the APA represents a crisis in its ‘ethical and moral duty’. While pro-accounts of lesbian and gay parents may be useful in the short term to generate ‘positive’ representations of lesbian and gay parents in the media (which in some cases may be an important aspect of legal challenges in regards to lesbian and gay adoption rights), they do little to challenge the networks of power within which they are located, focused as they are upon stereotypical representations of ‘good’ lesbian and gay parents who are typically white, able-bodied, and financially secure. As a result, these representations further marginalise those lesbians and gay men who do not fit within this category (for example, due to economic or cultural difference from the white, middle-class majority), in addition to those lesbians and gay men who choose not to parent. These points demonstrate how the fight for ‘positive representation’ within the media can lead to the further marginalisation of groups of lesbian and gay men who already have little access to such representation (Gamson). Within this paper, I have demonstrated some of the ways in which ‘good’ representations of lesbian and gay parents may also be ‘bad’—they may render us complicit with discourses of science that have often been used against us, and they also encourage us to conform to a heterosexual model of relationality. In this way, lesbian and gay parents are expected to be ‘as fit, effective and successful as heterosexual parents’ (Stacey). As a result, lesbian and gay parents are encouraged to accept a form of subjectivity that recognises scientific arguments as legitimate, and which thus encourages lesbians and gay men to open their lives to scientific scrutiny, measurement, and objectification. Moreover, it encourages lesbian and gay parents ‘not [to] demonstrate any important differences from… heterosexual parents’ (Gay & Lesbian Rights Lobby) under threat of being declared, by default, unfit parents. The converse effect of news media reports of lesbian and gay parents can also be true: ‘bad’ representations may inadvertently draw attention to the problems that inhere to using science to ‘prove the case’. Thus, as the extract from Maier suggests, naively believing that science is the answer ignores the moral assumptions that shape news media and which further marginalise the often critical moral frameworks of lesbian and gay parents. Obviously, I am not advocating here for more statements like those of Maier. Rather, I am suggesting that as lesbian and gay parents we need to be wary of accepting normative framework when mounting our resistances. In other words, if ‘bad’ is often ‘good’, and ‘good’ is often ‘bad’ in scientific media accounts of lesbian and gay parents, then it would seem important that we develop alternate ways of accounting for our experiences, at the same time as we critique such accounts in order to demonstrate their moral assumptions. Acknowledgements I would first like to acknowledge the sovereignty of the Kaurna people, upon whose land I live in Adelaide, South Australia. Thanks as always go to Greg for support and proof reading, and to our foster child, Gary, for helping this all make sense. References Bernstein, Mary. “Gender, Queer Family Policies, and the Limits of the Law.” Queer Families, Queer Politics: Challenging Culture and the State. Ed. Mary Bernstein and Renate Reimann. New York: Columbia UP, 2001. Clarke, Victoria. “‘Stereotype, Attack and Stigmatize Those Who Disagree’: Employing Scientific Rhetoric in Debates about Lesbian and Gay Parenting.” Feminism & Psychology 10 (2000): 152-9. Eldridge, John. “News, Truth and Power.” Getting the Message: News, Truth and Power. Ed. John Eldridge. London: Routledge, 1993. Gamson, Joshua. “Talking Freaks: Lesbian, Gay, Bisexual and Transgender Families on Daytime Talk TV.” Queer Families, Queer Politics: Challenging Culture and the State. Ed. Mary Bernstein and Renate Reimann. New York: Columbia UP, 2001. Kitzinger, Celia. “The Rhetoric of Pseudoscience.” Deconstructing Social Psychology. Eds. Ian Parker and John Shotter. London: Routledge, 1990. Riggs, Damien W. “The Politics of Scientific Knowledge: Constructions of Sexuality and Ethics in the Conversion Therapy Literature.” Lesbian & Gay Psychology Review 5 (2004): 6-14. Riggs, Damien W. “On Whose Terms?: Psychology and the Legitimisation of Lesbian and Gay Parents.” GLIP News 3 (2004): 3-6. http://www.psychology.org.au/units/interest_groups/gay_lesbian/publications.asp>. Riggs, Damien W. “The Psychologisation of Foster Care: Implications for Lesbian and Gay Parents.” PsyPag Quarterly 51 (2004): 34-43. Citation reference for this article MLA Style Riggs, Damien. "Who Wants to Be a 'Good Parent'?: Scientific Representations of Lesbian and Gay Parents in the News Media." M/C Journal 8.1 (2005). echo date('d M. Y'); ?> <http://journal.media-culture.org.au/0502/05-riggs.php>. APA Style Riggs, D. (Feb. 2005) "Who Wants to Be a 'Good Parent'?: Scientific Representations of Lesbian and Gay Parents in the News Media," M/C Journal, 8(1). Retrieved echo date('d M. Y'); ?> from <http://journal.media-culture.org.au/0502/05-riggs.php>.

Purpose The purpose of this paper is to investigate how users with particularly complex needs including intellectual disability (ID) reacted to the changes and restrictions during the COVID-19 pandemic in 2020. Design/methodology/approach As few studies of changes during the pandemic include users with ID and multiple, complex needs, the authors adopted a qualitative approach, using a semistructured interview guide. Ten participants were leading ID nurses in residential facilities in community settings. The interviews were taped, transcribed and analyzed using a thematic analysis. Findings The thematic analysis generated six main themes, including both user and staff perspectives: daily routines, activities, facilitation of tasks and well-being, from the users perspectives, and use of working hours and positive staff experiences, from the staff perspectives. Research limitations/implications Ten residential facilities constituted a convenience sample of services for users with multiple, complex needs. Thus, the authors do not know whether the findings are representative. Further research should include user opinions based on the findings of this study. Practical implications The users represented in this study appeared to experience less stress during the pandemic, contrary to the expectations of professional caregivers. The findings indicated more well-being among users. It was noted that receiving services at home, largely flexible schedules, staying in bed a little longer in the morning and avoiding stressful situations, such as travelling in minibuses, was appreciated by the users. Social implications Daily schedules with activities throughout the day should be considered for users as represented in this study. Stressful events should also be considered. Originality/value The knowledge about pandemic experiences of users with ID and additional complex conditions and hence comprehensive needs is still sparse. This study may add to this knowledge.

Vehicle Re-Identification (Re-ID) aims to discover and match target vehicles in different cameras of road surveillance. The high similarity between vehicle appearances and the dramatic variations in viewpoints and illumination cause great challenges for vehicle Re-ID. Meanwhile, in safety supervision and intelligent traffic systems, one needs a quick efficient method of identifying target vehicles. In this paper, we propose a Multi-Attention Guided Feature Enhancement Network (MAFEN) to extract robust vehicle appearance features. Specifically, the Fusing Spatial-Channel information multi-receptive fields Feature Enhancement module (FSCFE) is first proposed to aggregate richer and more representative multi-receptive fields features at different receptive fields sizes. It also learned the spatial structure information and channel dependencies of the multi-receptive fields features and embedded them to enhance the feature. Then, we construct the Spatial Attention-Guided Adaptive Feature Erasure (SAAFE) module, which uses spatial attention to erase the most distinguishing features. The network’s attention is shifted to potentially salient features to strengthen the ability of the network to extract salient features. In addition, a multi-loss knowledge distillation (MLKD) method using MAFEN as a teacher network is designed to improve computational efficiency. It uses multiple loss functions to jointly supervise the student network. Experimental results on three public datasets demonstrate the merits of the proposed method over the state-of-the-art methods.

Abstract The information transmitted by images accompanying technical and scientific texts id supposed to lead to a better, visually-oriented understanding of the concepts and descriptions contained in the text. Given that conceptualising scientific information entails creating mental representations of the concepts, and since the function of images is complementary to the function of texts, cultural attitudes might well influence many aspects of an image ranging from its contents, to shape or colour. One might ask if the translation process should include the adaptation of original images in the text in order to avoid a misunderstanding of the message by readers from a target culture, or if images should be treated differently depending on the target audience. As images in technical and scientific books and articles are often difficult to interpret a close study of them is needed so that the visual message matches the knowledge of the receiver in the target culture. In this article we propose cognitive and pragmatic criteria regarding the message transmitted by images in scientific texts as a guide to translation-oriented image analysis.

This essay explores how print media conceals implicit hegemonic texts that common readers unsuspectingly tend to internalize. These geopolitically infused texts are set to appropriate the reader’s worldviews by sublimating the kind of perceptions and notions they want to promote. This paper raises questions and awareness about how academia responds to these acts of internalization. These geopolitical texts, which dominate most of the print media and other resources, function at an imperceptible level to legitimize presuppositions and mould the world based on its own political imaginaries. To decode and interpret these largely shrewd texts requires a literacy skill that students need to acquire in different academic disciplines. This essay, therefore, explores how print media, such as newspapers and comics, attempts to legitimize knowledge through reports and stories that work at the subliminal level. Since all readers, students, instructors or researchers are vulnerable observers (Behar, 1996), because of our fallible human nature, the act of internalizing mediascaped knowledge becomes alarmingly simple and crucially effective on the way we are directed to perceive the world. By analogy, geopolitical texts are these id-instigated drives that the superego often suppresses and filters into dreams and fiction and yet they ominously somehow found their way out; they stealthily found expression and now they paint reality with their own biased colors. Can readers in the context be dream catchers? Cet article explore la manière dont les médias écrits dissimulent les textes hégémoniques implicites que les lecteurs ordinaires semblent assimiler à leur insu. Ces textes géopolitiquement insufflés sont appelés à approprier la vision du monde des lecteurs en sublimant le type de perceptions et de notions qu’ils souhaitent promouvoir. Cet article soulève des questions et sensibilise l’opinion sur la manière dont le monde universitaire répond à ces actes d’assimilation. Ces textes géopolitiques, qui dominent la majorité des médias écrits et autres ressources, fonctionnent à un niveau imperceptible afin de légitimer les présuppositions et façonner le monde sur la base de son propre imaginaire politique. Pour décoder et interpréter ces textes hautement astucieux, il faut avoir des capacités de lecture que les étudiants doivent acquérir dans diverses disciplines universitaires. Par conséquent, cet article explore comment les médias écrits, tels que les journaux et les bandes dessinées, tentent de légitimer la connaissance par le biais de rapports et de récits qui agissent au niveau subliminal. Du fait que tous les lecteurs, tous les étudiants, tous les instructeurs ou tous les chercheurs sont des observateurs vulnérables (Behar, 1996), du fait de notre nature humaine faible, l’acte qui consiste à assimiler la connaissance du paysage médiatique devient dangereusement simple et extrêmement efficace sur la manière dont nous sommes poussés à percevoir le monde. Par analogie, les textes géopolitiques sont des volontés menées par le besoin d’identité que le super-ego réprime et filtre souvent pour en faire des rêves et des fictions, et pourtant, d’une manière ou d’une autre, ces volontés réussissent quand même à trouver leur chemin; elles ont furtivement trouvé comment s’exprimer et maintenant, elles dépeignent une réalité colorée de leurs propres préjugés. Est-ce que dans ce contexte, les lecteurs peuvent devenir des capteurs de rêves?

Abstract Background Many patients consult their primary care physician with persistent somatic symptoms such as pain or sickness. Quite often these consultations and further diagnostic measures yield no medical explanation for the symptoms – patients and physicians are left in uncertainty. In fact, diagnostic and treatment barriers in primary care hinder timely health-care provision for patients suffering from persistent somatic symptoms (PSS). The significance of individual barriers is still unknown. We compare and quantify these barriers from the perspective of primary care physicians and identify subpopulations of primary care physicians who experience particular barriers as most severe. Methods We mailed a questionnaire to primary care physicians (PCP) in Germany and asked them which barriers they consider most important. We invited a random sample of 12,004 primary care physicians in eight federal states in Germany. Physicians provided anonymous mailed or online responses. We also mailed a postcard to announce the survey and a mail reminder. Main measures were Likert rating scales of items relating to barriers in the diagnosis and treatment of PSS in primary care. Information on demography and medical practice were also collected. Results We analyzed 1719 data sets from 1829 respondents. PCPs showed strongest agreement with statements regarding (1.) their lack of knowledge about treatment guidelines, (2.) their perceptions that patients with PSS would expect symptom relief, (3.) their concern to overlook physical disease in these patients, and (4.) their usage of psychotropic drugs with these patients. More experienced PCPs were better able to cope with the possibility of overlooking physical disease than those less experienced. Conclusions The PCPs in our survey answered that the obligation to rule out severe physical disease and the demand to relieve patients from symptoms belong to the most severe barriers for adequate treatment and diagnosis. Moreover, many physicians admitted to not knowing the appropriate treatment guidelines for these patients. Based on our results, raising awareness of guidelines and improving knowledge about the management of persistent somatic symptoms appear to be promising approaches for overcoming the barriers to diagnosis and treatment of persistent somatic symptoms in primary care. Trial registration German Clinical Trials Register (Deutschen Register Klinischer Studien, DRKS) https://www.drks.de/drks_web/setLocale_EN.do The date the study was registered: October 2nd 2017 The date the first participant was enrolled: February 9th 2018 DRKS-ID: DRKS00012942

IntroductionThe debate about the responsibility of museums to respect Indigenous peoples’ rights (Kelly and Gordon; Butts) has caught our attention on the basis of our previous research experience with regard to the protection of the tangible and intangible heritage of the San (former hunter gatherers) in Southern Africa (Martin and Vermeylen; Vermeylen, Contextualising; Vermeylen, Life Force; Vermeylen et al.; Vermeylen, Land Rights). This paper contributes to the critical debate about curatorial practices and the recovery of Indigenous peoples’ cultural practices and explores how museums can be transformed into cultural centres that “decolonise” their objects while simultaneously providing social agency to marginalised groups such as the San. Indigenous MuseumTraditional methods of displaying Indigenous heritage are now regarded with deep suspicion and resentment by Indigenous peoples (Simpson). A number of related issues such as the appropriation, ownership and repatriation of culture together with the treatment of sensitive and sacred materials and the stereotyping of Indigenous peoples’ identity (Carter; Simpson) have been identified as the main problems in the debate about museum curatorship and Indigenous heritage. The poignant question remains whether the concept of a classical museum—in the sense of how it continues to classify, value and display non-Western artworks—will ever be able to provide agency to Indigenous peoples as long as “their lives are reduced to an abstract set of largely arbitrary material items displayed without much sense of meaning” (Stanley 3). Indeed, as Salvador has argued, no matter how much Indigenous peoples have been involved in the planning and implementation of an exhibition, some issues remain problematic. First, there is the problem of representation: who speaks for the group; who should make decisions and under what circumstances; when is it acceptable for “outsiders” to be involved? Furthermore, Salvador raises another area of contestation and that is the issue of intention. As we agree with Salvador, no matter how good the intention to include Indigenous peoples in the curatorial practices, the fact that Indigenous peoples may have a (political) perspective about the exhibition that differs from the ideological foundation of the museum enterprise, is, indeed, a challenge that must not be overlooked in the discussion of the inclusive museum. This relates to, arguably, one of the most important challenges in respect to the concept of an Indigenous museum: how to present the past and present without creating an essentialising “Other”? As Stanley summarises, the modernising agenda of the museum, including those museums that claim to be Indigenous museums, continues to be heavily embedded in the belief that traditional cultural beliefs, practices and material manifestations must be saved. In other words, exhibitions focusing on Indigenous peoples fail to show them as dynamic, living cultures (Simpson). This raises the issue that museums recreate the past (Sepúlveda dos Santos) while Indigenous peoples’ interests can be best described “in terms of contemporaneity” (Bolton qtd. in Stanley 7). According to Bolton, Indigenous peoples’ interest in museums can be best understood in terms of using these (historical) collections and institutions to address contemporary issues. Or, as Sepúlveda dos Santos argues, in order for museums to be a true place of memory—or indeed a true place of recovery—it is important that the museum makes the link between the past and contemporary issues or to use its objects in such a way that these objects emphasize “the persistence of lived experiences transmitted through generations” (29). Under pressure from Indigenous rights movements, the major aim of some museums is now reconciliation with Indigenous peoples which, ultimately, should result in the return of the cultural objects to the originators of these objects (Kelly and Gordon). Using the Native American Graves Protection and Repatriation Act of 1990 (NAGPRA) as an illustration, we argue that the whole debate of returning or recovering Indigenous peoples’ cultural objects to the original source is still embedded in a discourse that emphasises the mummified aspect of these materials. As Harding argues, NAGPRA is provoking an image of “native Americans as mere passive recipients of their cultural identity, beholden to their ancestors and the museum community for the re-creation of their cultures” (137) when it defines cultural patrimony as objects having ongoing historical, traditional or cultural importance, central to the Native American group or culture itself. According to Harding (2005) NAGPRA’s dominating narrative focuses on the loss, alienation and cultural genocide of the objects as long as these are not returned to their originators. The recovery or the return of the objects to their “original” culture has been applauded as one of the most liberating and emancipatory events in recent years for Indigenous peoples. However, as we have argued elsewhere, the process of recovery needs to do more than just smother the object in its past; recovery can only happen when heritage or tradition is connected to the experience of everyday life. One way of achieving this is to move away from the objectification of Indigenous peoples’ cultures. ObjectificationIn our exploratory enquiry about new museum practices our attention was drawn to a recent debate about ownership and personhood within the context of museology (Busse; Baker; Herle; Bell; Geismar). Busse, in particular, makes the point that in order to reformulate curatorial practices it is important to redefine the concept and meaning of objects. While the above authors do not question the importance of the objects, they all argue that the real importance does not lie in the objects themselves but in the way these objects embody the physical manifestation of social relations. The whole idea that objects matter because they have agency and efficacy, and as such become a kind of person, draws upon recent anthropological theorising by Gell and Strathern. Furthermore, we have not only been inspired by Gell’s and Strathern’s approaches that suggests that objects are social persons, we have also been influenced by Appadurai’s and Kopytoff’s defining of objects as biographical agents and therefore valued because of the associations they have acquired throughout time. We argue that by framing objects in a social network throughout its lifecycle we can avoid the recurrent pitfalls of essentialising objects in terms of their “primitive” or “traditional” (aesthetic) qualities and mystifying the identity of Indigenous peoples as “noble savages.” Focusing more on the social network that surrounds a particular object opens up new avenues of enquiry as to how, and to what extent, museums can become more inclusive vis-à-vis Indigenous peoples. It allows moving beyond the current discourse that approaches the history of the (ethnographic) museum from only one dominant perspective. By tracing an artwork throughout its lifecycle a new metaphor can be discovered; one that shows that Indigenous peoples have not always been victims, but maybe more importantly it allows us to show a more complex narrative of the object itself. It gives us the space to counterweight some of the discourses that have steeped Indigenous artworks in a “postcolonial” framework of sacredness and mythical meaning. This is not to argue that it is not important to be reminded of the dangers of appropriating other cultures’ heritage, but we would argue that it is equally important to show that approaching a story from a one-sided perspective will create a dualism (Bush) and reducing the differences between different cultures to a dualistic opposition fails to recognise the fundamental areas of agency (Morphy). In order for museums to enliven and engage with objects, they must become institutions that emphasise a relational approach towards displaying and curating objects. In the next part of this paper we will explore to what extent an online museum could progressively facilitate the process of providing agency to the social relations that link objects, persons, environments and memories. As Solanilla argues, what has been described as cybermuseology may further transform the museum landscape and provide an opportunity to challenge some of the problems identified above (e.g. essentialising practices). Or to quote the museologist Langlais: “The communication and interaction possibilities offered by the Web to layer information and to allow exploration of multiple meanings are only starting to be exploited. In this context, cybermuseology is known as a practice that is knowledge-driven rather than object-driven, and its main goal is to disseminate knowledge using the interaction possibilities of Information Communication Technologies” (Langlais qtd. in Solanilla 108). One thing which shows promise and merits further exploration is the idea of transforming the act of exhibiting ethnographic objects accompanied by texts and graphics into an act of cyber discourse that allows Indigenous peoples through their own voices and gestures to involve us in their own history. This is particularly the case since Indigenous peoples are using technologies, such as the Internet, as a new medium through which they can recuperate their histories, land rights, knowledge and cultural heritage (Zimmerman et al.). As such, new technology has played a significant role in the contestation and formation of Indigenous peoples’ current identity by creating new social and political spaces through visual and narrative cultural praxis (Ginsburg).Online MuseumsIt has been acknowledged for some time that a presence on the Web might mitigate the effects of what has been described as the “unassailable voice” in the recovery process undertaken by museums (Walsh 77). However, a museum’s online engagement with an Indigenous culture may have significance beyond undercutting the univocal authority of a museum. In the case of the South African National Gallery it was charged with challenging the extent to which it represents entrenched but unacceptable political ideologies. Online museums may provide opportunities in the conservation and dissemination of “life stories” that give an account of an Indigenous culture as it is experienced (Solanilla 105). We argue that in engaging with Indigenous cultural heritage a distinction needs to be drawn between data and the cognitive capacity to learn, “which enables us to extrapolate and learn new knowledge” (Langlois 74). The problem is that access to data about an Indigenous culture does not necessarily lead to an understanding of its knowledge. It has been argued that cybermuseology loses the essential interpersonal element that needs to be present if intangible heritage is understood as “the process of making sense that is generally transmitted orally and through face-to-face experience” (Langlois 78). We agree that the online museum does not enable a reality to be reproduced (Langlois 78).This does not mean that cybermuseology should be dismissed. Instead it provides the opportunity to construct a valuable, but completely new, experience of cultural knowledge (Langlois 78). The technology employed in cybermuseology provides the means by which control over meaning may, at least to some extent, be dispersed (Langlois 78). In this way online museums provide the opportunity for Indigenous peoples to challenge being subjected to manipulation by one authoritative museological voice. One of the ways this may be achieved is through interactivity by enabling the use of social tagging and folksonomy (Solanilla 110; Trant 2). In these processes keywords (tags) are supplied and shared by visitors as a means of accessing museum content. These tags in turn give rise to a classification system (folksonomy). In the context of an online museum engaging with an Indigenous culture we have reservations about the undifferentiated interactivity on the part of all visitors. This issue may be investigated further by examining how interactivity relates to communication. Arguably, an online museum is engaged in communicating Indigenous cultural heritage because it helps to keep it alive and pass it on to others (Langlois 77). However, enabling all visitors to structure online access to that culture may be detrimental to the communication of knowledge that might otherwise occur. The narratives by which Indigenous cultures, rather than visitors, order access to information about their cultures may lead to the communication of important knowledge. An illustration of the potential of this approach is the work Sharon Daniel has been involved with, which enables communities to “produce knowledge and interpret their own experience using media and information technologies” (Daniel, Palabras) partly by means of generating folksonomies. One way in which such issues may be engaged with in the context of online museums is through the argument that database and narrative in such new media objects are opposed to each other (Manovich, New Media 225). A new media work such as an online museum may be understood to be comprised of a database and an interface to that database. A visitor to an online museum may only move through the content of the database by following those paths that have been enabled by those who created the museum (Manovich, New Media 227). In short it is by means of the interface provided to the viewer that the content of the database is structured into a narrative (Manovich, New Media: 226). It is possible to understand online museums as constructions in which narrative and database aspects are emphasized to varying degrees for users. There are a variety of museum projects in which the importance of the interface in creating a narrative interface has been acknowledged. Goldblum et al. describe three examples of websites in which interfaces may be understood as, and explicitly designed for, carrying meaning as well as enabling interactivity: Life after the Holocaust; Ripples of Genocide; and Yearbook 2006.As with these examples, we suggest that it is important there be an explicit engagement with the significance of interface(s) for online museums about Indigenous peoples. The means by which visitors access content is important not only for the way in which visitors interact with material, but also as to what is communicated about, culture. It has been suggested that the curator’s role should be moved away from expertly representing knowledge toward that of assisting people outside the museum to make “authored statements” within it (Bennett 11). In this regard it seems to us that involvement of Indigenous peoples with the construction of the interface(s) to online museums is of considerable significance. Pieterse suggests that ethnographic museums should be guided by a process of self-representation by the “others” portrayed (Pieterse 133). Moreover it should not be forgotten that, because of the separation of content and interface, it is possible to have access to a database of material through more than one interface (Manovich, New Media 226-7). Online museums provide a means by which the artificial homogenization of Indigenous peoples may be challenged.We regard an important potential benefit of an online museum as the replacement of accessing material through the “unassailable voice” with the multiplicity of Indigenous voices. A number of ways to do this are suggested by a variety of new media artworks, including those that employ a database to rearrange information to reveal underlying cultural positions (Paul 100). Paul discusses the work of, amongst others, George Legrady. She describes how it engages with the archive and database as sites that record culture (104-6). Paul specifically discusses Legrady’s work Slippery Traces. This involved viewers navigating through more than 240 postcards. Viewers of work were invited to “first chose one of three quotes appearing on the screen, each of which embodies a different perspective—anthropological, colonialist, or media theory—and thus provides an interpretive angle for the experience of the projects” (104-5). In the same way visitors to an online museum could be provided with a choice of possible Indigenous voices by which its collection might be experienced. We are specifically interested in the implications that such approaches have for the way in which online museums could engage with film. Inspired by Basu’s work on reframing ethnographic film, we see the online museum as providing the possibility of a platform to experiment with new media art in order to expose the meta-narrative(s) about the politics of film making. As Basu argues, in order to provoke a feeling of involvement with the viewer, it is important that the viewer becomes aware “of the plurality of alternative readings/navigations that they might have made” (105). As Weinbren has observed, where a fixed narrative pathway has been constructed by a film, digital technology provides a particularly effective means to challenge it. It would be possible to reveal the way in which dominant political interests regarding Indigenous cultures have been asserted, such as for example in the popular film The Gods Must Be Crazy. New media art once again provides some interesting examples of the way ideology, that might otherwise remain unclear, may be exposed. Paul describes the example of Jennifer and Kevin McCoy’s project How I learned. The work restructures a television series Kung Fu by employing “categories such as ‘how I learned about blocking punches,’ ‘how I learned about exploiting workers,’ or ‘how I learned to love the land’” (Paul 103) to reveal in greater clarity, than otherwise might be possible, the cultural stereotypes used in the visual narratives of the program (Paul 102-4). We suggest that such examples suggest the ways in which online museums could work to reveal and explore the existence not only of meta-narratives expressed by museums as a whole, but also the means by which they are realised within existing items held in museum collections.ConclusionWe argue that the agency for such reflective moments between the San, who have been repeatedly misrepresented or underrepresented in exhibitions and films, and multiple audiences, may be enabled through the generation of multiple narratives within online museums. We would like to make the point that, first and foremost, the theory of representation must be fully understood and acknowledged in order to determine whether, and how, modes of online curating are censorious. As such we see online museums having the potential to play a significant role in illuminating for both the San and multiple audiences the way that any form of representation or displaying restricts the meanings that may be recovered about Indigenous peoples. ReferencesAppadurai, Arjun. The Social Life of Things: Commodities in Cultural Perspective. Cambridge: Harvard UP, 1986. Bal, Mieke. “Exhibition as Film.” Exhibition Experiments. Ed. Sharon Macdonald and Paul Basu. Malden: Blackwell Publishing 2007. 71-93. Basu, Paul. “Reframing Ethnographic Film.” Rethinking Documentary. Eds. Thomas Austin and Wilma de Jong. Maidenhead: Open U P, 2008. 94-106.Barringer, Tim, and Tom Flynn. Colonialism and the Object: Empire, Material Culture and the Museum. London: Routledge, 1998. Baxandall, Michael. "Exhibiting Intention: Some Preconditions of the Visual Display of Culturally Purposeful Objects." Exhibiting Cultures. Ed. Ivan Karp and Steven Lavine. Washington: Smithsonian Institution P. 1991. 33-41.Bell, Joshua. “Promiscuous Things: Perspectives on Cultural Property through Photographs in the Purari Delta of Papa New Guinea.” International Journal of Cultural Property 15 (2008): 123-39.Bennett, Tony. “The Political Rationality of the Museum.” Continuum: The Australian Journal of Media & Culture 3 No.1 (1990). 8 Oct. 2008 ‹http://wwwmcc.murdoch.edu.au/ReadingRoom/3.1/Bennett.html›. Bolton, Lissant. “The Object in View: Aborigines, Melanesians and Museums.” Emplaced Myth: Space, Narrative and Knowledge in Australia and Papua New Guinea. Eds. Alan Rumsey & James Weiner. Honolulu: U of Hawai`i P. 2001. 215-32. Bush, Martin. “Shifting Sands: Museum Representations of Science and Indigenous Knowledge Traditions.” Open Museum Journal 7 (2005). 8 Oct. 2008 ‹http://archive.amol.org.au/craft/omjournal/volume7/docs/MBush_ab.asp?ID=›.Busse, Mark. “Museums and the Things in Them Should Be Alive.” International Journal of Cultural Property 15 (2008): 189-200.Butts, David. “Māori and Museums: the Politics of Indigenous Recognition.” Museums, Society and Inequality. Ed. Richard Sandell. London: Routledge, 2002. 225-43.Casey, Dawn. “Culture Wars: Museums, Politics and Controversy.” Open Museum Journal 6 (2003). 8 Oct. 2008 ‹http://archive.amol.org.au/omj/volume6/casey.pdf›.Carter, J. “Museums and Indigenous Peoples in Canada.” Museums and the Appropriation of Culture. Ed. Susan Pearce. London: Athlone P, 1994. 213-33.Carolin, Clare, and Cathy Haynes. “The Politics of Display: Ann-Sofi Sidén’s Warte Mal!, Art History and Social Documentary.” Exhibition Experiments. Eds. Sharon Macdonald and Paul Basu. Malden: Blackwell Publishing, 2007. 154-74.Cooper, Jonathan. “Beyond the On-line Museum: Participatory Virtual Exhibitions.” Museums and the Web 2006: Proceedings. Eds. Jennifer Trant and David Bearman. Albuquerque: Archives & Museum Informatics, 2006. 8 Oct. 2008 ‹www.archimuse.com/mw2006/papers/cooper/cooper.html›.Daniel, Sharon. “The Database: An Aesthetics of Dignity.” Database Aesthetics: Art in the Age of Information Overflow. Ed. Victoria Vesner. Minneapolis: U of Minnesota P, 2007. 142-82.Daniel, Sharon, and Casa Segura. “Need_ X_ Change.” 8 Oct. 2008 ‹http://arts.ucsc.edu/sdaniel/need/›.Daniel, Sharon. “Palabras” 8 Oct. 2008 ‹http://palabrastranquilas.ucsc.edu/›.Daniel, Sharon, and Erik Loyer. “Public Secrets.” Vectors. Winter (2007). 8 Oct. 2008 ‹http://vectors.usc.edu/index.php?page=7&projectId=57›.Dietz, Steve. “Curating (on) the Web.” Museums and the Web 1998: Proceedings. Eds. Jennifer Trant and David Bearman. Toronto: Archives & Museum Informatics, 1998. 8 Oct. 2008 ‹http://www.archimuse.com/mw98/papers/dietz/dietz_curatingtheweb.html›.Dietz, Steve. “Telling Stories: Procedural Authorship and Extracting Meanings from Museum Databases.” Museums and the Web 1999: Proceedings. Eds. Jennifer Trant and David Bearman. New Orleans: Archives & Museum Informatics, 1999. 8 Oct. 2008 ‹http://www.archimuse.com/mw99/papers/dietz/dietz.html›.Gell, Alfred. Art and Agency: An Anthropological Theory. Oxford: Clarendon P, 1998.Geismar, Haidy. (2008) “Cultural Property, Museums, and the Pacific: Reframing the Debates.” International Journal of Cultural Property 15: 109-22.Ginsburg, Faye. “Resources of Hope: Learning from the Local in a Transnational Era.” Indigenous Cultures in an Interconnected World. Ed. Claire Smith & Graeme Ward. St Leonards: Allen & Unwin, 2000. 27-47.Goldblum, Josh, Adele O’Dowd, and Traci Sym. “Considerations and Strategies for Creating Interactive Narratives.” Museums and the Web 2007: Proceedings. Ed. Jennifer Trant and David Bearman. Toronto: Archives & Museum Informatics, 2007. 8 Oct. 2008 ‹www.archimuse.com/mw2007/papers/goldblum/goldblum.html›.Guenther, Matthias. “Contemporary Bushman Art, Identity Politics, and the Primitive Discourse.” The Politics of Egalitarianism: Theory and Practice. Ed. Jacqueline Solway. New York: Berghahn Books, 2006. 159-88. Harding, Sarah. “Culture, Commodification, and Native American Cultural Patrimony.” Rethinking Commodification: Cases and Readings in Law and Culture. Ed. Martha Ertman and Joan Williams. New York: New York U P, 2005. 137-63.Herle, Anita. “Relational Objects: Connecting People and Things through Pasifika Styles.” International Journal of Cultural Property 15 (2008): 159-79.Hoopes, John. “The Future of the Past: Archaeology and Anthropology on the World Wide Web.” Archives and Museum Informatics 11 (1997): 87-105.“South African National Gallery.” Iziko: Museums of Cape Town. 8 Oct. 2008 ‹http://www.iziko.org.za/iziko/ourname.html›.Jones, Anna. “Exploding Canons: The Anthropology of Museums.” Annual Review of Anthropology 22 (1993): 201-20. Kelly, Lynda, and Phil Gordon. “Developing a Community of Practice: Museums and Reconciliation in Australia.” Museums, Society and Inequality. Ed. Richard Sandell. London: Routledge, 2002. 153-74.Kopytoff, Igor. “The Cultural Biography of Things: Commoditization as Process.” The Social Life of Things: Commodities in Cultural Perspective. Ed. Arjun Appadurai. Cambridge: Harvard U P, 1986. 64-91. Kreps, Christina. Theorising Cultural Heritage. Indigenous Curation as Intangible Cultural Heritage: Thoughts on the Relevance of the 2003 UNESCO Convention. Washington: Smithsonian Center for Folklife and Cultural Heritage, 2005.Langlois, Dominique. “Cybermuseology and Intangible Cultural Heritage.” Intersection Conference 2005. York U: Toronto, 2005. 8 Oct. 2008 ‹http://yorku.ca/topia/docs/conference/langlais.pdf›.“Life after the Holocaust.” United States Holocaust Memorial Museum. 8 Oct. 2008 ‹http://www.ushmm.org/museum/exhibit/online/life_after_holocaust/›.Manovich, Lev. The Language of New Media. Cambridge: MIT P, 2001.———. Making Art of Databases. Rotterdam: V2_Publishing/NAi Publishers, 2003.Martin, George, and Saskia Vermeylen. “Intellectual Property, Indigenous Knowledge, and Biodiversity.” Capitalism Nature Socialism 16 (2005): 27-48. Martínez, David. “Re-visioning the Hopi Fourth World: Dan Namingha, Indigenous Modernism, and the Hopivotskwani.” Art History 29 (2006): 145-72. McGee, Julie. “Restructuring South African Museums: Reality and Rhetoric within Cape Town.” New Museum Theory and Practice: An Introduction. Ed. Janet Marstine. Oxford: Blackwell, 2006. 178-99.McTavish, Lianne. “Visiting the Virtual Museum: Art and Experience Online.” New Museum Theory and Practice: An Introduction. Ed. Janet Marstine. Oxford: Blackwell, 2006. 226-45.Morphy, Howard. “Elite Art for Cultural Elites: Adding Value to Indigenous Arts.” Indigenous Cultures in an Interconnected World. Ed. Claire Smith and Graeme Ward. St Leonards: Allen & Unwin, 2000. 129- 43.Paul, Christiane. “The Database as System and Cultural Form: Anatomies of Cultural Narratives.” Database Aesthetics: Art in the Age of Information Overflow. Ed. Victoria Vesner. Minneapolis: U of Minnesota P, 2007. 95-109.Pearce, Susan. Museums and the Appropriation of Culture. London: Athlone P, 1994.Pieterse, Jan Nederveen. “Multiculturalism and Museums: Discourse about Others in the Age of Globalisation.” Theory, Culture & Society 14. 4 (1997): 123-46.“Ripples of Genocide: Journey through Eastern Congo.” United States Holocaust Memorial Museum. 8 Oct. 2008 ‹www.ushmm.org/museum/exhibit/online/congojournal›.Salvador, Mari Lyn. “‘The Kuna Way’: Museums, Exhbitions, and the Politics of Representation of Kuna Art.” Museum Anthropology 18 (1994): 48-52. Samis, Peter. “Artwork as Interface” Archives and Museum Informatics 13.2 (1999): 191-98.Sandell, Richard. “Museums and the Combating of Social Inequality: Roles, Responsibilities, Resistance.” Museums, Society and Inequality. Ed. Richard Sandell. London: Routledge, 2002. 3-23.Seaman, Bill. “Recombinant Poetics and Related Database Aesthetics.” Database Aesthetics: Art in the Age of Information Overflow. Ed. Victoria Vesner. Minneapolis: U of Minnesota P, 2007. 121-41.Sepúlveda dos Santos, Myrian. “Museums and Memory: The Enchanted Modernity.” Journal for Cultural Research 7 (2003): 27-46.Simpson, Moira. Making Representations. Museums in the Post-Colonial Era. London: Routledge, 2001.Skotnes, Pippa. “The Politics of Bushman Representations.” Images and Empires: Visuality in Colonial and Postcolonial Africa. Ed. Paul Landau and Deborah Kaspin. London: U of London P, 2002. 253-74.Sledge, Jane. “Stewarding Potential.” First Monday 12.7 (2007). 8 Oct. 2008 ‹http://www.firstmonday.org/issues/issue12_7/sledge/index.html›.Solanilla, Laura. “The Internet as a Tool for Communicating Life Stories: A New Challenge for Memory Institutions.” International Journal for Intangible Heritage 3 (2008): 103-16.Stalbaum, Brett. “An Interpretive Framework for Contemporary Database Practice in the Arts.” (2004). 8 Oct. 2008 ‹http://www.cityarts.com/paulc/database/Database_Stalbaum.doc›.Suzman, James. An Introduction to the Regional Assessment of the Status of the San in Southern Africa. Windhoek: Legal Assistance Centre, 2001.Stanley, Nick. “Introduction: Indigeneity and Museum Practice in the Southwest Pacific.” The Future of Indigenous Museums: Perspectives from the Southwest Pacific. Ed. Nick Stanley. New York: Berghahn Books, 2007. 1-37. Strathern, Marilyn. Property, Substance and Effect: Anthropological Essays on Persons and Things. London: Athlone, 1999. The Gods Must Be Crazy. Dir. Jamie Uys. Mimosa Films, 1980.Tomaselli, Keyan. “Rereading the Gods Must be Crazy Films.” Visual Anthropology 19 (2006):171-200.Trant, Jennifer. “Exploring the Potential for Social Tagging and Folksonomy in Art Museums: Proof of Concept.” New Review of Hypermedia and Multimedia 12.1 (2006). 8 Oct. 2008 ‹www.archimuse.com/papers/steve-nrhm-0605preprint.pdf›.Vermeylen, Saskia. “Contextualising ‘Fair’ and ‘Equitable’: the San’s Reflections on the Hoodia Benefit Sharing Agreement.” Local Environment 12.4 (2007): 1-14.———. “From Life Force to Slimming Aid: Exploring Views on the Commodification of Traditional Medicinal Knowledge.” Applied Geography 28 (2008): 224-35.———. Martin, George, and Roland Clift. “Intellectual Property Rights Systems and the ‘Assemblage’ of Local Knowledge Systems.” International Journal of Cultural Property 15 (2008): 201-21.———. “Land Rights and the Legacy of Colonialism.” Community Consent and Benefit-Sharing: Learning Lessons from the San Hoodia Case Ed. Rachel Wynberg and Roger Chennells. Berlin: Springer. Forthcoming.———, and Jeremy Pilcher. Indigenous Cultural Heritage and the Virtual Museum. Conference Paper. International Conference on the Inclusive Museum. Leiden, The Netherlands. 8-11 June 2008.Walsh, Peter. “The Web and the Unassailable Voice.” Archives and Museum Informatics 11 (1997): 77-85.Weinbren, Grahame. “Ocean, Database, Recut.” Database Aesthetics: Art in the Age of Information Overflow. Ed. Victoria. Vesner. Minneapolis: U of Minnesota P, 2007. 61-85.Weiner, James. “Televisualist Anthropology: Representation, Aesthetics, Politics [and Comments and Reply].” Current Anthropology 38 (1997): 197-235.“Yearbook 2006.” 8 Oct. 2008 ‹http://www.y06.org/›.Zimmerman, Larry, Karen Zimmerman, and Leonard Bruguier. “Cyberspace Smoke Signals: New Technologies and Native American Ethnicity.” Indigenous Cultures in an Interconnected World. Ed. Claire Smith & Graeme Ward. St Leonards: Allen & Unwin, 2000. 69-86.

Collards (Brassica oleracea var. acephala) are grown throughout the United States. Hydroponic greens are more common now due to technological advances lowering the cost and increasing the efficacy of production. In January 2021, a 325 m2 indoor hydroponic farm opened to provide fresh produce for a school in Los Angeles County, CA. Three week old collard seedlings were purchased from a local nursery, rinsed of their rooting media, and transplanted into deep water culture beds (1.2 m x 2.5 m x 0.3 m). Two weeks later, symptoms including plant stunting, chlorosis, leaf curling and wilting, and brown necrotic roots appeared. By and by 80-100% of usable plants were lost to disease. Symptomatic roots were plated on corn meal agar (CMA) amended with 2 ml of 25% lactic acid and CMA amended with pimaricin, ampicillin, rifampicin, and pentachloronitrobenzene (PARP) (Kannwischer et al. 1978). After 2 days a single colony type emerged on PARP but no growth occurred on acidified CMA. Representative isolates were transferred to CMA and to filtered (0.02 µm) soil extract solution with boiled grass blades (Martin 1992), both of which were incubated at 22 C and ambient light conditions. On CMA, isolates produced coenocytic mycelium with minimal aerial hyphae. After 24 h in soil extract, isolates developed filamentous sporangia, elongated discharge tubes with slightly inflated tips, and zoospores. Oospores were not observed. Pathogenicity was confirmed by soaking the roots of five day old collard seedlings in beakers containing zoospores (1 x 102 zoospores/ml) in filtered soil extract. Four isolates were tested on 15 seedlings each. After 24 h at 22 C in ambient light conditions, plants were transferred to new beakers with roots placed on filter paper at the bottom and saturated with sterile distilled water. Three days after this transfer, leaves on all plants turned chlorotic and roots developed brown lesions from which morphologically identical colonies were isolated. Control plants, soaked in filtered soil extract, developed no root or foliar symptoms. To molecularly identify the collard isolates, DNA was extracted from mycelial original and re-isolated isolates and was amplified by PCR using mitochondrial primers for the cytochrome oxidase I (COI) gene (Robideau et al. 2011) and the cytochrome oxidase II (COX2) gene (Martin 2000). The only species that matched both loci from the original and re-isolated isolates with a high percent identity was Pythium dissotocum. The COI locus from the original isolate (MZ027311) matched P. dissotocum with 99% identity and with 332/334 base pairs matching the isolate with Sequence ID MT981134.1. From the re-isolated isolate (MZ027313), the COIequence perfectly matched 657/657 base pairs of P. dissotocum (Sequence ID MT981147.1). The COX2 locus from the original isolate (MZ027312) matched P. dissotocum (Sequence ID MG719859.1) with a 99% identity and 517/518 matching base pairs and the re-isolated isolate (MZ027314) perfectly matched P. dissotocum (Sequence ID MG719859.1) with 515/515 matching base pairs. Based on these molecular and morphological data, the isolates were identified as Pythium dissotocum. To our knowledge, this is the first report of P. dissotocum causing root rot on collards. At this same facility, P. dissotocum was also confirmed as the cause of declining bean (Phaseolus vulgaris) plants. As hydroponics will be necessary to feed a growing population – especially in urban areas -- and because leafy greens are a main crop of the hydroponics industry, we anticipate this issue may become common. Hydroponic systems are highly conducive to the persistence of Oomycetes and a record of infection and plan of action will be necessary to preserve crop health.

Introduction Mentors play a role in real life, just as they do in fiction. They also feature in reality television, which sits somewhere between the two. In fiction, mentors contribute to the narrative arc by providing guidance and assistance (Vogler 12) to a mentee in his or her life or professional pursuits. These exchanges are usually characterized by reciprocity, the need for mutual recognition (Gadamer 353) and involve some kind of moral question. They dramatise the possibilities of mentoring in reality, to provide us with a greater understanding of the world, and our human interaction within it. Reality television offers a different perspective. Like drama it uses the plot device of a mentor character to heighten the story arc, but instead of focusing on knowledge-based portrayals (Gadamer 112) of the mentor and mentee, the emphasis is instead on the mentee’s quest for ascension. In attempting to transcend their unknownness (Boorstin) contestants aim to penetrate an exclusive creative class (Florida). Populated by celebrity chefs, businessmen, entertainers, fashionistas, models, socialites and talent judges (to name a few), this class seemingly adds authenticity to ‘competitions’ and other formats. While the mentor’s role, on the surface, is to provide divine knowledge and facilitate the journey, a different agenda is evident in the ways carefully scripted (Booth) dialogue heightens the drama through effusive praise (New York Daily News) and “tactless” (Woodward), humiliating (Hirschorn; Winant 69; Woodward) and cruel sentiments. From a screen narrative point of view, this takes reality television as ‘storytelling’ (Aggarwal; Day; Hirschorn; “Reality Writer”; Rupel; Stradal) into very different territory. The contrived and later edited (Crouch; Papacharissi and Mendelson 367) communication between mentor and mentee not only renders the relationship disingenuous, it compounds the primary ethical concerns of associated Schadenfreude (Balasubramanian, Forstie and van den Scott 434; Cartwright), and the severe financial inequality (Andrejevic) underpinning a multi-billion dollar industry (Hamilton). As upward mobility and instability continue to be ubiquitously portrayed in 21st century reality entertainment under neoliberalism (Sender 4; Winant 67), it is with increasing frequency that we are seeing the systematic reinvention of the once significant cultural and historical role of the mentor. Mentor as Fictional Archetype and Communicator of ThemesDepictions of mentors can be found across the Western art canon. From the mythological characters of Telemachus’ Athena and Achilles’ Chiron, to King Arthur’s Merlin, Cinderella’s Fairy Godmother, Jim Hawkins’ Long John Silver, Frodo’s Gandalf, Batman’s Alfred and Marty McFly’s Doc Emmett Brown (among many more), the dramatic energy of the teacher, expert or supernatural aid (Vogler 39) has been timelessly powerful. Heroes, typically, engage with a mentor as part of their journey. Mentor types range extensively, from those who provide motivation, inspiration, training or gifts (Vogler), to those who may be dark or malevolent, or have fallen from grace (such as Michael Douglas’ Gordon Gekko in Wall Street 1987, or the ex-tribute Haymitch in The Hunger Games, 2012). A good drama usually complicates the relationship in some way, exploring initial reluctance from either party, or instances of tragedy (Vogler 11, 44) which may prevent the relationship achieving its potential. The intriguing twist of a fallen or malevolent mentor additionally invites the audience to morally analyze the ways the hero responds to what the mentor provides, and to question what our teachers or superiors tell us. In television particularly, long running series such as Mad Men have shown how a mentoring relationship can change over time, where “non-rational” characters (Buzzanell and D’Enbeau 707) do not necessarily maintain reciprocity or equality (703) but become subject to intimate, ambivalent and erotic aspects.As the mentor in fiction has deep cultural roots for audiences today, it is no wonder they are used, in a variety of archetypal capacities, in reality television. The dark Simon Cowell (of Pop Idol, American Idol, Britain’s Got Talent, America’s Got Talent and The X-Factor series) and the ‘villainous’ (Byrnes) Michelin-starred Marco Pierre White (Hell’s Kitchen, The Chopping Block, Marco Pierre White’s Kitchen Wars, MasterChef Australia, New Zealand, South Africa) provide reality writers with much needed antagonism (Rupel, Stradal). Those who have fallen from grace, or allowed their personal lives to play out in tabloid sagas such as Britney Spears (Marikar), or Caitlyn Jenner (Bissinger) provide different sources of conflict and intrigue. They are then counterbalanced with or repackaged as the good mentor. Examples of the nurturer who shows "compassion and empathy" include American Idol’s Paula Abdul (Marche), or the supportive Jennifer Hawkins in Next Top Model (Thompson). These distinctive characters help audiences to understand the ‘reality’ as a story (Crouch; Rupel; Stradal). But when we consider the great mentors of screen fiction, it becomes clear how reality television has changed the nature of story. The Karate Kid I (1984) and Good Will Hunting (1998) are two examples where mentoring is almost the exclusive focus, and where the experience of the characters differs greatly. In both films an initially reluctant mentor becomes deeply involved in the mentee’s project. They act as a special companion to the hero in the face of isolation, and, significantly, reveal a tragedy of their own, providing a nexus through which the mentee can access a deeper kind of truth. Not only are they flawed and ordinary people (they are not celebrities within the imagined worlds of the stories) who the mentee must challenge and learn to truly respect, they are “effecting and important” (Maslin) in reminding audiences of those hidden idiosyncrasies that open the barriers to friendship. Mentors in these stories, and many others, communicate themes of class, culture, talent, jealousy, love and loss which inform ideas about the ethical treatment of the ‘other’ (Gadamer). They ultimately prove pivotal to self worth, human confidence and growth. Very little of this thematic substance survives in reality television (see comparison of plots and contrasting modes of human engagement in the example of The Office and Dirty Jobs, Winant 70). Archetypally identifiable as they may be, mean judges and empathetic supermodels as characters are concerned mostly with the embodiment of perfection. They are flawless, untouchable and indeed most powerful when human welfare is at stake, and when the mentee before them faces isolation (see promise to a future ‘Rihanna’, X-Factor USA, Season 2, Episode 1 and Tyra Banks’ Next Top Model tirade at a contestant who had not lived up to her potential, West). If connecting with a mentor in fiction has long signified the importance of understanding of the past, of handing down tradition (Gadamer 354), and of our fascination with the elder, wiser other, then we can see a fundamental shift in narrative representation of mentors in reality television stories. In the past, as we have opened our hearts to such characters, as a facilitator to or companion of the hero, we have rehearsed a sacred respect for the knowledge and fulfillment mentors can provide. In reality television the ‘drama’ may evoke a fleeting rush of excitement at the hero’s success or failure, but the reality belies a pronounced distancing between mentor and mentee. The Creative Class: An Aspirational ParadigmThemes of ascension and potential fulfillment are also central to modern creativity discourse (Runco; Runco 672; United Nations). Seen as the driving force of the 21st century, creativity is now understood as much more than art, capable of bringing economic prosperity (United Nations) and social cohesion to its acme (United Nations xxiii). At the upper end of creative practice, is what Florida called “the creative class: a fast growing, highly educated, and well-paid segment of the workforce” (on whose expertise corporate profits depend), in industries ranging “from technology to entertainment, journalism to finance, high-end manufacturing to the arts” (Florida). Their common ethos is centered on individuality, diversity, and merit; eclipsing previous systems focused on ‘shopping’ and theme park consumerism and social conservatism (Eisinger). While doubts have since been raised about the size (Eisinger) and financial practices (Krätke 838) of the creative class (particularly in America), from an entertainment perspective at least, the class can be seen in full action. Extending to rich housewives, celebrity teen mothers and even eccentric duck hunters and swamp people, the creative class has caught up to the more traditional ‘star’ actor or music artist, and is increasingly marketable within world’s most sought after and expensive media spaces. Often reality celebrities make their mark for being the most outrageous, the cruelest (Peyser), or the weirdest (Gallagher; Peyser) personalities in the spotlight. Aspiring to the creative class thus, is a very public affair in television. Willing participants scamper for positions on shows, particularly those with long running, heavyweight titles such as Big Brother, The Bachelor, Survivor and the Idol series (Hill 35). The better known formats provide high visibility, with the opportunity to perform in front of millions around the globe (Frere-Jones, Day). Tapping into the deeply ingrained upward-mobility rhetoric of America, and of Western society, shows are aided in large part by 24-hour news, social media, the proliferation of celebrity gossip and the successful correlation between pop culture and an entertainment-style democratic ideal. As some have noted, dramatized reality is closely tied to the rise of individualization, and trans-national capitalism (Darling-Wolf 127). Its creative dynamism indeed delivers multi-lateral benefits: audiences believe the road to fame and fortune is always just within reach, consumerism thrives, and, politically, themes of liberty, egalitarianism and freedom ‘provide a cushioning comfort’ (Peyser; Pinter) from the domestic and international ills that would otherwise dispel such optimism. As the trials and tests within the reality genre heighten the seriousness of, and excitement about ascending toward the creative elite, show creators reproduce the same upward-mobility themed narrative across formats all over the world. The artifice is further supported by the festival-like (Grodin 46) symbology of the live audience, mass viewership and the online voting community, which in economic terms, speaks to the creative power of the material. Whether through careful manipulation of extra media space, ‘game strategy’, or other devices, those who break through are even more idolized for the achievement of metamorphosing into a creative hero. For the creative elite however, who wins ‘doesn’t matter much’. Vertical integration is the priority, where the process of making contestants famous is as lucrative as the profits they will earn thereafter; it’s a form of “one-stop shopping” as the makers of Idol put it according to Frere-Jones. Furthermore, as Florida’s measures and indicators suggested, the geographically mobile new creative class is driven by lifestyle values, recreation, participatory culture and diversity. Reality shows are the embodiment this idea of creativity, taking us beyond stale police procedural dramas (Hirschorn) and racially typecast family sitcoms, into a world of possibility. From a social equality perspective, while there has been a notable rise in gay and transgender visibility (Gamson) and stories about lower socio-economic groups – fast food workers and machinists for example – are told in a way they never were before, the extent to which shows actually unhinge traditional power structures is, as scholars have noted (Andrejevic and Colby 197; Schroeder) open to question. As boundaries are nonetheless crossed in the age of neoliberal creativity, the aspirational paradigm of joining a new elite in real life is as potent as ever. Reality Television’s Mentors: How to Understand Their ‘Role’Reality television narratives rely heavily on the juxtaposition between celebrity glamour and comfort, and financial instability. As mentees put it ‘all on the line’, storylines about personal suffering are hyped and molded for maximum emotional impact. In the best case scenarios mentors such as Caitlyn Jenner will help a trans mentee discover their true self by directing them in a celebrity-style photo shoot (see episode featuring Caitlyn and Zeam, Logo TV 2015). In more extreme cases the focus will be on an adopted contestant’s hopes that his birth mother will hear him sing (The X Factor USA, Season 2, Episode 11 Part 1), or on a postal clerk’s fear that elimination will mean she has to go back “to selling stamps” (The X Factor US - Season 2 Episode 11 Part 2). In the entrepreneurship format, as Woodward pointed out, it is not ‘help’ that mentees are given, but condescension. “I have to tell you, my friend, that this is the worst idea I’ve ever heard. You don’t have a clue about how to set up a business or market a product,” Woodward noted as the feedback given by one elite businessman on The Shark Tank (Woodward). “This is a five million dollar contract and I have to know that you can go the distance” (The X Factor US – Season 2 Episode 11, Part 1) Britney Spears warned to a thirteen-year-old contestant before accepting her as part of her team. In each instance the fictitious premise of being either an ‘enabler’ or destroyer of dreams is replayed and slightly adapted for ongoing consumer interest. This lack of shared experience and mutual recognition in reality television also highlights the overt, yet rarely analyzed focus on the wealth of mentors as contrasted with their unstable mentees. In the respective cases of The X Factor and I Am Cait, one of the wealthiest moguls in entertainment, Cowell, reportedly contracts mentors for up to $15 million per season (Nair); Jenner’s performance in I Am Cait was also set to significantly boost the Kardashian empire (reportedly already worth $300 million, Pavia). In both series, significant screen time has been dedicated to showing the mentors in luxurious beachside houses, where mentees may visit. Despite the important social messages embedded in Caitlyn’s story (which no doubt nourishes the Kardashian family’s generally more ersatz material), the question, from a moral point of view becomes: would these mentors still interact with that particular mentee without the money? Regardless, reality participants insist they are fulfilling their dreams when they appear. Despite the preplanning, possibility of distress (Australia Network News; Bleasby) and even suicide (Schuster), as well as the ferocity of opinion surrounding shows (Marche) the parade of a type of ‘road of trials’ (Vogler 189) is enough to keep a huge fan base interested, and hungry for their turn to experience the fortune of being touched by the creative elite; or in narrative terms, a supernatural aid. ConclusionThe key differences between reality television and artistic narrative portrayals of mentors can be found in the use of archetypes for narrative conflict and resolution, in the ways themes are explored and the ways dialogue is put to use, and in the focus on and visibility of material wealth (Frere-Jones; Peyser). These differences highlight the political, cultural and social implications of exchanging stories about potential fulfillment, for stories about ascension to the creative class. Rather than being based on genuine reciprocity, and understanding of human issues, reality shows create drama around the desperation to penetrate the inner sanctum of celebrity fame and fortune. In fiction we see themes based on becoming famous, on gender transformation, and wealth acquisition, such as in the films and series Almost Famous (2000), The Bill Silvers Show (1955-1959), Filthy Rich (1982-1983), and Tootsie (1982), but these stories at least attempt to address a moral question. Critically, in an artistic - rather than commercial context – the actors (who may play mentees) are not at risk of exploitation (Australia Network News; Bleasby; Crouch). Where actors are paid and recognized creatively for their contribution to an artistic work (Rupel), the mentee in reality television has no involvement in the ways action may be set up for maximum voyeuristic enjoyment, or manipulated to enhance scandalous and salacious content which will return show and media profits (“Reality Show Fights”; Skeggs and Wood 64). The emphasis, ironically, from a reality production point of view, is wholly on making the audience believe (Papacharissi and Mendelson 367) that the content is realistic. This perhaps gives some insight as to why themes of personal suffering and instability are increasingly evident across formats.On an ethical level, unlike the knowledge transferred through complex television plots, or in coming of age films (as cited above) about the ways tradition is handed down, and the ways true mentors provide altruistic help in human experience; in reality television we take away the knowledge that life, under neoliberalism, is most remarkable when one is handpicked to undertake a televised journey featuring their desire for upward mobility. The value of the mentoring in these cases is directly proportionate to the financial objectives of the creative elite.ReferencesAggarwal, Sirpa. “WWE, A&E Networks, and Simplynew Share Benefits of White-Label Social TV Solutions at the Social TV Summit.” Arktan 25 July 2012. 1 August 2014 <http://arktan.com/wwe-ae-networks-and-simplynew-share-benefits-of-white-label-social-tv-solutions-at-the-social-tv-summit/>. Andrejevic, Mark. “The Work of Being Watched: Interactive Media and the Exploitation of Self-Disclosure.” Critical Studies in Media Communication 19.2 (2002): 230–48.Andrejevic, Mark, and Dean Colby. “Racism and Reality TV: The Case of MTV's Road Rules”. How Real Is Reality TV? Essays on Representation and Truth. Ed. David. S. Escoffery. Jefferson: McFarland and Company, 2006. 195–210. Balasubramanian, Savina, Clare Forstie, and Lisa-Jo K. van den Scott. “Shining Stars, Blind Sides, and 'Real' Realities: Exit Rituals, Eulogy Work, and Allegories in Reality Television.” Journal of Contemporary Ethnography 44.4 (2015): 417-49. Bissinger, Buz. “Caitlyn Jenner: The Full Story.” Vanity Fair 25 June 2015. 13 April 2016 <http://www.vanityfair.com/hollywood/2015/06/caitlyn-jenner-bruce-cover-annie-leibovitz>. Bleasby, Tom. “You Are Literally Watching on TV the Worst Experience of My Life.” Twitter @TomBleasby 12 Oct. 2015.Boorstin, Daniel J. The Image: A Guide to Pseudo-Events in America. 25th anniversary ed. New York: Vintage Books, 1987 (1962). Booth, William. “Reality Is Only an Illusion, Writers Say: Hollywood Scribes Want a Cut of Not-So-Unscripted Series.” The Washington Post 10 Aug. 2004. 10 April 2016 <http://www.washingtonpost.com/wp-dyn/articles/A53032-2004Aug9.html>.Buzzanell, Patrice, and Suzy D’Enbeau. “Intimate, Ambivalent and Erotic Mentoring: Popular Culture and Mentor–Mentee Relational Processes in Mad Men.” Human Relations 67.6 (2014): 695–714.Byrnes, Holly. “Michelin-Starred Mentor Marco Pierre White Says He’s No MasterChef Villain”. The Daily Telegraph 11 July 2015. 11 April 2016 <http://www.dailytelegraph.com.au/entertainment/michelinstarred-mentor-marco-pierre-white-says-hes-no-masterchef-villain/news-story/88c0f5df8390ddd07c4a67cdf8c9ea66>. “Caitlyn Jenner & Zeam | Beautiful as I Want to Be.” Logo TV 28 Oct. 2015. 8 Jan. 2016 <https://www.youtube.com/watch?v=R0mDFzBEYOY>.Creative Economy Report: The Challenge of Assessing the Creative Economy: Towards Informed Policy Making. Geneva: United Nations; UNCTAD, 2008. 5 Jan. 2015 <http://unctad.org/en/Docs/ditc20082cer_en.pdf>.Creative Economy Report: A Feasible Development Option. Geneva: United Nations; UNCTAD, 2010. 5 Jan. 2015 <http://unctad.org/en/Docs/ditctab20103_en.pdf>.Crouch, Michael. “13 Secrets Reality TV Show Producers Won’t Tell You.” Readers Digest 21 Feb. 2016. 15 Mar. 2016 <http://www.rd.com/culture/13-secrets-reality-tv-show-producers-wont-tell-you/>. Cartwright, Martina. “Tantalized by Train Wreck Reality Television.” Psychology Today 31 Jan. 2013. 1 June 2014 <https://www.psychologytoday.com/blog/food-thought/201301/tantalized-train-wreck-reality-television>. Day, Elizabeth. “Why Reality TV Works.” The Guardian (UK) 21 Nov. 2010. 14 July 2014 <http://www.theguardian.com/tv-and-radio/2010/nov/21/why-reality-tv-works> Darling-Wolf, Fabienne. “World Citizens ‘a la francaise’: Star Academy and the Negotiation of ‘French Identities’.” The Politics of Reality Television: Global Perspectives. Eds. Marwan M. Kraidy and Katherine Sender. New York: Routledge, 2011. 127-39. Eisinger, Peter. “Richard Florida, The Rise of the Creative Class.” Political Science 55 (2003): 82-83. Frere-Jones, Sasha. “Idolatry: Everybody’s a Critic.” New Yorker Magazine 19 May 2008. 10 Jan. 2016 <http://www.newyorker.com/magazine/2008/05/19/idolatry>.Gadamer, Hans-Georg. Truth and Method. Trans. Joel Weinsheimer and Donald D. Marshall. 2nd ed. London: Continuum Publishing Group, 2004 (1975). Gallagher, Brenden. “The 10 Weirdest Reality TV Shows of All Time.” VH1 28 Aug 2015. 10 Jan. 2016 <http://www.vh1.com/news/200027/10-weirdest-reality-tv-shows/>.Greenwood, Carl. “Simon Cowell Returns to X Factor after Signing £25 Million Deal Making Him the Highest Paid Entertainer Ever.” Mirror Online 19 Dec. 2013. 5 Jan 2016 <http://www.mirror.co.uk/tv/tv-news/simon-cowell-returns-x-factor-2935811>.Gamson, Joshua. “Reality Queens.” Contexts (Meditations) 12.2 (2013): 52-54. Good Will Hunting. Directed by Gus Van Sant. Laurence Bender Productions, 1998. Grodin, Jean. “Play, Festival, and Ritual in Gadamer: On the Theme of the Immemorial in His Later Works.” Language and Linguisticality in Gadamer’s Hermeneutics. Trans. Ed. Lawrence K. Schmidt. Maryland: Lexington Books, 2001. 43-50. Hamilton, Peter. “The Unreal Rise of Reality Television.” Huffington Post Entertainment 25 Sep. 2013. 5 Jun. 2015 <http://www.documentarytelevision.com/commissioning-process/the-unreal-rise-of-reality-television/ Page>. Hill, Annette. Reality TV: Audiences and Popular Factual Television. Oxon: Routledge, 2005. Hirschorn, Michael. “The Case for Reality TV: What the Snobs Don’t Understand.” The Atlantic May 2007. 16 April 2015 <http://www.theatlantic.com/magazine/archive/2007/05/the-case-for-reality-tv/305791/>. I Am Cait. Bunim Murray Productions and E! Entertainment. 26 Jul. 2015. The Karate Kid. Directed by John G. Avilsden. Columbia Pictures, 1984. Krätke, Stefan. “‘Creative Cities’ and the Rise of the Dealer Class: A Critique of Richard Florida’s Approach to Urban Theory.” International Journal of Urban and Regional Research 34 (2010): 835-53. Mad Men. Matthew Weiner. Weiner Bros. 19 Jul. 2007. Maslin, Janet. “Good Will Hunting (1997) FILM REVIEW; Logarithms and Biorhythms Test a Young Janitor.” New York Times 5 Dec. 1997.Marche, Stephen. “How Much Do We Owe Simon Cowell?” Esquire.com 11 Jan. 2010. 7 Feb. 2016 <http://www.esquire.com/news-politics/a6899/simon-cowell-leaving-american-idol-0110/>. Marikar, Sheila. “Bald and Broken: Inside Britney’s Shaved Head.” American Broadcasting Corporation 19 Feb. 2007. 13 Apr. 2016 <http://abcnews.go.com/Entertainment/Health/story?id=2885048>.Nair, Drishya. “Britney Spears to Join X Factor for $15 Million to Be the Highest Paid Judge Ever? Other Highly Paid Judges in Reality Shows.” International Business Times 12 Apr. 2012. 7 Feb. 2016 <http://www.ibtimes.com/britney-spears-join-x-factor-15-million-be-highest-paid-judge-ever-other-highly-paid-judges-reality>. New York Daily News. “Reality Bites: 'American Idol' Judges, Especially Ellen, Overly Praise Tim Urban for 'Hallelujah'.” New York Daily News 12 Mar. 2010. 11 April 2016 <http://www.nydailynews.com/entertainment/tv-movies/reality-bites-american-idol-judges-ellen-overly-praise-tim-urban-hallelujah-article-1.176978>. Orbe, Mark. “Representations of Race in Reality TV: Watch and Discuss.” Critical Studies in Media Communication 25.4 (2008) 345-52. Papacharissi, Zizi, and Andrew L. Mendelson. “Exploratory Study of Reality Appeal: Uses and Gratifications of Reality Shows.” Journal of Broadcasting and Electronic Media 51.2 (2007): 355-70. Pavia, Lucy. “Kardashian Net Worth: How Much Money Do They All Have Individually?” Instyle.co.uk 4 Dec. 2015. 6 Jan. 2016 <http://www.instyle.co.uk/celebrity/news/the-kardashian-rich-list-what-are-they-all-worth-individually#XkRy3pjE5mo1sxfG.99>.Pesce, Nicole. “Jenner's Gold! Caitlyn 'Could Be Worth over $500 Million' in Coming Years.” New York Daily News 3 June 2015. 6 Jan. 2016 <http://www.nydailynews.com/entertainment/gossip/caitlyn-jenner-richer-kardashians-experts-article-1.2244402>.Peyser, Marc. “AMERICAN IDOL.” Newsweek 13 Dec. 2008. 5 Jan. 2016 <http://europe.newsweek.com/american-idol-82867?rm=eu>.Pinter, Harold. “Art, Truth & Politics". Nobelprize.org. Nobel Lecture. Stockholm: Nobel Media AB, 2014. 13 Apr 2016 <http://www.nobelprize.org/nobel_prizes/literature/laureates/2005/pinter-lecture-e.html>. “Reality Show Fights.” American Broadcasting Corporation 30 Mar. 2011. 24 July 2014 <https://www.youtube.com/watch?v=X8bhnTfxWz8>.“Reality Writer.” WGAW Writer’s Guild of America West, n.d. 25 April 2014 <http://www.wga.org/organizesub.aspx?id=1092>. Runco, Mark A. “Everyone Has Creative Potential.” Creativity: From Potential to Realization. Washington DC: American Psychological Association, 2004. 21-30. ———. “Creativity.” Annual Review Psychology 55 (2004): 657–87. Rupel, David. “How Reality TV Works.” WGAW Writer’s Guild of America West, n.d. 15 May 2014 <http://www.wga.org/organizesub.aspx?id=1091>.Sender, Katherine. “Real Worlds: Migrating Genres, Travelling Participants, Shifting Theories.” The Politics of Reality Television: Global Perspectives. Eds. Marwan M. Kraidy and Katherine Sender. New York: Routledge, 2011. 1-13. Skeggs, Beverly, and Helen Wood. Reacting to Reality Television: Performance, Audience and Value. New York: Routledge, 2012. Stradal, Ryan. J. “Unscripted Does Not Mean Unwritten.” WGAW Writer’s Guild of America West, n.d. 15 May 2014 <http://www.wga.org/organizesub.aspx?id=1096>. Schroeder E.R. “‘Sexual Racism’ and Reality Television: Privileging the White Male Prerogative on MTV’s The Real World: Philadelphia.” How Real Is Reality TV?: Essays on Representation and Truth. Ed. D.S. Escoffery. Jefferson, NC: McFarland, 2006. 180–94. Schuster, Dana. “Dying for Fame: 21 Reality Stars Committed Suicide in a Decade.” New York Post 28 Feb. 2016. 11 April 2016 <http://nypost.com/2016/02/28/dying-for-fame-21-reality-stars-commit-suicide-in-past-decade/>.The X Factor (UK). TV show. ITV 4 Sep. 2004 to present. Thompson, Bronwyn. “FAST TRACK TO THE FINAL 12.” Fox 8 TV, 2015. 11 Apr. 2016 <http://www.fox8.tv/shows/australias-next-top-model/show/news>. Vogler, Chris. The Writer’s Journey: Mythic Structure for Writers. 3rd ed. Studio City: Michael Wiese Productions, 2007.West, Latoya. “INTERVIEW: Top Model's Tiffany Talks about Being Yelled At by Tyra Banks.” About Entertainment: Reality TV. 20 Feb. 2016. 13 Apr. 2016 <http://realitytv.about.com/od/thelatestinterviews/a/TiffanyChat.htm>. Winant, Gabriel. “Dirty Jobs, Done Dirt Cheap: Working in Reality Television.” New Labor Forum 23.3 (2014): 66-71. Woodward, Gary C. “Is Mentoring Out of Fashion?” The Perfect Response 6 Mar. 2015. 11 Apr. 2016 <https://theperfectresponse.pages.tcnj.edu/2015/03/06/is-mentoring-out-of-fashion/>. Wyatt, Daisy. “I Am Cait: Caitlyn Jenner 'Paid a Record-Breaking $5 Million' for E! Reality TV Show.” Independent 12 June 2015. 5 Feb. 2016 <http://www.independent.co.uk/arts-entertainment/tv/news/caitlyn-jenner-paid-record-5m-to-front-e-reality-tv-show-i-am-cait-10315826.html>. “‘X Factor’ UK 2015 Dark Secrets: ‘Horrific’ & Like ‘Prison’ Says Contestant.” Australia Network News 19 Nov. 2015. 1 Nov. 2015 <http://www.australianetworknews.com/x-factor-uk-2015-dark-secrets-horrific-like-prison-says-contestant/>.

Introduction The aim of this paper is to examine whether recent catastrophic tsunamis have driven a cultural shift in the awareness of Australians to the danger associated with this natural hazard and whether the media have contributed to the emergence of “tsunami” as a new Australian catastrophe. Prior to the devastating 2004 Indian Ocean Tsunami disaster (2004 IOT), tsunamis as a type of hazard capable of generating widespread catastrophe were not well known by the general public and had barely registered within the wider scientific community. As a university based lecturer who specialises in natural disasters, I always started my public talks or student lectures with an attempt at a detailed description of what a tsunami is. With little high quality visual and media imagery to use, this was not easy. The Australian geologist Ted Bryant was right when he named his 2001 book Tsunami: The Underrated Hazard. That changed on 26 December 2004 when the third largest earthquake ever recorded occurred northwest of Sumatra, Indonesia, triggering the most catastrophic tsunami ever experienced. The 2004 IOT claimed at least 220,000 lives—probably more—injured tens of thousands, destroyed widespread coastal infrastructure and left millions homeless. Beyond the catastrophic impacts, this tsunami was conspicuous because, for the first time, such a devastating tsunami was widely captured on video and other forms of moving and still imagery. This occurred for two reasons. Firstly, the tsunami took place during daylight hours in good weather conditions—factors conducive to capturing high quality visual images. Secondly, many people—both local residents and westerners who were on beachside holidays and at the coast at multiple locations impacted by the tsunami—were able to capture images of the tsunami on their cameras, videos, and smart phones. The extensive media coverage—including horrifying television, video, and still imagery that raced around the globe in the hours and days after the tsunami, filling our television screens, homes, and lives regardless of where we lived—had a dramatic effect. This single event drove a quantum shift in the wider cultural awareness of this type of catastrophe and acted as a catalyst for improved individual and societal understanding of the nature and effects of disaster landscapes. Since this event, there have been several notable tsunamis, including the March 2011 Japan catastrophe. Once again, this event occurred during daylight hours and was widely captured by multiple forms of media. These events have resulted in a cascade of media coverage across television, radio, movie, and documentary channels, in the print media, online, and in the popular press and on social media—very little of which was available prior to 2004. Much of this has been documentary and informative in style, but there have also been numerous television dramas and movies. For example, an episode of the popular American television series CSI Miami entitled Crime Wave (Season 3, Episode 7) featured a tsunami, triggered by a volcanic eruption in the Atlantic and impacting Miami, as the backdrop to a standard crime-filled episode ("CSI," IMDb; Wikipedia). In 2010, Warner Bros Studios released the supernatural drama fantasy film Hereafter directed by Clint Eastwood. In the movie, a television journalist survives a near-death experience during the 2004 IOT in what might be the most dramatic, and probably accurate, cinematic portrayal of a tsunami ("Hereafter," IMDb; Wikipedia). Thus, these creative and entertaining forms of media, influenced by the catastrophic nature of tsunamis, are impetuses for creativity that also contribute to a transformation of cultural knowledge of catastrophe. The transformative potential of creative media, together with national and intergovernmental disaster risk reduction activity such as community education, awareness campaigns, community evacuation planning and drills, may be indirectly inferred from rapid and positive community behavioural responses. By this I mean many people in coastal communities who experience strong earthquakes are starting a process of self-evacuation, even if regional tsunami warning centres have not issued an alert or warning. For example, when people in coastal locations in Samoa felt a large earthquake on 29 September 2009, many self-evacuated to higher ground or sought information and instruction from relevant authorities because they expected a tsunami to occur. When interviewed, survivors stated that the memory of television and media coverage of the 2004 IOT acted as a catalyst for their affirmative behavioural response (Dominey-Howes and Thaman 1). Thus, individual and community cultural understandings of the nature and effects of tsunami catastrophes are incredibly important for shaping resilience and reducing vulnerability. However, this cultural shift is not playing out evenly.Are Australia and Its People at Risk from Tsunamis?Prior to the 2004 IOT, there was little discussion about, research in to, or awareness about tsunamis and Australia. Ted Bryant from the University of Wollongong had controversially proposed that Australia had been affected by tsunamis much bigger than the 2004 IOT six to eight times during the last 10,000 years and that it was only a matter of when, not if, such an event repeated itself (Bryant, "Second Edition"). Whilst his claims had received some media attention, his ideas did not achieve widespread scientific, cultural, or community acceptance. Not-with-standing this, Australia has been affected by more than 60 small tsunamis since European colonisation (Dominey-Howes 239). Indeed, the 2004 IOT and 2006 Java tsunami caused significant flooding of parts of the Northern Territory and Western Australia (Prendergast and Brown 69). However, the affected areas were sparsely populated and experienced very little in the way of damage or loss. Thus they did not cross any sort of critical threshold of “catastrophe” and failed to achieve meaningful community consciousness—they were not agents of cultural transformation.Regardless of the risk faced by Australia’s coastline, Australians travel to, and holiday in, places that experience tsunamis. In fact, 26 Australians were killed during the 2004 IOT (DFAT) and five were killed by the September 2009 South Pacific tsunami (Caldwell et al. 26). What Role Do the Media Play in Preparing for and Responding to Catastrophe?Regardless of the type of hazard/disaster/catastrophe, the key functions the media play include (but are not limited to): pre-event community education, awareness raising, and planning and preparations; during-event preparation and action, including status updates, evacuation warnings and notices, and recommendations for affirmative behaviours; and post-event responses and recovery actions to follow, including where to gain aid and support. Further, the media also play a role in providing a forum for debate and post-event analysis and reflection, as a mechanism to hold decision makers to account. From time to time, the media also provide a platform for examining who, if anyone, might be to blame for losses sustained during catastrophes and can act as a powerful conduit for driving socio-cultural, behavioural, and policy change. Many of these functions are elegantly described and a series of best practices outlined by The Caribbean Disaster Emergency Management Agency in a tsunami specific publication freely available online (CDEMA 1). What Has Been the Media Coverage in Australia about Tsunamis and Their Effects on Australians?A manifest contents analysis of media material covering tsunamis over the last decade using the framework of Cox et al. reveals that coverage falls into distinctive and repetitive forms or themes. After tsunamis, I have collected articles (more than 130 to date) published in key Australian national broadsheets (e.g., The Australian and Sydney Morning Herald) and tabloid (e.g., The Telegraph) newspapers and have watched on television and monitored on social media, such as YouTube and Facebook, the types of coverage given to tsunamis either affecting Australia, or Australians domestically and overseas. In all cases, I continued to monitor and collect these stories and accounts for a fixed period of four weeks after each event, commencing on the day of the tsunami. The themes raised in the coverage include: the nature of the event. For example, where, when, why did it occur, how big was it, and what were the effects; what emergency response and recovery actions are being undertaken by the emergency services and how these are being provided; exploration of how the event was made worse or better by poor/good planning and prior knowledge, action or inaction, confusion and misunderstanding; the attribution of blame and responsibility; the good news story—often the discovery and rescue of an “iconic victim/survivor”—usually a child days to weeks later; and follow-up reporting weeks to months later and on anniversaries. This coverage generally focuses on how things are improving and is often juxtaposed with the ongoing suffering of victims. I select the word “victims” purposefully for the media frequently prefer this over the more affirmative “survivor.”The media seldom carry reports of “behind the scenes” disaster preparatory work such as community education programs, the development and installation of warning and monitoring systems, and ongoing training and policy work by response agencies and governments since such stories tend to be less glamorous in terms of the disaster gore factor and less newsworthy (Cox et al. 469; Miles and Morse 365; Ploughman 308).With regard to Australians specifically, the manifest contents analysis reveals that coverage can be described as follows. First, it focuses on those Australians killed and injured. Such coverage provides elements of a biography of the victims, telling their stories, personalising these individuals so we build empathy for their suffering and the suffering of their families. The Australian victims are not unknown strangers—they are named and pictures of their smiling faces are printed or broadcast. Second, the media describe and catalogue the loss and ongoing suffering of the victims (survivors). Third, the media use phrases to describe Australians such as “innocent victims in the wrong place at the wrong time.” This narrative establishes the sense that these “innocents” have been somehow wronged and transgressed and that suffering should not be experienced by them. The fourth theme addresses the difficulties Australians have in accessing Consular support and in acquiring replacement passports in order to return home. It usually goes on to describe how they have difficulty in gaining access to accommodation, clothing, food, and water and any necessary medicines and the challenges associated with booking travel home and the complexities of communicating with family and friends. The last theme focuses on how Australians were often (usually?) not given relevant safety information by “responsible people” or “those in the know” in the place where they were at the time of the tsunami. This establishes a sense that Australians were left out and not considered by the relevant authorities. This narrative pays little attention to the wide scale impact upon and suffering of resident local populations who lack the capacity to escape the landscape of catastrophe.How Does Australian Media Coverage of (Tsunami) Catastrophe Compare with Elsewhere?A review of the available literature suggests media coverage of catastrophes involving domestic citizens is similar globally. For example, Olofsson (557) in an analysis of newspaper articles in Sweden about the 2004 IOT showed that the tsunami was framed as a Swedish disaster heavily focused on Sweden, Swedish victims, and Thailand, and that there was a division between “us” (Swedes) and “them” (others or non-Swedes). Olofsson (557) described two types of “us” and “them.” At the international level Sweden, i.e. “us,” was glorified and contrasted with “inferior” countries such as Thailand, “them.” Olofsson (557) concluded that mediated frames of catastrophe are influenced by stereotypes and nationalistic values.Such nationalistic approaches preface one type of suffering in catastrophe over others and delegitimises the experiences of some survivors. Thus, catastrophes are not evenly experienced. Importantly, Olofsson although not explicitly using the term, explains that the underlying reason for this construction of “them” and “us” is a form of imperialism and colonialism. Sharp refers to “historically rooted power hierarchies between countries and regions of the world” (304)—this is especially so of western news media reporting on catastrophes within and affecting “other” (non-western) countries. Sharp goes much further in relation to western representations and imaginations of the “war on terror” (arguably a global catastrophe) by explicitly noting the near universal western-centric dominance of this representation and the construction of the “west” as good and all “non-west” as not (299). Like it or not, the western media, including elements of the mainstream Australian media, adhere to this imperialistic representation. Studies of tsunami and other catastrophes drawing upon different types of media (still images, video, film, camera, and social media such as Facebook, Twitter, and the like) and from different national settings have explored the multiple functions of media. These functions include: providing information, questioning the authorities, and offering a chance for transformative learning. Further, they alleviate pain and suffering, providing new virtual communities of shared experience and hearing that facilitate resilience and recovery from catastrophe. Lastly, they contribute to a cultural transformation of catastrophe—both positive and negative (Hjorth and Kyoung-hwa "The Mourning"; "Good Grief"; McCargo and Hyon-Suk 236; Brown and Minty 9; Lau et al. 675; Morgan and de Goyet 33; Piotrowski and Armstrong 341; Sood et al. 27).Has Extensive Media Coverage Resulted in an Improved Awareness of the Catastrophic Potential of Tsunami for Australians?In playing devil’s advocate, my simple response is NO! This because I have been interviewing Australians about their perceptions and knowledge of tsunamis as a catastrophe, after events have occurred. These events have triggered alerts and warnings by the Australian Tsunami Warning System (ATWS) for selected coastal regions of Australia. Consequently, I have visited coastal suburbs and interviewed people about tsunamis generally and those events specifically. Formal interviews (surveys) and informal conversations have revolved around what people perceived about the hazard, the likely consequences, what they knew about the warning, where they got their information from, how they behaved and why, and so forth. I have undertaken this work after the 2007 Solomon Islands, 2009 New Zealand, 2009 South Pacific, the February 2010 Chile, and March 2011 Japan tsunamis. I have now spoken to more than 800 people. Detailed research results will be presented elsewhere, but of relevance here, I have discovered that, to begin with, Australians have a reasonable and shared cultural knowledge of the potential catastrophic effects that tsunamis can have. They use terms such as “devastating; death; damage; loss; frightening; economic impact; societal loss; horrific; overwhelming and catastrophic.” Secondly, when I ask Australians about their sources of information about tsunamis, they describe the television (80%); Internet (85%); radio (25%); newspaper (35%); and social media including YouTube (65%). This tells me that the media are critical to underpinning knowledge of catastrophe and are a powerful transformative medium for the acquisition of knowledge. Thirdly, when asked about where people get information about live warning messages and alerts, Australians stated the “television (95%); Internet (70%); family and friends (65%).” Fourthly and significantly, when individuals were asked what they thought being caught in a tsunami would be like, responses included “fun (50%); awesome (75%); like in a movie (40%).” Fifthly, when people were asked about what they would do (i.e., their “stated behaviour”) during a real tsunami arriving at the coast, responses included “go down to the beach to swim/surf the tsunami (40%); go to the sea to watch (85%); video the tsunami and sell to the news media people (40%).”An independent and powerful representation of the disjunct between Australians’ knowledge of the catastrophic potential of tsunamis and their “negative” behavioral response can be found in viewing live television news coverage broadcast from Sydney beaches on the morning of Sunday 28 February 2010. The Chilean tsunami had taken more than 14 hours to travel from Chile to the eastern seaboard of Australia and the ATWS had issued an accurate warning and had correctly forecast the arrival time of the tsunami (approximately 08.30 am). The television and radio media had dutifully broadcast the warning issued by the State Emergency Services. The message was simple: “Stay out of the water, evacuate the beaches and move to higher ground.” As the tsunami arrived, those news broadcasts showed volunteer State Emergency Service personnel and Surf Life Saving Australia lifeguards “begging” with literally hundreds (probably thousands up and down the eastern seaboard of Australia) of members of the public to stop swimming in the incoming tsunami and to evacuate the beaches. On that occasion, Australians were lucky and the tsunami was inconsequential. What do these responses mean? Clearly Australians recognise and can describe the consequences of a tsunami. However, they are not associating the catastrophic nature of tsunami with their own lives or experience. They are avoiding or disallowing the reality; they normalise and dramaticise the event. Thus in Australia, to date, a cultural transformation about the catastrophic nature of tsunami has not occurred for reasons that are not entirely clear but are the subject of ongoing study.The Emergence of Tsunami as a “New Australian Catastrophe”?As a natural disaster expert with nearly two decades experience, in my mind tsunami has emerged as a “new Australian catastrophe.” I believe this has occurred for a number of reasons. Firstly, the 2004 IOT was devastating and did impact northwestern Australia, raising the flag on this hitherto, unknown threat. Australia is now known to be vulnerable to the tsunami catastrophe. The media have played a critical role here. Secondly, in the 2004 IOT and other tsunamis since, Australians have died and their deaths have been widely reported in the Australian media. Thirdly, the emergence of various forms of social media has facilitated an explosion in information and material that can be consumed, digested, reimagined, and normalised by Australians hungry for the gore of catastrophe—it feeds our desire for catastrophic death and destruction. Fourthly, catastrophe has been creatively imagined and retold for a story-hungry viewing public. Whether through regular television shows easily consumed from a comfy chair at home, or whilst eating popcorn at a cinema, tsunami catastrophe is being fed to us in a way that reaffirms its naturalness. Juxtaposed against this idea though is that, despite all the graphic imagery of tsunami catastrophe, especially images of dead children in other countries, Australian media do not and culturally cannot, display images of dead Australian children. Such images are widely considered too gruesome but are well known to drive changes in cultural behaviour because of the iconic significance of the child within our society. As such, a cultural shift has not yet occurred and so the potential of catastrophe remains waiting to strike. Fifthly and significantly, given the fact that large numbers of Australians have not died during recent tsunamis means that again, the catastrophic potential of tsunamis is not yet realised and has not resulted in cultural changes to more affirmative behaviour. Lastly, Australians are probably more aware of “regular or common” catastrophes such as floods and bush fires that are normal to the Australian climate system and which are endlessly experienced individually and culturally and covered by the media in all forms. The Australian summer of 2012–13 has again been dominated by floods and fires. If this idea is accepted, the media construct a uniquely Australian imaginary of catastrophe and cultural discourse of disaster. The familiarity with these common climate catastrophes makes us “culturally blind” to the catastrophe that is tsunami.The consequences of a major tsunami affecting Australia some point in the future are likely to be of a scale not yet comprehensible. References Australian Broadcasting Corporation (ABC). "ABC Net Splash." 20 Mar. 2013 ‹http://splash.abc.net.au/media?id=31077›. Brown, Philip, and Jessica Minty. “Media Coverage and Charitable Giving after the 2004 Tsunami.” Southern Economic Journal 75 (2008): 9–25. Bryant, Edward. Tsunami: The Underrated Hazard. First Edition, Cambridge: Cambridge UP, 2001. ———. Tsunami: The Underrated Hazard. Second Edition, Sydney: Springer-Praxis, 2008. Caldwell, Anna, Natalie Gregg, Fiona Hudson, Patrick Lion, Janelle Miles, Bart Sinclair, and John Wright. “Samoa Tsunami Claims Five Aussies as Death Toll Rises.” The Courier Mail 1 Oct. 2009. 20 Mar. 2013 ‹http://www.couriermail.com.au/news/samoa-tsunami-claims-five-aussies-as-death-toll-rises/story-e6freon6-1225781357413›. CDEMA. "The Caribbean Disaster Emergency Management Agency. Tsunami SMART Media Web Site." 18 Dec. 2012. 20 Mar. 2013 ‹http://weready.org/tsunami/index.php?Itemid=40&id=40&option=com_content&view=article›. Cox, Robin, Bonita Long, and Megan Jones. “Sequestering of Suffering – Critical Discourse Analysis of Natural Disaster Media Coverage.” Journal of Health Psychology 13 (2008): 469–80. “CSI: Miami (Season 3, Episode 7).” International Movie Database (IMDb). ‹http://www.imdb.com/title/tt0534784/›. 9 Jan. 2013. "CSI: Miami (Season 3)." Wikipedia. ‹http://en.wikipedia.org/wiki/CSI:_Miami_(season_3)#Episodes›. 21 Mar. 2013. DFAT. "Department of Foreign Affairs and Trade Annual Report 2004–2005." 8 Jan. 2013 ‹http://www.dfat.gov.au/dept/annual_reports/04_05/downloads/2_Outcome2.pdf›. Dominey-Howes, Dale. “Geological and Historical Records of Australian Tsunami.” Marine Geology 239 (2007): 99–123. Dominey-Howes, Dale, and Randy Thaman. “UNESCO-IOC International Tsunami Survey Team Samoa Interim Report of Field Survey 14–21 October 2009.” No. 2. Australian Tsunami Research Centre. University of New South Wales, Sydney. "Hereafter." International Movie Database (IMDb). ‹http://www.imdb.com/title/tt1212419/›. 9 Jan. 2013."Hereafter." Wikipedia. ‹http://en.wikipedia.org/wiki/Hereafter (film)›. 21 Mar. 2013. Hjorth, Larissa, and Yonnie Kyoung-hwa. “The Mourning After: A Case Study of Social Media in the 3.11 Earthquake Disaster in Japan.” Television and News Media 12 (2011): 552–59. ———, and Yonnie Kyoung-hwa. “Good Grief: The Role of Mobile Social Media in the 3.11 Earthquake Disaster in Japan.” Digital Creativity 22 (2011): 187–99. Lau, Joseph, Mason Lau, and Jean Kim. “Impacts of Media Coverage on the Community Stress Level in Hong Kong after the Tsunami on 26 December 2004.” Journal of Epidemiology and Community Health 60 (2006): 675–82. McCargo, Duncan, and Lee Hyon-Suk. “Japan’s Political Tsunami: What’s Media Got to Do with It?” International Journal of Press-Politics 15 (2010): 236–45. Miles, Brian, and Stephanie Morse. “The Role of News Media in Natural Disaster Risk and Recovery.” Ecological Economics 63 (2007): 365–73. Morgan, Olive, and Charles de Goyet. “Dispelling Disaster Myths about Dead Bodies and Disease: The Role of Scientific Evidence and the Media.” Revista Panamericana de Salud Publica-Pan American Journal of Public Health 18 (2005): 33–6. Olofsson, Anna. “The Indian Ocean Tsunami in Swedish Newspapers: Nationalism after Catastrophe.” Disaster Prevention and Management 20 (2011): 557–69. Piotrowski, Chris, and Terry Armstrong. “Mass Media Preferences in Disaster: A Study of Hurricane Danny.” Social Behavior and Personality 26 (1998): 341–45. Ploughman, Penelope. “The American Print News Media Construction of Five Natural Disasters.” Disasters 19 (1995): 308–26. Prendergast, Amy, and Nick Brown. “Far Field Impact and Coastal Sedimentation Associated with the 2006 Java Tsunami in West Australia: Post-Tsunami Survey at Steep Point, West Australia.” Natural Hazards 60 (2012): 69–79. Sharp, Joanne. “A Subaltern Critical Geopolitics of The War on Terror: Postcolonial Security in Tanzania.” Geoforum 42 (2011): 297–305. Sood, Rahul, Stockdale, Geoffrey, and Everett Rogers. “How the News Media Operate in Natural Disasters.” Journal of Communication 37 (1987): 27–41.

Tobacco (Nicotiana tabacum L.) is a leafy, annual, solanaceous plant grown commercially for its leaves. It is one of the most important cash crops in China. In April of 2020, tobacco stems in commercial tobacco fields developed a brown to dark brown rot, in the Hunan Province of China. Almost 20% of the plants were infected. Symptoms appeared as round water-soaked spots, then turned dark black and developed into brown necrotic lesions leading to the stem becoming girdled and rotted. Diseased stem tissue was cut and sterilized with 70% ethanol for 10 s, 0.1% HgCl2 for 2 min, rinsed with sterile distilled water three times, and then plated on potato dextrose agar (PDA) and incubated at 26°C in the dark. Six isolates with similar morphology were obtained. Colonies cultured on PDA have morphological characteristics of Fusarium spp. producing white to orange-white, densely aerial mycelium with magenta to dark violet pigmentation. Macroconidia were produced on carnation leaf agar plates (Xi et al. 2019), which were slightly curved, with apical and basal cells curved, and usually contained three or five septa, 25.50 to 41.50×3.55 to 5.80 μm (n=50). Microconidia were cylindrical, ovate-oblong, straight to slightly curved, aseptate and 5.80 to 13.75 × 3.10 to 4.10 μm (n=50). For molecular identification, the translation elongation factor 1-alpha (EF1-α), the largest subunit of RNA polymerase II gene sequences (RPB2) and the mitochondrial small subunit rDNA (mtSSU) of a representative isolate CZ3-5-6 were amplified using the primer pairs ef1/ef2 (O’Donnell et al. 1998), 5F2/7Cr (O’Donnell et al. 2010) and NMS1/ NMS2 (Li et al. 1994). The obtained EF1-α, RPB2 and mtSSU sequences (GenBank accession nos. MT708482, MT708483 and MW260121, respectively) were 99.70 %, 100% and 100% identical to strains of F. commune (HM057338.1 for EF1-α, KU171700.1 for RPB2 and MG846025 for mtSSU). Moreover, Fusarium-ID database searches revealed that the EF1-α and RPB2 were 100% identical to F. commune strains (FD_01140_EF-1a and FD_02411_RPB2). Based on the morphological and molecular characteristics of the representative isolate, the fungal species was identified as F. commune. Pathogenicity testing of a representative isolate was performed by inoculating tobacco plants, which were grown for 2.5 months in a sterile pot with autoclaved soil. Each tobacco stem was injected with 20 μl of conidial suspension (105 spores/ml). Plants inoculated with sterilized water served as control. The pathogenicity tests were performed twice using three replicate plants, and all plants were kept in humid chambers (80 × 50 × 80 cm) at 26°C with a 12-h photoperiod. After 10 days, dark brown necrotic symptoms around the inoculated site, similar to those observed in natural field, were developed in all inoculated plants, whereas no symptoms were observed on the control plants. The pathogenic fungus was re-isolated from symptomatic tissue and identified as F. commune but was not recovered from the control plants. Fusarium commune has been reported to cause root rot or stalk and stem rot on some plants, such as sugarcane (Wang et al. 2018), Gentiana scabra (Guan et al. 2016) and maize (Xi et al. 2019). However, to our knowledge, this is the first report of F. commune causing stem rot on tobacco in China. Identification of F. commune as a stem rot causing pathogen might provide important insights for disease diagnosis on tobacco caused by different Fusarium species. Overall, this disease might bring a threat to tobacco production, and appropriate control measures should be adopted to reduce losses in tobacco fields.

Mango (Mangifera indica L.) is the most economically important fruit in the tropical and subtropical regions of the world. Mexico is ranked the fourth largest mango producer worldwide with an approximate production of 2 396 675 t in 2019 (FAO 2020). Sinaloa is the principal mango production state in Mexico with 410,147 t in 2020 (SIAP 2021). Mango malformation disease (MMD) is one of the main limitations in the production of this crop worldwide, causing serious losses in yield. During December 2017 to April 2018, symptoms of MMD were observed in commercial mango in the municipality of El Rosario (Sinaloa, Mexico). These symptoms included malformed and compacted inflorescences, abnormal development of vegetative shoots with shortened internodes at an incidence of 25 %. Tissue from 15 symptomatic trees were superficially disinfested with 2% sodium hypochlorite and transferred to potato dextrose agar (PDA). Typical Fusarium spp. colonies were obtained from all samples. Fifteen pure cultures were obtained by single spore culturing. White to cream-colored aerial mycelia of typical Fusarium colonies were observed from all samples on PDA (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidia (n = 50) were hyaline, relatively slender with a curve, 4 to 5 septate, and measured 39.5 to 76.8 x 5.7 to 9.5 μm. The microconidia (n = 50) were hyaline and pyriform, without septa, and measured 8.1 to 10.6 x 5.1 to 6.9 μm. Chlamydospores were observed. The EF1-α gene (O’Donnell et al. 1998) was amplified by PCR and sequenced from the isolates. The EF1-α sequence from one representative isolate (128FRSIN) was deposited in GenBank with the accession number MK932806. Maximum likelihood analysis was carried out using the representative EF1-α sequence for F. proliferatum (MK932806) and other Fusarium species. Phylogenetic analysis revealed the isolate most closely related was F. proliferatum (100% bootstrap). The molecular identification was also confirmed via BLAST on the Fusarium ID and Fusarium MLST databases. The pathogenicity tests were carried out on healthy three-month-old mango plants. Twenty plants and five shoots per plant were inoculated with 20 µl of the conidial suspension (1 x 106 conidia/ml) (Freeman et al. 1999). Twenty plants served as noninoculated controls. Plants were maintained for 365 days under greenhouse conditions (25 to 30°C). The assay was conducted twice. Symptoms of multiple vegetative shoots and shortened internodes were observed four months after inoculation on the infected plants with an average disease of 4.5 in the first trial and 4.4 in the second assay according to the disease severity scale outlined by Iqbal et al., (2006). No symptoms were observed on non inoculated control plants after 365 days. One isolate per plant was isolated again from the plants with malformation symptoms (n=20), and identified again as F. proliferatum, by morphological and molecular characteristics. F. proliferatum was identified as the causal agent of MMD in China by Zhan et al. (2010). To our knowledge, this is the first report of F. proliferatum causing MMD in Mexico. The development of management strategies to prevent crop loss is required in this important mango production area.

Apparently some people upon coming across [Down Syndrome dolls] were offended. […] Still, it’s curious, and telling, what gives offense. Was it the shock of seeing a doll not modeled on the normative form that caused such offense? Or the assumption that any representation of Down Syndrome must naturally intend ridicule? Either way, it would seem that we might benefit from an examination of such reactions—especially as they relate to instances of the idealisation of the human form that dolls […] represent. (Faulkner) IntroductionWhen Joanne Faulkner describes public criticism of dolls designed to look like they have Down Syndrome, she draws attention to the need for an examination of the way discourses of disability are communicated. She calls, in particular, for an interrogation of people’s reactions to the disruption of the idealised human form that most dolls adopt. The case of Down Syndrome dolls is fascinating, yet critical discussion of these dolls from a disability or cultural studies perspective is conspicuously lacking. To address this lack, this paper draws upon theories of the cultural construction of disability, beauty, and normalcy (Garland-Thompson, Kumari Campbell, Wendell), to explore the way ideas about disability are communicated and circulated. The dominant discourse of disability is medical, where people are diagnosed or identified as disabled if they meet certain criteria, or lists of physical impairments. These lists have a tendency to subsume the disparate qualities of disability (Garland-Thompson) and remove people considered disabled from the social and cultural world in which they live (Snyder and Mitchell 377). While Down Syndrome dolls, produced by Downi Creations and Helga’s European Speciality Toys (HEST) in the US and Europe respectively, are reflective of such lists, they also perform the cultural function of increasing the visibility of disability in society. In addition, the companies distributing these dolls state that they are striving for greater inclusion of people with Down Syndrome (Collins, Parks). However, the effect of the dominance of medicalised discourses of disability can be seen in the public reaction to these dolls. This paper seeks also to bring an interrogation of disability into dialogue with a critical analysis of the discursive function of lists.The paper begins with a consideration of lists as they have been used to define disability and organise knowledge within medicine, and the impact this has had on the position of disability within society. In order to differentiate itself from medical discourses, the emerging social model also relied on lists during the 1980s and 1990s. However, these lists also decontextualised disability by ignoring certain factors for political advantage. The social model, like medicine, tended to ignore the diversity of humanity it was apparently arguing for (Snyder and Mitchell 377). The focus then shifts to the image of Down Syndrome dolls and the ensuing negative interpretation of them focusing, in particular, on reader comments following a Mail Online (Fisher) article. Although the dolls were debated across the blogosphere on a number of disability, special needs parenting, and Down Syndrome specific blogs, people commenting on The Mail Online—a UK based conservative tabloid newspaper—offer useful insights into communication and meaning making around disability. People establish meanings about disability through communication (Hedlund 766). While cultural responses to disability are influenced by a number of paradigms of interpretation such as superstition, religion, and fear, this paper is concerned with the rejection of bodies that do not ascribe to cultural standards of beauty and seeks to explore this paradigm alongside and within the use of lists by the various models of disability. This paper interrogates the use of lists in the way meanings about disability are communicated through the medical diagnostic list, the Down Syndrome dolls, and reactions to them. Each list reduces the disparate qualities and experiences of disability, yet as a cultural artefact, these dolls go some way towards recognising the social and cultural world that medicalised discourses of disability ignore. Drawing on the use of lists within different frameworks of disability, this paper contrasts the individual, or medical, model of disability (that being disabled is a personal problem) with the social model (that exclusion due to disability is social oppression). Secondly, the paper compares the characteristics of Down Syndrome dolls with actual characteristics of Down Syndrome to conclude that these features aim to be a celebrated, not stigmatised, aspect of the doll. By reasserting alternative notions of the body, the dolls point towards a more diverse society where disability can be understood in relation to social oppression. However, these aims of celebration have not automatically translated to a more diverse understanding. This paper aims to complicate perceptions of disability beyond a rudimentary list of characteristics through a consideration of the negative public response to these dolls. These responses are an example of the cultural subjugation of disability.Lists and the Creation of Normative Cultural ValuesFor Robert Belknap, lists are the dominant way of “organizing data relevant to human functioning” (8). While lists are used in a number of ways and for a variety of purposes, Belknap divides lists into two categories—the practical and the literary. Practical lists store meanings, while literary lists create them (89). Belknap’s recognition of the importance of meaning making is particularly relevant to a cultural interrogation of disability. As Mitchell and Snyder comment:Disability’s representational “fate” is not so much dependant upon a tradition of negative portrayals as it is tethered to inciting the act of meaning-making itself. (6)Disability unites disparate groups of people whose only commonality is that they are considered “abnormal” (Garland-Thompson). Ableism—the beliefs, processes, and practices which produce the ideal body—is a cultural project in which normative values are created in an attempt to neutralise the fact that all bodies are out of control (Kumari Campbell). Medical models use diagnostic lists and criteria to remove bodies from their social and cultural context and enforce an unequal power dynamic (Snyder and Mitchell 377).By comparison, the social model of disability shifts the emphasis to situate disability in social and cultural practices (Goggin and Newell 36). Lists have also been integral to the formation of the social model of disability as theorists established binary oppositions between medical and social understandings of disability (Oliver 22). While these lists have no “essential meaning,” through discourse they shape human experience (Liggett). Lists bring disparate items together to structure meaning and organisation. According to Hedlund, insights into the experience of disability—which is neither wholly medical nor wholly social—can be found in the language we use to communicate ideas about disability (766). For example, while the recent production of children’s dolls designed to reflect a list of the physical features of Down Syndrome (Table 2) may have no inherent meaning, negative public reception reveals recognisable modes of understanding disability. Down Syndrome dolls are in stark contrast to dolls popularly available which assume a normative representation. For Blair and Shalmon (15), popular children’s toys communicate cultural standards of beauty. Naomi Wolf describes beauty as a socially constructed normative value used to disempower women in particular. The idealisation of the human form is an aspect of children’s toys that has been criticised for perpetuating a narrow conception of beauty (Levy 189). Disability is likewise subject to social construction and is part of a collective social reality beyond diagnostic lists (Hedlund 766).Organising Knowledge: The Social vs. Medical Model of DisabilityDisability has long been moored in medical cultures and institutions which emphasise a sterile ideal of the body based on a diagnosis of biological difference as deviance. For example, in 1866, John Langdon Down sought to provide a diagnostic classification system for people with, what would later come to be called (after him), Down Syndrome. He focused on physical features:The hair is […] of a brownish colour, straight and scanty. The face is flat and broad, and destitute of prominence. The cheeks are roundish, and extended laterally. The eyes are obliquely placed, and the internal canthi more than normally distant from one another. The palpebral fissure is very narrow. The forehead is wrinkled transversely from the constant assistance which the levatores palpebrarum derive from the occipito-frontalis muscle in the opening of the eyes. The lips are large and thick with transverse fissures. The tongue is long, thick, and is much roughened. The nose is small. The skin has a slight dirty yellowish tinge, and is deficient in elasticity, giving the appearance of being too large for the body. (Down)These features form what Belknap would describe as a “pragmatic” list (12). For Belknap, scientific classification, such as the description Langdon Down offers above, introduces precision and validation to the use of lists (167). The overt principle linking these disparate characteristics together is the normative body from which these features deviate. Medicalised discourses, such as Down’s list, have been linked with the institutionalisation of people with this condition and their exclusion from the broader community (Hickey-Moody 23). Such emphasis on criteria to proffer diagnosis removes and decontextualises bodies from the world in which they live (Snyder and Mitchell 370). This world may in fact be the disabling factor, rather than the person’s body. The social model emerged in direct opposition to medicalised definitions of disability as a number of activists with disabilities in the United Kingdom formed The Union of Physically Impaired Against Segregation (UPIAS) and concluded that people with disability are disabled not by their bodies but by a world structured to exclude their bodies (Finkelstein 13). By separating disability (socially created) from impairment (the body), disability is understood as society’s unwillingness to accommodate the needs of people with impairments. The British academic and disability activist Michael Oliver was central to the establishment of the social model of disability. Following the activities of the UPIAS, Oliver (re)defined disability as a “form of social oppression,” and created two lists (reproduced below) to distinguish between the social and individual (or medical) models of disability. By utilising the list form in this way, Oliver both provided a repository of information regarding the social model of disability and contextualised it in direct opposition to what he describes as the individual model. These lists present the social model as a coherent discipline, in an easy to understand format. As Belknap argues, the suggestion of order is a major tool of the list (98). Oliver’s list suggests a clear order to the emerging social model of disability—disability is a problem with society, not an individual. However, this list was problematic because it appeared to disregard impairment within the experience of disability. As the “impersonal became political” (Snyder and Mitchell 377), impairment became the unacknowledged ambiguity in the binary opposition the social model was attempting to create (Shakespeare 35). Nevertheless, Oliver’s lists successfully enforced a desired order to the social model of disability. The individual modelThe social modelPersonal tragedy theorySocial oppression theoryPersonal problemSocial problemIndividual treatmentSocial actionMedicalisationSelf helpProfessional dominanceIndividual and collective responsibilityExpertiseExperienceAdjustmentAffirmationIndividual identityCollective identityPrejudiceDiscriminationAttitudesBehaviourCareRightsControlChoicePolicyPoliticsIndividual adaptation Social changeTable 1 The Individual v Social Model of Disability (Oliver)The social model then went through a period of “lists,” especially when discussing media and culture. Positive versus negative portrayals of disability were identified and scholars listed strategies for the appropriate representation of disability (Barnes, Barnes Mercer and Shakespeare). The representations of impairment or the physical markers of disability were discouraged as the discipline concerned itself with establishing disability as a political struggle against a disabling social world. Oliver’s lists arrange certain “facts” about disability. Disability is framed as a social phenomenon where certain aspects are emphasised and others left out. While Oliver explains that these lists were intended to represent extreme ends of a continuum to illustrate the distinction between disability and impairment (33), these are not mutually exclusive categories (Shakespeare 35). Disability is not simply a list of physical features, nor is it a clear distinction between individual/medical and social models. By utilising lists, the social model reacts to and attempts to move beyond the particular ordering provided by the medical model, but remains tied to a system of classification that imposes order on human functioning. Critical analysis of the representation of disability must re-engage the body by moving beyond binaries and pragmatic lists. While lists organise data central to human functioning, systems of meaning shape the organisation of human experience. Down Syndrome dolls, explored in the next section, complicate the distinction between the medical and social models.Down Syndrome DollsThese dolls are based on composites of a number of children with Down Syndrome (Hareyan). Helga Parks, CEO of HEST, describes the dolls as a realistic representation of nine physical features of Down Syndrome. Likewise, Donna Moore of Downi Creations employed a designer to oversee the production of the dolls which boast 13 features of Down Syndrome (Velasquez). These features are listed in the table below. HEST Down Syndrome Dolls Downi CreationsSmall ears set low on head with a fold at the topSmall ears with a fold at the topEars set low on the headSmall mouthSmall mouthProtruding tongueSlightly protruding tongueShortened fingers Shortened fingersPinkie finger curves inwardAlmond shaped eyesAlmond-shaped eyesHorizontal crease in palm of handHorizontal crease in palm of handGap between first and second toeA gap between the first and second toesShortened toesFlattened back of headFlattened back of headFlattened bridge across nose Flattened bridge across noseOptional: An incision in the chest to indicate open-heart surgery Table 2: Down Syndrome Dolls (Parks, Velasquez) Achieving the physical features of Down Syndrome is significant because Parks and Moore wanted children with the condition to recognise themselves:When a child with Down’s syndrome [sic.] picks up a regular doll, he doesn’t see himself, he sees the world’s perception of “perfect.” Our society is so focused on bodily perfection. (Cresswell)Despite these motivations, studies show that children with Down Syndrome prefer to play with “typical dolls” that do not reflect the physical characteristics of Down Syndrome (Cafferty 49). According to Cafferty, it is possible that children prefer typical dolls because they are “more attractive” (49). Similar studies of diverse groups of children have shown that children prefer to play with dolls they perceive as fitting into social concepts of beauty (Abbasi). Deeply embedded cultural notions of beauty—which exclude disability (see Morris)—are communicated from childhood (Blair & Shalmon 15). Notions of bodily perfection dominate children’s toys and Western culture in general as Cresswell comments above. Many bodies, not just those deemed “disabled,” do not conform to these cultural standards. Cultural ideals of beauty and an idealisation of the human body according to increasingly narrow parameters are becoming conflated with conceptions of normality (Wendell 86). Recognition of disability as subject to cultural rejection allows us to see “beauty and normalcy [as] a series of practices and positions [taken] in order to avoid the stigmatization of ugliness and abnormality” (Garland-Thompson). The exaggerated features of the doll problematise the idea that people with disability should strive to appear as nondisabled as possible and in turn highlights that some people, such as those with Down Syndrome, cannot “pass” as nondisabled and must therefore navigate a life and community that is not welcoming. While lists of the features of Down Syndrome store associated medicalised meanings, the discussion of the dolls online (the medium through which they are sold) provides insight into the cultural interpretation of disability and the way meaning is made. The next section of the paper considers a selection of negative responses to the Down Syndrome dolls that followed an article published in Mail Online (Fisher). What Causes Offence? Prior to Down Syndrome dolls, the majority of “disability dolls” were constructed through their accessories rather than through the dolls’ physical form and features. Wheelchairs, white canes, guide dogs and harnesses, plastic walkers, leg braces, and hearing aids could be purchased for use with dolls. Down Syndrome dolls look different as the features of impairment are embedded in the dolls’ construction. While accessories have a more temporary feel about them, the permanence of the impairments attributed to the doll was problematic for some who felt it projected a negative image of disability. Listed below are several negative comments following an article published in Mail Online (Fisher):What a grim world we are living in. No longer are dollies for play, for make believe, or for fun. Now it all about self image and psychological “help.” We “disabled” know we are “disabled”—we don’t need a doll to remind us of that! Stop making everything PC; let children be children and play and laugh once again!I think it’s sick and patronising.Who on earth are those education “experts?” Has nobody told them that you don’t educate children by mirroring their defects/weaknesses/negative traits but by doing exactly the opposite, mirroring back the BEST in them?The Downs Syndrome doll looks like they took the physical traits and presented them in an exaggerated way to make them more noticeable. That doll does not look attractive to me at all. If someone has a child that WANTS such a doll, fine. I can’t really see how it would help many of them, it would be like a huge sign saying “You are different.”The terminology used (grim, sick, patronising, defect, weak, negative, unattractive, different) to describe disability in these posts is significant. These descriptions are ideological categories which disadvantage and devalue “bodies that do not conform to certain cultural standards” (Garland-Thompson). Implicit and explicit in all of these comments is the sense that disability and Downs Syndrome in particular is undesirable, unattractive even. When listed together, like Belknap’s literary lists, they are not random or isolated interpretations; they form part of a larger system of meaning making around disability.These responses are informed by the notion that in order to gain equality in society, people with disability must suppress their difference and focus instead on how they are really just like everybody else. However, this focus ignores barriers to inclusion, such as in the rejection of bodies that do not ascribe to cultural standards of beauty. An increasing visibility of impairment in popular culture such as children’s toys advances an understanding of disability as diversity through difference and not something inherently bad. ConclusionPeter Laudin of Pattycake Doll, a company which sells Black, Hispanic, Asian, and Disabled dolls, has found that children “love all dolls unconditionally whether it’s special needs or not” (Lee Adam). He suggests that the majority of the negative responses to the Down Syndrome dolls stem from prejudice (Lee Adam). Dolls popularly available idealise the human form and assume a normative representation. While this has been criticised for communicating damaging standards of beauty from childhood (Levy, Blair and Shalmon), critiques about disability are not as widely understood. The social and medical models of disability focus attention on certain aspects of disability through lists; however, the reduction of diagnostic criteria in the form of a list (whether medical or social) decontextualises disability from the social and cultural world. Thus, the list form, while useful, has elided the disparate qualities of disability. As Belknap argues, lists “ask us to make them meaningful” (xv). Although the dolls discussed in this paper have been criticised for stereotyping and emphasising the difference between children with disability and those without, an inclusion of the physical features of Down Syndrome is consistent with recent moves within critical disability studies to re-engage the body (Shakespeare 35). As Faulkner notes in the epigraph to this paper, an examination of negative reactions to these dolls reveals much about the cultural position of people with disability. References Abbasi, Jennifer. “Why 6-Year Old Girls Want to be Sexy.” Live Science 16 July (2012). 30 Aug. 2012 ‹http://www.livescience.com/21609-self-sexualization-young-girls.html›. Barnes, Colin. Disabling Imagery and the Media: An Exploration of the Principles for Media Representations of Disabled People. Krumlin Halifax: Ryburn Publishing, 1992. 5 Aug. 2012 http://www.leeds.ac.uk/disability-studies/archiveuk/Barnes/disabling%20imagery.pdf.Barnes, Colin, Geoff Mercer, and Tom Shakespeare. Exploring Disability: A Sociological Introduction. Malden: Polity Press, 1999.Belknap, Robert. The List: The Uses and Pleasures of Cataloguing. New Haven: Yale U P, 2004.Blair, Lorrie, and Maya Shalmon. “Cosmetic Surgery and the Cultural Construction of Beauty.” Art Education 58.3 (2005): 14-18.Cafferty, Diana De Rosa. A Doll Like Me: Do Children with Down Syndrome Prefer to Play with Dolls That Have the Physical Features Associated with Down Syndrome? MS thesis. U of California, 2012. Campbell, Fiona Kumari. Contours of Ableism: The Production of Disability and Abledness. New York: Palgrave Macmillan, 2009.Collins, Allyson. “Dolls with Down Syndrome May Help Kids.” ABC News. 27 Jun. 2008. 4 Oct. 2012 ‹http://abcnews.go.com/Health/Parenting/story?id=5255393&page=1#.UGzQXK6T-XP›. Cresswell, Adam. “Dolls with Disability Divide Opinion.” The Australian 12 Jul. 2008. 26 Dec. 2008 ‹http://www.theaustralian.news.com.au/story/0,25197,24000338-23289,00.html›.Down, John Langdon. “Observations on an Ethnic Classification of Idiots.” Neonatology on the Web. 1866. 3 Aug. 2012 ‹http://www.neonatology.org/classics/down.html›.Faulkner, Joanne “Disability Dolls.” What Sorts of People? 26 Jun. 2008. 29 Aug. 2012 ‹http://whatsortsofpeople.wordpress.com/2008/06/26/disability-dolls/›.Finkelstein, Vic. “Representing Disability.” Disabling Barriers—Enabling Environments. Ed. John Swain, et al. Los Angeles: Sage, 2004. 13-20.Fisher, Lorraine. “Parents’ Fury at ‘Down's Syndrome Dolls’ Designed to Help Children Deal with Disability.” Mail Online 7 Jul. 2008. 26 Dec. 2008. ‹http://www.dailymail.co.uk/femail/article-1032600/Parents-fury-Downs-Syndrome-dolls-designed-help-children-deal-disability.html›. Garland-Thomson, Rosemarie. “Re-Shaping, Re-Thinking, Re-Defining: Feminist Disability Studies.” The Free Library 1 Jan. 2008. 3 Aug. 2012. ‹http://www.thefreelibrary.com/Re-shaping, Re-thinking, Re-defining: Feminist Disability Studies.-a084377500›.Goggin, Gerard and Christopher Newell. Disability in Australia: Exposing a Social Apartheid. Sydney: U of New South Wales, 2005.Hareyan, Armen. “Using Dolls to Reduce the Stigma of Down Syndrome.” EMax Health. 4 Dec. 2008. Jan 2009 ‹http://www.emaxhealth.com/7/22865.html›.Hedlund, Marianne. “Disability as a Phenomenon: A Discourse of Social and Biological Understanding.” Disability & Society. 15.5 (2000): 765-80.Hickey-Moody, Anna. Unimaginable Bodies. Netherlands: Sense Publishers, 2009.Lee Adams, William. “New Dolls on the Block.” Time Magazine 19 Mar. 2009. 13 Dec. 2009. ‹http://www.time.com/time/magazine/article/0,9171,1886457,00.html›.Levy, Ariel. Female Chauvinist Pigs: Women and the Rise of Raunch Culture. Collingwood: Black Inc. 2010.Liggett, Helen. “Stars are not Born: An Interpretive Approach to the Politics of Disability” in Disability Studies: Past Present and Future. Ed. Len Barton and Mike Oliver. Leeds: The Disability Press, 1997. 178-194.Mitchell, David and Sharon Snyder. Narrative Prosthesis: Disability and the Dependencies of Discourse. Ann Arbor, The U of Michigan P, 2000.Morris, Jenny “A Feminist Perspective.” Framed. Ed. Ann Pointon & Chris Davies. London: British Film Institute, 1997. 21-30. Oliver, Michael. Understanding Disability: From Theory to Practice. New York: Palgrave Macmillan, 1996.Parks, Helga. “New Doll Is Child’s Best Friend.” HEST Press Release, 2005. Shakespeare, Tom. Disability Rights and Wrongs. London: Routledge, 2006.Snyder, Sharon, and David Mitchell. “Re-Engaging the Body: Disability Studes and the Resistance to Embodiment.” Public Culture 13.3 (2001): 367-89.Velasquez, Leticia. “Downi Creations.” 2007. 4 Dec. 2009. ‹http://cause-of-our-joy.blogspot.com/2007/08/downi-creations.html›.Wendell, Susan. The Rejected Body: Feminist Philosophical Reflections on Disability. New York: Routledge, 1996.Wolf, Naomi. The Beauty Myth: How Images of Beauty Are Used against Women. New York: Harper Perennial, 2002 [1991].

Tea (Camellia sinensis) is a significant commercial crop cultivated in China. A collar canker and dieback disease of tea has recently been reported in Sri Lanka (Sinniah et al. 2017). During the Spring of 2020, tea bushes with symptoms of fewer leaves, yellowing of leaves with cankers having cracks and peeling of bark, premature falling in the early stage and progressive dieback of branches followed by death of the whole tree that were partially covered with white-colored mold were observed in tea plantations over a 200 hm2 area in Xinyang, Henan Province, China (Figure 1A). To determine the causative agent, dead tea plant stems with white-colored mold were collected, cut into small pieces and surface-sterilized with 75% ethanol, followed by rinsing twice with sterile distilled water and then air-drying. The pieces were placed on potato dextrose agar (PDA) and incubated at 28℃ for 7 days. A total of 19 fungal colonies were isolated and transferred to fresh PDA. Single-spore isolates were made for each and all were observed to produce white flocculent mycelium with the reverse side being pale yellow on PDA. The appearance of a representative strain, XYWLD-07, on PDA is shown (Figure 1B and 1C). Macroconidia (14.26 to 42.13 × 3.53 to 6.79μm) and microconidia (6.93 to 11.85 × 2.72 to 6.33μm) were observed in the cultures (Figure 1E). The genomic DNA from XYWLD-07 was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA, beta-tubulin, translation elongation factor 1-alpha (TEF- 1α), RNA polymerase I beta subunit (RPB1) and RNA polymerase II beta subunit (RPB2) genes were amplified using the primer pairs ITS1/ITS4 (5’- CTTGGTCATTTAGAGGAAGTAA -3’/5’- TCCTCCGCTTATTGATATGC -3’) (Gardes & Bruns 1993) , Bt-F/Bt-R (5’- AACATGCGTGAGATTGTAAGT -3’/5’- TCTGGATGTTGTTGGGAATCC -3’), EF-1/EF-2 (5’- ATGGGTAAGGARGACAAGAC -3’/5’- GGARGTACCAGTSATCATGTT -3’), RPB-1F/1R (5’- TTTTCCTCACAAAGGAGCAAATCATG -3’/5’- GTTCACCCAAGATATGGTCGAAAGCC -3’) and RPB2-5F2/11aR (5’- GGGGWGAYCAGAAGAAGGC -3’/5’- GCRTGGATCTTRTCRTCSACC -3’) (O’Donnell et al. 2010), respectively. The PCR products were sequenced and deposited in GenBank (Accession Nos. MZ411431, MZ439920, OL982608, OM069738 and OM265212), respectively. BLASTn against NCBI nr and Fusarium-ID database revealed that the ITS sequence had 99.65% homology with BLAST sequences of F. solani (GenBank Accession Nos. JN882257.1 and JN882255.1), the beta tubulin sequence had 96.92% similarity with BLAST sequences of F. solani (KU983876.1 and MN692929.1), TEF- 1α gene sequence had 99.15% and 99.29% homology with BLAST sequences of F. solani (KM096405.1 and KM096409.1), RPB1 gene sequence had 99.32% and 99.41% homology with BLAST sequences of F. solani (KU974331.1 and MT305119.1) and RPB2 gene sequence had 98.15% and 98.20% homology with BLAST sequences of F. solani (MT305182.1 and MT305177.1), respectively. Furthermore, TEF- 1α, RPB1 and RPB2 gene sequences had more than 98.52% match with F. solani sequences in Fusarium-ID databases. To test for pathogenicity, the inoculum was grown for 10 days at 25°C on 200g sterilized boiled wheat grain and sand (3:1, v/v) with 20-ml spore suspension (107 conidia /ml) of strain XYWLD-07. Two-year tea seedlings were planted in pots of autoclaved soil with 5% (m/m) strain XYWLD-07 inoculum but controls were grown in autoclaved soil with only sterile wheat/sand mix. The experiment was performed five times. After 30 days, collar canker symptoms appeared on inoculated tea branches, whereas the control was asymptomatic (Figure 1F). The fungal pathogen was reisolated from the symptomatic tea tissues and again identified as F. solani based on the above analysis of the five gene sequences (Figure 1D). F. solani has been previously identified as causal agent of collar canker and dieback of C. sinensis in Sri Lanka (Sinniah et al. 2017) and India (Sarmah et al. 2017).To our knowledge, this is the first report of F. solani causing collar canker and dieback of C. sinensis in China. As this disease could result in death of tea bushes, effective management strategies should be investigated and applied.