Journal articles: 'HFSH'

1

Toh, Evelyn, Harry D. Kurtz, and Yves V. Brun. "Characterization of the Caulobacter crescentus Holdfast Polysaccharide Biosynthesis Pathway Reveals Significant Redundancy in the Initiating Glycosyltransferase and Polymerase Steps." Journal of Bacteriology 190, no. 21 (August 29, 2008): 7219–31. http://dx.doi.org/10.1128/jb.01003-08.

Full text

Abstract:

ABSTRACT Caulobacter crescentus cells adhere to surfaces by using an extremely strong polar adhesin called the holdfast. The polysaccharide component of the holdfast is comprised in part of oligomers of N-acetylglucosamine. The genes involved in the export of the holdfast polysaccharide and the anchoring of the holdfast to the cell were previously discovered. In this study, we identified a cluster of polysaccharide biosynthesis genes (hfsEFGH) directly adjacent to the holdfast polysaccharide export genes. Sequence analysis indicated that these genes are involved in the biosynthesis of the minimum repeat unit of the holdfast polysaccharide. HfsE is predicted to be a UDP-sugar lipid-carrier transferase, the glycosyltransferase that catalyzes the first step in polysaccharide biosynthesis. HfsF is predicted to be a flippase, HfsG is a glycosyltransferase, and HfsH is similar to a polysaccharide (chitin) deacetylase. In-frame hfsG and hfsH deletion mutants resulted in severe deficiencies both in surface adhesion and in binding to the holdfast-specific lectin wheat germ agglutinin. In contrast, hfsE and hfsF mutants exhibited nearly wild-type levels of adhesion and holdfast synthesis. We identified three paralogs to hfsE, two of which are redundant to hfsE for holdfast synthesis. We also identified a redundant paralog to the hfsC gene, encoding the putative polysaccharide polymerase, and present evidence that the hfsE and hfsC paralogs, together with the hfs genes, are absolutely required for proper holdfast synthesis.

APA, Harvard, Vancouver, ISO, and other styles

2

Donadeu, Francesc Xavier, and Mario Ascoli. "The Differential Effects of the Gonadotropin Receptors on Aromatase Expression in Primary Cultures of Immature Rat Granulosa Cells Are Highly Dependent on the Density of Receptors Expressed and the Activation of the Inositol Phosphate Cascade." Endocrinology 146, no. 9 (September 1, 2005): 3907–16. http://dx.doi.org/10.1210/en.2005-0403.

Full text

Abstract:

Abstract Signaling pathways mediating the divergent effects of FSH and LH on aromatase in immature rat granulosa cells were studied by infecting cells with increasing amounts of adenoviral vectors for the human LH receptor (hLHR) or FSH receptor (hFSHR). Increasing amounts of Ad-hLHR, used at a multiplicity of infection (MOI) of 20 or 200 viable viral particles/cell, increased human chorionic gonadotropin (hCG) binding and hCG-induced cAMP and Akt phosphorylation, but inositol phosphates only increased in response to hCG in cells infected with 200 MOI Ad-hLHR. In contrast, hCG increased aromatase expression in cells infected with 20, but not in cells infected with 200, MOI Ad-hLHR. Cells infected with 20 or 200 MOI Ad-hFSHR showed increased hFSH binding and hFSH-induced Akt phosphorylation, but the hFSH-induced cAMP response was unchanged relative to control cells. However, hFSH was able to stimulate the inositol phosphate cascade in the Ad-hFSHR-infected cells, and the hFSH induction of aromatase was abolished. We also found that activation of C kinase or expression of a constitutively active form of Gαq inhibited the induction of aromatase by hFSH or 8Br-cAMP. We conclude that the differential effects of FSH and LH on aromatase in immature granulosa cells are highly dependent on gonadotropin receptor density and on the signaling pathways activated. We propose that aromatase is induced by common signals generated by activation of the FSHR and LHR (possibly cAMP and Akt) and that the activation of the inositol phosphate cascade in cells expressing a high density of LHR or FSHR antagonizes this induction.

APA, Harvard, Vancouver, ISO, and other styles

3

Kene, PS, VC Nalavadi, RR Dighe, KS Iyer, and SD Mahale. "Identification of the structural and functional determinants of the extracellular domain of the human follicle stimulating hormone receptor." Journal of Endocrinology 182, no. 3 (September 1, 2004): 501–8. http://dx.doi.org/10.1677/joe.0.1820501.

Full text

Abstract:

The extracellular domain (ECD) of the human follicle-stimulating hormone receptor (hFSHR) is believed to be the major determinant of hormone selectivity. Different discrete, discontinuous regions on the ECD of the hFSHR have been suggested to be crucial for hormone binding. However, the role of the ECD in signal transduction is not well understood. This study provides some insight into these aspects of the structure-function relationship of the ECD of hFSHR. Ten peptides were selected from the ECD on the basis of their ability to be surface oriented, synthesized by the solid-phase method using fluorenylmethyloxycarbonyl chemistry, purified and characterized. They were further studied for their ability to modulate both human follicle-stimulating hormone (hFSH)-FSHR binding and cAMP generation. Competitive inhibition studies showed that, of all the peptides studied, peptides 285-300 and 297-310 hFSHR were able to inhibit hFSH binding to FSHR. Both peptides function as weak competitive inhibitors of hFSH-FSHR binding. Peptides 285-300 hFSHR, 216-235 hFSHR, 184-195 hFSHR, 79-89 hFSHR and 15-31 hFSHR were observed to inhibit FSH-induced cAMP production. In summary, this study suggests that discrete, functional domains of the ECD have a role in hormone binding and signal transduction. Region 285-300 has been identified as a novel region crucial for both FSH binding and cAMP generation.

APA, Harvard, Vancouver, ISO, and other styles

4

Grasso, P., and L. E. Reichert. "Evidence that a calmodulin-like calcium-binding domain of the FSH β-subunit is involved in FSH-induced calcium uptake by Sertoli cells." Journal of Molecular Endocrinology 13, no. 2 (October 1994): 149–55. http://dx.doi.org/10.1677/jme.0.0130149.

Full text

Abstract:

ABSTRACT We have previously shown that a synthetic peptide amide corresponding to residues 1–15 of the human FSH β-subunit (hFSH-β-(1–15)) possesses structural characteristics and calcium-binding properties similar to the calcium-binding loops of calmodulin (CaM). The calcium-binding property of hFSH-β-(1–15) correlated well with its ability to stimulate uptake of calcium (as45 Ca2+) by cultured rat Sertoli cells and proteoliposomes enriched with bovine calf testis FSH receptors. A sequence found in the calcium-binding loops of CaM and a number of other calcium-binding proteins can be represented by the motif +−+−+−+−+−−+, where + represents a calcium-binding residue and − represents a non-binding residue. A sequence containing a similar motif appears in hFSHβ-(1–15) between residues 4 and 15: +−++−+−−−+−+. Using a synthetic peptide strategy, we undertook to determine whether the first three residues of hFSH-β-(1–15) were required to induce uptake of calcium by cultured rat Sertoli cells and FSH receptor-enriched proteoliposomes, and to assess whether rearrangement of the putative calcium-binding ligands (+) of hFSH-β-(1–15) to correspond to their linear sequence in CaM would enhance the ability of hFSH-β-(1–15) to induce calcium uptake in these two model systems. Our results indicate that (1) the amino terminal tripeptide of hFSH-β-(1–15), NSC, is not required for its effects on calcium influx and (2), although the putative calcium-binding loop of hFSH-β-(1–15) does not strictly adhere to the structural motif present in the calcium-binding loops of CaM, this does not adversely affect the potency of hFSH-β-(1–15) in the systems studied. In addition to providing a structural basis for understanding the affinity of hFSH-β-(1–15) for calcium, these studies suggest that the effects of FSH on calcium flux in Sertoli cells may involve a CaM-like region of its β-subunit.

APA, Harvard, Vancouver, ISO, and other styles

5

Santa-Coloma, Tomás A., John W. Crabb, and Leo E. Reichert. "Serine analogues of hFSH-beta-(33–53) and hFSH-beta-(81–95) inhibit hFSH binding to receptor." Biochemical and Biophysical Research Communications 184, no. 3 (May 1992): 1273–79. http://dx.doi.org/10.1016/s0006-291x(05)80020-8.

Full text

APA, Harvard, Vancouver, ISO, and other styles

6

Vischer, Henry F., Joke C. M. Granneman, and Jan Bogerd. "Identification of Follicle-Stimulating Hormone-Selective β-Strands in the N-Terminal Hormone-Binding Exodomain of Human Gonadotropin Receptors." Molecular Endocrinology 20, no. 8 (August 1, 2006): 1880–93. http://dx.doi.org/10.1210/me.2005-0202.

Full text

Abstract:

Abstract Glycoprotein hormone receptors contain large N-terminal extracellular domains (ECDs) that distinguish these receptors from most other G protein-coupled receptors. Each glycoprotein hormone receptor ECD consists of a curved leucine-rich repeat domain flanked by N- and C-terminal cysteine-rich regions. Selectivity of the different glycoprotein hormone receptors for their cognate hormones is exclusively determined by their ECDs and, in particular, their leucine-rich repeat domain. To identify human (h)FSH-selective determinants we used a gain-of-function mutagenesis strategy in which β-strands of the hLH receptor (hLH-R) were substituted with their hFSH receptor (hFSH-R) counterparts. Introduction of hFSH-R β-strand 1 into hLH-R conferred responsiveness to hFSH, whereas hLH-R mutants harboring one of the other hFSH-R β-strands displayed none or very limited sensitivity to hFSH. However, combined substitution of hFSH-R β-strand 1 and some of the other hFSH-R β-strands further increased the sensitivity of the mutant hLH-R to hFSH. The apparent contribution of multiple hFSH-R β-strands in providing a selective hormone binding interface corresponds well with their position in relation to hFSH as recently determined in the crystal structure of hFSH in complex with part of the hFSH-R ECD.

APA, Harvard, Vancouver, ISO, and other styles

7

Vischer, Henry F., Joke C. M. Granneman, and Jan Bogerd. "Opposite Contribution of Two Ligand-Selective Determinants in the N-Terminal Hormone-Binding Exodomain of Human Gonadotropin Receptors." Molecular Endocrinology 17, no. 10 (October 1, 2003): 1972–81. http://dx.doi.org/10.1210/me.2003-0172.

Full text

Abstract:

Abstract The nine leucine-rich repeat-containing exodomains of the human FSH receptor (hFSH-R) and the human LH/chorionic gonadotropin receptor (hLH-R) harbor molecular determinants that allow the mutually exclusive binding of human FSH (hFSH) and human LH (hLH)/human chorionic gonadotropin (hCG) when these hormones are present in physiological concentrations. Previously, we have shown that the β-strands of hLH-R leucine-rich repeats 3 and 6 can confer full hCG/hLH responsiveness and binding when simultaneously introduced into a hFSH-R background without affecting the receptor’s responsiveness to hFSH. In the present study, we have determined the nature of contribution of each of these two β-strands in conferring hCG/hLH responsiveness to this mutant hFSH-R. Human LH-R β-strand 3 appeared to function as a positive hCG/hLH determinant by increasing the hCG/hLH responsiveness of the hFSH-R. In contrast, mutagenesis of hFSH-R β-strand 6, rather than the introduction of its corresponding hLH-R β-strand, appeared to allow the interaction of hCG/hLH with the hFSH-R. Hence, hFSH-R β-strand 6 functions as a negative determinant and, as such, restrains binding of hCG/hLH to the hFSH-R. Detailed mutagenic analysis revealed that the ability of the hFSH-R to interact with hCG/hLH depends primarily on the identity of two amino acids (Asn104, a positive LH-R determinant, and Lys179 a negative FSH-R determinant) that are situated on the C-terminal ends of β-strands 3 and 6, respectively.

APA, Harvard, Vancouver, ISO, and other styles

8

Gaillard, O. "L'hormone folliculo-stimulante (hFSH)." Immuno-analyse & Biologie Spécialisée 15, no. 5 (September 2000): 328–33. http://dx.doi.org/10.1016/s0923-2532(00)80055-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Jiang, Chao, Xiaoying Hou, Cheng Wang, Jeffrey V. May, Viktor Y. Butnev, George R. Bousfield, and John S. Davis. "Hypoglycosylated hFSH Has Greater Bioactivity Than Fully Glycosylated Recombinant hFSH in Human Granulosa Cells." Journal of Clinical Endocrinology & Metabolism 100, no. 6 (June 2015): E852—E860. http://dx.doi.org/10.1210/jc.2015-1317.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Arey, Brian J., Darlene C. Deecher, Emily S. Shen, Panayiotis E. Stevis, Edwin H. Meade, Jay Wrobel, Donald E. Frail, and Francisco J. López. "Identification and Characterization of a Selective, Nonpeptide Follicle-Stimulating Hormone Receptor Antagonist." Endocrinology 143, no. 10 (October 1, 2002): 3822–29. http://dx.doi.org/10.1210/en.2002-220372.

Full text

Abstract:

Abstract The glycoprotein hormones (LH, FSH, and TSH) are critical to the maintenance of physiological homeostasis and control of reproduction. However, despite an obvious utility for synthetic pharmacological agents, there are few reports of selective, nonpeptide agonists or antagonists to receptors for these hormones. We have identified and characterized a novel synthetic molecule capable of inhibiting the action of FSH. This compound, 7-{4-[Bis-(2-carbamoyl-ethyl)-amino]-6-chloro-(1,3,5)-triazin-2-ylamino)-4-hydroxy-3-(4-methoxy-phenylazo)-naphthalene}-2-sulfonic acid, sodium salt (compound 1), is a selective, noncompetitive inhibitor of the human (h) and rat (r) FSH receptors (FSHRs). Compound 1 selectively inhibited binding of [125I]hFSH with an IC50 value of 5.4 ± 2.3 μm. Radioligand-binding assays were performed using the baculovirus expressed extracellular domain of hFSHR (BV-tFSHR) to demonstrate site-specific interaction. Compound 1 competed for [125I]hFSH binding to BV-tFSHR with an IC50 value of 10 ± 2.8 μm. Functionally, compound 1 inhibited hFSH-induced cAMP accumulation and steroidogenesis in vitro with an IC50 value of 3 ± 0.6 μm. Competition of compound 1 for binding to other glycoprotein hormone receptors and other G protein-coupled receptors demonstrated select activity for FHSRs. Compound 1 inhibited ovulation in immature and cycling adult rats. These data provide proof of concept that selective, small molecule antagonists can be designed for glycoprotein hormone receptors.

APA, Harvard, Vancouver, ISO, and other styles

11

Kohva, Ella, Hanna Huopio, Matti Hero, Päivi J. Miettinen, Kirsi Vaaralahti, Virpi Sidoroff, Jorma Toppari, and Taneli Raivio. "Recombinant Human FSH Treatment Outcomes in Five Boys With Severe Congenital Hypogonadotropic Hypogonadism." Journal of the Endocrine Society 2, no. 12 (October 15, 2018): 1345–56. http://dx.doi.org/10.1210/js.2018-00225.

Full text

Abstract:

Abstract Context Recombinant human FSH (r-hFSH), given to prepubertal boys with hypogonadotropic hypogonadism (HH), may induce Sertoli cell proliferation and thereby increase sperm-producing capacity later in life. Objective To evaluate the effects of r-hFSH, human chorionic gonadotropin (hCG), and testosterone (T) in such patients. Design and Setting Retrospective review in three tertiary centers in Finland between 2006 and 2016. Patients Five boys: ANOS1 mutation in two, homozygous PROKR2 mutation in one, FGFR1 mutation in one, and homozygous GNRHR mutation in one. Prepubertal testicular volume (TV) varied between 0.3 and 2.3 mL; three boys had micropenis, three had undergone orchidopexy. Interventions Two boys received r-hFSH (6 to 7 months) followed by r-hFSH plus hCG (33 to 34 months); one received T (6 months), then r-hFSH plus T (29 months) followed by hCG (25 months); two received T (3 months) followed by r-hFSH (7 months) or r-hFSH plus T (8 months). Main Outcome Measures TV, inhibin B, anti-Müllerian hormone, T, puberty, sperm count. Results r-hFSH doubled TV (from a mean ± SD of 0.9 ± 0.9 mL to 1.9 ± 1.7 mL; P < 0.05) and increased serum inhibin B (from 15 ± 5 ng/L to 85 ± 40 ng/L; P < 0.05). hCG further increased TV (from 2.1 ± 2.3 mL to 8.6 ± 1.7 mL). Two boys with initially extremely small testis size (0.3 mL) developed sperm (maximal sperm count range, 2.8 to 13.8 million/mL), which was cryopreserved. Conclusions Spermatogenesis can be induced with gonadotropins even in boys with HH who have extremely small testes, and despite low-dose T treatment given in early puberty. Induction of puberty with gonadotropins allows preservation of fertility.

APA, Harvard, Vancouver, ISO, and other styles

12

Raivio, Taneli, Anne M. Wikström, and Leo Dunkel. "Treatment of gonadotropin-deficient boys with recombinant human FSH: long-term observation and outcome." European Journal of Endocrinology 156, no. 1 (January 2007): 105–11. http://dx.doi.org/10.1530/eje.1.02315.

Full text

Abstract:

Background: Boys with prepubertal onset of hypogonadotropic hypogonadism (HH) are at a risk of poor testis growth and impaired spermatogenesis. One potential cause for this is deficient proliferation of immature Sertoli cells before and during puberty due to the absence of FSH. Objective: To evaluate the effects of recombinant human FSH (r-hFSH) and human chorionicgonadotropin (hCG) on testicular function and pubertal development in boys with prepubertal onset of HH. Design: Retrospective clinical study. Setting: Two university central hospitals, pediatric referral endocrinology outpatient clinics. Patients: Fourteen boys (aged, 9.9–17.7 years) with prepubertal (testicular volume (TV) <3 ml) onset of HH (idiopathic HH, n=2; Kallman syndrome, n=2; idiopathic panhypopituitarism, n=4; organic panhypopituitarism, n=6). Intervention: Treatment with r-hFSH alone (2 mo–2.8 years) prior to induction of puberty with the combination of FSH and hCG. Main outcome measures: Progression of puberty, change in serum inhibin B, spermatogenesis. Results: r-hFSH alone increased testicular volume twofold, from 0.9±0.6 ml (mean±s.d.) to 1.8 ± 1.1 ml (P<0.005), and serum inhibin B threefold, from 27±14 to 80±57 pg/ml (P<0.01). Three boys with an apparent absence of postnatal hypothalamic–pituitary–testicular axis activation displayed attenuated inhibin B responses to long-term (≥1 year) r-hFSH (P<0.01). Further significant increase in both TVand inhibin B occurred with induction of puberty with FSH and hCG (P<0.001). Seven boys provided semen samples: one had azoospermia, and others displayed a maximal sperm count range from 2.9 to 92 million/ml (median 8.5 million/ml). Conclusions: (i) r-hFSH induces prepubertal testis growth and increases circulating inhibin B levels, findings suggesting proliferation of immature Sertoli cells. (ii) Puberty was successfully induced with hCG and r-hFSH following r-hFSH priming. (iii) Inhibin B appears useful for monitoring spermatogenetic activity in boys treated with hCG. (iv) Despite the extremely small initial testis volume, six out of seven patients (86%) primed with r-hFSH displayed sperm in the ejaculate suggesting beneficial effect of r-hFSH priming on testicular function later in life.

APA, Harvard, Vancouver, ISO, and other styles

13

Gordon, Ana, José C. Garrido-Gracia, Rafaela Aguilar, Carmina Bellido, Juan A. García Velasco, Yolanda Millan, Manuel Tena-Sempere, Juana Martín de las Mulas, and José E. Sánchez-Criado. "The ovary-mediated FSH attenuation of the LH surge in the rat involves a decreased gonadotroph progesterone receptor (PR) action but not PR expression." Journal of Endocrinology 196, no. 3 (December 4, 2007): 583–92. http://dx.doi.org/10.1677/joe-07-0223.

Full text

Abstract:

Hyperstimulation of ovarian function with human FSH (hFSH) attenuates the preovulatory surge of LH. These experiments aimed at investigating the mechanism of ovarian-mediated FSH suppression of the progesterone (P4) receptor (PR)-dependent LH surge in the rat. Four-day cycling rats were injected with hFSH, oestradiol benzoate (EB) or vehicle during the dioestrous phase. On pro-oestrus, their pituitaries were studied for PR mRNA and protein expression. Additionally, pro-oestrous pituitaries were incubated in the presence of oestradiol-17β (E2), and primed with P4 and LH-releasing hormone (LHRH), with or without the antiprogestin RU486. After 1 h of incubation, pituitaries were either challenged or not challenged with LHRH. Measured basal and LHRH-stimulated LH secretions and LHRH self-priming were compared with those exhibited by incubated pituitaries on day 4 from ovariectomized (OVX) rats in metoestrus (day 2) injected with hFSH and/or EB on days 2 and 3. The results showed that: i) hFSH lowered the spontaneous LH surge without affecting basal LH and E2 levels, gonadotroph PR-A/PR-B mRNA ratio or immunohistochemical protein expression; ii) incubated pro-oestrous pituitaries from hFSH-treated rats did not respond to P4 or LHRH, and lacked E2-augmenting and LHRH self-priming effects and iii) OVX reversed the inhibitory effects of hFSH on LH secretion. It is concluded that under the influence of hFSH, the ovaries produce a non-steroidal factor which suppresses all PR-dependent events of the LH surge elicited by E2. The action of such a factor seemed to be due to a blockade of gonadotroph PR action rather than to an inhibition of PR expression.

APA, Harvard, Vancouver, ISO, and other styles

14

Spetzler, Jane C., Morten Meldal, Ernst Meinjohanns, Lucilla Steinaa, Søren Mouritsen, and Klaus Bock. "Synthetic hFSH peptide constructs in the evaluation of previous studies on the hFSH receptor interaction." Journal of Peptide Science 3, no. 6 (November 1997): 397–414. http://dx.doi.org/10.1002/(sici)1099-1387(199711)3:6<397::aid-psc113>3.0.co;2-k.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Minegishi, T., S. Igarashi, K. Nakamura, M. Nakamura, M. Tano, H. Shinozaki, K. Miyamoto, and Y. Ibuki. "Functional expression of the recombinant human FSH receptor." Journal of Endocrinology 141, no. 2 (May 1994): 369–75. http://dx.doi.org/10.1677/joe.0.1410369.

Full text

Abstract:

Abstract The functional capacity of the recombinant human FSH (hFSH) receptor was tested on the basis of gonadotrophin stimulation of cyclic AMP (cAMP) production by transient transfections of 293 cells and stable transfections of Chinese hamster ovary (CHO) cells. A CHO cell line expressed with the hFSH receptor cDNA covering the entire amino acid coding region revealed the presence of FSH binding site (Kd 6·2 × 10−10 m) on the plasma membrane. Treatment of transfected cells with hFSH induced dose-dependent increases in intracellular cAMP production. These results indicate that the hFSH receptor functionally couples with endogenous adenylyl cyclase. Although rat FSH also induced dose-dependent increases in cAMP production, bovine FSH was effective only at high doses and human chorionic gonadotropin did not alter cAMP levels compared with control values. Northern blot analysis with a cRNA probe derived from hFSH receptor cDNA indicated the presence of two common FSH receptor mRNA transcripts (2·4 and 4·1 kb) in RNA prepared from a human ovary and transfected cell lines. Preincubation of CHO cells expressing a functional hFSH receptor (CHO-FSHR) with FSH for 16 h decreased the subsequent cAMP production resulting from a 30-min pulse of FSH stimulation. These results indicate that desensitization of the adenylyl cyclase response to FSH stimulation occurs in CHO-FSHR cells. This cell line therefore provides a tool with which to pursue detailed studies on the molecular basis of FSH-induced desensitization. Journal of Endocrinology (1994) 141, 369–375

APA, Harvard, Vancouver, ISO, and other styles

16

Gordon, Ana, José C. Garrido-Gracia, Rafaela Aguilar, Silvia Guil-Luna, Yolanda Millán, Juana Martín de las Mulas, and José E. Sánchez-Criado. "Ovarian stimulation with FSH reduces phosphorylation of gonadotrope progesterone receptor and LH secretion in the rat." REPRODUCTION 137, no. 1 (January 2009): 151–59. http://dx.doi.org/10.1530/rep-08-0318.

Full text

Abstract:

Administration of human FSH (hFSH) to cyclic rats during the dioestrous phase attenuates progesterone receptor (PR)-dependent events of the preovulatory LH surge in pro-oestrus. The increased bioactivity of the putative ovarian gonadotropin surge inhibiting/attenuating factor induced by hFSH treatment is not associated with a decrease in PR protein expression, and the possibility of its association at a PR posttranslational effect has been raised. The present experiments aimed to analyse PR phosphorylation status in the gonadotrope of rats with impaired LH secretion induced byin vivohFSH injection. Two experimental approaches were used. First, incubated pro-oestrous pituitaries from hFSH-injected cycling and oestrogen-treated ovariectomized (OVX) rats were used to analyze the effect of calyculin, an inhibitor of intracellular phosphatases, on PR-dependent LH release, which was measured in the incubation medium by RIA. Second, pituitaries taken from hFSH-injected intact cycling and OVX rats and later incubated with P or GNRH1 were used to assess the phosphorylation rate of gonadotrope. The latter was analysed in formalin-fixed, paraffin-embedded tissue sections by immunohistochemistry using a MAB that recognizes the phosphorylated (p) form of PR at Ser294. Calyculin reduced the ovary-mediated inhibition of hFSH in GNRH1-stimulated LH secretion. In addition, the immunohistochemical expression of pSer294 PR was significantly reduced after ovarian stimulation with hFSH in pituitaries from pro-oestrous rats incubated with P or GNRH1. Altogether, these results suggested that the ovarian-dependent inhibitory effect of FSH injection on the preovulatory LH secretion in the rat may involve an increase in dephosphorylation of PR.

APA, Harvard, Vancouver, ISO, and other styles

17

Costa, Sanely Lourenço da, Eduardo Paulino da Costa, Emílio César Martins Pereira, Wagner Gonzaga Gonçalves, Talita Fernandes da Silva, and Vanessa Lopes Dias Queiroz. "HUMAN FOLLICLE STIMULATING HORMONE (hFSH) AND THYROXINE (T4) IN SURVIVAL MAINTENANCE AND IN VITRO GROWTH PROMOTION OF CAPRINE PREANTRAL FOLLICLES." Ciência Animal Brasileira 16, no. 2 (June 2015): 298–311. http://dx.doi.org/10.1590/1089-6891v16i231471.

Full text

Abstract:

The aim of this study was to investigate the interaction of human FSH (10ng/ml) with T4 (20ng/mL) on survival, activation and growth of preantral follicles cultured in vitro for 28 days. Fragments of non-cultured and cultured ovarian tissue were processed for classic histology and transmission electron microscopy. The results showed a reduction in the survival rate in all the media tested (one to 28 days) when compared to the fresh control. However the treatment with T4/hFSH for seven days of culture maintained the rate similar to the control. The media tested by one and 28 days reduced the percentage of primordial follicles in all periods of culture. However, T4/hFSH on day one of culture remained similar to the fresh control. None of the media were able to keep the percentage of the developing follicles. It was observed that the follicular diameter in the medium with T4/hFSH remained similar to the fresh control. The ultrastructural analysis confirmed the integrity of follicles cultured for seven days in a medium supplemented with T4/hFSH. In conclusion, the medium with T4/hFSH is able to maintain the survival, promote the activation, and the ultrastructural integrity of caprine preantral follicles for until seven days.

APA, Harvard, Vancouver, ISO, and other styles

18

Ali, Atef, and Marc-André Sirard. "Protein kinases influence bovine oocyte competence during short-term treatment with recombinant human follicle stimulating hormone." Reproduction 130, no. 3 (September 2005): 303–10. http://dx.doi.org/10.1530/rep.1.00387.

Full text

Abstract:

The aim of this study was to investigate the effect of short-term treatment (first 2 or 6 h) with recombinant human follicle-stimulating hormone (r-hFSH) during in vitro maturation (IVM) on the developmental competence of bovine oocytes. The roles of protein kinase A (PKA) and protein kinase C (PKC) (possibly involved in FSH response), were investigated using activators (Sp-cAMPS, PMA) or inhibitors (Rp-cAMPS, sphingosine) of these two protein kinases, respectively. The developmental competence of bovine oocytes was measured by the rate of blastocyst formation after in vitro fertilization (IVF). Our results showed that when cumulus–oocyte complexes (COCs) were cultured with r-hFSH for the first 6 h, a highly significant (P < 0.0001) improvement is seen in blastocyst development rate as a proportion of oocytes in culture compared with those matured with r-hFSH for the first 2 or 24 h. A transient exposure (6 h) to the highest dose (100 μM) of forskolin (an activator of adenylate cyclase) increased (P < 0.05) the rate of blastocyst formation. But the PKA inhibitors (Rp-cAMPS) did not affect the stimulatory effects of r-hFSH on the blastocyst yield. However, stimulation of PKC by low doses of PMA (0.1–0.5 μM) during short-term treatment, enhanced (P < 0.0001) the developmental capacity of oocytes, while sphingosine (a specific inhibitor of PKC) inhibited (P < 0.05) the stimulatory effects of r-hFSH on the rate of blastocyst formation. Our results indicate that although the developmental capacity of bovine oocytes in vitro can be modulated by both the PKA, and the PKC pathways, the activation of PKC during short-term treatment can mimic the effect of r-hFSH on the cytoplasmic maturation in bovine oocytes in vitro.

APA, Harvard, Vancouver, ISO, and other styles

19

Cai, Yongming, Zhengmin Chen, Zongpeng Zhang, Longsheng Zhang, Ming Li, and Changxiao Liu. "A 30-Day Preclinical Safety Evaluation Study of Recombinant Human Follicle-Stimulating Hormone in Female Rhesus Monkeys." International Journal of Toxicology 30, no. 2 (March 2011): 153–61. http://dx.doi.org/10.1177/1091581810390823.

Full text

Abstract:

The objective of this study was to identify potential target organs for toxicity of recombinant human follicle stimulating hormone (r-hFSH) in female rhesus monkeys and to establish a no observed adverse effect level (NOAEL). In all, 24 female rhesus monkeys (Chinese origin, weighing 3.4-5.2 kg, approximately 5 years of age) received repeated subcutaneous (sc) r-hFSH at doses of 10, 60, and 300 IU/kg per d or vehicle once daily for 30 days followed by a 15-day recovery period. Endometrial hyperplasia and dermal edema in the external genitals were found in some animals at 300 IU/kg per d. Pharmacologic-related multiple cystic follicles were found in all r-hFSH-treated groups. A weak, anti-FSH antibody response was detected at the end of treatment in animals administered 60 and 300 IU/kg per d. These results indicate that the primary effects of r-hFSH in female rhesus monkeys were related to its pharmacological activity on the reproductive system. The NOAEL was considered to be 60 IU/kg per d.

APA, Harvard, Vancouver, ISO, and other styles

20

Polim, Arie A., Nining Handayani, Adinda Pratiwi, Caroline Hutomo, Arief Boediono, and Ivan Sini. "Comparison of Highly Purified HMG versus Recombinant FSH with Antagonist Protocol in Poor Responder Patients." Fertility & Reproduction 02, no. 01 (March 2020): 14–20. http://dx.doi.org/10.1142/s2661318220500036.

Full text

Abstract:

Background:Luteinizing hormone (LH) supplementation may have beneficial effect on the maturity and fertilizability of oocytes in poor ovarian reserve (POR) and may influence the progesterone level, thus increasing the pregnancy rate. However, previous studies on the effect of LH activity supplementation on poor responders have shown conflicting results. This study aimed to compare the clinical effectiveness of two different forms of gonadotropin (highly purified human menopausal gonadotropin (HP-HMG) vs. recombinant human follicle-stimulating hormone (r-hFSH)-only) in Indonesian population. Methods: Women diagnosed with poor ovarian response who received gonadotropin-releasing hormone (GnRH) antagonist protocol with either HP-HMG or r-hFSH-only were investigated. Women who underwent freeze all cycles, mini stimulation, and natural stimulation were excluded. Multiple logistic regression was performed to assess the effect of follicle-stimulating hormone (FSH) + human chorionic gonadotropin (HCG)-driven LH activity combination in HP-HMG to pregnancy event adjusting for progesterone level, demographic variables, and clinical characteristic variables. Results: A total of 101 subjects in the HP-HMG treatment group and 89 subjects in r-hFSH-only treatment group were involved in the study. There was no significant difference of clinical pregnancy rate between HP-HMG group and r-hFSH-only group (adjusted OR: 0.94, 95% CI: 0.39–2.25; p-value: 0.890). Conclusion: Compared to r-hFSH-only group, combination of FSH + HCG-driven LH activity in HP-HMG group had similar effectiveness in poor responders undergoing in vitro fertilization (IVF) using the antagonist protocol.

APA, Harvard, Vancouver, ISO, and other styles

21

Madersbacher, S., R. Gerth, K. Mann, S. Dirnhofer, and P. Berger. "Gonadotrophin secretion patterns in testicular cancer patients with greatly increased human chorionic gonadotrophin serum concentrations." Journal of Endocrinology 159, no. 3 (December 1, 1998): 451–58. http://dx.doi.org/10.1677/joe.0.1590451.

Full text

Abstract:

Despite the fact that a number of alterations of the hypothalamic-pituitary-gonadal hormone axis have been identified in patients with testicular cancer, little is known about the gonadotrophin secretion pattern in such patients who have greatly increased human chorionic gonadotrophin (hCG) serum concentrations. The aim of this study was to assess this issue in detail using a longitudinal study design and a panel of highly sensitive and specific immunoassays. Eleven patients with non-seminomatous (n=11), and one with seminomatous testicular cancer with pretreatment hCG serum concentrations exceeding 10(5) pg/ml (>1000 mIU/ml) were selected and followed for a mean of 166 days (mean of 14 serum samples/patient) after initial diagnosis. Serum concentrations of hCG, its free alpha- (hCGalpha) and beta- (hCGbeta) subunits, human follicle-stimulating hormone (hFSH) and human luteinizing hormone (hLH) were determined by highly sensitive and specific enzymometric immunoassays based on a panel of monoclonal antibodies (MCA) established in our laboratory. A potential FSH-like activity (FSA) of hCG in the respective sera was determined by radioreceptor assays (RRA) for LH/CG and FSH. Specificity of FSA at the level of the receptor was assessed by MCA-based immunoabsorption studies. At diagnosis, hCG (9.8x10(7)+/-4.84x10(7) pg/ml; range 1.1x10(5)-5x10(8) pg/ml) was greatly increased and serum hFSH was undetectable (<9 pg/ml) in 11 patients, and one patient had very low, albeit detectable (approximately 30 pg/ml) hFSH concentrations. hLH was below the limit of detection (<2 pg/ml) in five individuals. During successful chemotherapy, hCG rapidly declined to physiological concentrations and hFSH/hLH returned to normal or even reached supraphysiological values. There was a highly significant negative correlation between hCG and hFSH (P=0.0001) and, to a lesser extent, hLH (P=0.0265). The ability of serum hCG to block the binding of [125I]rFSH (rat FSH) to its receptor was found to be 0.01-0.1% compared with the FSH standard; this could be reversed by an anti-hCG MCA. Addition of a specific MCA against hFSH blocked 3 microg/ml of the hFSH standard, but had no effect on the FSA of serum hCG in the FSH RRA. As observed during pregnancy, secretion of gonadotrophin -- particularly that of FSH -- is substantially or completely suppressed in patients with testicular cancer when serum hCG concentrations exceed 10(5)-10(6) pg/ml (approximately 10(3)-10(4) mIU/ml). As determined by RRA, the intrinsic FSA of tumour-derived hCG is most probably responsible for the suppression of hFSH in this group of patients with testicular cancer.

APA, Harvard, Vancouver, ISO, and other styles

22

Gordon, Ana, José C. Garrido-Gracia, Rafaela Aguilar, and José E. Sánchez-Criado. "Understanding the regulation of pituitary progesterone receptor expression and phosphorylation." REPRODUCTION 149, no. 6 (June 2015): 615–23. http://dx.doi.org/10.1530/rep-14-0592.

Full text

Abstract:

Administration of human FSH (hFSH) during the diestrus phase in cyclic rats is followed by a reduction in the preovulatory LH surge. This inhibitory action of FSH involves a decrease in the stimulatory effect of gonadotrope progesterone receptor (PR) activation, in a ligand-dependent (progesterone) and -independent (GNRH) manner. PR activation and action are mandatory for LH surge, and are dependent on the phosphorylation of serine (Ser) residues. Together with this post-translational modification, PR is marked for downregulation by proteasome machinery. These experiments used the western blotting technique to measure pituitary expression of PR-A and PR-B isoforms and phosphorylation levels of Ser294 and Ser400 PR-B in rats bearing i) hFSH treatment or ii) PR downregulation. Treatment with hFSH reduced LH secretion and increased that of estradiol in proestrus afternoon. hFSH injections, without altering PR-A and PR-B content or ratio, caused a reduction in phosphorylation of Ser294 and Ser400 but only when pituitaries were previously challenged with progesterone or GNRH for 2 h. However, while pSer294 levels increased after 2 h of pituitary incubation with progesterone or GNRH, those of pSer400 were not modified by thesein vitrotreatments. Finally, progesterone had a biphasic effect: in 2-h incubations increased pituitary PR-A and PR-B content, but after 8 h caused downregulation and altered PR-A:PR-B ratio. The results provide a potential mechanism through which LH levels are decreased by hFSH administration and better understanding of the control of PR expression and phosphorylation in rat pituitaries.

APA, Harvard, Vancouver, ISO, and other styles

23

Weinbauer, G. F., M. Simoni, J. S. Hutchison, and E. Nieschlag. "Pharmacokinetics and pharmacodynamics of recombinant and urinary human FSH in the male monkey (Macaca fascicularis)." Journal of Endocrinology 141, no. 1 (April 1994): 113–21. http://dx.doi.org/10.1677/joe.0.1410113.

Full text

Abstract:

Abstract A dose-finding study was performed in adult male monkeys (Macaca fascicularis) to evaluate the pharmacokinetics and pharmacodynamics of a recombinant human FSH preparation (rhFSH). Groups of five monkeys were randomly assigned to receive single i.m. injections of 0·9% (w/v) NaCl (diluent), 6, 12 or 24 IU rhFSH/kg or 24 IU urinary human FSH/kg (uhFSH). The doses were based on an in vivo ovarian weight gain assay. Blood samples were collected 24 h before and immediately prior to injections, and 4, 8, 12, 24, 72 and 96 h after injections for determination of serum levels of immunoactive FSH by fluoroimmunoassay, bioactive FSH by an in vitro Sertoli cell assay, and inhibin and testosterone by radioimmunoassay. Inhibin was chosen as a marker for in vivo hFSH activity, since the secretion of inhibin in male monkeys is under the control of FSH. Administration of hFSH resulted in dose-related increases in serum hFSH concentrations. rhFSH and uhFSH exhibited similar pharmacokinetics. Comparable findings were obtained when serum samples were analysed for in vitro FSH bioactivity. Maximum serum hFSH levels were obtained 4–6 h after administration and the elimination half-life of hFSH was on average 18–22 h. The serum pharmacokinetics of rhFSH were linear within the dose range explored. Baseline inhibin concentrations varied significantly between groups. However, when the changes in inhibin concentrations were normalized to the baseline values (per cent change, area under curve and maximum inhibin level), a dose-dependent stimulatory effect of rhFSH on serum inhibin was evident. This effect attained statistical significance with doses of 24 IU rhFSH/kg and 24 IU uhFSH/kg, and the serum inhibin responses to rhFSH and uhFSH were not significantly different. No significant differences were observed with regard to the serum concentrations of testosterone between the diluentand hFSH-treated groups. It was concluded that rhFSH is bioactive in terms of stimulating testicular inhibin production in the male monkey and that the pharmacokinetic properties of rhFSH and uhFSH are similar. Journal of Endocrinology (1994) 141, 113–121

APA, Harvard, Vancouver, ISO, and other styles

24

Pimpalkhute, M., M. A. Majali, and R. S. Mani. "Radioimmunoassay of Human Follicle Stimulating Hormone /HFSH/." Journal of Radioanalytical and Nuclear Chemistry Letters 103, no. 2 (January 1986): 105–16. http://dx.doi.org/10.1007/bf02162766.

Full text

APA, Harvard, Vancouver, ISO, and other styles

25

Gurgan, Timur, Debbie Montjean, Aygul Demirol, and Yves J. R. Menezo. "Sequential (hFSH + recFSH) vs homogenous (hFSH or recFSH alone) stimulation: clinical and biochemical (cumulus cell gene expression) aspects." Journal of Assisted Reproduction and Genetics 31, no. 6 (March 18, 2014): 657–65. http://dx.doi.org/10.1007/s10815-014-0208-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Au, C. L., D. M. Robertson, and D. M. de Kretser. "Effects of hypophysectomy and subsequent FSH and testosterone treatment on inhibin production by adult rat testes." Journal of Endocrinology 105, no. 1 (April 1985): 1–6. http://dx.doi.org/10.1677/joe.0.1050001.

Full text

Abstract:

ABSTRACT The hormonal control of inhibin production by adult rat testes was investigated using an in-vitro inhibin bioassay validated for the measurement of inhibin activity in charcoal-treated rat testicular extracts. The effect of hypophysectomy examined at 16 h, 3, 7 and 42 days after surgery showed a decrease in testicular inhibin content and seminiferous tubule fluid production by 7 days and a decrease in inhibin production by 42 days. Serum FSH and LH were suppressed 3 days after surgery. In 30-day chronically hypophysectomized adult rats treated for 3 days with twice daily s.c. injections of (a) human FSH (hFSH, 22 i.u./rat per day), (b) testosterone (5 mg/rat per day), (c) hFSH + testosterone (same doses as a and b), or (d) human chorionic gonadotrophin (hCG, 12 i.u./rat per day), hFSH or hFSH and testosterone stimulated an increase in testicular inhibin content but not in inhibin production or tubule fluid production. Testosterone and hCG had no effect on these parameters. It is concluded that in vivo, FSH alone stimulates an increase in testicular inhibin content. The failure to observe an increase in inhibin production in vivo is attributed to the suppression of seminiferous tubule fluid production under the same experimental conditions. J. Endocr. (1985) 105, 1–6

APA, Harvard, Vancouver, ISO, and other styles

27

Madersbacher, S., T. Shu-Chen, S. Schwarz, S. Dirnhofer, G. Wick, and P. Berger. "Time-resolved immunofluorometry and other frequently used immunoassay types for follicle-stimulating hormone compared by using identical monoclonal antibodies." Clinical Chemistry 39, no. 7 (July 1, 1993): 1435–39. http://dx.doi.org/10.1093/clinchem/39.7.1435.

Full text

Abstract:

Abstract The influence of assay design and quantification system on assay performance was investigated by developing, optimizing, and comparing a time-resolved immunofluorometric assay (IFMA), an immunoenzymometric assay (IEMA), an immunoradiometric assay (IRMA), and a competitive radioimmunoassay (RIA), all performed with the same monoclonal antibodies (MCA) directed against human follicle-stimulating hormone (hFSH). The lowest detection limit (2 ng/L for hFSH-I-3, corresponding to 2.5 mIU of 1st International Reference Preparation of hFSH 78/549 per liter), the widest measuring range (2-160,000 ng/L), and the greatest signal-to-noise ratio (13,000:1 at 160,000 ng/L) were obtained in the IFMA. For analysis of serum samples from 101 male (ages 2-91 years) and 99 female (ages 2-90 years) individuals at a single dilution, 100% of samples were within the measuring range of the IFMA, whereas only 87%, 55%, 32%, and 8% of the sera were for the IRMA, the IEMA evaluated with double-wavelength measurement, the conventional IEMA, and the competitive MCA-based RIA, respectively. These studies demonstrate clear advantages of the IFMA in sensitivity and assay range, which allows reliable and cost- and time-effective determination of hFSH in individuals from infancy to senescence.

APA, Harvard, Vancouver, ISO, and other styles

28

Shaw, H. J., and J. K. Hodges. "Effects of oestradiol-17β on FSH-stimulated steroidogenesis in cultured marmoset granulosa cells." Journal of Endocrinology 132, no. 1 (January 1992): 123–31. http://dx.doi.org/10.1677/joe.0.1320123.

Full text

Abstract:

ABSTRACT A role for oestradiol in ovarian follicular development is well recognized. However, a number of disparate effects have been reported for the action of oestradiol in the primate ovary. To investigate this further, we have examined the effects of oestradiol on the differentiation of granulosa cells isolated from small (0·5–1 mm) antral follicles obtained from the ovaries of prepubertal marmoset monkeys (Callithrix jacchus). Granulosa cells were co-cultured with oestradiol and human FSH (hFSH) for 48 h, or were pretreated with oestradiol for 48 h before addition of gonadotrophin for a further 48 h. Oestradiol (0·01–100 nmol/l) had no effect on basal or hFSH-stimulated progesterone accumulation and aromatase activity when the hormones were added concurrently. Furthermore, oestradiol did not influence the ability of hFSH to induce LH/human chorionic gonadotrophin (hCG) responsiveness in immature granulosa cells. The absence of synergism between oestradiol and hFSH in the induction of marmoset granulosa cell differentiation was independent of the presence of phenol red in culture medium. However, gonadotrophin-stimulated steroidogenesis was attenuated when cells were cultured in the presence of phenol red compared with in its absence; this effect was more pronounced for gonadotrophin-stimulated aromatase activity but was evident for LH/hCG-stimulated progesterone accumulation at higher doses of hCG (10 and 100 ng/ml). An effect of phenol red on basal steroidogenesis was less obvious. In contrast, pretreatment of granulosa cells with oestradiol (0·1 μmol/l) alone for 48 h resulted in a greater steroidogenic response to hFSH (P<0·001) and dibutyryl cyclic AMP (P<0·01) treatment during a second 48-h culture period compared with cultures pretreated with dihydrotestosterone (0·1 μmol/l), hFSH (30 ng/ml) or without hormones. This stimulatory effect of oestradiol appeared to be specific in that it was antagonized (P<0·05) by the anti-oestrogen tamoxifen (1 μmol/l). In conclusion, this study provides evidence for a stimulatory autocrine role of oestradiol in the primate ovary. However, the action of oestradiol appears not to synergize with FSH directly, but rather to increase FSH-stimulated steroidogenesis by an independent mechanism. Journal of Endocrinology (1992) 132, 123–131

APA, Harvard, Vancouver, ISO, and other styles

29

Arslan, M., G. F. Weinbauer, S. Schlatt, M. Shahab, and E. Nieschlag. "FSH and testosterone, alone or in combination, initiate testicular growth and increase the number of spermatogonia and Sertoli cells in a juvenile non-human primate (Macaca mulatta)." Journal of Endocrinology 136, no. 2 (February 1993): 235—NP. http://dx.doi.org/10.1677/joe.0.1360235.

Full text

Abstract:

ABSTRACT The present study was designed to investigate the relative contributions of FSH and testosterone in the initiation of testicular growth and function in primates. Four groups (n = 4/group) of juvenile rhesus monkeys (Macaca mulatta), 12–18 months old, were treated with vehicle, a highly purified human FSH preparation (hFSH; Fertinorm, 3 IU/kg per day), testosterone (testosterone enanthate, 125 mg/week) or FSH plus testosterone, for a period of 12 weeks. Compared with vehicle treatment, the administration of hormones significantly (P <0·05) increased testicular weight and volume, and the diameter of seminiferous tubules. The number of Sertoli cells per tubule cross-section also increased significantly (P <0·05). Numbers of Ad (dark) spermatogonia (reserve stem cells) were not significantly influenced by any treatment. In contrast, the numbers of Ap (pale) spermatogonia (renewing stem cells) were significantly (P <0·05) stimulated with hFSH and testosterone alone. Following the combined treatment, numbers of Ap spermatogonia were also higher compared with control but this effect did not attain statistical significance. In half of the animals in both testosterone-treated groups, a few prophase I spermatocytes were present. Inhibin concentrations reached adult levels in hFSH-treated groups but remained unaffected by testosterone. Conversely, testosterone failed to influence inhibin levels and, unlike hFSH, increased testicular androgen concentration and epididymal weights. Our observations suggest that hFSH and testosterone alone are capable of initiating testicular growth and gametogenesis in an immature primate. Both hormones probably act via activation of the proliferation of Ap spermatogonia, which are considered to be renewing stem cells within the testis. This study also suggests that androgens might be involved in the morphological differentiation of the immature primate Sertoli cell, whereas the secretory activity of the seminiferous tubule, in terms of peripheral inhibin levels, might be under the influence of FSH. Journal of Endocrinology (1993) 136, 235–243

APA, Harvard, Vancouver, ISO, and other styles

30

Wide, Leif. "The regulation of metabolic clearance rate of human FSH in mice by variation of the molecular structure of the hormone." Acta Endocrinologica 112, no. 3 (July 1986): 336–44. http://dx.doi.org/10.1530/acta.0.1120336.

Full text

Abstract:

Abstract. The relationship between charge on human FSH (hFSH) molecules and their metabolic clearance rate (MCR) was investigated. The median charge of the hFSH molecules was expressed as their median mobility at electrophoresis in 0.075 m sodium veronal buffer, pH 8.6. MCR was estimated after single iv injection in mice of unfractionated and fractionated extracts of human pituitaries. There was a highly significant (P < 0.001) correlation between charge and MCR both for forms of FSH present within the individual pituitary and for FSH in different pituitaries. After the iv injection there was a gradual change to a more negative median charge of hFSH in plasma. This was explained by the more rapid clearance of the less negatively charged forms of hFSH and thus selective survival of different forms in the circulation. This is a most likely explanation for the differences in median charge between FSH in pituitaries and in sera of men and women of corresponding age. The results suggest that MCR of human FSH is controlled by a gonadal-pituitary feed-back mechanism which involves changes in the structure of the FSH produced by the pituitary. It is suggested that charge is one factor involved in the regulation of the survival of FSH in the circulation and that this is of physiological importance for the control of the ovarian function during the menstrual cycle.

APA, Harvard, Vancouver, ISO, and other styles

31

Melchiorre, Chiara, Cerina Chhuon, Vincent Jung, Joanna Lipecka, Francesca Di Rella, Alessandro Conforti, Angela Amoresano, Andrea Carpentieri, and Ida Chiara Guerrera. "Identification and Relative Quantification of hFSH Glycoforms in Women’s Sera via MS–PRM-Based Approach." Pharmaceutics 13, no. 6 (May 27, 2021): 798. http://dx.doi.org/10.3390/pharmaceutics13060798.

Full text

Abstract:

Follicle-stimulating hormone (FSH) is a glycohormone synthesized by adenohypophysis, and it stimulates ovulation in women and spermatogenesis in men by binding to its receptor (FSHR). FSHR is involved in several mechanisms to transduce intracellular signals in response to the FSH stimulus. Exogenous FSH is currently used in the clinic for ovarian hyperstimulation during in vitro fertilization in women, and for treatment of infertility caused by gonadotropin deficiency in men. The glycosylation of FSH strongly affects the binding affinity to its receptor, hence significantly influencing the biological activity of the hormone. Therefore, the accurate measurement and characterization of serum hFSH glycoforms will contribute to elucidating the complex mechanism of action by which different glycoforms elicit distinct biological activity. Nowadays ELISA is the official method with which to monitor serum hFSH, but the test is unable to distinguish between the different FSH glycovariants and is therefore unsuitable to study the biological activity of this hormone. This study presents a preliminary alternative strategy for identifying and quantifying serum hFSH glycoforms based on immunopurification assay and mass spectrometry (MS), and parallel reaction monitoring (PRM) analysis. In this study, we provide an MS–PRM data acquisition method for hFSH glycopeptides identification with high specificity and their quantification by extracting the chromatographic traces of selected fragments of glycopeptides. Once set up for all its features, the proposed method could be transferred to the clinic to improve fertility treatments and follow-ups in men and women.

APA, Harvard, Vancouver, ISO, and other styles

32

Felberbaum, R., S. Daya, R. Fischer, M. Thaele, J. P. Auray, G. Duru, R. Bouzayen, A. Beresniak, and J. Blechschmidt. "Kosteneffektivität von rekombinantem FSH (r-hFSH) bei assistierten Reproduktionstechniken (ART) in Deutschland - Modellierung im Vergleich zu urinärem FSH (u-hFSH)." Geburtshilfe und Frauenheilkunde 62, no. 7 (July 2002): 668–76. http://dx.doi.org/10.1055/s-2002-33008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Gurgan, Timur, Debbie Montjean, Aygul Demirol, Moncef Benkhalifa, and Yves J. R. Menezo. "Erratum to: Sequential (hFSH + recFSH) vs homogenous (hFSH or recFSH alone) stimulation: clinical and biochemical (cumulus cell gene expression) aspects." Journal of Assisted Reproduction and Genetics 31, no. 8 (August 2014): 1111. http://dx.doi.org/10.1007/s10815-014-0313-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Hua, Guohua, Jitu W. George, Kendra L. Clark, Kim C. Jonas, Gillian P. Johnson, Siddesh Southekal, Chittibabu Guda, et al. "Hypo-glycosylated hFSH drives ovarian follicular development more efficiently than fully-glycosylated hFSH: enhanced transcription and PI3K and MAPK signaling." Human Reproduction 36, no. 7 (June 1, 2021): 1891–906. http://dx.doi.org/10.1093/humrep/deab135.

Full text

Abstract:

Abstract STUDY QUESTION Does hypo-glycosylated human recombinant FSH (hFSH18/21) have greater in vivo bioactivity that drives follicle development in vivo compared to fully-glycosylated human recombinant FSH (hFSH24)? SUMMARY ANSWER Compared with fully-glycosylated hFSH, hypo-glycosylated hFSH has greater bioactivity, enabling greater follicular health and growth in vivo, with enhanced transcriptional activity, greater activation of receptor tyrosine kinases (RTKs) and elevated phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) and Mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) signaling. WHAT IS KNOWN ALREADY Glycosylation of FSH is necessary for FSH to effectively activate the FSH receptor (FSHR) and promote preantral follicular growth and formation of antral follicles. In vitro studies demonstrate that compared to fully-glycosylated recombinant human FSH, hypo-glycosylated FSH has greater activity in receptor binding studies, and more effectively stimulates the PKA pathway and steroidogenesis in human granulosa cells. STUDY DESIGN, SIZE, DURATION This is a cross-sectional study evaluating the actions of purified recombinant human FSH glycoforms on parameters of follicular development, gene expression and cell signaling in immature postnatal day (PND) 17 female CD-1 mice. To stimulate follicle development in vivo, PND 17 female CD-1 mice (n = 8–10/group) were treated with PBS (150 µl), hFSH18/21 (1 µg/150 µl PBS) or hFSH24 (1 µg/150 µl PBS) by intraperitoneal injection (i.p.) twice daily (8:00 a.m. and 6:00 p.m.) for 2 days. Follicle numbers, serum anti-Müllerian hormone (AMH) and estradiol levels, and follicle health were quantified. PND 17 female CD-1 mice were also treated acutely (2 h) in vivo with PBS, hFSH18/21 (1 µg) or hFSH24 (1 µg) (n = 3–4/group). One ovary from each mouse was processed for RNA sequencing analysis and the other ovary processed for signal transduction analysis. An in vitro ovary culture system was used to confirm the relative signaling pathways. PARTICIPANTS/MATERIALS, SETTING, METHODS The purity of different recombinant hFSH glycoforms was analyzed using an automated western blot system. Follicle numbers were determined by counting serial sections of the mouse ovary. Real-time quantitative RT-PCR, western blot and immunofluorescence staining were used to determine growth and apoptosis markers related with follicle health. RNA sequencing and bioinformatics were used to identify pathways and processes associated with gene expression profiles induced by acute FSH glycoform treatment. Analysis of RTKs was used to determine potential FSH downstream signaling pathways in vivo. Western blot and in vitro ovarian culture system were used to validate the relative signaling pathways. MAIN RESULTS AND THE ROLE OF CHANCE Our present study shows that both hypo- and fully-glycosylated recombinant human FSH can drive follicular growth in vivo. However, hFSH18/21 promoted development of significantly more large antral follicles compared to hFSH24 (P < 0.01). In addition, compared with hFSH24, hFSH18/21 also promoted greater indices of follicular health, as defined by lower BAX/BCL2 ratios and reduced cleaved Caspase 3. Following acute in vivo treatment with FSH glycoforms RNA-sequencing data revealed that both FSH glycoforms rapidly induced ovarian transcription in vivo, but hypo-glycosylated FSH more robustly stimulated Gαs and cAMP-mediated signaling and members of the AP-1 transcription factor complex. Moreover, hFSH18/21 treatment induced significantly greater activation of RTKs, PI3K/AKT and MAPK/ERK signaling compared to hFSH24. FSH-induced indices of follicle growth in vitro were blocked by inhibition of PI3K and MAPK. LARGE SCALE DATA RNA sequencing of mouse ovaries. Data will be shared upon reasonable request to the corresponding author. LIMITATIONS, REASONS FOR CAUTION The observations that hFSH glycoforms have different bioactivities in the present study employing a mouse model of follicle development should be verified in nonhuman primates. The gene expression studies reflect transcriptomes of whole ovaries. WIDER IMPLICATIONS OF THE FINDINGS Commercially prepared recombinant human FSH used for ovarian stimulation in human ART is fully-glycosylated FSH. Our findings that hypo-glycosylated hFSH has greater bioactivity enabling greater follicular health and growth without exaggerated estradiol production in vivo, demonstrate the potential for its development for application in human ART. STUDY FUNDING/COMPETING INTEREST(S) This work was supported by NIH 1P01 AG029531, NIH 1R01 HD 092263, VA I01 BX004272, and the Olson Center for Women’s Health. JSD is the recipient of a VA Senior Research Career Scientist Award (1IK6 BX005797). This work was also partially supported by National Natural Science Foundation of China (No. 31872352). The authors declared there are no conflicts of interest.

APA, Harvard, Vancouver, ISO, and other styles

35

Stanton, P. G., P. G. Burgon, M. T. W. Hearn, and D. M. Robertson. "Structural and functional characterisation of hFSH and hLH isoforms." Molecular and Cellular Endocrinology 125, no. 1-2 (December 1996): 133–41. http://dx.doi.org/10.1016/s0303-7207(96)03958-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

36

Bousfield, George R., Vladimir Y. Butnev, Viktor Y. Butnev, Bin Shuai, Rajeswari Devabhakthuni, and David J. Harvey. "Comparison of hFSH Glycosylation by Electrospray Ionization Mass Spectrometry." Biology of Reproduction 85, Suppl_1 (July 1, 2011): 612. http://dx.doi.org/10.1093/biolreprod/85.s1.612.

Full text

APA, Harvard, Vancouver, ISO, and other styles

37

Bramley, T. A., D. Stirling, I. A. Swanston, G. S. Menzies, and D. T. Baird. "Specific binding sites for LH/chorionic gonadotrophin, low-density lipoprotein, prolactin and FSH in homogenates of human corpus luteum. I: Validation of methods." Journal of Endocrinology 113, no. 2 (May 1987): 305–15. http://dx.doi.org/10.1677/joe.0.1130305.

Full text

Abstract:

ABSTRACT The specific binding of 125I-labelled human chorionic gonadotrophin (hCG), human low-density lipoprotein (hLDL), human FSH (hFSH) and human prolactin (hPRL) to homogenates of human corpus luteum tissue was measured. Specific binding of 125I-labelled hCG was dependent on the temperature and duration of incubation, was inhibited by divalent metal ions or chelating agents, and increased linearly with homogenate concentration. Recovery of bound hormone was more effective using Millipore filtration or polyethylene glycol precipitation compared with centrifugation alone. Binding of 125I-labelled hCG was inhibited specifically by low levels of hCG and human LH (hLH) but not by ovine LH or bovine LH. Incubation of human luteal tissue with ice-cold citrate buffer (pH 3) released more than 90% of specifically bound 125I-labelled hCG within 5 min. This treatment inactivated LH receptors, but did not affect the immunoactivity of hLH released, enabling the measurement of released hormone by radioimmunoassay. Scatchard plots of binding of 125I-labelled LDL to human corpus luteum demonstrated a single class of binding sites. Binding was saturable, increased linearly with increasing concentration of homogenate, and was displaceable by low concentrations of unlabelled LDL. Binding of 125I-labelled hPRL to human luteal homogenates was increased by Mg2+ and was specific for lactogenic hormones (human prolactin, human growth hormone and ovine prolactin). Binding of 125I-labelled hFSH was not dependent on divalent metal ion concentration (in marked contrast to hFSH binding to immature pig granulosa cell receptors) and was displaced by hFSH preparations but not by hPRL, ovine LH or hCG at 1 μg/ml. These results establish optimal conditions and hormone specificities for the measurement of human luteal gonadotrophin and LDL receptors, and methods for the estimation of hLH/hCG endogenously bound to human corpus luteum tissue. J. Endocr. (1987) 113, 305–315

APA, Harvard, Vancouver, ISO, and other styles

38

Klein, J., L. Lobel, S. Pollak, B. Lustbader, R. T. Ogden, M. V. Sauer, and J. W. Lustbader. "Development and characterization of a long-acting recombinant hFSH agonist." Human Reproduction 18, no. 1 (January 1, 2003): 50–56. http://dx.doi.org/10.1093/humrep/deg024.

Full text

APA, Harvard, Vancouver, ISO, and other styles

39

Butnev, Viktor Y., Vladimir Y. Butnev, Jeffrey V. May, Bin Shuai, Patrick Tran, William K. White, Alan Brown, Aaron Smalter Hall, David J. Harvey, and George R. Bousfield. "Production, purification, and characterization of recombinant hFSH glycoforms for functional studies." Molecular and Cellular Endocrinology 405 (April 2015): 42–51. http://dx.doi.org/10.1016/j.mce.2015.01.026.

Full text

APA, Harvard, Vancouver, ISO, and other styles

40

Hillier, S. G., E. J. Wickings, P. T. K. Saunders, A. F. Dixson, S. Shimasaki, I. A. Swanston, L. E. Reichert, and A. S. McNeilly. "Control of inhibin production by primate granulosa cells." Journal of Endocrinology 123, no. 1 (October 1989): 65–73. http://dx.doi.org/10.1677/joe.0.1230065.

Full text

Abstract:

ABSTRACT In-vitro data from experiments on rats implicate granulosa cells as primary sites of hormone-dependent ovarian inhibin biosynthesis, but no equivalent data exist for primates. We have used the common marmoset (Callithrix jacchus) to investigate inhibin biosynthesis in primate granulosa cells in vitro and to determine its relationship to preovulatory follicular development. To relate the production of immunoactive inhibin to follicular maturity, we studied primary granulosa cell cultures from follicles at progressive stages of preovulatory development. Granulosa cells from 'large' (≥2·0 mm diameter) follicles expressed high rates of inhibin production and steroidogenesis (progesterone), and were positively regulated by human (h)LH in vitro. Less mature granulosa cells from 'medium' (1·1–1·9 mm) and 'small' (≤ 1·0 mm) follicles expressed proportionately lower rates of inhibin production and steroidogenesis, but each parameter was stimulated in a dose- and time-dependent manner by hFSH in vitro. The stimulatory action of hFSH on immunoactive inhibin was augmented by the presence of testosterone or oestradiol; testosterone (but not oestradiol) also augmented the steroidogenic response to hFSH. Marmoset luteal tissue also produced inhibin in vitro and expressed an ∼1·5 kb inhibin α-subunit mRNA, confirming the corpus luteum as a source of ovarian inhibin in primates. These results provide direct experimental evidence that primate granulosa cells produce inhibin. They suggest that production of inhibin by immature granulosa cells is initially induced by FSH and subject to modulation by follicular steroids. During advanced preovulatory development, granulosa cell inhibin production becomes directly responsive to LH, thereby indicating a role for LH in the control of peri- and postovulatory inhibin secretion by the primate ovary. Journal of Endocrinology (1989) 123, 65–73

APA, Harvard, Vancouver, ISO, and other styles

41

Grasso, Patricia, Marina Rozhavskaya, and Leo E. Reichert. "In Vivo Effects of Human Follicle-Stimulating Hormone-Related Synthetic Peptide hFSH-,β-(81–95) and Its Subdomain hFSH-β-(90–95) on the Mouse Estrous Cycle." Biology of Reproduction 58, no. 3 (March 1, 1998): 821–25. http://dx.doi.org/10.1095/biolreprod58.3.821.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Lehert, Philippe, Efstratios M. Kolibianakis, Christos A. Venetis, Joan Schertz, Helen Saunders, Pablo Arriagada, Samuel Copt, and Basil Tarlatzis. "Recombinant human follicle-stimulating hormone (r-hFSH) plus recombinant luteinizing hormone versus r-hFSH alone for ovarian stimulation during assisted reproductive technology: systematic review and meta-analysis." Reproductive Biology and Endocrinology 12, no. 1 (2014): 17. http://dx.doi.org/10.1186/1477-7827-12-17.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Nõmm, M., M. Ivask, P. Pärn, Ü. Jaakma, and S. Kõks. "36 Transgenic Somatic Cell Nuclear Transfer Blastocyst Selection with Embryo Biopsying." Reproduction, Fertility and Development 30, no. 1 (2018): 157. http://dx.doi.org/10.1071/rdv30n1ab36.

Full text

Abstract:

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.93%), of which 12 (54.54%) were TG positive blastocysts and selected for transfer. Our hFSH TG fibroblast cell line demonstrated a low concentration of TG cells in its culture, despite the selection and verification methods applied. Based on the analysis of SCNT embryos, only 54.54% of the embryos developed were TG positive. The embryo biopsying technique enables us to use only TG-positive SCNT cloned embryos for transfer, therefore avoiding non-TG pregnancies. This study was supported by Enterprise Estonia grant EU30020, Institutional research funding IUT 8-1 and Horizon 2020 Project SEARMET 692299.

APA, Harvard, Vancouver, ISO, and other styles

44

Howles, C. M. "The use of recombinant hFSH (Gonal-F®) in assisted reproductive techniques." Gynecological Endocrinology 10, sup4 (January 1996): 57–58. http://dx.doi.org/10.3109/09513599609116188.

Full text

APA, Harvard, Vancouver, ISO, and other styles

45

Bousfield, George R., Vladimir Y. Butnev, Jean-Michel Bidart, Dilusha Dalpathado, Janet Irungu, and Heather Desaire. "Chromatofocusing Fails To Separate hFSH Isoforms on the Basis of Glycan Structure†." Biochemistry 47, no. 6 (February 2008): 1708–20. http://dx.doi.org/10.1021/bi701764w.

Full text

APA, Harvard, Vancouver, ISO, and other styles

46

Smith, Chris S., Aaron Hinz, Diane Bodenmiller, David E. Larson, and Yves V. Brun. "Identification of Genes Required for Synthesis of the Adhesive Holdfast in Caulobacter crescentus." Journal of Bacteriology 185, no. 4 (February 15, 2003): 1432–42. http://dx.doi.org/10.1128/jb.185.4.1432-1442.2003.

Full text

Abstract:

ABSTRACT Adhesion to both abiotic and biotic surfaces by the gram-negative prothescate bacterium Caulobacter crescentus is mediated by a polar organelle called the “holdfast,” which enables the bacterium to form stable monolayer biofilms. The holdfast, a complex polysaccharide composed in part of N-acetylglucosamine, localizes to the tip of the stalk (a thin cylindrical extension of the cell wall and membranes). We report here the isolation of adhesion mutants with transposon insertions in an uncharacterized gene cluster involved in holdfast biogenesis (hfs) as well as in previously identified polar development genes (podJ and pleC), and the holdfast attachment genes (hfa). Clean deletions of three of the four genes in the hfs gene cluster (hfsDAB) resulted in a severe holdfast biogenesis phenotype. These mutants do not bind to surfaces or to a fluorescently labeled lectin, specific for N-acetylglucosamine. Transmission electron microscopy indicated that the hfsDAB mutants fail to synthesize a holdfast at the stalk tip. The predicted hfs gene products have significant sequence similarity to proteins necessary for exopolysaccharide export in gram-negative bacteria. HfsA has sequence similarity to GumC from Xanthomonas campestris, which is involved in exopolysaccharide export in the periplasm. HfsD has sequence similarity to Wza from Escherichia coli, an outer membrane protein involved in secretion of polysaccharide through the outer membrane. HfsB is a novel protein involved in holdfast biogenesis. These data suggest that the hfs genes play an important role in holdfast export.

APA, Harvard, Vancouver, ISO, and other styles

47

Ali, Atef, and Marc-André Sirard. "The effects of 17β-estradiol and protein supplement on the response to purified and recombinant follicle stimulating hormone in bovine oocytes." Zygote 10, no. 1 (February 2002): 65–71. http://dx.doi.org/10.1017/s0967199402002095.

Full text

Abstract:

During in vitro maturation of bovine oocytes, effects of gonadotropins (FSH, LH) and growth factors such as epidermal growth factor (EGF) vary among studies. Now that we can use defined or semi-defined medium, it becomes possible to evaluate recombinant products to assess their roles. Therefore, this study was designed to evaluate the effect of purified porcine (pFSH) or recombinant human (r-hFSH; 5, 50, or 500 ng/ml) follicle stimulating hormone, luteinising hormone (LH; 50, 500 or 5000 ng/ml) and epidermal growth factor (EGF; 5, 10, 30 or 50 ng/ml) on subsequent embryonic development of in vitro matured bovine oocytes. In addition, the presence of bovine serum albumin (BSA; 8 mg/ml) as a protein supplement during in vitro maturation (IVM) was studied. For all treatments, cumulus-oocyte complexes were matured in defined maturation medium consisting of synthetic oviduct fluid. Addition of LH to the maturation medium at all concentrations studied did not increase the proportion of oocytes developing to the morula and blastocyst stages. However, morula and blastocyst yield were improved (p < 0.05) after addition of EGF (30 ng/ml) as compared with maturation medium alone (29.3% vs 18.0%, respectively). Addition of r-hFSH to the maturation medium in the presence of 17β-estradiol (E2) significantly (p < 0.0001) increased the morula and blastocyst rate compared with maturation medium alone (40.3% vs 19.3%, respectively). The presence of BSA alone during IVM significantly reduced the developmental competence of oocytes as reflected by the morula and blastocyst yield. These results demonstrate the essential role of FSH, EGF and E2 on the kinetics of nuclear and cytoplasmic maturation that are essential for the formation of an egg capable of fertilisation and development. Also, supplementation of r-hFSH and E2 during IVM under our conditions increases morula and blastocyst yield following in vitro fertilisation and in vitro culture in defined medium. Finally, the presence of BSA as the only protein supplement during IVM may be detrimental to oocyte maturation.

APA, Harvard, Vancouver, ISO, and other styles

48

Nagorny, Pavel, Bernhard Fasching, Xuechen Li, Gong Chen, Baptiste Aussedat, and Samuel J. Danishefsky. "Toward Fully Synthetic Homogeneous β-Human Follicle-Stimulating Hormone (β-hFSH) with a Biantennary N-Linked Dodecasaccharide. Synthesis of β-hFSH with Chitobiose Units at the Natural Linkage Sites." Journal of the American Chemical Society 131, no. 16 (April 29, 2009): 5792–99. http://dx.doi.org/10.1021/ja809554x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

GRASSO, PATRICIA, TOMÁS A. SANTA-COLOMA, and LEO E. REICHERT. "Synthetic Peptides Corresponding to Human Follicle- Stimulating Hormone (hFSH)-β-(l–15) and hFSH-β- (51–65) Induce Uptake of45Ca++by Liposomes: Evidence for Calcium-Conducting Transmembrane Channel Formation*." Endocrinology 128, no. 6 (June 1991): 2745–51. http://dx.doi.org/10.1210/endo-128-6-2745.

Full text

APA, Harvard, Vancouver, ISO, and other styles

50

Berger, B. M., D. Ezcurra, and M. M. Alper. "Comparison of in-vitro fertilization-embryo transfer (IVF-ET) outcomes in patients treated with recombinant human follicle stimulating hormone (r-hFSH) or r-hFSH and human menopausal gonadotropins (hMG)." Fertility and Sterility 82 (September 2004): S236—S237. http://dx.doi.org/10.1016/j.fertnstert.2004.07.626.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Journal articles on the topic 'HFSH'

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles