Relevant bibliographies by topics / HDB

Academic literature on the topic 'HDB'

Author: Grafiati
Published: 4 June 2021
Last updated: 5 February 2022

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Contents

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'HDB.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "HDB"

1

Bredenfeld, Henning, Elena Gilman, Beate Pfistner, Volker Diehl, and Andreas Engert. "A Comparison of Outcome and Second Malignancies in Adolescents and Adult Patients with Hodgkin’s Lymphoma (HL). Results from the German Hodgkin Study Group." Blood 106, no. 11 (November 16, 2005): 2670. http://dx.doi.org/10.1182/blood.v106.11.2670.2670.

Full text
Abstract:
Abstract Introduction: Whether adolescent (alc) patients with HL represent a distinct patient group, requiring a therapy strategy separated from adults, is currently focussed in international debates. Most study groups are treating adult (ad) patients (pts) (age > 18 years) apart from younger patients (age < 18 years), considering a difference in treatment related toxicity and therapy outcome in both patient groups. Between 1988 and 1998, the GHSG trial generations 2 (G2) and 3 (G3) included younger patients from the age of 15 (G2), and 16 (G3), in identically therapy regimen with adults up to 65, and 75 years. The trials for early stages HD were comparing radiation therapy (RX) arms only (HD4, recruited 1988–1993), and, RX vs 2 cycles polychemotherapy plus RX (HD7, 1993–1998). Intermediate stages HD received 2 cycles of different chemotherapy regimen plus identically RX (HD5, 1988–1993), and, 2 identically cycles of chemotherapy plus different RX (HD8, 1993–1998). Advanced stages HL were treated with either 4 cycles conventional polychemotherapy plus EF, or, 4 cycles of a hybrid regimen plus EF RX (HD6, 1988–1993); the following trial (HD9, 1993–1998) compared 3 arms of different polychemotherapy followed by RX on bulky disease. Methods: In G2 and G3, a total of 573 adolescents (15–21 yrs) in early, intermediate, and advanced stages HL were compared with 4917 pts (15–75 yrs) for complete remission rate (CR), 5 yrs survival rate (SV), 5 yrs freedom from treatment failure (FFTF), and, secondary neoplasias (2nd NPL). (table 1) Conclusion: Based on this large analysis of HL patients treated in prospectively randomized trials, the prognosis of patients aged 15–21 years is rather similar to the prognosis of adult patients. A more detailed evaluation including age-adapted prognosis will be presented. Results: Adolescents /Adults CR % 5 yrs FFTF % 5 yrs SV % Alc Ad Alc Ad Alc Ad Early stages HD4 97.7 97.3 81.6 80.5 97.6 95.1 HD7 93.3 94.3 82.0 83.3 100 94.1 Intermediate stages HD5 93.5 93.4 83.3 81.7 94.3 90.5 HD8 93.8 92.6 84.5 82.7 97.3 91.3 Advanced stages HD6 77.8 77.0 61.0 58.8 85.3 78.6 HD9 93.5 90.3 85.8 79.2 92.4 88.0
APA, Harvard, Vancouver, ISO, and other styles
2

Latif, Najibah A., Anika Zafiah M. Rus, and M. Khairul Zaimy A. Ghani. "Effect of Thickness for Sound Absorption of High Density Biopolymer Foams." Key Engineering Materials 594-595 (December 2013): 183–87. http://dx.doi.org/10.4028/www.scientific.net/kem.594-595.183.

Full text
Abstract:
Waste cooking oils are problematic disposal especially in the developed countries. In this paper, waste cooking oil is used as raw material to produce foam. The purpose of the study is to develop the high density solid biopolymer (HDB) by using hot compression moulding technique based on flexible and rigid crosslinking agents. Physical properties such as Scanning Electron Microscope (SEM) and density of HDB were examined. The acoustic study of HDB for flexible and rigid has been measured using impedance tube test according ASTM E1050 standard with multiple layers of thicknesses. It was revealed that higher thicknesses of HDB exhibit less sound absorption coefficients. This situation is occurred for both flexible and rigid HDB. The frequency also shifted to the left when the layers of HDB were increased for both materials. The highest increment was 63.46%, observed from two layers from flexible and rigid HDB. For the conclusion, rigid HDB showed that they could absorb more sound, thus having higher noise reduction coefficient (NRC) than flexible HDB at low frequency.
APA, Harvard, Vancouver, ISO, and other styles
3

Latif, Najibah A., Anika Zafiah M. Rus, and M. Khairul Zaimy A. Ghani. "Influence of Hot Compression Moulding of Particulate Biopolymer and their Sandwich Layups for Sound Absorption Characteristic." Applied Mechanics and Materials 465-466 (December 2013): 1044–48. http://dx.doi.org/10.4028/www.scientific.net/amm.465-466.1044.

Full text
Abstract:
Waste cooking oils are problematic disposal especially in the developed countries. In this paper, waste cooking oil is used as raw material to produce foam. The purpose of the study is to develop the high density solid biopolymer (HDB) by using hot compression moulding technique based on flexible and rigid crosslinking agents. Physical properties such as Scanning Electron Microscope (SEM) and density of HDB were examined. The acoustic study of HDB sandwich layups of flexible (F) or rigid (R) has been measured using an impedance tube test according ASTM E1050 standard up to four maximum sandwich lay ups of F and R HDB in different arrangement. It was revealed that the arrangement sandwich layups of FRRF HDB sandwich gives the lowest sound absorption coefficients. The resonance frequency for RFR, FRF and FRRF were shifted to the left except for RFFR. The highest increment was 35.7 %, observed from RFR compared to the three layers of sandwich HDB. For the conclusion, RFR HDB showed that could absorb more sound, thus having higher noise reduction coefficient (NRC) than the other sandwich layups HDB at low frequency.
APA, Harvard, Vancouver, ISO, and other styles
4

Yang, Chao-Feng, Zhi-Hong Yin, Wen-Bin Shangguan, and Xiao-Cheng Duan. "A Study on the Dynamic Performance for Hydraulically Damped Rubber Bushings with Multiple Inertia Tracks and Orifices: Parameter Identification and Modeling." Shock and Vibration 2016 (2016): 1–16. http://dx.doi.org/10.1155/2016/3695950.

Full text
Abstract:
Hydraulically damped rubber bushings (HDBs) are important for vehicle noise, vibration, and harshness (NVH) performance as they are able to decay the vehicle’s oscillation induced by engine and road. The dynamic stiffness and loss angle of an HDB are crucial and it is significant to investigate the relations between the design parameters with the dynamic stiffness and loss angle. Therefore, the force-deflection relation of the HDB is measured statically and the dynamic stiffness and loss angle are measured dynamically and the test data are analyzed with a view to examine how the measurement results are influenced by the design parameters (the number of the fluid tracks). Compared with the results predicted by a nonlinear lumped parameter model whose parameters are extracted by a parameter identification technique, using the model, the effect of the main rubber and the fluid track on the dynamic stiffness and the loss angle is investigated. A unified analytical model of HDB is also developed with the purpose of predicting the static and dynamic characteristics, and the predictions are shown to be well correlated with the measurement data. The good correlation suggests the validity of the model and the parameter identification implementation.
APA, Harvard, Vancouver, ISO, and other styles
5

López-Pérez, Héctor M., Sixto Velarde-Félix, Idalia Enriquez-Verdugo, Rosa Xicotencatl-Palacios, and Soila M. Gaxiola-Camacho. "Adaptación de Mycobacterium smegmatis ante el agotamiento de nutrientes y su efecto en la expresión de esat-6." Revista Mexicana de Ciencias Pecuarias 7, no. 1 (February 17, 2016): 127. http://dx.doi.org/10.22319/rmcp.v7i1.4153.

Full text
Abstract:
Cuando los recursos son escasos, las micobacterias detienen su crecimiento para dar paso a los genes de la adaptación. Contrariamente, cuando el crecimiento continúa bajo condiciones de estrés, se activan genes específicos de redes metabólicas para su protección. En este sentido, la proteína codificada por esat-6 (por sus siglas en inglés: early secretory antigenic target, 6 kDa) en Mycobacterium tuberculosis, actúa en la lisis del epitelio alveolar y membranas de los macrófagos para escapar e invadir otras células. Pero puede tener otras funciones, tales como interferir en el contacto célula-célula y transferir su ADN. En M. smegmatis, el sistema ESX-1 (por sus siglas en inglés: Secretion Ejectosoma BOX) facilita la secreción de la proteína ESAT-6, probablemente es sensible a uno o más nutrientes del medio de cultivo. Por lo que en el presente estudio se evalúan las condiciones de cultivo limitantes en nutrientes para el crecimiento de M. smegmatis y su relación con la expresión del gen esat-6. Los medios de cultivos probados fueron Hartmans de Bond medio mínimo (HdB), limitado en carbono (HdB<C), nitrógeno (HdB<N) y fosfato inorgánico (HdB<Pi). M. smegmatis se adapta a HdB medio mínimo, HdB<C y HdB<N y reanuda su actividad metabólica en medio fresco, pero no se expresa esat-6. En HdB<Pi M. smegmatis pierde su capacidad metabólica respecto a la resistencia alcohol-ácido y expresa esat-6. Por lo tanto, se proponen los medios de cultivo probados como modelo para la expresión génica bajo limitación por nutrientes.
APA, Harvard, Vancouver, ISO, and other styles
6

Fitriyanti, Clara S. A., Suharsono Suharsono Suharsono, and Tri Joko Santoso. "Molecular and Phenotypic Analyses of Inpari HDB/K15 F2 Lines Containing sd1 Mutant Gene Resulted from Genome Editing Method." Jurnal AgroBiogen 16, no. 1 (July 17, 2020): 35. http://dx.doi.org/10.21082/jbio.v16n1.2020.p35-44.

Full text
Abstract:
<p>Inpari HDB variety is resistant to bacterial leaf blight (BLB) disease, but due to its tall stature, the variety is susceptible to lodging. Inpari HDB with semidwarf stature, therefore, is of high interest for lodging resistant performance. sd1 gene encoding GA20ox-2 enzyme is one of the genes responsible for imparting semidwarf stature of rice. In previous study, sd1 mutant rice cv. Kitaake (K15) was developed by using CRISPR/Cas9 technology. The objective of this study was to analyze molecularly and phenotypically F2 lines containing sd1 mutant gene resulted from a cross between Inpari HDB and K15 to develop semidwarf<br />Inpari HDB rice variety. Thirty F2 Inpari HDB/K15 lines were analyzed at molecular level using DNA sequencing method together with phenotypic assessment of the lines to verify the integration of sd1 mutant gene. DNA sequencing analysis showed that 9 out of the 30 F2 Inpari HDB/K15 lines were sd1 mutants. The remaining F2 lines contained 17 heterozygotes and 4 nonmutants. All the nine mutant lines demonstrated shorter plant stature and showed more tiller number per plant compared to the nonmutant lines. The sd1 mutant gene in the F2 lines showed pleiotropic effects on panicle number and<br />showed no effects on other traits, such as flowering time, panicle length, filled and unfilled grain percentages. This study showed the introduction of sd1 mutant gene generated semidwarf Inpari HDB lines. The semidwarf Inpari HDB lines obtained from this research should be further evaluated to confirm their lodging resistant performances.</p>
APA, Harvard, Vancouver, ISO, and other styles
7

Alqarni, Mohammed Hamed, Ahmed Ibrahim Foudah, Magdy Mohamed Muharram, Haritium Budurian, and Nikolaos E. Labrou. "Probing the Role of the Conserved Arg174 in Formate Dehydrogenase by Chemical Modification and Site-Directed Mutagenesis." Molecules 26, no. 5 (February 25, 2021): 1222. http://dx.doi.org/10.3390/molecules26051222.

Full text
Abstract:
The reactive adenosine derivative, adenosine 5′-O-[S-(4-hydroxy-2,3-dioxobutyl)]-thiophosphate (AMPS-HDB), contains a dicarbonyl group linked to the purine nucleotide at a position equivalent to the pyrophosphate region of NAD+. AMPS-HDB was used as a chemical label towards Candida boidinii formate dehydrogenase (CbFDH). AMPS-HDB reacts covalently with CbFDH, leading to complete inactivation of the enzyme activity. The inactivation kinetics of CbFDH fit the Kitz and Wilson model for time-dependent, irreversible inhibition (KD = 0.66 ± 0.15 mM, first order maximum rate constant k3 = 0.198 ± 0.06 min−1). NAD+ and NADH protects CbFDH from inactivation by AMPS-HDB, showing the specificity of the reaction. Molecular modelling studies revealed Arg174 as a candidate residue able to be modified by the dicarbonyl group of AMPS-HDB. Arg174 is a strictly conserved residue among FDHs and is located at the Rossmann fold, the common mononucleotide-binding motif of dehydrogenases. Arg174 was replaced by Asn, using site-directed mutagenesis. The mutant enzyme CbFDHArg174Asn was showed to be resistant to inactivation by AMPS-HDB, confirming that the guanidinium group of Arg174 is the target for AMPS-HDB. The CbFDHArg174Asn mutant enzyme exhibited substantial reduced affinity for NAD+ and lower thermostability. The results of the study underline the pivotal and multifunctional role of Arg174 in catalysis, coenzyme binding and structural stability of CbFDH.
APA, Harvard, Vancouver, ISO, and other styles
8

Mansi, J., F. da Costa, C. Viner, I. Judson, M. Gore, and D. Cunningham. "High-dose busulfan in patients with myeloma." Journal of Clinical Oncology 10, no. 10 (October 1992): 1569–73. http://dx.doi.org/10.1200/jco.1992.10.10.1569.

Full text
Abstract:
PURPOSE To evaluate the use of high-dose busulfan (HDB) with autologous bone marrow transplantation (ABMT) in patients with myeloma. PATIENTS AND METHODS Fifteen patients received HDB (16 mg/kg), eight of whom received high-dose melphalan (HDM) but had experienced a short remission or progression-free interval. Two patients had received HDM on two previous occasions, one had no response to low-dose melphalan, and four had impaired renal function (edathamil clearance < 40 mL/min). All patients received induction chemotherapy before HDB. RESULTS Two patients were in complete remission (CR) after induction chemotherapy before HDB. Of the remaining 13 patients, four (31%) achieved CR and two (15%) achieved a partial remission for an overall response rate of 46%. There were three treatment-related deaths, but the toxicity was otherwise predictable and manageable. CONCLUSIONS In heavily pretreated patients, HDB results in a relatively high response rate. It can also be used safely in patients with renal impairment who are not suitable for HDM.
APA, Harvard, Vancouver, ISO, and other styles
9

Wang, Jian. "A Behavioral Model for Analysis and Intervention of Healthy Dietary Behavior." Global Journal of Health Science 12, no. 4 (March 12, 2020): 57. http://dx.doi.org/10.5539/gjhs.v12n4p57.

Full text
Abstract:
Proper diet is an important way to improve and maintain health, which involves the comprehensive matching of food (category, quantity) and individual (physical fitness, health). Behavior is the key point to achieve this matching. Without behavior change, all cognition and motivations can&rsquo;t get any tangible health benefits. The aim of this study was to construct a model for analysis and intervention of healthy dietary behavior (HDB). Based on the Integrated Behavioral Model (IBM), Maslow&rsquo;s hierarchy of needs and Satter&rsquo;s hierarchy of food needs, this study abstracted the characteristics of longevity, specificity and uncertainty of Healthy Dietary Behavior, constructed a Healthy Dietary Behavioral Model (HDBM), divided 9 negative behaviors of healthy diet (NBHD), and put forward 9 behavior interventions, which could provide ideas for change and habit formation of HDB.
APA, Harvard, Vancouver, ISO, and other styles
10

Devore, Sasha, Nathaniel Pender-Morris, Owen Dean, David Smith, and Christiane Linster. "Basal forebrain dynamics during nonassociative and associative olfactory learning." Journal of Neurophysiology 115, no. 1 (January 1, 2016): 423–33. http://dx.doi.org/10.1152/jn.00572.2015.

Full text
Abstract:
Cholinergic and GABAergic projections from the horizontal diagonal band (HDB) and medial preoptic area (MCPO) of the basal forebrain to the olfactory system are associated with odor discrimination and odor learning, as well as modulation of neural responses in olfactory structures. Whereas pharmacological and lesion studies give insights into the functional role of these modulatory inputs on a slow timescale, the response dynamics of neurons in the HDB/MCPO during olfactory behaviors have not been investigated. In this study we examined how these neurons respond during two olfactory behaviors: spontaneous investigation of odorants and odor-reward association learning. We observe rich heterogeneity in the response dynamics of individual HDB/MCPO neurons, with a substantial fraction of neurons exhibiting task-related modulation. HDB/MCPO neurons show both rapid and transient responses during bouts of odor investigation and slow, long-lasting modulation of overall response rate based on behavioral demands. Specifically, baseline rates were higher during the acquisition phase of an odor-reward association than during spontaneous investigation or the recall phase of an odor reward association. Our results suggest that modulatory projections from the HDB/MCPO are poised to influence olfactory processing on multiple timescales, from hundreds of milliseconds to minutes, and are therefore capable of rapidly setting olfactory network dynamics during odor processing and learning.
APA, Harvard, Vancouver, ISO, and other styles
More sources

Dissertations / Theses on the topic "HDB"

1

Emami, Seyed Majid. "Communication through high delay spread X bandwidth (HDB) channels /." May be available electronically:, 2007. http://proquest.umi.com/login?COPT=REJTPTU1MTUmSU5UPTAmVkVSPTI=&clientId=12498.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Guarnieri, Leandro de Castro. "Transporte eletrônico quântico em uma heteroestrutura de dupla barreira(HDB) assistido por fônons." Universidade Federal de Juiz de Fora (UFJF), 2011. https://repositorio.ufjf.br/jspui/handle/ufjf/5344.

Full text
Abstract:
Submitted by Renata Lopes (renatasil82@gmail.com) on 2017-06-27T11:13:15Z No. of bitstreams: 1 leandrodecastroguarnieri.pdf: 14716199 bytes, checksum: d864ab0333d3140dd1b45ea0361a21d8 (MD5)
Approved for entry into archive by Adriana Oliveira (adriana.oliveira@ufjf.edu.br) on 2017-08-07T20:52:00Z (GMT) No. of bitstreams: 1 leandrodecastroguarnieri.pdf: 14716199 bytes, checksum: d864ab0333d3140dd1b45ea0361a21d8 (MD5)
Made available in DSpace on 2017-08-07T20:52:00Z (GMT). No. of bitstreams: 1 leandrodecastroguarnieri.pdf: 14716199 bytes, checksum: d864ab0333d3140dd1b45ea0361a21d8 (MD5) Previous issue date: 2011-08-19
CAPES - Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
Nesta tese, é feito um estudo teórico sobre as propriedades de transporte de elétrons e de emissão de um feixe coerente de fônons com frequências na faixa de terahetz, conhecido como saser, a partir de um dispositivo semicondutor de dimensões nano-métricas, formado por uma heteroestrutura de dupla barreira (HDB) e controlado por um potencial externo. O sistema é descrito por um hamiltoniano na aproximação de tight-binding no qual são incluídos as contribuições dos elétrons, dos fônons e das interações elétron-fônon e elétron-elétron. Para o estudo das propriedades de transporte eletrônico, utilizou-se do formalismo de Keldysh que considera, de forma direta, as interações de muitos corpos com a finalidade de reduzir uma corrente de elétrons fora do equilíbrio a uma que depende das funções Green retardadas que estão em equilíbrio termodinâmico a uma dada temperatura. Um procedimento conhecido como dizimação é empregado repetidamente ao longo deste trabalho para a obtenção das funções de Green retardadas. Para o estudo das propriedades de emissão dos fônons TA, são utilizadas as soluções das equações cinéticas que governam as populações dos elétrons nos dois primeiros níveis ressonantes e dos fônons dentro do poço. O perfil de energia potencial e a distribuição de cargas são calculados auto-consistentemente através de um sistema de equações no qual se inclui a equação de Poisson. Verificaram-se nos resultados as conhecidas regiões de instabilidade no início da emissão dos fônons LO e de biestabilidade no final do segundo pico da corrente. Uma análise sobre o comportamento destas regiões é feita através de mudanças nos parâmetros da HDB. A influência da temperatura sobre o saser também é estudada. A baixa temperatura, os resultados encontrados aqui coincidem com aqueles existentes na literatura.
In this thesis, we study theoretically the transport properties of electrons and emission of a coherent beam of TA phonons with terahetz frequencies, known as saser, from a semiconductor device of nanometric dimensions formed by a double barrier heterostructure and controlled by an external potential. The system is described by a Hamiltonian in the 'tight-binding' approximation in which the electrons, the phonons, the electron-phonon and the electron-electron interactions contributions are included. To study the electronic transport properties we use the Keldysh formalism, which directly considers the many body's interactions, to reduce the flow of electrons out of equilibrium to one that depends on the retarded Green functions that are in the thermodynamic equilibrium at a given temperature. A procedure known as decimation is used repeatedly throughout this work to find such retarded Green functions. To study the emission properties of the TA phonons, we solve the kinetic equations that govern the populations of electrons in the first two resonant levels and the phonons in the well. The potential profile and the charge distribution energy are calculated self-consistently, through a system of equations which includes the Poisson equation. We verify in our results the well known regions of instability at the beginning LO phonon emission and bistability at the end of the second peak current. We analyze the behavior of these regions through the change in the barriers thickness of the HDB. A study of the influence of temperature on saser is carried out in this work. At low temperatures, our results coincide with those in the literature.
APA, Harvard, Vancouver, ISO, and other styles
3

com, LKSHIS@gmail, and Kah Seng Loh. "The 1961 Kampong Bukit Ho Swee Fire and the Making of Modern Singapore." Murdoch University, 2008. http://wwwlib.murdoch.edu.au/adt/browse/view/adt-MU20090219.104739.

Full text
Abstract:
By 1970, Singapore’s urban landscape was dominated by high-rise blocks of planned public housing built by the People’s Action Party government, signifying the establishment of a high modernist nation-state. A decade earlier, the margins of the City had been dominated by kampongs, home to semi-autonomous communities of low-income Chinese families which freely built, and rebuilt, unauthorised wooden houses. This change was not merely one of housing but belied a more fundamental realignment of state-society relations in the 1960s. Relocated in Housing and Development Board flats, urban kampong families were progressively integrated into the social fabric of the emergent nation-state. This study examines the pivotal role of an event, the great Kampong Bukit Ho Swee fire of 1961, in bringing about this transformation. The redevelopment of the fire site in the aftermath of the calamity brought to completion the British colonial regime’s ‘emergency’ programmes of resettling urban kampong dwellers in planned accommodation, in particular, of building emergency public housing on the sites of major fires in the 1950s. The PAP’s far greater political resolve, and the timing of and state of emergency occasioned by the scale of the 1961 disaster, enabled the government to rehouse the Bukit Ho Swee fire victims in emergency housing in record time. This in turn provided the HDB with a strategic platform for clearing other kampongs and for transforming their residents into model citizens of the nation-state. The 1961 fire’s symbolic usefulness extended into the 1980s and beyond, in sanctioning the PAP’s new housing redevelopment schemes. The official account of the inferno has also become politically useful for the government of today for disciplining a new generation of Singaporeans against taking the nation’s progress for granted. Against these exalted claims of the fire’s role in the Singapore Story, this study also examines the degree of actual change and continuity in the social and economic lives of the people of Bukit Ho Swee after the inferno. In some crucial ways, the residents continued to occupy a marginal place in society while pondering, too, over the unresolved question of the cause of the fire. These continuities of everyday life reflect the ambivalence with which the citizenry regarded the high modernist state in contemporary Singapore.
APA, Harvard, Vancouver, ISO, and other styles
4

Gott, Travis Matthew. "Spectroscopic and Kinetic Studies of Hydrodenitrogenation and Hydrodesulfurization over Supported Nickel Phosphide (Ni2P)." Diss., Virginia Tech, 2008. http://hdl.handle.net/10919/29536.

Full text
Abstract:
This dissertation describes preparation and characterization of Ni2P catalysts and their application in hydrodesulfurization (HDS) and hydrodenitrogenation (HDN). The work carried out includes synthesis of Ni2P on different siliceous supports, SiO2 and MCM-41. It also includes characterization of these catalytic materials using X-ray diffraction (XRD), temperature-programmed reduction (TPR), Fourier transform infrared (FTIR) spectroscopy and X-ray absorbance fine structure (XAFS) spectroscopy. In situ FTIR was employed to study the acidity of Ni2P/SiO2 and probe the catalytic sites involved in the HDN of pyridine. Transient and steady-state kinetics of a surface intermediate that is formed upon pyridine adsorption and reaction was studied to elucidate the mechanism of HDN over Ni2P/SiO2. Additionally, in situ FTIR and X-ray absorption near edge structure (XANES) spectroscopy was utilized to probe the bonding, mechanism and kinetics of thiophene HDS over a novel MCM-41-supported Ni2P catalyst. The use of these techniques allowed for better understanding of the surface intermediates, mechanisms and the nature of the active sites involved in HDN and HDS.
Ph. D.
APA, Harvard, Vancouver, ISO, and other styles
5

Lee, Yong-Kul. "Reactivity and Structure of Supported Nickel Phosphides (Ni2P) in Deep Hydrodesulfurization Catalysis." Diss., Virginia Tech, 2004. http://hdl.handle.net/10919/30228.

Full text
Abstract:
This dissertation describes preparation and characterization of Ni2P catalysts and their application in deep hydrodesulfurization (HDS) of a model sulfur compound, 4,6-dimethyldibenzothiophene (4,6-DMDBT), one of the most refractory S-compounds. This topic is of great importance in addressing recently enacted environmental regulations limiting the sulfur content in fuels. The work carried out includes synthesis of Ni2P on different siliceous supports, SiO2, MCM-41, and ultra-stable Y zeolite (USY). It also includes determining the characteristics of the supported Ni2P catalysts with a wide range of techniques: X-ray powder diffraction (XRD), transmission electron microscopy (TEM), Fourier transform infrared (FTIR) and X-ray absorption fine structure (XAFS) spectroscopy. The use of these techniques allowed better understanding of the nature of the active sites as well as the effect of supports. Activity tests were conducted in the HDS of 4,6-DMDBT and the HDN of quinoline. The performance of the catalysts will be compared to that of a conventional sulfide hydrotreating catalyst, Ni-Mo-S/Al2O3. Investigation of the reaction mechanism in the hydrodenitrogenation (HDN) of 2-methylpiperidine together with in situ FT-IR measurements were conducted to understand how catalyst properties affect activity and selectivity.
Ph. D.
APA, Harvard, Vancouver, ISO, and other styles
6

Zelenková, Jana. "Přístupy k měření chudoby se zaměřením na členské státy EU." Master's thesis, Vysoká škola ekonomická v Praze, 2014. http://www.nusl.cz/ntk/nusl-201951.

Full text
Abstract:
This thesis focuses on current approaches to the measurement of poverty. The aim of the thesis is to evaluate if measuring poverty indicators and quality of life indicators used by United Nations Development Programme and Eurostat are meaningful enough. The theoretical part is an analysis of chosen indicators. The theoretical knowledge is followed by practical part, comparing poverty levels in member states of the European Union, and giving deeper insight into the analysis of sub-indicators. Furthermore, the thesis looks at informative value connected to mutual relations among the indicators. The comparison reveals that the level of human development is negatively related to aspects such as insufficient economic growth, inequality and low level of wealth redistribution. From an analytical point of view, new multi-criteria indicators are useful enough for the purpose of research on this topic, in spite of certain imperfections.
APA, Harvard, Vancouver, ISO, and other styles
7

Burgisser, Alain. "HDR." Habilitation à diriger des recherches, Université d'Orléans, 2009. http://tel.archives-ouvertes.fr/tel-00447580.

Full text
Abstract:
La Volcanologie moderne utilise des approches expérimentales, de terrain et théoriques pour mieux comprendre des phénomènes volcaniques critiques. Ces différents angles sont nécessaires en raison de l'extrême variation des échelles impliquées : des bulles de gaz de moins d'un millimètre libérant le gaz générant des panaches explosifs de plusieurs kilomètres de haut. La physique multiphasée, qui a pour objet d'étude l'écoulement de mixtures réactives de fluide et de particules, a permis des avancées dans l'unification de ces échelles. En combinant des lois à petite échelle, comme la croissance d'une bulle, des propriétés nouvelles émergent des simulations numériques, comme la ségrégation des bulles dans un conduit volcanique. De telles propriétés émergentes sont souvent valides à de grandes échelles et peuvent parfois être testées dans les systèmes naturels. La physique multiphasée reste cependant très jeune: les expérimentalistes qui déterminent les lois constitutives des systèmes les plus simples, les modélisateurs qui assemblent ces lois dans des modèles numériques complexes aux propriétés émergentes et les volcanologues de terrain qui mesures ces propriétés n'ont pas toujours le langage commun permettant de confronter leurs découvertes. Mes travaux ont eu pour but de trouver ce langage commun afin de faciliter l'intégration de nos connaissances sur les volcans. Cette intégration, renforcée dans le futur, pourrait ouvrir la possibilité d'unification de ces sous domaines. Allons-nous vers une unification de la Volcanologie ?
APA, Harvard, Vancouver, ISO, and other styles
8

Kremer, Laurent. "HDR." Habilitation à diriger des recherches, Université Montpellier II - Sciences et Techniques du Languedoc, 2007. http://tel.archives-ouvertes.fr/tel-00259336.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Lukáč, Ľuboš. "Udržitelnost sociální situace obyvateľstva v období hospodářské krize." Master's thesis, Vysoká škola ekonomická v Praze, 2010. http://www.nusl.cz/ntk/nusl-72281.

Full text
Abstract:
Abstract The role of the thesis is to analyze the financial situation of households and changes in living standards in Slovakia since 2000 through the creation of economic crisis to the present. In the thesis are described in detail information about unemployment, income and economically active population, but also the inflow of foreign investment, social security, household indebtedness of individuals and social situation in the Slovak Republic. These indicators compared with countries of European Union Member States. This topic is very interested because of its topicality. I chose Slovakia for two reasons. The first is that I am citizen of the Slovak Republic and the second is the availability of statistical data and work with them. Keywords: social situation, GDP, HDI, unemployment, poverty, FDI
APA, Harvard, Vancouver, ISO, and other styles
10

Fernlund, Fredrik, and Markus Koskinen. "HDR in production." Thesis, Linköpings universitet, Institutionen för teknik och naturvetenskap, 2008. http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-95329.

Full text
Abstract:
HDR (High Dynamic Range) är en teknik som gör det möjligt att fånga in ett större dynamiskt omfång en vad en vanlig bild skulle klara av. Användningsområdena för sådana HDR-bilder är många men företag inom mspel- och film- och visualiseringsindustrin använder ofta bilderna för virtuell ljussättning, däribland Syndicate Entertainment. Det är ett filmproduktionsbolag beläget i Stockholm där examensarbetet delvis är utfört. Idén bakom examensarbetet är att den komplicerade och långsamma processen att skapa HDR-bilderna bör kunna effektiviseras. En utförd enkätundersökning ligger tillsammans med litteraturstudier och kontakt med handledare på företaget och skolan som grund för en framtagen arbetsgång. Arbetsgången är den kedja av processer som krävs för att skapa en HDR-bild och vidare en ljusmapp. Denna arbetsgång granskas kritiskt där förslag på förbättringar redovisas. Förutom granskningen har en demonstrationsapplikation utvecklats. Det finns två syften med denna applikation. Syftena är dels att tillgodose företagets önskemål om att erhålla en applikation som går att använda i praktiken, dels för att realisera och testa några av de framtagna effektiviseringsteorierna.
APA, Harvard, Vancouver, ISO, and other styles
More sources

Books on the topic "HDB"

1

Singapore. Dept. of Statistics. Tenant households in HDB flats. Singapore: Dept. of Statistics, 1997.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
2

Pi, Moey-Khoo Hsiao. Profile of residents living in HDB flats. Singapore: Research Section, Research & Planning Dept., Housing & Development Board, 1995.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
3

Fisher, Robert. The Anti-HDR HDR Photography Book. New York, NY : Routledge, 2016.: Routledge, 2016. http://dx.doi.org/10.4324/9781315659497.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Attila, Mizser. Hab nélkül. [Bratislava]: AB-ART, 2000.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
5

Wagner, Reinhard. Profibuch HDR-Fotografie: [atemberaubende Bilder mit HDR-Effekt erstellen ; richtig belichten für perfekte HDR-Bilder ; HDR-Bilder per Software optimieren]. Poing: Franzis, 2010.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
6

Hab yak: Riwāyah. al-Muhandisīn, al-Jīzah: Aṭlas lil-Nashr wa-al-Intāj al-Iʻlāmī, 2013.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
7

Mengenal H.B. Jassin. Jakarta: Cakrawala Budaya, 2012.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
8

Davis, Harold. Creating HDR photos. New York: Amphoto Books, 2012.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
9

Heb y mwgwd. Talybont, Ceredigion: Y Lolfa, 2008.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
10

Lloyd, Helen. Mwg heb dân. Caerdydd: Hughes a'i Fab, 1993.

Find full text
APA, Harvard, Vancouver, ISO, and other styles
More sources

Book chapters on the topic "HDB"

1

Allmendinger, Georg. "Leitungscodes: AMI-HDB-3." In Aufgaben und Lösungen zur Elektronik und Kommunikationstechnik, 187. Wiesbaden: Vieweg+Teubner, 2010. http://dx.doi.org/10.1007/978-3-8348-9731-2_31.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Padmanabhan, Srihari, and Sharma Chakravarthy. "HDB-Subdue: A Scalable Approach to Graph Mining." In Data Warehousing and Knowledge Discovery, 325–38. Berlin, Heidelberg: Springer Berlin Heidelberg, 2009. http://dx.doi.org/10.1007/978-3-642-03730-6_26.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

van Tol, A., F. M. van’t Hooft, T. van Gent, and G. M. Dallinga-Thie. "HDL Subfractions, HDL Receptors and HDL Turnover." In Advances in Experimental Medicine and Biology, 15–21. Boston, MA: Springer US, 1987. http://dx.doi.org/10.1007/978-1-4684-1268-0_3.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Gooch, Jan W. "HDT." In Encyclopedic Dictionary of Polymers, 358. New York, NY: Springer New York, 2011. http://dx.doi.org/10.1007/978-1-4419-6247-8_5816.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Gooch, Jan W. "Hob." In Encyclopedic Dictionary of Polymers, 369. New York, NY: Springer New York, 2011. http://dx.doi.org/10.1007/978-1-4419-6247-8_6001.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Sainburg, Robert L., Andrew L. Clark, George E. Billman, Zachary J. Schlader, Toby Mündel, Kevin Milne, Earl G. Noble, et al. "HDL." In Encyclopedia of Exercise Medicine in Health and Disease, 383. Berlin, Heidelberg: Springer Berlin Heidelberg, 2012. http://dx.doi.org/10.1007/978-3-540-29807-6_2498.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Newman, Kim. "‘Hob’." In Quatermass and the Pit, 37–97. London: British Film Institute, 2014. http://dx.doi.org/10.1007/978-1-84457-793-4_3.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Henkel, Knut. "HGB." In Rechnungslegung von Treasury-Instrumenten nach IAS/IFRS und HGB, 247–301. Wiesbaden: Gabler, 2010. http://dx.doi.org/10.1007/978-3-8349-8806-5_4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Abbas, Karim. "HDL." In Handbook of Digital CMOS Technology, Circuits, and Systems, 317–409. Cham: Springer International Publishing, 2020. http://dx.doi.org/10.1007/978-3-030-37195-1_9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Wietzke, Joachim. "HDD." In Xpert.press, 75–76. Berlin, Heidelberg: Springer Berlin Heidelberg, 2012. http://dx.doi.org/10.1007/978-3-642-23996-0_10.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "HDB"

1

Di Carlo, Matteo, Mauro Dolci, Matteo Canzari, and Riccardo Smareglia. "HDB@ELK: another noSql customization for the HDB++ archiving system." In Software and Cyberinfrastructure for Astronomy V, edited by Juan C. Guzman and Jorge Ibsen. SPIE, 2018. http://dx.doi.org/10.1117/12.2312464.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Cheng, D. Y. "HDB-a high level debugging." In the 1989 ACM/IEEE conference. New York, New York, USA: ACM Press, 1989. http://dx.doi.org/10.1145/76263.76327.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Knight, Mark A., Kay Awe, Ahmed Abdel-aal, Richard Baxter, and George Bontus. "Design of CIPP Pressure Liners Using the HDB Method." In Pipelines 2019. Reston, VA: American Society of Civil Engineers, 2019. http://dx.doi.org/10.1061/9780784482483.012.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Laraswati, Rini, Evan Purnama Ramdan, and Umi Kulsum. "Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.234.

Full text
Abstract:
Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.
APA, Harvard, Vancouver, ISO, and other styles
5

Feng, Xu. "Notice of Retraction: On the Principles of Realizing XML Exchange and Integration Technique under the HDB Environment." In 2010 International Conference on Intelligent Computing and Cognitive Informatics (ICICCI 2010). IEEE, 2010. http://dx.doi.org/10.1109/icicci.2010.118.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Haddad, Adel N. "Modern Bimodal High Density Polyethylene for the Nuclear Power Plant Piping System." In 17th International Conference on Nuclear Engineering. ASMEDC, 2009. http://dx.doi.org/10.1115/icone17-75888.

Full text
Abstract:
Originally introduced in the 1990s, bimodal HDPE, pipe resins are still finding new niches today, including even nuclear power plants. HDPE pipe grades are used to make strong, corrosion resistant and durable pipes. High density polyethylene, PE 4710, is the material of choice of the nuclear industry for the Safety Related Service Water System. This grade of polymer is characterized by a Hydrostatic Design Basis (HDB) of 1600 psi at 73 °F and 1000 psi at 140 °F. Additionally bimodal high density PE 4710 grades display &gt;2000 hours slow crack growth resistance, or PENT. HD PE 4710 grades are easy to extrude into large diameter pipes; fabricate into fitting and mitered elbows and install in industrial settings. The scope of this paper is to describe the bimodal technology which produces HDPE pipe grade polymer; the USA practices of post reactor melt blending of natural resin compound with black masterbatch; and the attributes of such compound and its conformance to the nuclear industry’s Safety Related Service Water System.
APA, Harvard, Vancouver, ISO, and other styles
7

Kunimaru, Takanori, Kunio Ota, Kenji Amano, and W. Russell Alexander. "Development of a Quality Management System (QMS) for Borehole Investigations: Part 2—Evaluation of Applicability of QMS Methodology for the Hydrochemical Dataset." In ASME 2010 13th International Conference on Environmental Remediation and Radioactive Waste Management. ASMEDC, 2010. http://dx.doi.org/10.1115/icem2010-40065.

Full text
Abstract:
An appropriate QMS, which is among the first tools required for repository site characterisation, will save on effort by reducing errors and the requirement to resample and reanalyse–but this can only be guaranteed by continuously assessing if the system is truly fit-for-purpose and amending it as necessary based on the practical experience of the end-users on-site. A QA audit of hydrochemical datasets for boreholes HDB-1–11 from Horonobe URL project by JAEA has been carried out by the application of a formal QA analysis which is based on the methodology previously employed for groundwaters during the recent site characterisation programme in Sweden. This methodology has been successfully applied to the groundwaters of the fractured crystalline rocks of the Fennoscandian Shield and has now been adapted and applied to some of the ground- and porewaters of the Horonobe URL area. This paper will present this system in the context of the Japanese national programme and elucidate improvements made during hands-on application of the borehole investigation QMS. Further improvements foreseen for the future will also be discussed with a view of removing inter-operator variability as much as is possible. Only then can confidence be placed in URL project or repository site hydrochemical datasets.
APA, Harvard, Vancouver, ISO, and other styles
8

Long, Wes. "Advanced Applications for HDPE Pipe With New PE-RT Material." In ASME 2017 Pressure Vessels and Piping Conference. American Society of Mechanical Engineers, 2017. http://dx.doi.org/10.1115/pvp2017-65224.

Full text
Abstract:
Canfor, a producer of lumber, pulp and paper needed a solution to replace aging 30-inch (760mm) fiberglass reinforced pipe. A new PE-RT product now expands PE into industrial applications requiring resistance to high temperatures and having a Hydrostatic Design Basis (HDB) of 800psi (55 bar) at 180°F (82.2°C). Through chemical processes, Canfor cooks, washes, and extracts pulp fiber from wood that results in both acidic and caustic effluent with temperatures normally in the 50–60°C range or as high as 70–75°C. Traditional fiberglass pipes have experienced repeated joint failures over time, whereas heat-fused HDPE pipe provides solutions reducing unnecessary maintenance and a longer service life. Standard PE4710 High Density Polyethylene Pipes (HDPE) have pressure ratings limited to 140°F (60°C) and are not normally acceptable for such high temperature acidic and caustic effluent. Additionally, the potential for higher oxidation-reduction potential (ORP) from residual chlorine levels and bleaching also justified turning to a different material based on the potential oxidative attack at high temperatures. The new PE-RT resin protects against oxidative attacks at high temperatures and the flexible heat-fused HDPE pipe provides considerable cost savings during installation. Compared to fiberglass, up to eight 40-foot lengths of HDPE pipe can be joined by heat fusion per day, whereas only two 6-meter (20-foot) lengths of FRP pipe can be wrapped per day. The presentation will highlight photos during the installation process and report the advantages of using the new pipe material. This project provides reference for expanding HDPE pipe into new applications using PE-RT materials.
APA, Harvard, Vancouver, ISO, and other styles
9

Littleton, Linda. "HDD." In the 22nd annual ACM SIGUCCS conference. New York, New York, USA: ACM Press, 1994. http://dx.doi.org/10.1145/196355.196453.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Misherghi, Ghassan, and Zhendong Su. "HDD." In Proceeding of the 28th international conference. New York, New York, USA: ACM Press, 2006. http://dx.doi.org/10.1145/1134285.1134307.

Full text
APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "HDB"

1

Wilhoit, Juliana, Natalie Myers, and George Calfas. Data collection and management with ENSITE HUB: ENSITE HUB Version 1.0. Construction Engineering Research Laboratory (U.S.), September 2017. http://dx.doi.org/10.21079/11681/23050.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

Drozhdin, A., N. Mokhov, and R. Schailey. HEB beam collimation system. Office of Scientific and Technical Information (OSTI), February 1994. http://dx.doi.org/10.2172/10148213.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Muth, Thomas R., and William H. Peter. Aircraft Propeller Hub Repair. Office of Scientific and Technical Information (OSTI), February 2015. http://dx.doi.org/10.2172/1185928.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

Muth, Thomas, and William Peter. Aircraft Propeller Hub Repair. Office of Scientific and Technical Information (OSTI), February 2015. http://dx.doi.org/10.2172/1237592.

Full text
APA, Harvard, Vancouver, ISO, and other styles
5

Murphy, Hugh D. HDR Report to Senate. Office of Scientific and Technical Information (OSTI), February 1988. http://dx.doi.org/10.2172/1244371.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Heather, Patrick. "A hub for Europe". Oxford Institute for Energy Studies, March 2019. http://dx.doi.org/10.26889/9781784671327.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Spindler, Martin, Christian Hansen, and Victor Chernozhukov. hdm: High-Dimensional Metrics. The IFS, August 2016. http://dx.doi.org/10.1920/wp.cem.2016.3716.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Maloney, W. HSB 84A pumping test. Office of Scientific and Technical Information (OSTI), March 2000. http://dx.doi.org/10.2172/752143.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Larson, D. J. The HEB at flat top: Arranging for the HEB to collider beam transfer. Office of Scientific and Technical Information (OSTI), March 1994. http://dx.doi.org/10.2172/10149459.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Acharya, R., and K. Sawa. HRB-22 preirradiation thermal analysis. Office of Scientific and Technical Information (OSTI), May 1995. http://dx.doi.org/10.2172/81077.

Full text
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the extended bibliographies on the topic 'HDB' for particular source types:
Journal articles Dissertations / Theses Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography