Journal articles on the topic 'Ha 31.3 p36 2000'

Objetivos: Describir la evolución de la malaria en la región Loreto, tanto para malaria vivax como para falciparum, su relación con el total de casos para el Perú y los cambios de políticas en medicamentos. Material y métodos: Estudio observacional, descriptivo. La fuente de información fue la Oficina General de Epidemiología del Ministerio de Salud. Resultados: La incidencia de malaria en Loreto (vivax y falciparum) aumenta desde el año 2000 luego de una disminución de 40%. El año 2001 se reporta un incremento de 24% con respecto al 2000 y el 2002, de 52% respecto al 2001. Como porcentaje del total casos en Perú, Loreto aportó 29%, 31%, 44%, 47% y 57% los años 1998 al 2002, respectivamente. Loreto está en alto riesgo desde 1995. En la semana epidemiológica 46 (09 al 15 de noviembre 2003) Loreto (IPA 45) y San Martin (IPA 10) se presentan en condición de riesgo alto. En total, 60,4% de los casos totales procede de Loreto. Conclusiones: La incidencia de la malaria en la región Loreto ha ido en aumento en los últimos 3 años. En los últimos años, los casos de Malaria en el Perú se concentran en la región Loreto.

Soil organic carbon (SOC) redistribution by soil erosion is fundamental to the C cycle and is a key component of global soil C accounting. Widespread conversion of cropland to forest and grassland and the adoption of conservation agriculture (minimum-till and no-till practices) worldwide and particularly in China since 2000, may have reduced wind erosion and increased SOC storage and ‘avoided’ CO2 emission. However, few SOC sequestration studies have separated changes in SOC stock caused by changes in land-use and management activity from net SOC redistribution due to reduced SOC erosion and SOC dust accumulation, particularly from individual or short-term (months) wind erosion events. We used measurements of SOC and the short-lived natural radionuclide beryllium-7 (7Be, half-life 53.3 days) to estimate net SOC redistribution for changes in several land-use and management practices in Fengning County in North China. Compared with conventional tillage (CT), conservation grassland (CG) and minimum tillage (CL) showed enhanced SOC stocks (0–245 mm depth) of ~0.8 ± 0.03 and 2.0 ± 0.06 t C ha–1 year–1 as a consequence of their land-use conversion for 5 and 3 years, respectively. However, SOC erosion on CG (0.46 ± 0.04 t C ha–1 year–1) and CL (0.52 ± 0.04 t C ha–1 year–1) plots was 54% and 47%, respectively, less than on CT (0.99 ± 0.11 t C ha–1 year–1). Net C sequestration (0–245 mm), considering SOC redistribution for CG (0.27 ± 0.12 t C ha–1 year–1; 5 years) and CL (1.53 ± 0.13 t C ha–1 year–1; 3 years), revealed an overestimate of 196% and 31% without considering SOC redistribution (CG, 0.8 ± 0.03 t C ha–1 year–1; CL, 2.0 ± 0.06 t C ha–1 year–1), respectively, relative to CT. Reduced SOC erosion and/or SOC dust accumulation by vegetation–crop cover must be included when considering SOC sequestration induced by changes in land use and management.

Egy műtrágyázási tartamkísérlet 28. évében, 2001-ben vizsgáltuk az eltérő N, P, K ellátottsági szintek és kombinációik hatását a réti csenkesz (Festuca pratensis) vezérnövényű, nyolckomponensű, pillangós nélküli gyepkeverék termésére, fejlődésére és N-felvételére. Termőhely talaja a szántott rétegben mintegy 3% humuszt, 3-5% CaCO3-ot és 20-22% agyagot tartalmazott, N és K elemekben közepesen, P és Zn elemekben gyengén ellátottnak minősült. A kísérlet 4N x 4P x 4K = 64 kezelést x 2 ismétlést = 128 parcellát foglalt magában. A talajvíz 13-15 m mélyen helyezkedik el, a terület aszályérzékeny. A vizsgált 2001. évben azonban kielégítő 621 mm csapadék hullott, és annak eloszlása is kedvező volt. A gyep telepítése spenót elővetemény után 2000. szeptember 20-án történt gabona sortávra 60 kg/ha vetőmaggal. Főbb eredményeink: 1. Vetéstől az 1. kaszálásig, 2001. 05. 23-ig összesen 391 mm csapadék hullott a 8 hónap alatt. A 2. kaszálás október 9-én történt, a közel 4,5 hónapos periódus alatt újabb 368 mm eső esett. A kedvező csapadékellátás nyomán az abszolút kontroll parcellák szénatermése az 1. kaszálással 1,7 t/ha-ról 8,8 t/ha-ra, a 2. kaszálással 1,2 t/ha-ról 4,2 t/ha-ra, az 1+2. kaszálás éves szénahozama 3 t/ha-ról 13 t/ha-ra nőtt az N3P3K3 kezelésekben. 2. A fiatal állomány N-igénye még mérsékelt, míg P-igénye erőteljes. A jobb kezdeti fejlődés segítése céljából a gyep telepítése előtt célszerű a talajt a „közepes” P-ellátottsági szintre feltölteni. E termőhelyen a 150 mg/kg körüli AL-P2O5 tartalom tekinthető elérendő célnak. Idővel a gyep P-igénye csökkent, míg N-igénye emelkedett. K-hatások nem jelentkeztek ezen a 135 mg/kg AL-K2O ellátottságú termőhelyen. 3. A 2. kaszálás idején P-hatásokat már nem kaptunk, a füvek kielégítették P-igényüket a 28 éve P-ral nem trágyázott, 66 mg/kg AL-P2O5 „gyenge” ellátottságúnak minősített talajon is. Termés a N-adag függvénye volt, mely a szénahozamokat megnégyszerezte. Az 1. kaszálásnál a 100 kg/ha, a 2. kaszálásnál a 200 kg/ha/év N-adag bizonyult előnyösnek. A 2. kaszálás kisebb termést, de N-ben gazdagabb szénát eredményezett. A széna kielégítően ellátottnak tekinthető N-ben, ha az anyaszéna N-tartalma a 2%-ot, a sarjúszéna N-tartalma a 2,5-3,0%-ot eléri. A gyep légszáraz-anyag tartalmát a N-trágyázás az 1. kaszálásnál 33%-ról 31%-ra, a 2. kaszálásnál 27%-ról 21%-ra csökkentette. 4. A PK-val kielégítően ellátott talajon a 100 kg/ha/év N-adag adta a maximális szénatöbbletet: az 1. kaszálással 61 kg, a 2. kaszálással 14 kg, azaz összesen 75 kg széna/kg N-re. A 200 kg/ha/év N 43 kg, a 300 kg/ha/év N 34 kg többletszénát eredményezett minden kg N-re. A 300 kg/ha/év N-adagnál az anyaszéna NO3-N tartalma 0,34%-ot ért el, túllépve a megengedett 0,25%-os koncentrációt. A kontrollon 0,06, N 100 kg/ha/év kezelésben 0,10, N 200 kg/ha/év kezelésben 0,22%-ot mértünk. A 2. kaszálásnál a sarjúszéna NO3-N készlete átlagosan felére csökkent az egyes kezelésekben. 5. A különbség-módszerrel számított N-hasznosulás a PK elemekkel is kielégítően ellátott kezelésekben meghaladta a 100%-ot. Ez visszavezethető a nagyobb termések fokozott N-felvételére a talaj NO3-N készletének rovására, melyet a korábbi évek túltrágyázása eredményezett.

Para aportar elementos que contribuyan a la toma de decisiones en una empresa forestal, este estudio examina la edad óptima de cosecha (turno o rotación óptima) en plantaciones de eucalipto (Eucalyptus grandis Hill ex Maiden y E. urophylla S. T. Blake) establecidas en el noreste de Oaxaca, México. Se determinó el valor neto presente y la rotación óptima para plantaciones en dos calidades de sitio y para dos escenarios de productos finales: 1) madera para celulosa; y 2) madera para aserrío más madera para celulosa, en ambos casos con y sin ingresos por captura de carbono. Se supusieron los costos de mantenimiento de la plantación con una tasa de descuento (r) de 4.5 %, un costo de establecimiento (Co) de $ 4123 ha-1, un precio de carbono (pc) de $ 31 (t CO2e)-1, un precio de madera sólida de $ 600 m-3 y un precio de madera para celulosa de $211 m-3. Se hizo un análisis de sensibilidad al incrementar r, Co y pc en intervalos de 2 %, $ 2000 ha-1 y $ 21 (t CO2e)-1, respectivamente. Las edades óptimas de cosecha encontradas con base únicamente en ingresos por venta de madera varían de 83 a 108 meses en el escenario 1, y de 108 a 163 meses en el escenario 2, según la especie y el índice de sitio. Al incorporar los beneficios por captura de carbono se obtuvo una extensión de la rotación. La edad óptima de cosecha se prolonga de 12 a 20 meses y de 17 a 30 meses para los dos escenarios, respectivamente. Los beneficios por captura de carbono incrementan el valor neto presente de la cosecha al extender la rotación al igual que la relación beneficio-costo, aunque los cambios en esta última son mínimos.

We investigated the influence of fire severity, logging of burnt wood, local ecological factors and their interaction on the natural regeneration, survival and growth of maritime pine (Pinus pinaster Ait.), following a fire that took place in 2005. During the period 2006–2020, a sample of 1900 seedlings were monitored, in which three post-fire treatments were applied: (1) Early logging (before seedling emergence); (2) Delayed logging (after emergence); and (3) No management. Multivariate semi-parametric and non-parametric techniques were used to model seedling survival, estimated density and growth of natural pine regeneration. Seedling survival was 31% with a mean density of more than 2000 seedlings/ha at the end of the study period. Logging before seedling emergence was positively related with pine survival and density. Delayed logging resulted in the lowest seedling density and regeneration. Fire severity had a negative influence on regeneration density. The findings indicate that site conditions and fire severity have a stronger influence on natural regeneration of maritime pine than subsequent post-fire management treatments. In order to ensure the presence of maritime pine in pure or mixed stands, silvicultural work is required to control competition from other species and reduce the risk of new wildfires.

El H-135 es un híbrido cuya hembra es una cruza simple formada por dos lineas originadas en El Bajio y cuyo progenitor masculino es la linea Hgo. 10-3 que pertenece a la Raza Chalqueño. Las lÍneas de la cruza simple (H~353-245-6-10 x H-353-363-7-2) fueron seleccionadas por su resistencia al carbón de la espiga (Sphacelotheca reiliana (Kuehn) Clinton). La linea H-353-245-6-10 tieneuna productividad de semilla "Buena" de 3878 kg/ha; altura de planta, 224 cm; altura de mazorca, 114 cm; floración masculina, 93 dias y femenina 96 dias. La linea H-353-363-7-2 tiene un rendimiento inferior a 2000 kg/ha, presenta protandria y florece 10 días antes que la linea hembra de la cruza simple. La linea Hgo. 10-3 rinde 2600 kg/ha de semilla, tiene altura de planta de 223 cm y de mazorca de 108 cm. Cuando se incrementa semilla certificada del híbrido H-135 en El Bajio, la cruza simple hembra coincide en floración con la línea macho, lo cual ocurre a los 83 días, aproximadamente.El hibrido H-135 tiene un rendimiento experimental máximo de 17 ton/ha y un promedio comercial de 9.1 ton/ha. La floración masculina ocurre de 77 a 102 días y la floración femenina de 83 a 107 días, dependiendo de la altitud a la que se establezca el cultivo. La altura de planta va de 220 a 279 cm y la mazorca de 118 a 158 cm. Presenta mazorcas de 18 a 28.5 cm de largo y 5.1 a 6.0 cm dediámetro: con 15 a 22 hileras por mazorca y 31 a 45 granos por hilera. El grano es dentado y de color blanco. Cuando se cultiva en altitudes superiores a 1900 msnm y se presentan bajas temperaturas, el pericarpio de algunas mazorcas presenta una tonalidad ligeramente violácea.El hibrido H-135 sustituye al H-133 retirado del mercado por su susceptibilidad al carbón de la espiga; el H-135 es de porte un poco más bajo que H-133, pero lo supera en 11.3% de rendimiento promedio a nivel nacional. En terrenos infestados con carbón de la espiga en Zapopan, Jal., el H-135 ha presentado 2.35% •de incidencia de esta enfermedad en comparación con 7.08% del H-311. Al aplicar los par´´´´´´´´´´´´´´´´´´ámetros de estabilidad, el H-135 fue clasificado como de "Respuesta mejor en buenos ambientes pero inconsistente". Cuando el H-135 se cultiva en alturas superiores a 2100 msnm, presenta incidencia de roya (Puccinia sp). La semilla certificada de más alta calidad física, genética y fisiológica se obtiene en localidades de El Bajío, donde se pueden esperar rendimientos superiores a 6.0 ton/ha de semilla; es decir, es un híbrido altamente redituable en la producción de semilla. A partir de 1987, fue registrado en el Registro Nacional de Variedades de Plantas con el namero MAZ- 180886-113.

AbstractIntroduction: Fetal cardiac tumors are anomalies, that occur rarely: from Nationwide Register of Fetal Cardiological Problems in Poland in years 2004-2016 amongst 8112 fetuses with cardiological problems, there were 85 fetuses with cardiac tumors, including 52 cases of multiple cardiac tumors (0,64%) and 33 of single anomalies (0,4%). Material: This analysis included 13 cases from single tertiary fetal cardiac center Lodz in years 1993-2017. Results: Ten out of 13 fetuses with single cardiac tumors (SFCT) had cardiomegaly: on average HA/CA was 0,49. The size of the tumor was different: the smallest one - 6 x 6 mm, the biggest 47 x 47 mm. The way of the delivery: in 10 cases there was CS and in 3 cases natural delivery. Birth weight was from 2000-3950 g (average 2989,2 g). Cardiosurgical resection of the tumor was performed on 4 newborns: at 2nd, 4th, 8th and 16th day of life (average 7,5 day). Four neonatal deaths were registered (31%): in 1st 2nd and 11th day (before surgery) and in the 28th day after the operation. Conclusions: Single fetal cardiac tumors (SFCT) can be diagnosed at 20 weeks of pregnancy, which allows to start echocardiographic monitoring, taking into consideration the potential risk of hemodynamic progression. SFCT can be the first sign of tuberous sclerosis complex in later prenatal or postnatal life. SFCT other than rhabdomyoma can be asymptomatic in newborn, but may require an early cardiosurgical resection.

The use of small seed can reduce the production costs of kabuli chickpea (Cicer arietinum L.) 15 to 25% by reducing the amount of seed needed per unit area, but little is known about the effects of seed size on stand establishment, plant growth, and seed yield in semiarid environments. We conducted a field study in southwest Saskatchewan from 1998 to 2000 and determined the chickpea responses to seed size under different planting depths. Crops grown from small (7.1–9.0 mm) diameter seed required the same number of days to emerge (16.7 d) and mature (106 d) as those from large (9.1–11.0 mm) diameter seed. There were no differences in plant establishment, shoot dry weight, pod production, or seed yield between the two seed sizes when planted at a 50-mm depth. However, the small-seeded crop produced 7% lower plant stand, 4% lower seed yield, and 3% less seed 1799-mm diameter compared to the large-seeded crop when planted at a 100-mm depth (P < 0.05). Large-seed ed chickpea plants were 20 mm (4%) taller, and the height of the lowest pods from the soil surface was 11 to 13 mm (5%) higher than those from the small seed, suggesting an improvement of harvestability. In general, planting depth did not affect seedling emergence, shoot dry weight, or seed yield, but when small seed was used, chickpea sown at the 50-mm depth increased seed yield by 6% compared to that at the 100-mm depth. Kabuli chickpea produced an average of >20 pods plant-1, with 77% of them containing one seed per pod, 10% with two seeds per pod, and the remainder containing no seed; this ratio of pod fertility was independent of seed size or planting depth. Our results indicate that the use of small seed and shallow planting can reduce the production costs of chickpea by $31 to $52 ha-1 without a seed yield penalty. This level of saving in production far exceeds the otherwise increased value of $4 to $6 ha-1 with the use of large seed which produces a higher (3%) proportion of ≥ 9-mm diameter seed. Key words: Seedling emergence, seed mass, pod production, Cicer arietinum L.

Nitrate is a crucial element for crop growth, and its optimal application is essential for maximizing agricultural yield. In Iranian agriculture, there is a substantial gap between recommended nitrate usage and what farmers actually apply. In this study, our primary objective is to determine the most effective utilization of nitrate for crop cultivation. Simultaneously, we aim to analyze the factors that contribute to the disparity between optimal and current nitrate application practices. Furthermore, our research explores the impact of these differences on regional variations in crop yields. This is achieved using a quadratic yield response function model based on unbalanced panel data spanning the years 2000 to 2016, which includes a total of 14 crop activities and encompasses 31 administrative regions. The results show that rice exhibits the highest nitrogen usage, while rain-fed wheat demonstrates the lowest utilization at the optimal point. Depending on whether random- or fixed-effects estimation is found to be the most suitable specification, average yields corresponding to the optimal level of nitrogen use are calculated by region, or the average across all regions. In Iran, the top-performing regions for cereals like rain-fed wheat and irrigated barley can achieve yields of 1.33 and 3 t/ha, respectively. These yields represent a 31% and a 9% increase from the levels observed in 2016. The outcomes derived from the estimated yield response function will be integrated into comprehensive agricultural, economic, and environmental optimization models. These integrated models will facilitate the assessment of various fertilizer policies on fertilizer use, land allocation, farm-household incomes, and environmental externalities, such as nitrate leaching and nitrate balance. This study holds substantial scientific promise, given its exploration of the policy implications surrounding fertilizer usage, making it crucial not only for Iran, but also for many developing nations grappling with inefficient and unsustainable agricultural practices. It represents the first of its kind in the literature, providing estimations of optimal nitrogen use and crop yield points across all regions in Iran. This is achieved through advanced visualization using GIS maps.

El perro sin pelo del Perú ha sido declarado patrimonio cultural de la nación mediante Ley Nº 27537 del 3 de octubre del 2001, y asimismo, por Resolución Directoral de la Nación Nº 001-2001/INC (04- 01-2000), el Instituto Nacional de Cultura ha dispuesto su protección en todos los sitios arqueológicos de la costa.El presente trabajo de investigación se realizó en la ciudad de Lima, durante el período que va de octubre del 2003 a febrero del 2004. Para el efecto se procedió a observar la cavidad bucal de este animal para determinar la ausencia de dientes y a registrar los datos en un odontograma. Como muestra fueron tomados todos los perros sin pelo del Perú mayores de un año inscritos en la ciudad de Lima, que se contaron en número de 50. Los perros fueron clasificados por sexo (19 machos y 31 hembras) y por talla: pequeños (4 ejemplares), medianos (6 ejemplares) y grandes (30 ejemplares), y se les asignó un código numérico. El análisis de los datos de los datos se realizó utilizando la estadística descriptiva, analizando el número y porcentaje de dientes ausentes. Del total de perros de la muestra, se encontró que todos presentaban ausencia de dientes, hallándose como máximo 30 dientes ausentes, y como mínimo, 4 dientes ausentes. El diente más comprometido en el maxilar fue el tercer premolar derecho, ausente en 38 ejemplares. En la mandíbula, el tercer premolar izquierdo fue el más ausente, determinándose su ausencia en 42 perros. En promedio, los machos carecían de 20 dientes, y las hembras, de 17. La ausencia de dientes no depende de la talla, ni tampoco de la edad.De los 50 ejemplares tomados como muestra, se observó que 15 de ellos presentaban una persistencia de los caninos de leche. El único caso de simetría bilateral es el del primer premolar de la mandíbula, el cual siempre estuvo presente, en tanto que los demás dientes siempre estuvieron ausentes en uno u otro caso.Palabras clave: perro sin pelo del Perú, diente, ausencia.DOI: http://dx.doi.org/10.21503/CienciayDesarrollo.2007.v8.02

Abstract Abstract 3526 The pre-treatment karyotype is frequently a potent prognostic determinant of survival in patients (pts) with hematological malignancies. The prognostic significance of chromosomal aberrations, detected at time of diagnosis in pts with essential thrombocythemia (8–10%), polycythemia Vera (PV) (29%) and PMF (approximately 50%), is not well appreciated. We performed a retrospective analysis of 286 pts with PMF who had cytogenetic analyses at our single center between 1984 and July 2011. We first hypothesized that interphase FISH (I-FISH) studies might increase detection of chromosomal rearrangements. Initially, between 2000 and 2008 we performed I-FISH for the detection of the 5 most frequently rearranged loci in Ph negative myeloproliferative neoplasms and extended to 10 loci (1q21, EGR1 at 5q31, D7S511 at 7q31, P15/P16 at 9p21, ATM at 11q22.3, RB1 at 13q14, D20S108 at 20q11 and for numerical detection of chromosomes 7, 8, and 9) as of 2008. The addition of molecular cytogenetics revealed 146 pts (51%) with a normal karyotype and 140 (49%) with abnormal chromosomal lesions, including 12 pts with previously unrecognized lesions. To investigate the relationship between specific chromosomal lesions and JAK2V617F, testing when available after 2007, was performed in 170 of 286 (59%) pts. The V617F mutation was present in 66%. Wild type JAK2 (35%) PMF pts showed del(20q) (4 pts), del(13q) (3 pts), +8 (3 pts, one had cryptic +8), inv(12)(p11q15) (4pts), + der(19)t(1;19) (2pts), complex karyotype (2pts) as well as cryptic lesions (1pt)in a setting of a normal karyotype. The median follow up time of 31pts with normal baseline cytogenetics was 18 months (range 5 to 216 months) and 33% of these patients acquired an abnormal karyotype within the median time of 38mos (range 13–122 months). Four pts acquired a complex karyotype within the mean time of 13 mos (range 11–16 mos) while 2 pts acquired del(20q) within an average of 105 mos (126 and 84 mos). No patient developed a monosomal karyotype. Among 140 pts with an abnormal baseline karyotype, follow up studies were available for 29 pts. The median follow up time was 11 mos (range 5–93 mos) and clonal evolution was observed in 9 pts (31%). The most frequent recurrent abnormalities included del (20)(q11q13) in 30%, del(13q) in 18%, + 8 in 17%, +9/+9p in 16%, trisomy 1q/dup1q in 16%, and i(17q)/del(17p) in 9%. Complex karyotype involving 3 or more chromosomes was identified in 19% while monosomal karyotype, including loss of chromosomes 5, 6,7,17 and18 was observed in 11%. All 6 pts with +der(9)t(1;9)(q21;q12), had PV related PMF and 3 of these pts underwent allogeneic SCT, implying that this abnormality is associated with disease progression. A unique rearrangement, t(1;9) (p36;p24), resulted in identification of a novel JAK2 fusion partner. Survival of these pts based on their cytogenetic risk categories will be presented. Our observations demonstrated that a novel der(19)t(1;19) was detected only in JAK2V617F negative pts, while other abnormalities such as del(20q) and del(13q) are present in both mutation positive and wild type pts. These results confirm previous observations made by us and others that chromosomal abnormalities may occur either before or after JAK2V617F (Wang et al 2009). Even though 33% of pts will progress from a normal to an abnormal karyotype, monosomal karyotype does not appear to be a cytogenetic risk factor in these pts. The observation that the del(20q) abnormality developed over a 7–10 year period in pts with PMF, leads us to conclude that this specific cytogenetic abnormality should be considered a favorable prognostic risk factor. Disclosures: Off Label Use: Oral histone deacetylase inhibitor that targets epigenetic changes in malignant myelofibrosis cells with an goal to modify the disease process.

La incidencia de cáncer durante la gestación es de 1: 1000 a 2000 embarazos, siendo los más frecuentes el de cérvix, mama, ovario, melanoma, tiroides, colon y hematológicos como linfoma y leucemia. A pesar de ser una entidad poco frecuente en el embarazo, se ha visto una tendencia a aumentar en los últimos años debido al incremento progresivo de la edad materna en el momento de la concepción.El carcinoma gástrico es una patología aún menos frecuente, siendo su incidencia durante la gestación de aproximadamente 0.016% a 0.026% en las series de casos de Japón, país con la mayor prevalencia de enfermedad. La cirugía es el tratamiento oncológico menos controversial durante la gestación. En los últimos años, ha cobrado importancia la quimioterapia adyuvante con antineoplásicos de tipo antimetabolito como el 5 fluoracilo (5 – FU), medicamento que ha demostrado mejoría de la supervivencia en pacientes gestantes con adenocarcinoma gástrico. Desafortunadamente, el 96.7% de los casos son diagnosticados en estadíos avanzados, pues su presentación clínica suele confundirse con las manifestaciones propias de la primera mitad de la gestación como son las nauseas y el vomito. Presentamos dos casos clinicos, el de una gestante de 34 años con embarazo de 19 semanas y 3 días al momento del diagnóstico de un carcinoma gástrico Bormann III, llevada a laparotomía con intención curativa a las 21 semanas con hallazgo intraoperatorio de enfermedad metastásica avanzada y tumor ovárico izquierdo sugestivo de tumor de Krukenberg, a quien se le inicia a las 23 semanas quimioterapia paliativa con esquema FOLFIRI el cual recibió hasta la finalización de la gestación a las 33 semanas por restricción del crecimiento intrauterino y posteriormente durante el puerperio; y el de una gestante de 31 años con embarazo de 26 semanas y 6 días quien se ingresa para estudio de emesis persistente durante la gestación con confirmación diagnóstica de adenocarcinoma gástrico Bormann III asociado a Restricción del crecimiento intrauterino que fue llevada a cesárea a las 34 semanas y en el puerperio a gastrectomía total con vaciamiento ganglionar del area celiaca y reconstrucción en Y de Roux.El objetivo de realizar estos reportes surge de la carencia de guias de manejo respecto a dicha entidad durante la gestación debido a la poca frecuencia de presentación de la misma. Es frecuente encontrar discrepancias entre los conceptos en cuanto a conductas médicas se refiere. Disponemos de reportes y series de casos que orientan el manejo hacia un enfoque interdisciplinario dirigido a sopesar los riesgos y beneficios derivados de implementar o no un tratamiento durante la gestación siendo pocos los casos exitosos reportados en la literatura.

Come è noto, l'unione Europea ha fra i suoi scopi quello di favorire lo sviluppo sociale ed economico dei Paesi aderenti, facilitando la ricerca scientifica, l’innovazione tecnologica, la produzione di beni e la circolazione degli stessi nell’ambito dell’Unione, eliminando per quanto è possibile differenze, normative e conflitti commerciali. Con questo spirito, dopo anni di difficile lavoro, è stata emanata la Direttiva 98/44/CE del Parlamento Europeo e del Consiglio (6luglio 1998) che riguarda la protezione giuridica delle invenzioni biotecnologiche, ne presupposto che si tratti di genoma – sia esso di origine vegetale, animale o umano – in quanto risultati da “invenzioni” suscettibili di applicazioni industriali e non dal mero isolamento (“scoperta”). L’Autore, che già ha esaminato in un precedente contributo gli aspetti etici dell’impiego delle biotecnologie nel campo vegetale e animale (v. Medicina e Morale 2000, 3: 449-504), si sofferma a descrivere quanto prevede la Direttiva 98/44/CE stessa, assieme ad altre norme internazionali precedentemente emanat, per la tutela dell’ambiente, degli animali e degli organismi umani. L’Autore riconosce che la direttiva vieta, nel dispositivo, lo sfruttamento commerciale che sia contrario all’ordine pubblico e al buon costume, fornendo gli esempi concreti dei divieti applicabili ai processi di clonazione umana a scopo riproduttivo, di modificazione dell’identità genetica germinale dell’essere umano; di modificazione degli embrioni umani a fini commerciali e industriali; di modificazione dell’identità genetica animale di natura tale da provocare sofferenza negli stessi, senza utilità sostanziale per l’uomo o per l’animale. Tuttavia la Direttiva – sotto l’aspetto giuridico – consente l’utilizzazione di embrioni umani (sia pure non direttamente ed espressamente prodotti a scopo di ricerca in base all’art. 18 della Convenzione sui diritti dell’uomo e la biomedicina) a scopo sperimentale e per applicazioni biotecnologiche riguardanti la produzione di cellule staminali od i medicamenti. L’Autore esamina anche il dibattito che è seguito alla emanazione della Direttiva soprattutto a livello di Assemblea parlamentare del Consiglio d’Europa (Strasburgo) in merito alle preoccupazioni dell’opinione pubblica sui cosiddetti “cibi transgenici” (raccomandazione n. 1398 (1998) dal titolo “sicurezza del consumatore e qualità degli alimenti”), nella quale è stata espressa contrarietà alla brevettabilità degli organismi viventi, pur riconoscendo la necessità di assicurare un’adeguata protezione ai diritti dell’”invenzione” (proprietà intellettuale) [Raccomandazione 1417/1999]. Questi problemi sono stati affrontati ma non risolti nella conferenza internazionale di Oviedo (16-19 maggio 19999) organizzata dal Consiglio d’Europa. Il Comitato Direttivo di Bioetica del medesimo Consiglio d’Europa è stato indicato di esprimere “parere” sulla complessa materia; nel frattempo sono intervenute la conferenza di Seattle e Montreal, ove è stato firmato, nel gennaio 2000, un Protocollo sulla biosicurezza che regolamenta il commercio internazionale di sementi e sostanze geneticamente modificate ritenuti pericolosi per l’ambiente e la salute, escludendo però i prodotti finiti, e perciò il cibo transgenico. Nel momenti in cui – scadendo la moratoria –la Direttiva 98/44/CE entrerà in vigore (31 luglio 2000) essendo improbabile l’accettazione delle argomentazioni di invalidazione sollevate da Olanda e Italia, l’Autore insiste per l’adozione del “principio di precauzione”, esplicitamente incorporato nel diritto comunicato relativo alla protezione della salute, oltreché alla tutela dell’ambiente, che dovrà essere tuttavia meglio specificato nella sua estensione e nelle conseguenze attese. Un secondo principio, quello della “trasparenza”, richiede un’ulteriore affinamento delle informazioni rivolte al consumatore, tramite una più chiara etichettatura che consenta una scelta realmente libera e consapevole dei prodotti derivanti da organismi geneticamente modificati posti in commercio. Dovrà essere perseguita la ricerca, escludendo peraltro l’uso dell’embrione umano.

The efficiency and effectiveness of foliar nitrogen (N) applications as urea to macadamia leaves were investigated in field experiments at Alstonville, New South Wales. The first experiment (August 2000) evaluated the effect of 1–8% urea solutions on the evidence of leaf burn. A 2% urea solution produced negligible leaf burn (1% leaves with lesions) whereas the incidence of leaf burn increased with urea concentration; 20% of leaves were affected with an 8% urea solution. In the following month, a second experiment was conducted using a 2% urea solution that was painted onto both sides of leaves to measure N uptake efficiency. The urea was enriched with the stable isotope 15N, which allows a direct measure of urea uptake, a common method for tracing plant N uptake. Leaves were sampled after 3 and 6 days, and cellulose acetate was then applied to remove urea adhering to the surface of leaves. Leaves adjacent to urea-treated leaves were also sampled to account for any transport out of treated leaves. The experiment was repeated in September 2001. In 2000, a mean of 31% of the urea was absorbed by the mature leaves and this increased the N content by 2.2%. In 2001, a mean of 38% of the urea was absorbed by the mature leaves and this increased N content by 1.9%. Leaves from part of a large mature macadamia tree were stripped to provide an estimate of leaf biomass. From this, the increase in leaf N uptake for a mature orchard was calculated to be 3.98 kg/ha in 2000 and 4.57 kg/ha in 2001. The efficiency of application and hence leaf N uptake from a commercial spray would be expected to be lower than that of the present study. Commercial foliar urea applications are unlikely to meet the N requirements of a productive macadamia orchard. In a separate study, the efficiency of zinc (Zn) fertiliser as soil (5–20 g Zn/m2 canopy ground area) and foliar applications were examined at a mature commercial orchard near Alstonville on a Ferrosol soil. In August 2001, a 2% solution of zinc sulfate heptahydrate was thoroughly applied to the canopy of trees using a backpack misting machine and mature leaves were sampled 4 weeks later. Non-sprayed control trees were also sampled. Cellulose acetate was applied to sampled leaves to remove foliar-applied Zn adhering to the surface of leaves. The leaf Zn concentrations were increased (P<0.05) from 11 to 52 mg/kg 4 weeks after foliar Zn application. Sprayed leaf Zn concentrations were stable 18 weeks later, and flush leaves that emerged after spray application had similar (P>0.05) Zn concentrations to control leaves 12 months later indicating that little if any remobilisation of Zn had occurred over these periods. Soil Zn application had no effect (P>0.05) on leaf Zn concentrations 1 and 2 years after application. The effectiveness of a commercial foliar Zn application was evaluated in September 2001 using a low set orchard sprayer and a 1% Zn solution. After 4 weeks, leaf Zn concentrations were increased from 12 to 26 mg/kg. Foliar Zn applications can be recommended to increase leaf Zn concentrations in macadamias despite evidence in the literature for only 1% uptake efficiency.

Mészlepedékes csernozjom vályogtalajon, az MTA TAKI Nagyhörcsök Kísérleti Telepén (Mezőföldön) vizsgáltuk a kálium, bór és stroncium elemek közötti kölcsönhatásokat 1991 és 1994 között lucernában. A lucerna telepítése előtt 400 kg P2O5·ha-1 alaptrágyát adtunk szuperfoszfát formájában. A K-szinteket megismételt 0, 1000 és 2000 K2O-, a B-szinteket megismételt 0, 20, 40 és 60 kg·ha-1 B-, a Sr-szinteket 67 kg·ha-1 Sr-adaggal állítottuk be. Műtrágyaként 60%-os kálisót, 11%-os bóraxot és 33%-os SrCl2×6H2O sót alkalmaztunk. Főparcellánként 3 K-kezelés, alparcellánként 4 B-kezelés, al-alparcellánként 2 Sr-kezelés szolgált: 24 kezelés×3 ismétlés = 72 parcellával osztott parcellás elrendezésben. A kísérlet beállításakor 1987 őszén a szántott réteg 5% CaCO3-ot, 3% humuszt, 20% agyagot tartalmazott. A pH(H2O) 7,8; a pH(KCl) 7,3; az AL-K2O 180–200, az AL-P2O5 100–120, a KCl-oldható Mg 110–150, a KCl+EDTA-oldható Mn 60–80, a Cu és Zn 1–2, valamint a B 0,7 mg·kg-1 értékkel volt jellemezhető. A termőhely kielégítő K-, Ca- és Mg-; közepes N- és P-; valamint gyenge Zn- és Cu-ellátottságú. A talajvíz szintje 13–15 m mélyen található, a terület aszályérzékeny. Az átlagos középhőmérséklet 11 °C, az éves csapadékösszeg 400–600 mm közötti egyenetlen eloszlással. A főbb megállapítások, levonható tanulságok: – Ezen a káliummal és bórral egyaránt kielégítően ellátott karbonátos vályogtalajon trágyahatások a termésben nem jelentkeztek. Az extrémen nagy, ismételt 2000 kg·ha-1 K2O-, illetve 60 kg·ha-1 B-adagok sem okoztak terméscsökkenést. A talaj AL-K2O tartalma a kontrollon mért 191 mg·kg-1-ról 515 mg·kg-1-ra, a forróvíz oldható B-tartalma 0,7 mg·kg-1-ról 5,1 mg·kg-1-ra nőtt a maximális adagokkal. – A lucerna B-tartalma 30–50 mg·kg-1-ról ugyanitt 50–120 mg·kg-1-ra nőtt. A Ktrágyázással emelkedett a széna K-, valamint visszaesett Na-, Mg-, Ca- és Cu-koncentrációja. A széna Cu-tartalmát a B-trágyázás is igazolhatóan mérsékelte, növelve a lucerna látens Cu-hiányát, 3 mg·kg-1 körüli Cu-tartalmat eredményezve a szénában. – A 2. éves lucerna volt a leggazdagabb a N, K, Ca, Mg, S és P makroelemekben és a legnagyobb szénatermést adta. Ebből adódóan a maximális elemfelvételt mutatta 319 kg N, 176 kg K (211 kg K2O), 184 kg Ca, 31 kg S, 28 kg Mg és 22 kg P (50 kg P2O5) hektáronkénti mennyiséggel. – A 4 év alatt 26,4 t·ha-1 széna termett, melybe 756 kg N, 654 kg K2O és 158 kg P2O5 épült be. A lucernatermesztés gyorsan elszegényítheti a talajt, főként káliumban. Mészben szegény talajokat kalciumban is, mivel a Ca-felvétel hasonló mértékű lehet. A felvett nitrogén nagyobb része viszont a levegőből származik. A visszamaradó, nitrogénben gazdag gyökérmaradványok a talaj N-szolgáltatását növelik, a következő növény N-trágyaszükségletét mérséklik. – Az 1 t széna képződéséhez szükséges átlagos fajlagos elemigény 1991 és 1994 között ezen a talajon 20–40 kg N, 18–22 kg K és Ca, 3–4 kg Mg és S, 2–3 kg P (5– 7 kg P2O5) volt. Adataink iránymutatóul szolgálhatnak a tervezett termés K-, Ca-, Mg-, P- és S-igényének számításakor. A fajlagos mikroelem-tartalmak szórása az alábbinak adódott: 400–500 g Na, 80–120 g Fe és Sr, 40–60 g Mn, 20–50 g Al és B, 12–16 g Zn, 8–10 g Ba, 5–20 g Cu és 0,3–1,4 g Ni. A fajlagos Zn és Cu mutatók tükrözik a termőhely gyenge ellátottságát, optimum alattiak.

To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica. References: (1) Anonymous. Annual Report of the Sugar Industry Research Institute, Jamaica, 2004. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) N. A. Harrison and M. J. Davis. Phytopathology 78:722, 1988.

Potato (Solanum tuberosum L. subsp. tuberosum) is one of the most important food crops in Canada. Potato cyst nematodes, Globodera rostochiensis (Wollenweber, 1923) Skarbilovich, 1959 and Globodera pallida (Stone, 1973) Behrens, 1975, are considered the most economically important nematode pests of potatoes worldwide and are the subject of strict quarantine regulations in many countries including Canada. In Canada, G. rostochiensis was found in the Saanich Peninsula of Vancouver Island, British Columbia and both G. rostochiensis and G. pallida are present on the island of Newfoundland (3). During August of 2006, soil and roots of potato plants collected from a 19.2-ha field in the Saint-Amable region, Quebec, were submitted to the Nematology Laboratory, Canadian Food Inspection Agency, Ottawa. Golden, spherical-shaped cysts were found associated with the roots and were also extracted from the soil. The nematodes recovered were identified by morphological and morphometric analysis and DNA analysis. Measurements and morphological observation of 60 second-stage juveniles were as follows: body length = 427.4 ± 22.0 (395 to 495) μm; stylet length = 21.3 ± 1.2 (18 to 23) μm; distance from stylet base to dorsal esophageal gland opening = 5.5 ± 0.9 (3.5 to 7.0) μm; tail length = 46.7 ± 3.7 (36 to 58) μm; hyaline tail terminus = 21.1 ± 3.1 (13 to 27) μm; and the shape of stylet basal knobs varied from rounded to lateral flattened. Observations for 35 mature cysts were: number of cuticular ridges between anus and vulval fenestra = 21 ± 6 (12 to 31); fenestral length = 18.4 ± 3.6 (11 to 30) μm; distance from anus to the edge of fenestra = 81.1 ± 30.4 (29 to 165) μm; Granek's ratio = 4.4 ± 1.6 (1.8 to 6.0), with parallel wavy cuticular ridges between anus and vulval fenestra. These observations conformed to the published description of G. rostochiensis (2). Additionally, the identification was supported by the PCR-restriction fragment length polymorphism pattern of the ITS-1 region amplified using primers 18S (5′-TTGATTACGTCCCTGCCCTTT-3′) and rDNA1.58S (5′-ACGAGCCGAGTGATCCACCG-3′) and digested with BstU I and a PCR product specific for G. rostochiensis (1). Sequence of a 1,190-bp PCR fragment of ribosomal DNA amplified using primers rDNA1 (5′-TTGATTACGTCCCTGCCCTTT-3′) and rDNA2 (5′- TTTCACTCGCCGTTACTAAGG-3′) showed 99.0 to 100% identity with published DNA sequences of the same genomic region for G. rostochiensis (4). The sequence is available from the authors upon request. The origin of the introduction of G. rostochiensis into Saint-Amable is unknown. An intensive soil survey is underway to define the infested area, and strict quarantine measures have been taken to prevent further spread of G. rostochiensis. To our knowledge, this is the first evidence of the occurrence of G. rostochiensis in Quebec, Canada. References: (1) A. Fullaondo et al. Nematology 1:157, 1999. (2) A. M. Golden et al. Proc. Helminthol. Soc. Wash. 39:64, 1972. (3) A. R. Stone et al. Plant Dis. Rep. 61:590, 1977. (4) S. A. Subbotin et al. Nematology 2:591, 2000.

Abstract [Background] Immune tolerance induction (ITI) therapy is the only therapeutic approach that can eradicate factor (F)VIII and FIX inhibitors in patients with hemophilia A (HA) and B (HB), respectively. Although results of several retrospective cohort studies have been published, predictors of successful outcome are still debated. Nonetheless, little information is so far available in terms of large ITI cohort in non-Caucasian countries. [Aim] In this study, we performed a retrospective cohort study on ITI therapy carried out for Japanese hemophilia patients with inhibitors to understand the status of practice on this therapy in Japan and to study the predictors of successful outcome. [Methods] As of March 31, 2015, the registry of ITI therapy in Japanese hemophilia patients had received reports on 155 HA patients (140 severe type, high responder 69.1%) and 7 HB patients (7 severe type, high responder 42.5%) who have undergone this therapy from 45 hospitals including Hemophilia Treatment Centers since 2000. The ITI outcome was centrally reviewed. The success of ITI was defined as an undetectable inhibitor for 2 successive measurements, and the salvage ITI was defined as any rescue ITI regimen by using von Willebrand factor-containing FVIII concentrates. [Results] Among the completed ITI courses, the overall success rate of ITI therapy was 71.2% (94/132) and 83.3% (5/6) for HA and HB patients, respectively. Cumulated ITI success rates of 50% and 80% for HA patients were achieved at 1.6 and 4.3 years after the inhibitor diagnosis, and 0.6 and 2.3 years after the initiation of ITI, respectively. Significant predictors for success of ITI in HA were (i) low responding inhibitors (success 35/37 (94.5%)) compared to high responding inhibitors (59/93 (63.4%); p <0.0001), (ii) shorter intervals from inhibitor diagnosis to the initiation of ITI (success (S): 1.85±3.52 vs failure (F): 3.38±3.77 years; p =0.02), (iii) lower historical peak titers on pre-ITI (S: 24.9±55.2 vs F: 132±295 BU/ml; p =0.04), and (iv) lower peak inhibitor titers on-ITI (S: 72.4±231 vs F: 916±1,307 BU/ml; p <0.01). However, outcome was not significantly different (p =0.77) between high dose regimens (>90 IU/kg, 7 days/wk) and low dose regimens (<75 IU/kg, 3 days/wk). Also, either FVIII products (plasma-derived or recombinant) at the initiation or the insertion of central venous access devise (CVAD) did not affect the outcome (p =0.32 and 0.85). Although the outcome prediction was difficult for HB because of low number of the cases registered, success rate was much higher than those of previous reports. The success rate of salvage ITI was 50% (6/12) for HA. The significant predictive parameter for outcome was only the age at the initiation of salvage ITI (p =0.03). The inhibitor relapsed in 6 cases, and all cases were HA patients (4.5% 6/140). In 86 cases with insertion of CVAD, the catheter-related infection was complicated in 21 cases (12.9%). [Conclusion] This study underscores the importance of initiating the ITI as early as possible after the diagnosis of inhibitor and the low response of inhibitor titer before and during the ITI to maximize the success of the treatment for Japanese hemophilia patients. Disclosures Nogami: Chugai: Membership on an entity's Board of Directors or advisory committees; Bayer, NovoNordisk, Baxalta, Chugai, Kaketsuken, Pfizer, Biogen: Honoraria; Bayer, Novo Nordisk, Baxalta. Biogen: Research Funding. Taki:Biogen, Baxalta, Bayer, Novo, Pfizer: Honoraria; Biogen, Baxalta, NovoNordisk, CSL-Behring, Kaketsuken, Chugai: Research Funding. Matsushita:Pfizer: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Baxalta: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Biogen: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; CLS-Behling: Research Funding; Japan Blood Products Organization: Honoraria, Research Funding; Kyowa-Kirin: Honoraria, Research Funding; Octapharma AG: Honoraria; Sysmex: Speakers Bureau; Seamens: Speakers Bureau; Nihon Pharmaceutical: Honoraria, Research Funding, Speakers Bureau; Kaketsuken: Honoraria, Research Funding, Speakers Bureau; Asahi Kasei Pharma: Honoraria, Research Funding, Speakers Bureau; Eisai: Research Funding; Novartis Pharma: Honoraria, Speakers Bureau; Bayer Healthcare: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Novo Nordisk Pharma: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Chugai Pharmaceutical Co., Ltd.: Research Funding. Hanabusa:Novo Nordisk, Baxalta, Bayer, Pfizer, Biogen, and KaketsuKen: Honoraria; Novo Nordisk, Baxalta, KaketsuKen, and Biogen: Membership on an entity's Board of Directors or advisory committees. Shima:Pfizer: Honoraria, Research Funding; Kaketsuken: Honoraria; Biogen: Honoraria, Research Funding; Chugai Pharmaceutical Co., Ltd: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding; Novo Nordisk: Honoraria, Research Funding; Bayer: Honoraria, Research Funding; Baxalta: Honoraria, Research Funding.

The paper presents an improved algorithm based on Bhaskara Rao and Ramesh Babu’s algorithm to invert magnetic anomalies of three-dimensional basement structures. The magnetic basement is approximated by an ensemble of juxtaposed vertical prisms whose bottom surface coincides with Curie surface with the known depth. The computer program operating with the proposed algorithm is built in Matlab environment. Test applications show that the proposed method can perform computations with fast and stable convergence rate where the results also coincide well with the actual model structure. The effectiveness of the method is demonstrated by inverting magnetic anomalies of the southeast part of Vietnam continental shelf. The calculated magnetic basement relief of the study area provides useful additional information for studies in the aim of dealing with the geological structure of the area.References Beiki M., 2010. Analytic signals of gravity gradient tensor and their application to estimate source location, Geophysics, 75(6), i59–i74.Bui C.Q. (chief author), Le T., Tran T. D., Nguyen T. H., Phi T.T., 2007. Map of deep structure of the Earth’s crust, Atlas of the characteristics of natural conditions and environment in Vietnam’s waters and adjacent region. Publisher of Science and Technology, Ha Noi. Do D.T., Nguyen T.T.H., 2011. Atempt the improvement of inversion of magnetic anomalies of two dimensional polygonal cross sections to determine the depth of magnetic basement in some data profile of middle off shelf of Vietnam. Journal of Science and Technology, Vietnam Academy of Science and Technology, 49(2), 125–132.Do D.T., 2013. Study for application of 3D magnetic and gravity method to determine density contribution of basement rock and depth of magnetic basement on Vietnam’s shelf for oil research and prospecting Vietnam National University, Hanoi, Project code QG-11-04. Keating P. and Pilkington M., 2000, Euler deconvolution of the analytic signal, 62nd Annual International Meeting, EAGE, Session P0193.Keating P., Zerbo L., 1996. An improved technique for reduction to the pole at low latitudes, Geophysics, 61, 131–137.Le H.M., Luu V.H., 2003. Preliminary interpretation of the magnetic anomalies of the Eastern Vietnam sea and adiacent regions. J. Sci. of the Earth, 25(2), 173–181. Mai T.T., Pham V.T., Dang V.B., Le D.B., Nguyen B., Le V.D., 2011. Characteristics of Pliocene - Quaternary geology and Geoengineering in the Center and Southeast parts of Continental Shelf of Vietnam. J. Sci. of the Earth, 33(2), 109-118.Mushayandebvu M.F., Lesur V., Reid A.B., Fairhead J.D., 2004. Grid Euler deconvolution with constraints for 2D structures, Geophysics, 69, 489–496.Nguyen N.T., Bui V.N., Nguyen T.T.H., Than D.L., 2014a. Application of power density spectrum of magnetic anomaly to estimate the structure of magnetic layer of the earth crust in the Bac Bo gulf. Journal of Marine Science and Technology, 14(4A), 137–148.Nguyen N.T., Bui V.N., Nguyen T.T.H., 2014b. Determining the depth to the magnetic basementand fault systems in Tu Chinh - Vung May area by magnetic data interpretation. Journal of Marine Science and Technology, 14(4A), 16–25.Nguyen T.T.H., Pham T.L., Do D.T., Le H.M., 2018. Improving algorithm of determining the coordinates of the vertices of the polygon to invert magnetic anomalies of two-dimensional basement structures in space domain, Journal of Marine Science and Technology (preparing to print).Parker R.L., 1973. The rapid calculation of potential anomalies, Geophys. J. Roy. Astron. Soc, 31, 447–455. Pilkington M., Gregotski M.E., Todoeschuck J.P., 1994. Using fractal crustal magnetization models in magnetic interpretation, Geophysical Prospecting, 42, 677–692.Pilkington M., 2006. Joint inversion of gravity and magnetic data for two-layer models, Geophysics, 71, L35–L42.Rao D.B., Babu N.R., 1993. A fortran 77 computer program for three dimensional inversion of magnetic anomalies resulting from multiple prismatic bodies, Computer & Geosciences, 19(8), 781–801.Tanaka A., Okubo Y., Matsubayashi O., 1999. Curie point depth based on spectrum analysis of the magnetic anomaly data in East and Southeast Asia, Tectonic Pphysics, 306, 461–470.Thompson D.T., 1982. EULDTH – A new technique for marking computer-assisted depth estimates from magnetic data, Geophysics, 47, 31–37.Vo T.S., Le H.M., Luu V.H., 2005. Determining the horizontal position and depth of the density discontinuties in Red River Delta by using the vertical derivative and Euler deconvolution for the gravity anomaly data, Vietnam. Journal of Geology, Series A, 287(3–4), 39–52. Werner S., 1955. Interpretation of magnetic anomalies of sheet-like bodies, Sveriges Geologiska Undersokning, Series C, Arsbok, 43, 6.Xu S.Z., 2006. The integral-iteration method for continuation of potential fields, Chinese journal of geophysics (in Chinese), 49(4), 1176–1182.Zhang C., Huang D.N., Zhang K., Pu Y.T., Yu P., 2016. Magnetic interface forward and inversion method based on Padé approximation, Applied Geophysics, 13(4), 712–720.CCOP, 1996. Magnetic anomaly map of East Asia, scale 1:4.000.000, Geological survey of Japan and Committee for co-ordination of joint prospecting for mineral resources in asian offshore areas.

Diplodia pinea is a latent, opportunistic pathogen of Pinus and other coniferous species, including Pseudotsuga menziesii (3). The fungus causes twig blight, branch cankers, tree and seedling collar rot, root rot, and can also infect cones (1). D. pinea has often been reported causing tip and shoot blight on various Pinus spp. in different parts of Turkey. During disease surveys on Pinus spp. carried out in May 2012 in Izmit in the Marmara Region (37°36′54″N, 31°20′00″E), typical shoot blight symptoms of D. pinea infection were also observed on the neighboring P. menziesii trees. Shoots and cones of P. menziesii were investigated for the presence of D. pinea pycnidia. Pycnidia from cones and shoots were placed on potato dextrose agar (PDA) and incubated at 23°C. Three isolates were obtained from shoot and cone samples. Identification of the pathogen was based on morphological characteristics of the conidia and by PCR of the ITS region of nuclear rDNA. Colonies on PDA were woolly, whitish at first turning black, sometimes partly or entirely turning light gray. Micromorphological characteristics of the Diplodia isolates were similar to those described in (2): conidia width 18.4 μm (SD ± 2.8) (range 11 to 22 μm) × length 34.0 μm (SD ± 5.3) (range 20 to 41 μm) (n = 100). Conidia were at first hyaline, later becoming brown to dark brown, oblong ellipsoid, bicellular with a distinct septum. To confirm the identity of the isolates, genomic DNA was extracted and the internal transcribed spacer (ITS) region of the rDNA was amplified using primers ITS1 and ITS4 (4). Amplicons were 483 bp in length (GenBank Accession No. KF372874) and shared 98% nucleotide identity with HM100285.1 and 97% nucleotide identity with JX981458.1 of D. pinea. Inoculation tests were performed on 2-year-old P. menziesii seedlings by placing mycelial plugs of three isolates obtained from pycnidia on the main stem after wounding with a cork borer. Control seedlings were inoculated with PDA plugs without mycelium. All seedlings were incubated at 24°C for 3 weeks in a climate chamber. Following incubation, the seedlings displayed dark brown-to-black discoloration, measuring on average 10.7 ± 0.6 cm, of the bark and wood tissues around the inoculation points on the stems. The pathogen was successfully re-isolated from symptomatic stem tissues, thus fulfilling Koch's postulates. To our knowledge, this is the first report of P. menziesii as a host of D. pinea in Turkey. P. menziesii is not endemic to Turkey and to date has a limited distribution (approximately 140 ha), but it is an important fast growing tree species for new industrial plantations. References: (1) J. de Wet. PhD thesis, University of Pretoria, 2008. (2) J. de Wet et al. Plant Dis. 84:151, 2000. (3) G. Hausner et al. Can. J. Plant Pathol. 21:256, 1999. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

La fibrosis quística (FQ) constituye un trastorno hereditario complejo multisistémico, de evolución crónica y de gran heterogenicidad clínica. Afecta a la mayoría de los órganos, siendo el páncreas y los pulmones los más comprometidos, determinando la morbimortalidad. Desde sus primeras descripciones se ha recorrido un largo camino, en el que, gracias a técnicas de biología y genética molecular, se ha identificado el defecto básico y se comienza a vislumbrar la posibilidad de curación. Ella refleja la evolución de la medicina de las últimas décadas, pues en poco más de 60 años se ha pasado de su delimitación clínica como nueva entidad nosológica, al conocimiento preciso de su etiología, su sustrato patológico y su fisiopatología. Paralelamente se ha producido una transformación en su historia natural y de constituir un proceso letal de la primera infancia, ha pasado a ser una enfermedad crónica, abierta a la esperanza de un tratamiento curativo. Con el conocimiento de su fisiopatología y del defecto básico se desarrollaron tratamientos más eficaces y la sobrevida media es hoy de más de 40 años en países desarrollados(1,2). Alguna vez considerada una enfermedad de la población caucásica europea, es actualmente reconocido que ningún grupo étnico se encuentra excluido. En Latinoamérica se han incrementado los casos y es previsible un aumento mayor con el screening y el reconocimiento de las formas moderadas(3). El descubrimiento del gen mutado de la proteína reguladora de la conductancia transmembrana de la FQ (CFTR siglas en inglés) en 1989 y la función de la proteína natural (wild- type) CFTR en 1992, esclareció el mecanismo fisiopatológico básico. Actualmente, existen más de 1900 mutaciones y cerca de 2/3 de los casos corresponden a la mutación p.F508del(4). La prevalencia difiere entre las poblaciones, así en Latinoamérica cada país posee un variado espectro(2). La incidencia depende del ambiente, la consanguineidad, las variaciones fenotípicas derivadas del tipo de mutación y del grupo étnico. Debido a la heterogeneidad étnica se observa amplia variación a nivel mundial. En Latinoamérica se reportan incidencias de 1/3.900, 1/6.573, 1/8.500 y 1/14.000 nacidos vivos(3,5,6,7). Gracias a una mayor capacitación, programas de screening neonatal, diagnóstico molecular y otros test diagnósticos se ha progresado en las tasas de diagnóstico y en el diagnóstico oportuno. A pesar de ello, el sub diagnóstico resta como desafío. Se precisa mayor uniformidad y acceso universal a herramientas de diagnóstico dentro y entre países(3,8). El screening neonatal ha permitido evaluar el impacto de la intervención temprana. El diagnóstico en las primeras semanas de vida posibilita la terapéutica específica oportuna, previene la desnutrición y reduce el daño pulmonar mejorando la salud a mayor edad. Los niños identificados con screening demostraron una clara ventaja en el Zscore talla/edad y Zscore de función pulmonar, resaltando la importancia de la detección neonatal(2). A nivel mundial las Asociaciones de Lucha Contra la FQ han impulsado el desarrollo científico y tecnológico e implementado acciones a favor de esta condición incapacitante y onerosa, desde lo económico, físico y psíquico. En Paraguay el diagnóstico y tratamiento de la FQ ha sido realizado desde fines de la década de 1980 con grandes dificultades debido a la escasez de métodos diagnósticos a nivel del sistema público y al elevado costo del tratamiento, destacándose el sub diagnóstico y el abandono del tratamiento como los mayores problemas(1). En la década de 1990 me cupo acompañar a un grupo de padres de niños con FQ, quienes abrumados por la situación de orfandad en que se encontraban, lideraron la creación de la Fundación Paraguaya de lucha contra la FQ (FUPAFI) que se constituye en el año 1995. En ese transcurso, diversas publicaciones en medios locales y en colaboración con colegas latinoamericanos se realizaron en el afán de dar a conocer nuestra realidad(9,10,11,12,13,14). Luego de un largo transitar, esfuerzo y perseverancia FUPAFI obtiene la personería jurídica por decreto nº17.518 del Poder Ejecutivo en el año 2002(15). Los primeros reportes en el país reflejan el diagnóstico tardío, el estado nutricional deficiente y la mortalidad precoz(1). En un estudio de casos de Garcete L los diagnósticos fueron tardíos, ninguno antes de los 10 meses de edad(16). Otra investigación que incluyó 30 pacientes con FQ, del Servicio de Pediatría. Hospital de Clínicas. FCM. UNA, entre los años 1985 al 2000, encontró que cuanto más tardío el diagnóstico, mayor el deterioro nutricional y menor capacidad de recuperación. El reducido número de casos en esa serie, hacia presumir un subdiagnóstico(1). En el año 2002 Garcete et al describen una media de edad al diagnóstico de 21 meses 25 sobre una población de 31 pacientes(17). Es en el año 2003 que Paraguay da un salto en la historia de la FQ con la Ley 2138 y en el 2016 con la Ley 5732 del Programa Nacional de Detección Neonatal (PNDN)(18) que establece la detección, diagnóstico y tratamiento obligatorio y gratuito de la FQ para recién nacidos (RN). Al inicio solo para RN con síntomas o antecedentes, desde el año 2015 se tamizan el 100% de las muestras del país y se provee tratamiento a pacientes(5). En el año 2016 sobre 84 pacientes registrados en el PNDN, se reporta una mediana de edad al diagnóstico de 4,9 meses, 64 % diagnosticados antes de los 6 meses de vida, avance atribuible a la creación del PNDN. El 22 % diagnosticado por screening y el 78% por síntomas. Un porcentaje de estos 78% fueron derivados de otras instituciones(19). Escurra y col reportan en este número la incidencia de la FQ en Paraguay por tamizaje en RN y confirmación diagnóstica con test del sudor, procesadas en el PNDN en los años 2105-2017, arrojando incidencias de 1/ 6.591 RN, 1/4.176 RN y 1 /5.112 RN. Los resultados en esta serie no presentan diferencias significativas con las reportadas para la población hispánica de la región que oscilan entre 1/3000 a 1/8500(5,6,8,16). A pesar de los avances, la FQ sigue caracterizada por déficit de crecimiento, daño pulmonar y muerte prematura(2,20). El pronóstico depende de la precocidad del diagnóstico y de una terapéutica oportuna y actualizada. Las piedras angulares del tratamiento son la nutrición óptima, la fisioterapia y el ejercicio, aunadas al tratamiento precoz de la afectación pulmonar y al nuevo arsenal dirigido al defecto básico(1). El tratamiento de la disfunción de la CFTR constituye una realidad muy próxima o ya establecida en varios países(3). Las intervenciones focalizadas sobre los defectos básicos de la CFTR y su inicio oportuno evitaría la acumulación de daño tisular mejorando la evolución en los afectados(2). Una caracterización genética por regiones es esencial para maximizar las oportunidades(3). En nuestro medio se ha recorrido un largo camino brindando posibilidades diagnósticas para conocimiento de su incidencia y abordaje precoz, como también posibilidades terapéuticas. Aún hay progresos por realizar en lo que atañe al diagnóstico de los casos que han escapado al screening, y al manejo multidisciplinario de los pacientes, mejorando el conocimiento médico y estableciendo políticas claras que protejan la salud. Se requiere disponibilidad de métodos diagnósticos, estudios genéticos para mejor abordaje y asistencia a las familias(1). El registro de pacientes es vital para monitorizar la incidencia y evolución de estos, facilitar la identificación de las necesidades particulares y orientar las acciones(3). El derecho a la salud universal es una deuda que debemos saldar y sólo lo lograremos con el compromiso de todos. Correspondencia: Lidia Garcete Mañotti; Correo: lidiga1@hotmail.com Recibido: 29/03/2019 Aceptado: 11/04/2019

Abstract Abstract 474 BACKGROUND: Autologous stem cell transplantation (autoSCT) is considered as standard treatment for non-frail patients with mantle cell lymphoma (MCL). However, little is known about outcome of MCL recurrence after autoSCT. We therefore conducted a retrospective analysis of patients with MCL who failed autoSCT using the EBMT database. PRIMARY OBJECTIVE was to analyse outcome and prognostic factors after relapse following autoSCT for MCL in the rituximab era. PRIMARY ENDPOINT was overall survival (OS) from relapse. ELIGIBLE were patients aged 18 years or more who relapsed following an autoSCT for MCL performed between 2000 and 2010 and who were registered with the EBMT. Centres were contacted to provide additional information on relapse treatment. STATISTICAL ANALYSIS was based on log-rank comparisons and multivariable testing using Cox regression models. RESULTS: 1054 patients meeting the eligibility criteria could be identified in the EBMT registry. Of these, a full data set could be retrieved for 382 patients. Sixteen patients had to be excluded due to loss of follow up (n=7), wrong diagnosis (n=6), or falsely reported relapse (n=3). Median age at autoSCT of 366 evaluable patients was 59 years (range: 37 to 76), 290 patients (79%) were men. 64% had undergone autoSCT as part of 1st-line therapy; 68% and 49% had documented exposure to rituximab (RTX) and high-dose ara-C (HA) before autoSCT; and 12% had had refractory disease at autoSCT. Median time from autoSCT to relapse was 20 months (range: 0.4 to 117). 21 relapses (6%) occurred beyond 5 years after autoSCT. With a median observation time of 37 months (95% CI 32–43), median OS after relapse of the whole study group was 20 months. By univariate analysis, a long (>12mo) interval between autoSCT and relapse (p<0.001; HR 0.26; Figure 1A), 1st-line autoSCT (p=0.006; HR 0.7) refractory disease at autoSCT (p<0.001, HR 2.0) and more recent year of relapse (p<0.001, HR per year 0.9) significantly influenced OS from relapse, whereas age, gender, RTX and HA exposure did not. By multivariate analysis refractory disease at autoSCT (p<0.001, HR=2.14), remission duration after autoSCT (p<0.001 HR per 3 months 0.88) and calendar year of relapse (p<0.03, HR per year 0.93) were confirmed to be predictors for OS. In addition, HA exposure prior autoSCT adversely affected OS from relapse (p=0.06, HR 1.38). Salvage chemotherapy after relapse resulted in only 31% complete responses and 29% partial responses, whereas 40% of patients have been refractory to first salvage chemotherapy. 83 patients (23%) received an allogeneic SCT (alloSCT), whereas only 7 patients (2%) received a second autoSCT after relapse. Median time after relapse to second SCT was 7 months (range: 1 to 40). Survival after relapse for patients who received a second autoSCT was poor with no long-term survivor. AlloSCT performed for late relapse (>12mo) after autoSCT was associated with superior OS compared to patients who received an allograft upon a shorter remission duration after autoSCT (5-year OS from alloSCT 50% vs 0%; p=0.001; Figure 1B). Achievement of CR before alloSCT (p=0.05 HR=0.5), but not donor source, T-cell depletion or conditioning intensity affected OS after alloSCT. CONCLUSIONS: Patients with MCL who relapse within one year after autoSCT have an extremely dismal outcome even with alloSCT. In contrast, about half of the patients who have MCL recurrence beyond one year after autoSCT and can undergo salvage alloSCT enjoy long-term survival. It remains to be shown if a similarly good outcome can be achieved without alloSCT in this favourable selection of patients. A 2nd autoSCT does not appear to be a promising option in patients with MCL failing a 1st autoSCT. Disclosures: Walewski: Mundipharma: Honoraria, Membership on an entity's Board of Directors or advisory committees, Research Funding, Speakers Bureau; Roche: Honoraria, Speakers Bureau; GSK: Membership on an entity's Board of Directors or advisory committees; Celgene: Membership on an entity's Board of Directors or advisory committees; Janssen-Cilag: Membership on an entity's Board of Directors or advisory committees; Cephalon: Research Funding.

The aim of this research was to measure the effect of yellow corn substitution with banana peel meal as a beta-carotene and antioxidant source in the chicken diet on cholesterol, vitamin A and fatty acid profiles of egg yolk Arab chicken. The experimental design used was a completely randomized design. Data were analyzed by Analysis of Variance (ANOVA) and significant differences between the treatments were analyzed by Duncan's Multiple Range Test. Eighty pullet of Arabic chickens (19 weeks old) were randomly assigned to four treatment diets with four replications for 6 weeks of fed trials. Dietary treatments consisted of R0 (0%) banana peel meal (TP) : 50% yellow corn (JK) and 3 levels of yellow corn and banana peel. The composition of yellow corn and banana peel meal used R1 (20 % TP ; 30% JK), R2 (30% TP : 20% JG) and R3 (40% TP :10% JG). The variables observed were production performance, cholesterol, vitamin A and fatty acid profile of the egg yolk. The results showed that egg yolk cholesterol levels were not significantly different compared to the control. Substitution of yellow corn with banana peel meal had increased vitamin A level up to 49% compared to the control. There was no difference in fatty acid profiles in all treatments observed. It is concluded that banana peel meal can be used to substitute 40 % of yellow corn in the chicken diet and tend to increased vitamin A of egg yolk. Key words: Arabic chicken, banana peel meal, cholesterol, fatty acid, yolk DAFTAR PUSTAKA Abel FAS, Adeyemi OA, Oluwole OB, Oladunmoye OO, Ayo-Ajasa OY, Anuoluwatelemi JO. 2015. Effect of treated banana peel meal on the feed efficiency, digestibility and cost effectiveness of broiler chicken diet. Journal of Veterinery Science & Animal Husbandry. 3 (1): 1-6 Abou-Arab AA, Abu-Salem FM. 2017. Nutritional and anti-Nutritional composition of banana peels as influenced by microwave drying methods. International Scholarly and Scientific Research & Innovation. 11(12): 845-852 Amrullah, IK. 2004. Nutrisi Ayam Petelur. Cetakan ke-3. Bogor (ID): Lembaga Satu Gunungbudi. Anhwange BA, Ugye TJ, Nyiaatagher TD. 2009. Chemical composition of Musa sapientum (Banana) peels. Electronic Journal of Environment, Agricultural and Food Chemistry. 8 (6):437-442 Antruejo A, Azcona JO, Garcia PT, Gallinger C, Rosmini M, Ayerza R, Coates W, Perez CD. 2011. Omega-3 enriched egg production: The effect of α-linolenic ῳ-3 fatty acid sources on laying hen performance and yolk lipid content and fatty acid composition. British Poultry Science. 52(6): 750-760 Aryani T, Mu’awanah IAU, Wydiantara AB. 2018. Karakteristik fisik, kandungan gizi tepung kulit pisang dan perbandingannya terhadap syarat mutu tepung terigu. Jurnal Riset Sains dan Teknologi. 2(2): 45-50 Arora A, Choudhary D, Agarwal G, Singh VP. 2008. Composition variation in β-carotene content, carbohydrate and antioxidant enzymes in selected banana cultivar. International journal of Food Science and Technology. 43: 1913-1921 Blandon JC, Hamady GAA, Abdel-Moneim A. 2015. The effect of partial replacement of yellow corn by banana peels with and without enzymes on broiler’s performance and blood parameters. Journal of Animal and Poultry Science. 4(1): 10-19 Diana, FM. 2013. Omega 6. Jurnal Kesehatan Masyarakat. 7(1): 26-31 Diarra SS. 2018. Peel meals as a feed ingredient in poultry diets. Chemical composition, dietary recommendation and prospect. Journal of Animal Physiology and Animal Nutrition. 102: 1284-1295 Chueh CC, Lin LJ, Lin WC, Huang SH, Jan MS, Chang SC, Chung WS, Lee TT. 2019. Antioxidant capacity of banana peels and its modulation of Nrf2-ARE associated gene expression in broiler chickens. Italian Journal of Animal Science. 18 (1): 1394-1403 Haryanto, A, Miharja K, Wijayani N. 2016. Effect of banana meal on the feed conversion ratio and blood lipid profile of broiler chickens. International Journal of Poultry Science. 15 (1) : 27-34 Has, H, Napirah A, Dewi L. 2017. Efektivitas substitusi kulit pisang dengan dedak padi dalam ransum ayam kampung. Makasar (ID): Seminar Nasional Peternakan. Universitas Hasanudin. Indra GK, Achmanu, Nurgiatiningsih A. 2013. Performans produksi ayam Arab (Gallus turcicus) berdasarkan warna bulu. Jurnal Ternak Tropika. 14 (1): 8-14 Konieczka M, Czauderna S, Smulikowsk S. 2017. The enrichment of chicken meat with omega-3 fatty acid by dietary fish oil or its mixture with rapeseed or flaxseed-effect of feeding duration dietary fish oil, flaxseed, and repeseed and n-3 enriched broiler meat. Animal Feed Science and Technology. 223 : 42-52 McDowell, L.R. 2000. Vitamine in Animal and Human Nutrition. 2nd Edition. Iowa (US): State University Press, Iowa. Mulyadi Y. 2013. Penggunaan pakan fungsional terhadap performan produksi dan kualitas telur ayam arab. Jurnal Ilmu Ternak. 13 (2): 27-33 [NRC] National Research Council. 1994. Nutrient Requirements of Poultry. 9th Revised Edition. Washington. D. C. (US) : National Academy Press, Nuraini, Sabrina, Latif SA. 2008. Performa ayam dan kualitas telur yang menggunakan ransum mengandung onggok fermentasi dengan Neurospora crassa. Media Peternakan. 31:195-202. Pereira A, Maraschin M. 2015. Banana (Musa spp) from peel to pulp: ethnopharmacology, source of bioactive compounds and its relevance for human health. Jurnal Ethnopharmacology. 160:149–163 Piliang WG, Djojosoebagio S. 2006. Fisiologi Nutrisi. Volume I. Edisi ke-2. Bogor (ID): IPB Press Rehaul-Godbert, S, Guyot N, Nys Y. 2019. The Golden Egg: Nutritional value, bioactivities, and emerging benefits for human health. Nutrients. 11: 1-26 (www.mdpi.com/journal/nutrient) Sartika RAD. 2008. Pengaruh asam lemak jenuh, tidak jenuh dan asam lemak trans terhadap kesehatan. Jurnal Kesehatan Masyarakat. 2(4): 154-160 Siregar HA, Rahmadi HY, Wening S, Suprianto E. 2018. Komposisi asam lemak dan karoten kelapa sawit Elaeis oleifera, interspesifik hibrida, dan Pseudo-backcross pertama di Sumatera Utara, Indonesia. Jurnal Penelitian Kelapa Sawit. 26 (2): 91-101 Suci DM, Fitria Z, Mutia R. 2017. Meat fatty acid and cholesterol content of native Indonesian Muscovy Duck Fed with rice bran in tradisional farm. Animal Production. 19 (1):37-45 Sutama, INS. 2008. Daun pepaya dalam ransum menurunkan kolesterol pada serum dan telur ayam. Jurnal Veteriner. 9: 152-156. Wiradimadja R, Burhanuddin H, & Saefulhadjar D. 2010. Peningkatan kadar vitamin A pada telur ayam melalui penggunaan daun katuk (Sauropus androgynus L. Merr) dalam Ransum. Jurnal Ilmu Ternak. 10 (2): 90-94

The aim of this research was to measure the effect of yellow corn substitution with banana peel meal as a beta-carotene and antioxidant source in the chicken diet on cholesterol, vitamin A and fatty acid profiles of egg yolk Arab chicken. The experimental design used was a completely randomized design. Data were analyzed by Analysis of Variance (ANOVA) and significant differences between the treatments were analyzed by Duncan's Multiple Range Test. Eighty pullet of Arabic chickens (19 weeks old) were randomly assigned to four treatment diets with four replications for 6 weeks of fed trials. Dietary treatments consisted of R0 (0%) banana peel meal (TP) : 50% yellow corn (JK) and 3 levels of yellow corn and banana peel. The composition of yellow corn and banana peel meal used R1 (20 % TP ; 30% JK), R2 (30% TP : 20% JG) and R3 (40% TP :10% JG). The variables observed were production performance, cholesterol, vitamin A and fatty acid profile of the egg yolk. The results showed that egg yolk cholesterol levels were not significantly different compared to the control. Substitution of yellow corn with banana peel meal had increased vitamin A level up to 49% compared to the control. There was no difference in fatty acid profiles in all treatments observed. It is concluded that banana peel meal can be used to substitute 40 % of yellow corn in the chicken diet and tend to increased vitamin A of egg yolk. Key words: Arabic chicken, banana peel meal, cholesterol, fatty acid, yolk DAFTAR PUSTAKA Abel FAS, Adeyemi OA, Oluwole OB, Oladunmoye OO, Ayo-Ajasa OY, Anuoluwatelemi JO. 2015. Effect of treated banana peel meal on the feed efficiency, digestibility and cost effectiveness of broiler chicken diet. Journal of Veterinery Science & Animal Husbandry. 3 (1): 1-6 Abou-Arab AA, Abu-Salem FM. 2017. Nutritional and anti-Nutritional composition of banana peels as influenced by microwave drying methods. International Scholarly and Scientific Research & Innovation. 11(12): 845-852 Amrullah, IK. 2004. Nutrisi Ayam Petelur. Cetakan ke-3. Bogor (ID): Lembaga Satu Gunungbudi. Anhwange BA, Ugye TJ, Nyiaatagher TD. 2009. Chemical composition of Musa sapientum (Banana) peels. Electronic Journal of Environment, Agricultural and Food Chemistry. 8 (6):437-442 Antruejo A, Azcona JO, Garcia PT, Gallinger C, Rosmini M, Ayerza R, Coates W, Perez CD. 2011. Omega-3 enriched egg production: The effect of α-linolenic ῳ-3 fatty acid sources on laying hen performance and yolk lipid content and fatty acid composition. British Poultry Science. 52(6): 750-760 Aryani T, Mu’awanah IAU, Wydiantara AB. 2018. Karakteristik fisik, kandungan gizi tepung kulit pisang dan perbandingannya terhadap syarat mutu tepung terigu. Jurnal Riset Sains dan Teknologi. 2(2): 45-50 Arora A, Choudhary D, Agarwal G, Singh VP. 2008. Composition variation in β-carotene content, carbohydrate and antioxidant enzymes in selected banana cultivar. International journal of Food Science and Technology. 43: 1913-1921 Blandon JC, Hamady GAA, Abdel-Moneim A. 2015. The effect of partial replacement of yellow corn by banana peels with and without enzymes on broiler’s performance and blood parameters. Journal of Animal and Poultry Science. 4(1): 10-19 Diana, FM. 2013. Omega 6. Jurnal Kesehatan Masyarakat. 7(1): 26-31 Diarra SS. 2018. Peel meals as a feed ingredient in poultry diets. Chemical composition, dietary recommendation and prospect. Journal of Animal Physiology and Animal Nutrition. 102: 1284-1295 Chueh CC, Lin LJ, Lin WC, Huang SH, Jan MS, Chang SC, Chung WS, Lee TT. 2019. Antioxidant capacity of banana peels and its modulation of Nrf2-ARE associated gene expression in broiler chickens. Italian Journal of Animal Science. 18 (1): 1394-1403 Haryanto, A, Miharja K, Wijayani N. 2016. Effect of banana meal on the feed conversion ratio and blood lipid profile of broiler chickens. International Journal of Poultry Science. 15 (1) : 27-34 Has, H, Napirah A, Dewi L. 2017. Efektivitas substitusi kulit pisang dengan dedak padi dalam ransum ayam kampung. Makasar (ID): Seminar Nasional Peternakan. Universitas Hasanudin. Indra GK, Achmanu, Nurgiatiningsih A. 2013. Performans produksi ayam Arab (Gallus turcicus) berdasarkan warna bulu. Jurnal Ternak Tropika. 14 (1): 8-14 Konieczka M, Czauderna S, Smulikowsk S. 2017. The enrichment of chicken meat with omega-3 fatty acid by dietary fish oil or its mixture with rapeseed or flaxseed-effect of feeding duration dietary fish oil, flaxseed, and repeseed and n-3 enriched broiler meat. Animal Feed Science and Technology. 223 : 42-52 McDowell, L.R. 2000. Vitamine in Animal and Human Nutrition. 2nd Edition. Iowa (US): State University Press, Iowa. Mulyadi Y. 2013. Penggunaan pakan fungsional terhadap performan produksi dan kualitas telur ayam arab. Jurnal Ilmu Ternak. 13 (2): 27-33 [NRC] National Research Council. 1994. Nutrient Requirements of Poultry. 9th Revised Edition. Washington. D. C. (US) : National Academy Press, Nuraini, Sabrina, Latif SA. 2008. Performa ayam dan kualitas telur yang menggunakan ransum mengandung onggok fermentasi dengan Neurospora crassa. Media Peternakan. 31:195-202. Pereira A, Maraschin M. 2015. Banana (Musa spp) from peel to pulp: ethnopharmacology, source of bioactive compounds and its relevance for human health. Jurnal Ethnopharmacology. 160:149–163 Piliang WG, Djojosoebagio S. 2006. Fisiologi Nutrisi. Volume I. Edisi ke-2. Bogor (ID): IPB Press Rehaul-Godbert, S, Guyot N, Nys Y. 2019. The Golden Egg: Nutritional value, bioactivities, and emerging benefits for human health. Nutrients. 11: 1-26 (www.mdpi.com/journal/nutrient) Sartika RAD. 2008. Pengaruh asam lemak jenuh, tidak jenuh dan asam lemak trans terhadap kesehatan. Jurnal Kesehatan Masyarakat. 2(4): 154-160 Siregar HA, Rahmadi HY, Wening S, Suprianto E. 2018. Komposisi asam lemak dan karoten kelapa sawit Elaeis oleifera, interspesifik hibrida, dan Pseudo-backcross pertama di Sumatera Utara, Indonesia. Jurnal Penelitian Kelapa Sawit. 26 (2): 91-101 Suci DM, Fitria Z, Mutia R. 2017. Meat fatty acid and cholesterol content of native Indonesian Muscovy Duck Fed with rice bran in tradisional farm. Animal Production. 19 (1):37-45 Sutama, INS. 2008. Daun pepaya dalam ransum menurunkan kolesterol pada serum dan telur ayam. Jurnal Veteriner. 9: 152-156. Wiradimadja R, Burhanuddin H, & Saefulhadjar D. 2010. Peningkatan kadar vitamin A pada telur ayam melalui penggunaan daun katuk (Sauropus androgynus L. Merr) dalam Ransum. Jurnal Ilmu Ternak. 10 (2): 90-94

The experiment was conducted in the Agronomy Field, Sher-e-Bangla Agricultural University (SAU), Dhaka-1207 during the period of November 17, 2016 to March 29, 2017 on growth and yield performance of selected wheat genotypes at variable irrigation. In this experiment, the treatment consisted of three varieties viz. V1 = BARI Gom 26, V2 = BARI Gom 28, V3 = BARI Gom 30, and four different irrigations viz. I0 = No Irrigation throughout the growing season, I1 = One irrigation (Irrigate at CRI stage), I2= Two irrigation (Irrigate at CRI and grain filling), I3= Three irrigation (irrigate at CRI, booting and grain filling stages). The experiment was laid out in two factors split plot with three replications. The collected data were statistically analyzed for evaluation of the treatment effect. Results showed that a significant variation among the treatments in respect majority of the observed parameters. Results showed significant variation in almost every parameter of treatments. The highest Plant height, number of effective tillers hill-1, spike length, number of grain spike-1 was obtained from BARI Gom-30. The highest grain weight hectare-1 (3.44 ton) was found from wheat variety BARI Gom-30. All parameters of wheat showed statistically significant variation due to variation of irrigation. The maximum value of growth, yield contributing characters, seed yield was observed with three irrigation (irrigate at CRI, booting and grain filling stages). The interaction between different levels of variety and irrigation was significantly influenced on almost all growth and yield contributing characters, seed yield. The highest yield (3.99 t ha-1) was obtained from BARI Gom-30 with three irrigation (irrigate at CRI, booting and grain filling stages). The optimum growth and higher yield of wheat cv. BARI Gom-30 could be obtained by applying three irrigations at CRI, booting and grain filling stages. Introduction Wheat (Triticumaestivum L.) is one of the most important cereal crops cultivated all over the world. Wheat production was increased from 585,691 thousand tons in 2000 to 713,183 thousand tons in 2013 which was ranked below rice and maize in case of production (FAO, 2015). In the developing world, need for wheat will be increased 60 % by 2050 (Rosegrant and Agcaoili, 2010). The International Food Policy Research Institute projections revealed that world demand for wheat will increase from 552 million tons in 1993 to 775 million tons by 2020 (Rosegrantet al.,1997). Wheat grain is the main staple food for about two third of the total population of the world. (Hanson et al., 1982). It supplies more nutrients compared with other food crops. Wheat grain is rich in food value containing 12% protein, 1.72% fat, 69.60% carbohydrate and 27.20% minerals (BARI, 2006). It is the second most important cereal crop after rice in Bangladesh. So, it is imperative to increase the production of wheat to meet the food requirement of vast population of Bangladesh that will secure food security. During 2013-14 the cultivated area of wheat was 429607 ha having a total production of 1302998 metric tons with an average yield of 3.033 metric tons ha-1whereas during 2012-13 the cultivated area of wheat was 416522 ha having a total production of 1254778 metric tons with an average yield of 3.013 tons ha-1 (BBS, 2014). Current demand of wheat in the country is 3.0-3.5 million tons. Increasing rate of consumption of wheat is 3% per year (BBS, 2013). Wheat production is about 1.0 milllion from 0.40 million hectares of land. Bangladesh has to import about 2.0-2.5-million-ton wheat every year. Wheat is grown all over Bangladesh but wheat grows more in Dhaka, Faridpur, Mymensingh, Rangpur, Dinajpur, Comilla districts. Wheat has the umpteen potentialities in yield among other crops grown in Bangladesh. However, yield per hectare of wheat in Bangladesh is lower than other wheat growing countries in the world due to various problems. Increasing food production of the country in the next 20 years to much population growth is a big challenge in Bangladesh. It is more difficult because, land area devoted to agriculture will decline and better-quality land and water resources will be divided to the other sector of national economy. In order to grow more food from marginal and good quality lands, the quality of natural resources like seed, water, varieties and fuel must be improved and sustained. Variety plays an important role in producing high yield of wheat because different varieties responded differently for their genotypic characters, input requirement, growth process and the prevailing environment during growing season. In Bangladesh the wheat growing season (November-March) is in the driest period of the year. Wheat yield was declined by 50% owing to soil moisture stress. Irrigation water should be applied in different critical stages of wheat for successful wheat production. Shoot dry weight, number of grains, grain yield, biological yield and harvest index decreased to a greater extent when water stress was imposed at the anthesis stage while water stress was imposed at booting stage caused a greater reduction in plant height and number of tillers (Gupta et al., 2001). Determination of accurate amount of water reduces irrigation cost as well as checks ground water waste. Water requirements vary depending on the stages of development. The pick requirement is at crown root initiation stage (CRI). In wheat, irrigation has been recommended at CRI, flowering and grain filling stages. However, the amount of irrigation water is shrinking day by day in Bangladesh which may be attributed to filling of pond river bottom. Moreover, global climate change scenarios are also responsible for their scarcity of irrigation water. So, it is essential to estimate water saving technique to have an economic estimate of irrigation water. Information on the amount of irrigation water as well as the precise sowing time of wheat with change in climate to expedite wheat production within the farmer’s limited resources is inadequate in Bangladesh. The need of water requirement also varies with sowing times as the soil moisture depletes with the days after sowing in Bangladesh as there is scanty rainfall after sowing season of wheat in general in the month of November. With above considerations, the present research work was conducted with the following objectives: To evaluate yield performance of selected wheat genotypes(s) at variable irrigation management. To identify the suitable genotype (s) of wheat giving higher yield under moisture stress condition. Materials and Methods Description of the experimental site The experiment was conducted in the Research Field, Sher-e-Bangla Agricultural University (SAU), Dhaka-1207 during the period of November, 2016 to March, 2017 to observe the growth and yield performance of selected wheat genotypes at variable irrigation management. The experimental field is located at 23041´ N latitude and 90º 22´ E longitude at a height of 8.6 m above the sea level belonging to the Agro-ecological Zone “AEZ-28” of Madhupur Tract (BBS, 2013). Soil characteristics The soil of the research field is slightly acidic in reaction with low organic matter content. The selected plot was above flood level and sufficient sunshine was available having available irrigation and drainage system during the experimental period. Soil samples from 0-15 cm depths were collected from experimental field. The experimental plot was also high land, having pH 5.56. Climate condition The experimental field was situated under sub-tropical climate; usually the rainfall is heavy during Kharifseason, (April to September) and scanty in Rabi season (October to March). In Rabi season temperature is generally low and there is plenty of sunshine. The temperature tends to increase from February as the season proceeds towards kharif. Rainfall was almost nil during the period from November 2016 to March 2017 and scanty from February to September. Planting material The test crop was wheat (Triticumaestivum). Three wheat varieties BARI Gom-26, BARI Gom-28 and BARI Gom-30 were used as test crop and were collected from Bangladesh Agricultural Research Institute (BARI), Joydebpur, Gazipur. Treatments The experiment consisted of two factors and those were the wheat genotypes and irrigation. Three wheat genotypes and four irrigations were used under the present study. Factor A: three wheat varieties- V1 = BARI Gom-26, V2 = BARI Gom-28 and V3= BARI Gom-30. Factor B: four irrigations- I0 = No Irrigation throughout the growing season, I1 = One irrigation (Irrigate at CRI stage), I2= Two irrigation (Irrigate at CRI and grain filling) and I3= Three irrigation (Irrigate at CRI, booting and grain filling stages). The experiment was laid out in a split plot design with three replications having irrigation application in the main plots, verities in the sub plots. There were 12 treatments combinations. The total numbers of unit plots were 36. The size of unit plot was 2 m x 2 m = 4.00 m2. The distances between sub-plot to sub-plot, main plot to main plot and replication to replication were, 0.75, 0.75 and 1.5 m, respectively. Statistical analysis The collected data on each plot were statistically analyzed to obtain the level of significance using the computer-based software MSTAT-C developed by Gomez and Gomez, 1984. Mean difference among the treatments were tested with the least significant difference (LSD) test at 5 % level of significance. Results and Discussion Plant height Plant height varied significantly among the tested three varieties (Table 1). At, 75 DAS, BARI Gom 30 showed the tallest plant height (34.72 cm) and BARI Gom 26 recorded the shortest plant height (32.32 cm). At, 90 DAS, BARI Gom 30 recorded the highest plant height (76.13 cm) was observed from BARI Gom 26. However, BARI Gom 26 recorded the shortest plant height (75.01 cm) which was also statistically similar with BARI Gom 28. Islam and Jahiruddin (2008) also concluded that plant height varied significantly due to various wheat varieties. Plant height of wheat showed statistically significant variation due to amount of irrigation at 75, 90 DAS under the present trial (Table 2). At 75 DAS, the tallest plant (34.78 cm) was recorded from I3 (Three irrigation) while the shortest plant (32.02 cm) was observed from I0 (No Irrigation throughout the growing season) treatment. At 60 DAS, the tallest plant (77.51 cm) was found from I3, which was statistically similar with I2 (Two irrigation) and I1 (One irrigation). The shortest plant (71.29 cm) was observed from I0. Plant height was likely increased due to applying higher amount of irrigation compared to less amount of irrigation. Sultana (2013) stated that increasing water stress declined the plant height. Interaction effect of variety and different amount of irrigation showed significant differences on plant height of wheat at 75 and 90 DAS (Table 3). The highest plant height at 30 was 38.00 cm obtained from V3I3 treatment combination. The shortest plant height at 30 was 30.67 cm obtained from V1I0 treatment combination. At 60 DAS, plant height was 78.50 cm obtained from V3I3 and lowest was 69.83 cm obtained from V1I0 treatment combination, which was statistically similar with V2I0 and 3I0 treatment combination. Table 1. Effect of variety on plant height of wheat at different days after sowing Table 2. Effect of irrigation on plant height of wheat at different days after sowing Table 3. Interaction effect of variety and irrigation on plant height of wheat Number of effective tiller hill-1 Number of effective tillers hill-1of wheat was not varied significantly due to varieties (Table 4). BARI Gom 30 produced the highest number of effective tillers hill-1 (9.33) and the lowest number of effective tillers hill-1(8.58) was observed in BARI Gom 26. Different levels of irrigation varied significantly in terms of number of effective tillers hill-1 of wheat at harvest under the present trial (Table 5). The highest number of effective tillers hill-1 9.89 was recorded from I3 treatment, while the corresponding lowest number of effective tillers hill-1 were 7.89 observed in I0 treatment. Sultana (2013) stated that increasing water stress reduced the number of tillers per hill. Variety and irrigation showed significant differences on number of effective tillers hill-1 of wheat due to interaction effect (Table 6). The highest number of effective tillers hill-1 10.33 were observed from V3I3 treatment combination, while the corresponding lowest number of effective tillers hill-1 as 7.33 were recorded from V1I0 treatment combination. Number of non-effective tiller hill-1 Number of non-effective tillers hill-1of wheat was not varied significantly due to varieties (Table 4). BARI Gom 26 produced the highest number of non-effective tillers hill-1 (1.33) and the lowest number of non-effective tillers hill-1(1.00) was observed in BARI Gom 30. Different levels of irrigation varied significantly in terms of number of non-effective tillers hill-1 of wheat at harvest under the present trial (Table 5). The highest number of non-effective tillers hill-1 (2.00) was recorded from I0, while the corresponding lowest number of non-effective tillers hill-1 (0.67) was observed in I3. Variety and irrigation showed significant differences on number of non-effective tillers hill-1 of wheat due to interaction effect (Table 6). The highest number of non-effective tillers hill-1 (2.33) were observed from V1I0 treatment combination, while the corresponding lowest number of non-effective tillers hill-1 (0.33) were recorded from V3I2 treatment combination. Table 4. Effect of variety on yield and yield contributing characters of wheat Table 5. Effect of irrigation on yield and yield contributing characters of wheat Table 6. Interaction effect of variety and irrigation on yield and yield contributing characters of wheat Spike length (cm) Insignificant variation was observed on spike length (cm) at applied three types of modern wheat variety as BARI Gom-26 (V1), BARI Gom-28 (V2), and BARI Gom-30 (V3). From the experiment with that three types of varieties BARI Gom-30 (V3) (8.46 cm) given the largest spike length and BARI Gom-26 (V1) (8.08 cm) was given the lowest spike length (Table 4). Similar result was found using with different type varieties by Hefniet al. (2000). Different irrigation application has a statistically significant variation on spike length as irrigated condition (I3) was given the maximum result (9.17 cm) and non-irrigated condition (I0) given the lowest spike length (7.17 cm) (Table 5). Interaction effect of improved wheat variety and irrigation showed significant differences on spike length. Results showed that the highest spike length was obtained from V3I3 (10.33 cm). On the other hand, the lowest spike length was observed at V1I0 (6.50cm) treatment combination (Table 6). Grain spike-1 Significant variation was observed on grain spike-1 at these applied three types of modern wheat variety. The BARI Gom-30 (V3) (37.75) given the maximum number of grain spike-1 and BARI Gom-26 (V1) (36.92) was given the lowest number of grain spike-1, which was statistically similar with V2 treatment (Table 4). Different wheat genotypes have significant effect on grain spike-1 observed also by Rahman et al. (2009). Different irrigation application has a statistically significant variation on grain spike-1 as the irrigation condition (I3) was given the maximum result (39.33), which was statistically similar with I2 and non-irrigated condition (I0) given the lowest grain spike-1 (34.56) (Table 5). Sarkar et al. (2010) also observed that irrigation have a significant effect on grain spike-1. Interaction effect of improved wheat variety and irrigation showed significant differences on grain spike-1. Results showed that the highest grain spike-1 was obtained from V3I3 (41.0). On the other hand, the lowest grain spike-1 was observed at V1Io (34.00) which were also statistically similar with V3Io (34.67) (Table 6). 3Thousand Seed weight There was significant variation was observed on thousand seed weight due to different types of modern wheat variety. The wheat variety of BARI Gom-30 (V3) (50.40 g) given the maximum thousand seed weight and statistically different from BARI Gom-28 (V2) (46.74 g). BARI Gom-26 (V1) (46.22 g) was given the lowest thousand seed weight (Table 7). Rahman et al. (2009), Islam et al. (2015) also conducted experiment with different variety and observed have effect of varieties on yield. Different irrigation application has a statistically significant variation on thousand seed weight. The I3 was given the maximum thousand seed weight (48.91) and non-irrigated condition (I0) given the lowest yield (46.13 g) (Table 8). Sarkar et al. (2010), Baser et al. (2004) reported that grain yield under non-irrigated conditions was reduced by approximately 40%. Bazzaet al. (1999) reported that one water application during the tillering stage allowed the yield to be lower only than that of the treatment with three irrigations but Meenaet al. (1998) reported that wheat grain yield was the highest with 2 irrigations (2.57 ton/ha in 1993 and 2.64 ton/ha) at flowering and/or crown root initiation stages. Wheat is sown in November to ensure optimal crop growth and avoid high temperature and after that if wheat is sown in the field it faces high range of temperature for its growth and development as well as yield potential. Islam et al. (2015) reported that late planted wheat plants faced a period of high temperature stress during reproductive stages causing reduced kernel number spike-1 as well as the reduction of grain yield. Interaction effect of improved wheat variety and irrigation showed significant differences on thousand seed weight (Table 9). Results showed that the highest thousand seed weight (52.33 g) was obtained from V3I3 which was statistically similar with V3I2 (52.06 g). On the other hand, the lowest yield (45.36 g) was observed at V1I1. Table 7. Effect of variety on yield and yield of wheat Table 8. Effect of irrigation on yield and yield of wheat Table 9. Interaction effect of variety and irrigation on yield and yield of wheat Grain yield (t ha-1) Different wheat varieties showed significant difference for grain weight hectare-1 (Table 7). The highest grain yield hectare-1 (3.44 ton) was found from wheat variety BARI Gom-30 (V3), which was statistically similar with V2, whereas the lowest (3.21 ton) was observed from wheat variety BARI gom 26. Rahman et al. (2009), Islam et al. (2015) also conducted experiment with different variety and observed have effect of varieties on yield. Significant difference was observed for yield for different irrigation application. The three irrigation (I3) was given the maximum yield (3.74 t ha-1), which was statistically similar with I2 treatment and non-irrigated condition (I0) given the lowest yield (2.97 t ha-1) (Table 8). Sarkar et al. (2010), Baser et al. (2004) reported that grain yield under non-irrigated conditions was reduced by approximately 40%. Bazzaet al. (1999) reported that one water application during the tillering stage allowed the yield to be lower only than that of the treatment with three irrigations but Meenaet al. (1998) reported that wheat grain yield was the highest with 2 irrigations (2.57 ton/ha in 1993 and 2.64 ton/ha) at flowering and/or crown root initiation stages. Wheat is sown in November to ensure optimal crop growth and avoid high temperature and after that if wheat is sown in the field it faces high range of temperature for its growth and development as well as yield potential. Islam et al. (2015) reported that late planted wheat plants faced a period of high temperature stress during reproductive stages causing reduced kernel number spike-1 as well as the reduction of grain yield. Interaction effect of improved wheat variety and irrigation showed significant differences on yield (t ha-1). Results showed that the highest yield (3.99 t ha-1) was obtained from V3I3, which was statistically similar with V2I3 and V3I2. On the other hand, the lowest yield (2.93 t ha-1) was observed at V1I0 (Table 7). Straw yield (t ha-1) Applied three types of wheat variety have a statistically significant variation on straw yield (t ha-1). The maximum straw yield (1.95 t ha-1) was obtained from BARI Gom-30 and BARI Gom-26 (V1) was given the lowest straw yield (1.87 t ha-1), which was statistically similar with V2 treatment. Different irrigation application has a statistically significant variation on straw yield (t ha-1) of wheat. The I3 treatment for straw yield (2.01 t ha-1) was given the maximum result and non-irrigated condition (I0) given the lowest (1.80 t ha-1). Similar results were found by Ali and Amin (2004) through his experiment. Interaction effect of improved wheat variety and irrigation showed significant differences on straw yield (t ha-1). The highest straw yield (2.08 t ha-1) was obtained from V3I3 which was statistically similar with V3I2 (2.07 t ha-1) treatment combination. On the other hand, the lowest straw yield (1.78 t ha-1) was observed at V1Io, which was statistically similar with V2I0 (2.07 t ha-1) treatment combination. Biological yield Significant variation was attained for biological yield for different wheat varieties. The variety BARI Gom-30 given the maximum biological yield (5.39 t ha-1) and BARI Gom-26 (V1) was given the lowest biological yield (5.078 t ha-1). Different irrigation application has a statistically significant variation biological yield (t ha-1) of wheat. The I3 treatment for biological yield (5.76 t ha-1) was given the maximum result and non-irrigated condition (I0) given the lowest (4.77 t ha-1). Similar results were found by Ali and Amin (2004) through his experiment. At the time of biological yield (t ha-1) consideration with variety and irrigation statistically significance variation was observed as maximum biological yield (t ha-1) at V3I3 (6.07 t ha-1). On the other hand, the lowest result was given at V1Io (4.72 tha-1). Summary And Conclusion It may be concluded within the scope and limitation of the present study that the optimum growth and higher yield of wheat cv. BARI Gom-30 could be obtained by applying three irrigations at irrigate at CRI, booting and grain filling stages. However, further studies are necessary to arrive at a definite conclusion. References Ali, M. N.; and Amin, M.S. Effect of single irrigation and sowing date on growth and yield of wheat. M. S. thesis, SAU, Dhaka, Bangladesh. 2004. (Bangladesh Agricultural Research Institute). Hand book of Agricultural Technology. Joydebpur, Gazipur. 2006, 9. Baser, I.; Sehirali, S.; Orta, H.; Erdem, T.; Erdem, Y.; Yorganclar, O. Effect of different water stresses on the yield and yield components of winter wheat. Cereal Res. Comn. 2004, 32(2), 217-223. Bazza, S. S.; Awasthi, M. K.; Nema, R. K. Studies on Water Productivity and Yields Responses of Wheat Based on Drip Irrigation Systems in Clay Loam Soil. Indian J. Sci. Tech. 1999, 8(7), 650-654. Bangladesh Bureau of Statistics, Ministry of Planning, Government of the Peoples Republic of Bangladesh, Dhaka. 2013. Bangladesh Bureau of Statistics, Ministry of Planning, Government of the Peoples Republic of Bangladesh, Dhaka. 2014. K. A.; Gomez, A. A. Statistical Procedures for Agricultural Research. 2nd edition. John Willy and Sons, New York. 1984, 28-192. Gupta, P. K.; Gautam, R. C.; Ramesh, C. R. Effect of water stress on different stages of wheat cultivation. Plant Nutri. and Fert. Sci. 2001, 7(2), 33-37. Hanson, M.; Farooq, M.; Shabir, G.; Khan, M. B.; Zia, A. B.; Lee, D. G. Effect of date sowing and rate of fertilizers on the yield of wheat under irrigated condition. J. Agril. & Biol. 1982, 14(4), 25-31. Hefni, S.; Sajjad, A.; Hussain M. I.; Saleem, M. Growth and yield response of three wheat varieties to different seeding densities. J. Agric. Biol. 2000, 3(2), 228-229. Islam, S.; Islam, S.; Uddin, M. J.; Mehraj, H.; Jamal Uddin, A. F. M. Growth and yield response of wheat to irrigation at different growing stages. J. Agron. Agril. Res. 2015, 6(1), 70-76. Meena, B. N.; Tunio, S. D.; Shah, S. Q. A.; Sial, M. A.; Abro, S. A. Studies on grain and grain yield associated traits of bread wheat (Triticum aestivum L.) varieties under water stress conditions. Pakistan J. Agril. Engin. Vet. Sci. 1998, 24(2), 5-9. Rahman, M. ; Hossain, A.; Hakim, M. A.; Kabir, M. R; Shah, M. M. R. Performance of wheat genotypes under optimum and late sowing condition. Int. J. Sustain Crop Prod. 2009, 4(6), 34-39. Rosegrant, M. W.; Agcaoili, M. Global food demand, supply, and price prospects to 2010. Washington, DC: Int. Food Policy Res. Inst. 2010. Rosegrant, M. W.; Sombilla, M. A.; Gerpacio R. V.; Ringler, C. Global food markets and US exports in the twenty-first century. Paper prepared for the Illinois World Food and Sustainable Agriculture Program Conference ‘Meeting the Demand for Food in the 21st Century: Challenges and Opportunities for Illinois Agriculture’, 1997. Sarker, S.; Singh, S. K.; Singh, S. R.; Singh, A. P. Influence of initial profile water status and nitrogen doses on yield and evapotranspiration rate of dryland barley. Indian Soc. Soil Sci. 2010, 47(1), 22-28. Sultana, F. Effect of irrigation on yield and water use of wheat. M.S. Thesis, Dept. of Irrigation and Water Management. Bangladesh Agril. Univ., Mymensingh. 2013.

La economía ecuatoriana a lo largo de los años ha atravesado un escenario negativo de eventos y acontecimientos que han originado el ascenso del riesgo-país. El objetivo de esta investigación es demostrar el impacto que genera el índice riesgo país en los flujos de inversión directa de la balanza de pagos del Ecuador. El diseño metodológico evidenció un enfoque cuantitativo-predictivo de alcance correlacional, puesto que, se analizó una base de datos con información recabada del Banco Central del Ecuador mediante el software estadístico R-Studio. Se evidenciaron resultados que indican la reducción de inversión extranjera frente a eventuales incrementos en los puntos básicos del índice riesgo-país. En conclusión, la inversión extranjera directa se muestra con una alta sensibilidad ante los eventuales sucesos políticos, macroeconómicos y de inestabilidad social que provoca la alta calificación en los puntos básicos del indicador. Palabras Clave: inversión extranjera, riesgo-país, balanza de pagos. Referencias [1]Banco Central del Ecuador, «Notas metodológicas de la balanza de pagos del Ecuador,» BCE, Quito, 2018. [2]J. Armijos, «Efecto de la inversión extranjera directa en el crecimiento económico en Ecuador,» Revista Económica, vol. 2, nº 1, pp. 31-38, 2017. [3]J. López y J. Laverde, «Inversión Extranjera Directa y carga tributaria en Ecuador, periodo 2004-2016,» Valor Agregado, vol. 5, nº 7, pp. 50-53, 2017. [4]G. Rodriguez y D. Forero, «Factores determinantes de la inversión extranjera directa,,» Universidad Tecnológica de Bolivar, vol. 2, pp. 119-134, 2016. [5]S. Cárdenas y J. Behr, «La inversión extranjera y el riesgo país en el Ecuador, Periodo 2007-2013,» Revista Observatorio de la Economía Latinoamericana,Ecuador, 2016. [6]Banco Central del Ecuador, «Análisis trimestral de labalanza de pagos,» BCE, Quito, 2019. [7]D. Rosillo, Análisis de la inversión extranjera directa en el ecuador, la afectación del índice riesgo país en la captación de inversiones y su incidencia en la economía de las empresas en el período 2007-2010, Quito, 2011. [8]A. Espín y A. Villalva, Análisis de la inversión extranjera directa y sus determinantes en el Ecuador, período 2007-2015, Quito, 2017. [9]O. Cedeño y Á. Mendoza, «Impacto del índice riesgo país en la inversión extranjera directa de Ecuador periodo 2016-2018,» Polo de Conocimiento, vol. 5, nº 03, pp. 619-639, 2020. [10]J. Mogrovejo, «Factores determinantes de la inversión extranjera directa en algunos países de Latinoamérica, » Latinoamericana de Desarrollo Económico, vol. 5, pp. 51-82, 2005. [11]C. Silvia, Impacto del riesgo país en la inversión extranjera directa en el Ecuador en el período 2005-2015, Cuenca, 2018. [12]Organización de las Naciones Unidas ONU, «Análisis de las políticas de inversión Ecuador,» de Conferencia de las Naciones Unidas Sobre Comercio y Desarrollo, Nueva York y Ginebra, 2012. [13]J. Espín, A. Córdova, y G. López r,» Retos- Revista de Ciencias de la Administración y Economia, vol. 6, nº 12, p. 215, 2016. [14]J. Soliz, La inversión extranjera directa en el Ecuador y su incidencia en la economía, periodo 2008–2013, Quito, 2015. [15]E. Zurita, G. González, y E. Borja «Análisis de la dolarización y sus efectos sobre la inversión extranjera directa en Ecuador. Periodo 2000 - 2016,» Bolentín de Coyuntura, vol. 1, p. 4, 2017. [16]OXFAM, «Ecuador 2016 Respuesta al terremoto,» Ecuador, 2017. [17]A. Acosta, El otro riesgo país, Quito-Ecuador: Ediciones Abya-Yala, 2005. [18]L. Domenech y J. Diaz, Análisis de la evolución del riesgo país en la inversión extranjera directa ecuatoriana.período 2003 -2007, Guayaquil, 2008. [19]J. Erazo y K. Lindao Riesgo Pais Ecuador: “Principales determinantes y su incidencia”, Guayaquil, 2004, pp. 1–77, 2004. [20]C. Larrea, «Crisis, dolarización y pobreza en Ecuador, » Retos para la integración social de los pobres en América Latina, vol. 1, pp. 217-227, 2005. [21]E. G. Montenegro Cueva, «Análisis de riesgo de las acciones de las empresas más representativas que estructuran el mercado de valores del Ecuador,» Quito, 2014. [22]J. M. Wooldridge, Introducción a la econometría. Un enfoque moderno, Michigan : South-Western, 2010. [23]Banco Central del Ecuador, «Información estadística monetarias y financieras mensuales,» 31 03 2020. [En línea]. Disponible en: https://contenido.bce.fin.ec/home1/estadisticas/bolmensual/IEMensual.jsp.. [Último acceso: 15 07 2020]. [24]J. Galán, «Equilibrios y conjeturas,» Cuadernos del Seminario de Credibilidad Macroeconómica, vol. 1, p.1, 2014. [25]J. S. Santana, «El arte de programar en R,» Instituto Mexicano de Tecnologia del Agua, vol. 1, 2014. [26]L. Mahadeva, «Prueba de raíz unitaria para ayudar a la construcción de un modelo,» Centro de Estudios Monetarios Latinoamericanos, vol. 1, p. 54, 2009. [27]H. Catalán, «Econometría y análisis de políticas fiscales, » University of Minnesota, vol. 48. [28]A. Novales, «Modelos vectoriales autoregresivos,» Universidad Complutense, vol. 1, 2017. [29]T. Calagua, «La Metodología del Vector Autorregresivo: Presentación y Algunas Aplicaciones,» Ciencias Empresariales, vol. 2, pp. 103-108, 2010.

La industria textil en el Ecuador ha sido un sector de gran aporte económico a la industria nacional. El objetivo de la investigación es analizar los costos de importación de productos textiles y su incidencia en la utilidad empresarial. La metodología se basó en un estudio de caso con un enfoque cuantitativo y un alcance de investigación correlacional, como información primaria se tomó los balances generales y de resultado de la de la empresa Texpadilla Cia. Ltda. Los resultados revelan que existe una relación directa entre los incoterms, seguro y valor total de los productos; de forma que, el CIF (seguro y flete) o FOB (Libre a Bordo) mantienen un coeficiente de regresión de R2= 0,9618 y una significancia ANOVA menor a cero. Se concluye que, los costos de importación de bienes textiles si inciden en la utilidad empresarial, pues, las variables poseen un alto grado de explicación. Palabras Clave: costos de importación, industria textil, utilidad empresarial. Referencias [1]S. Amaluisa, «Bajo nivel de crecimiento de la industria textil ecuatoriana,» Boletín de Coyuntura, Ambato, 2019. [2]B. Pinta, Estructura productiva del sector manufacturero ecuatoriano, un análisis territorial en el período 2000-2012, quito: facultad latinoamericana de ciencias sociales, 2017. [3]J.Basantes, E. González y M. Bonilla, Caracterización de las peqeñas y medianas empresa en el sector de la economía ecuatoriana, Chimborazo: Universidad de Oriente, 2015. [4]D.Rodriguez, «Importación costos y valores.,» 11 6 2020. [En línea]. Disponible: https://www.e-comex.com/costos-de-una-importacion/. [5]Primicias, «Producción de textiles está estancada,» 2010. [6]CFN, «ficha sectorial hiladura, tejedura y acabados de productos textiles,» 02 2018. [En línea]. Disponible: https://www.cfn.fin.ec/wp-content/uploads/2018/04/Ficha-Sectorial-Hiladura-Tejedura-y-Acabados-de-Productos-Textiles.pdf. [7]C. Robles, Costos históricos, Estado de México: Red Tercer Milenio S.C, 2020. [8]J. Gavelán, Costos de importación, Mexico: researchgate, 2015. [9]J. Carrión, Naturaleza del costo de importación, Quito: Todo Comercio Exterior, 2019. [10]A. Romero, «Agencia de Aduanas - Alberto Romero Sánchez y Cia. Ltda.,» 21 06 2020. [En línea]. Disponible: https://www.agenciaromero.cl/es/noticias/detalle/identifique-los-valores-cif-y-fob-en-transacciones-comerciales-12. [11]A. Romero, «Agencia de Aduanas,» 31 08 20. [En línea]. Disponible: https://www.agenciaromero.cl/es/noticias/detalle/identifique-los-valores-cif-y-fob-en-transacciones-comerciales-12. [12]G. Villarroel, «Quees Economia,» 01 05 2020. [En línea]. Disponible: https://www.queeseconomia.site/utilidad/#:~:text=La%20utilidad%20es%20el%20inter%C3%A9s,puede%20sacar%20de%20un%20producto.&text=Nos%20encontramos%20con%20tres%20tipos,la%20neta%20y%20la%20operacional. [13]K. Silva, «kueski,» ¿Qué es la utilidad bruta y cómo se calcula?, 20 02 2020. [En línea]. Disponible: https://kueski.com/blog/finanzas-personales/dinero-economia/que-es-la-utilidad-bruta/. [14]P.Roldán, «Economipedia,» 19 02 2019. [En línea]. Disponible: https://economipedia.com/definiciones/utilidad-neta.html. [15]A. Broseta, «¿Qué es la utilidad bruta, neta y operacional?: Fórmulas,» Mexico, 2016. [16]ProEcuador, «proecuador.gob.ec,» 2020. [En línea]. Disponible: https://www.proecuador.gob.ec/category/sector/confeccion-y-textil/. [17]Revista Lideres, «Sector textil es el segundo de Ecuador que genera más empleo,» Lideres Produccion, 16 03 2017. [18]Asociación de Industriales Textiles de Ecuador (AITE)., «Informe Asociación de Industriales Textiles de Ecuador (AITE).,» 2017. [En línea]. Available: https://pe.fashionnetwork.com/news/Las-exportaciones-textiles-de-ecuador-crecen-en-un-5-8-,1042825.html. [19]T. Gonzalez, «Fashion Net Work,» 6 12 2018. [En línea]. Disponible: https://pe.fashionnetwork.com/news/Las-exportaciones-textiles-de-ecuador-crecen-en-un-5-8-,1042825.html. [20]Banco Central del Ecuador, «Exportaciones por bloques económicos (SIN OTROS USOS),» 19 10 2019. [En línea]. Disponible: https://www.aite.com.ec/estadisticas/2018/EXPORT%202018%20BLOQUES%20ECON.%20SIN%20OTROS%20USOS.pdf. [21]Asociación de Industrias Textiles del Ecuador, «Asociación de Industrias Textiles del Ecuador,» 5 10 2019. [En línea]. Disponible: https://www.aite.com.ec/estadisticas/2018/IMPORT%202018%20TIPO%20PRODUCTO.pdf. [22]Textiles y confecciones en Ecuador, «textiles y confecciones en Ecuador,» 12 3 2014. [En línea]. Disponible: https://www.legiscomex.com/BancoMedios/Documentos%20PDF/estudio-textil-confecciones-ecuador-listo.pdf. [23]V. Yuliana y M. Pastaz, Barreras arancelarias y no arancelarias a las importaciones de textiles en el Ecuador y su impacto en los niveles de rentabilidad en la industria nacional, GUAYAQUIL: Universidad Laica VICENTE ROCAFUERTE, 2017. [24]A. Peiro, «Economipedia,» 10 05 2020. [En línea]. Disponible: https://economipedia.com/definiciones/coeficiente-de-correlacion-lineal.html#:~:text=La%20correlaci%C3%B3n%2C%20tambi%C3%A9n%20conocida%20como,variaci%C3%B3n%20conjunta%20entre%20dos%20variables.

ABSTRACT Finger millet (Eleusine coracana (L) commonly known as ragi is an important crop used for food, forage and industrial products. Finger millet has a wide ecological and geographical adaptability and resilience to various agro-climatic adversities hence, it is highly suited to drought condition and marginal land and requires low external input in cultivation.. Farmers participatory field demonstrations of ragi variety Arjun and Bhairabi were conducted at two villages ie Pedawada of Malkangiri block and MPV -1 of Kalimela block of Malkangiri district, comprising 40 farmers in cluster approach in Kharif 2018 and 2019 , by Krishi Vigyan Kendra, Malkangiri , in South Eastern Ghat Zone of Odisha . Conducting front line demonstrations on farmer’s field help to identify the constraints and potential of the finger millet in the specific area as well as it helps in improving the economic and social status of the farmers. Observation on growth and yield parameters were taken and economic analysis was done. The final seed yield was recorded at the time of harvest and the gross return in (Rs ha -1) was calculated based on prevailing market prices. The results from the demonstration conclusively proved that finger millet variety Arjun (OEB-526) recorded the higher yield ( 18.8 q ha-1) , followed by Bhairabi ( 15.3 q ha-1) and farmer’s traditional variety Nali Mandia ( Dasaraberi) recorded an average yield of (8.6 q ha-1 ) . HYV Finger millet variety Arjun with proper nutrient management and plant protection measures gave 118 % higher over farmer’s practices. The technological and extension gap was 1.9 q ha-1 and 12.07 q ha-1 respectively. Similarly, technological index was 8.2 percent. The benefit cost ratio was 2.4 and 1.9 in case of Arjun and Bhairabi respectively and in case of farmer’s variety Nali Mandia it was 1.4. Hence the existing local finger millet variety can be replaced by HYV Arjun ans Bhairabi , since it fits good to the existing rainfed farming situation for higher productivity. By conducting front line demonstrations on millet on large scale in farmer’s field, yield potential of finger millet can be enhanced largely which will increase in the income level of farmers and improve the livelihood condition of the farming community. Introduction Among small millets, finger millet (Elusine coracana L,) locally known as Ragi/Mandia is the most important crop grown in tribal districts of Odisha and it is the staple food of the tribals. It was originated about 5000 years ago in east Africa (possibly Ethiopia) and was introduced into India, 3000 years ago (Upadhyaya et al., 2006) and it is highly suited to drought condition and marginal land and requires low external input in cultivation. Millet is a collective term referring to a number of small seeded annual grasses that are cultivated as grain crops, primarily on marginal lands in dry areas in temperate, subtropical and tropical regions (Baker, 1996). Nutritionally finger millet is superior to major cereal crops and rich source of micronutrients such as calcium, phosphorous, magnesium and iron. And it has several health benefits. Finger millet grains contain higher amount of proteins, oils and minerals than the grains of rice, maize or sorghum (Reed et al., 1976). Vadivoo and Joseph (1998) mentioned finger millet grains contain 13.24% moisture, 7.6% protein, 74.36% carbohydrate, 74.36% carbon, 1.52% dietary fiber, 2.35% minerals, 1.35% fat and energy 341.6 cal/100g. (Joshi and Katoch, 1990; Ravindran, 1991). It is a rich source of micronutrients such as calcium, phosphorus, magnesium and iron. Cysteine, tyrosine, tryptophan and methionine are the right spectrum of amino acids found in finger millet protein (Rachie, 1975). The increase in global temperature leads to climate changes that directly affect crop production and increase people's hunger and malnutrition around the world.. With regard to protein (6-8%) and fat (1-2%) it is comparable to rice and with respect to mineral and micronutrient contents it is superior to rice and wheat (Babu et al., 1987). It is also known for several health benefits such as anti-diabetic, anti-tumerogenic, atherosclerogenic effects, antioxidant, which are mainly attributed due to its polyphenol and dietary fiber contents. Being indigenous minor millet it is used in the preparation of various foods both in natural and malted forms. Grains of this millet are converted into flours for preparation of products like porridge, puddings, pancakes, biscuits, roti, bread, noodles, and other snacks. Besides this, it is also used as a nourishing food for infants when malted and is regarded as wholesome food for diabetic's patients. Diversification of food production must be encouraged both at national and household level in tandem with increasing yields. Growing of traditional food crops suitable for the area is one of the possible potential successful approaches for improving household food security. Malkangiri is one of the seven districts where a flagship programme called “Special Programme for Promotion of Millets in Tribal Areas of Odisha (hereafter, Odisha Millets Mission, (OMM)” has been launched by Department of Agriculture and Farmers Empowerment, Odisha in order to revive millets in rainfed farming systems and household consumption. It was started in kharif 2017 in four blocks of the district, namely Chitrakonda, Korkunda, Mathili and Khairiput. The Government of Odisha launched Odisha Millets Mission (OMM) also known as the Special Programme for Promotion of Millets in Tribal Areas of Odisha in 2017 to revive millets in farms and on plates. The aim was to tackle malnutrition by introducing millets in the public distribution system (PDS) and other state nutrition schemes. The focus is on reviving millets in farms and putting it on plates.” Millet, a nutritious and climate-resilient crop, has traditionally been cultivated and consumed by tribal communities in the rainfed regions of southern Odisha. Technology gap, i.e. poor knowledge about newly released crop production and protection technologies and their management practices in the farmers’ fields is a major constraint in Ragi production. So far, no systematic approach was implemented to study the technological gap existing in various components of Ragi cultivation. Awareness of scientific production technology like HYV of ragi, seed treatment with fungicide, use of insecticide and bio-fertilizers, is lacking in Malkangiri district which were a key reason for low productivity. The production potential could be increased by adopting recommended scientific and sustainable management production practices with improved high yielding varieties and timely use of other critical inputs. Objective The field experiment was undertaken to study the performance of three finger millet varieties Local Mandia (Nali Mandia), Bhairabi and Arjun in rainfed upland situation in kharif season. The present investigation was undertaken to evaluate the field performance of newly released finger millet varieties Arjun and Bhairabi under rainfed condition. The demonstrations were carried out in Malkangiri district covering two villages like Pedawada and MPV-6 to find out the existing technological and extension gap along with technology index with an objective to popularize the ragi varieties having higher yield potential. Material and methods The study was carried out in operational area of Krishi Vigyan Kendra (KVK), Malkangiri during Kharif season in the year 2018 and 2019. The study was under taken in Malkangiri and Kalimela blocks of Malkangiri district of Odisha and the blocks were selected purposefully as Finger millet is the major cereals crop grown in large area in Kharif season. The demonstrations were conducted in two different adopted villages Pedawada and MPV-6 in cluster approach. The Front Line Demonstration (FLD) is an applied approach to accelerate the dissemination of proven technologies at farmer’s fields in a participatory mode with an objective to explore the maximum available resources of crop production and also to bridge the productivity gaps by enhancing the production in national basket.The necessary steps for selection of site and farmers and layout of demonstrations etc were followed as suggested by Choudhary (1999). Forty numbers front line demonstrations on HYV Ragi were conducted in two clusters comprising 40 numbers of farmers. All the participating farmers were trained on various aspects of Ragi production technologies and recommended agronomic practices and certified seeds of Ragi variety Arjun and Bhairabi were used for demonstration. The soil of demonstration site was slightly acidic in reaction (pH-5.0 to 5.25) with sandy loam in texture and EC was 0.134 (dS m −1). The available nitrogen, phosphorus and potassium was between 214 .00, 22 .00, 142 .00 (Kg ha−1) respectively with 0.48 (%) Organic Carbon. The crop was sown in under rainfed condition in the first to second week of July. The crop was raised with recommended agronomic practices and harvested within 4th week of November up to 2nd week of December. Krishi Vigyan Kendra ( KVK), Malkangiri conducted front line demonstration with HYV varieties like Bhiarabi and Arjun and farmer’ local var Dasaraberi as check Finger millet Variety Arjun (OEB-526) is having Maturity duration 110 days and average yield 20.7q/ha with moderate resistance to leaf, neck and finger blast and brown seed and Bhairabi is a HYV of Ragi with Maturity duration 110 days and average yield 17.6 q/ha. Moderate resistance to leaf, neck blast and brown seeded and protein content 81%. Local variety Dsaraberi or Nali Mandia is having 105 days duration and drought tolerant variety used as farmers variety as local check . The technologies demonstrated were as follows: Popularization of high yielding Ragi variety, Seed treatment with Trichoderma viride @ 4g kg-1 seed , Line sowing with, soil test based fertilizer application along with need based plant protection measures. The field was ploughed two times and planking was done after each plugging, Need based plant protection measures were taken; along with soil test based fertilizer application was done with fertilizer dose 40:30:60 kg. N: P2O5: K2O kg ha -1. In case of local checks existing practices being used by farmers were followed. The observations were recorded for various parameters of the crop. The farmers’ practices were maintained in case of local checks. The field observations were taken from demonstration plot and farmer’s plot as well. Parameters like Plant height, number of fingers per plant, length of finger , no of fingers per year, 1000 seed weight and seed yield were recorded at maturity stage and the gross returns (Rs ha -1 ) were calculated on the basis of prevailing market price of the produce. The extension gap, technology gap, technology index along with B: C ratio was calculated and the data were statistically analyzed applying the statistical techniques. Statistical tools such as percentage, mean score, Standard deviation, co-efficient of variation, Fisher‘s “F” test, were employed for analysis of data. The farmer’s practices (FP) plots were maintained as local check for comparison study. The data obtained from intervention practices (IP) and famers practices (FP) were analyzed for extension gap, technological gap, technological index and benefit cost ratio study as per (Samui et al., 2000) as given below. Technology gap = Pi (Potential yield) - Di (Demonstration yield) Extension gap = Di (Demonstration Yield) - Fi (Farmers yield) Technology index = X 100 Result and Discussion The results obtained from the present investigation are summarized below. The Table 1 depicts the major differences observed between demonstration package and farmer’s practices in ragi production in the study area. The major differences were observed between demonstration package and farmer’s practices were regarding recommended varieties, seed treatment, soil test based fertilizer application, keeping optimum plant population by thinning, weed management and plant protection measures. The data of Table 1 shows that under the demonstrated plot only recommended high yielding variety, proper weeding and optimum plant population maintaining by thinning and the farmers used herbicides and the farmers timely performed all the other package and practices. It was also observed that farmers were unaware about balanced fertilizer application, seed treatment, and use of fertilizers application and maintenance of plant population for enhancing the yield. Majority of the farmers in the study area were unaware about use of weed management practices. The findings are in corroborated with the findings of (Katar et al., 2011) From the Table 2 it was revealed that in the district Malkangiri the productivity of finger millet was 6.38 (q ha-1) as compare to state average productivity 8.67 (q ha-1), but there exists a gap between potential yield and farmers yield, which can be minimized by adoption High yielding varieties with improved management practices. The productivity of finger millet was very low in the district as the crop is mostly grown along the hillsides on sloppy land on light textured soil. It was also coupled with negligence in adoption of improved varieties no input like fertilizers use and no plant protection measures and improper method and time of sowing. However, there is a wide gap between the Potential and the actual production realized by the farmers due to partial adoption of recommended package of practices by the growers. Several constraints contributed to yield fluctuation on Ragi production, including: unreliable rainfall; lack of high yielding variety ,disease tolerant varieties; pests and diseases incidence; low producer prices; poor agronomic practices; and lack of institutional support (Bucheyeki et al., 2008; Okoko et al., 1998). One of the central problems of ragi production and processing in this district is due to an uncertain production environment owing to rain fed cultivation, the low resource base of smallholder farmers and processors, and no scope for post harvest management and value addition facilities and poor marketing facility. The results clearly indicated from the Table 3 that the positive effects of FLDs over the existing practices. HYV Ragi Arjun recorded higher yield 18.8(q ha-1) followed by Bhairabi 15.53 (q ha-1) which was 21 % more and the yield performance of these two HYV varieties was higher than the farmer’s variety. This is due to higher of panicle length, more number of tillers and more number of fingers per panicle in HYV of ragi as compared to local variety. The results are in conformity with the findings of (Tomar et al. , 2003). The results clearly indicated the positive effects of FLDs over the existing practices towards enhancing the productivity. It is revealed form table 4 that, as the calculated ‘F’ value at α=0.05 level was found to be larger than table value, indicating significant difference in yield between farmer’s variety and recommended varieties. There was significant difference between average yield of ragi under Farmers practice (FP) and Recommended practice (RP) in variety Arjun under this demonstration. It was concluded that the yield of these HYV ragi varieties was significantly higher as compared to farmer’s variety. The economics and B:C ratio of farmers practice and Demonstration practice has been presented in Table 6. From the table it was revealed that Benefit: Cost ratio (B:C) was recorded to be higher under demonstrations against control treatments during all the years of experimentation. The cost of cultivation in HYV variety was higher due to more labour cost involved in transplanting and also it included cost of fertilizers and plant protection chemicals and also net returns was higher as compared to farmer’s practice. The B: C ratio was found to be 2.4 in case of variety Arjun as compared to 1.9 in case of variety Bhairabi. The results on economic analysis indicated that HYV ragi Arjun and Bhairabi performed better than local variety Ragi. The HYV variety Arjun recorded higher gross return upto Rs 54,332 and followed by Bhairabi Rs 44,289 per ha which was significantly higher than farmers practice and it was due to higher productivity of varieties under demonstration. Conclusion The results revealed that in Malkangiri district finger millet variety Arjun rerecorded highest yield followed by Variety Bhirabi with proper package and practices under rainfed upland condition. From the above study it was concluded that use of finger millet varieties like Arjun or Bhairabi with scientific methods and technological practices of can reduce the technological gap and enhance the productivity in the district. Yield improvement in Finger Millet in the demonstration was due to use of HYV seed and scientific management practices adopted by the farmers. Yield of Finger Millet can be increased to a great extent by conducting effective front line demonstrations in larger area with proven technologies. Finger millet is one of future smart food crop of India and can be grown in the drought condition. This crop is rich in nutrient for food insecurity and within few years because of increase in population of world and depletion of area of production.. The principal reasons of lower productivity of finger millet in the district Malkangiri were lack of knowledge among the farmers about cultivation of HYV finger millet varieties and improper fertilization, late season sowing and severe weed infestation in crop at critical stages. From the above findings, it can be concluded that use of scientific methods of Finger millet cultivation can reduce the technology gap to a considerable extent thus leading to increased productivity of millets in the district. Moreover, extension agencies in the district need to provide proper technical support to the farmers through different educational and extension methods to reduce the extension gap for better production. Acknowledgments The OUAT Bhubaneswar and ICAR-ATRI Kolkata, is acknowledged for financial support to the research program. Conflicts of interest The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. References: Babu, B. V.; Ramana, T.; Radhakrishna, T.M. Chemical composition and protein in hybrid varieties of finger millet. Indian J. Agric. Sci. 1987, 57(7), 520-522. Biplab, M.; Samajdar, T. Yield gap analysis of rapeseed-mustard through Front Line Demonstration. Agricultural Extension Review. 2010, 16-17. Bucheyeki, T. L.; Shenkalwa, E. M.; Mapunda, T. X.; Matata, L.W. On-farm evaluation of promising groundnut varieties for adaptation and adoption in Tanzania. African Journal of Agricultural Research. 2008, 3(8), 531-536. Chandra, D.; Pallavi S C.; Sharma A.K. Review of Finger millet (Eleusine coracana (L.) Gaertn): A power house of health benefiting nutrients. Food Science and Human Wellness. 2016, 5( 3), 149-155. Choudhary, B. N. Krishi Vigyan Kendra - a guide for KVK managers. Division of Agricultural Extension, ICAR, 1999, 73-78. De Onis M.; Frongillo E.A.; Blossner, M. “Is malnutrition declining? An analysis of changes in levels of child malnutrition since, 1980.” Bulletin of the World Health Organization. 2000, 1222–1233. Gull, A.; Jan, R.; Nayik, G. A.; Prasad, K.; Kumar, P. Significance of Finger Millet in Nutrition, Health and Value added Products: A Review. Journal of Environmental Science, Computer Science and Engineering & Technology, JECET. 2014, 3(3), 1601-1608. Gupta, S .M.; Arora, S.; Mirza, N.; Pande, A.; Lata, C.; Puranik, ; Kumar, J.; Kumar, A. Finger Millet: A “Certain” Crop for an “Uncertain” Future and a Solution to Food Insecurity and Hidden Hunger under Stressful Environments. Frontiers on Plant Sci. 2017, 8, 643 Joshi, H. C.; Katoch, K. K. Nutritive value of millets: A comparison with cereals and pseudocereals. Himalayan Res. Dev. 1990, 9, 26-28. Kande, M.; Dhami, N B.; Subedi, N.; Shrestha, J. Arjun. Field evaluation and nutritional benefits of finger millet (Eleusine coracana (L.) Gaertn.) 2019. Katare, S.; Pandey, S.K.; Mustafa, M. Yield gap analysis of Rapeseed-mustard through front line demonstration. Agriculture update. 2011, 6(2), 5-7. Lupien, J.R. Sorghum and millets in human nutrition. FAO, ICRISAT. At: ao.org. 1990, 86. Mohanty, B. Odisha Millet Mission: The successes and the challenges. 2020. "Baseline Survey: Malkangiri District 2016-17, Phase-1 (Special Programme for Promotion of Millets in Tribal Areas of Odisha or Odisha Millets Mission, OMM)," Nabakrushna Choudhury Centre for Development Studies, Bhubaneswar. 2019. Nigade, R. D.; Jadhav, B. S.; Bhosale, A. S. Response 0f long duration finger millet(Elusine coracana L,) variety to different levels of nitrogen under rainfed condition. J agrc Sci. 2011, 7(1), 152-155. Odisha Agriculture Statistics, Govt of Odisha. 2013-2014. Rachie, K. O. The Millets: Importance, Utilization and Outlook. International Crops Research Institute for the Semi-Arid Tropics, Hyderabad, India. 1975, 63. Ravindran, G. Studies on millets: proximate composition, mineral composition, phytate, and oxalate contents. Food Chem. 1991, 39(1), 99- 107. Ravindran G. Seed proteins of millets: amino acid composition, proteinase inhibitors and in vitro digestibility. Food Chem. 1992, 44(1), 13- 17. Reed C. F. Information summaries on 1000 economic plants. USDA, USA. 1976. Samui, S K.; Maitra, S.; Roy, D K.; Mandal, A. K.; Saha, D. Evaluation of front line demonstration on groundnut. Journal of Indian Society of Coastal Agricultural Research. 2000, 18(2), 180-183. Singh, J.; Kaur, R..; Singh, P. Economics and Yield gap analysis of Front Line Demonstrations regarding Scientific practices of Indian Mustard in district Amritsar. Indian Journal of Economics and Development. 2016, 12(1a), 515. Singh, P.; Raghuvanshi. R. S. Finger millet for food and nutritional security. African Journal of Food Science. 2012, 6(4), 77-84. Srivastava, P.P.; Das, H.; Prasad, S. Effect of roasting process variables on hardness of Bengal gram, maize and soybean. Food Sci. Technol. 1994, 31(1), 62-65. Tomar, L. S.; Sharma, B. P.; Joshi, K. Impact of front line demonstration of soybean in transfer of improved technology. Journal of Extension Research. 2003, 22(1), 139. Upadhyaya, H.D.; Gowdaand C.L.L.; Reddy, V.G. Morphological diversity in finger millet germplasm introduced from Southern and Eastern. African Journal of SAT Agriculture Research. 2007, 3(1). ejournal.icrisat.org. Vadivoo, A.S.; Joseph, R. Genetic variability and diversity for protein and calcium contents in finger millet (Elusine coracona (L.) Gaertn) in relation to grain color. Plant Foods for Human Nutrition Dordrecht. 1998, 52, 353-364. Department of Botany, Avinashilingam Institute for Home Science and Higher Education for Women, Deemed University, Coimbatore, TN, 641 043, India.

Con el propósito de estudiar la organización de datos e identificar la diversidad de representaciones construidas en situación de exploración de datos auténticos, en un grupo de 56 estudiantes chilenos de tercer grado de primaria, se diseñó e implementó un plan de clases de estadística, en el que se solicitó a los estudiantes ordenar y organizar los datos para responder a un problema. Este artículo se centra en el estudio cualitativo de las representaciones de datos producidas por los estudiantes durante la implementación del plan de clases. La exploración de los datos realizada por los estudiantes sobre los alimentos que consumían en la escuela (“colaciones”), los llevó a elaborar representaciones de datos (listas, estado intermedio de esquema tabular y tabla de frecuencias). Se concluye que el contexto auténtico y la construcción de representaciones propias promovieron que los estudiantes construyeran preponderantemente listas (77%), aplicando con sentido la partición, la clase y el cardinal. Se sugiere incorporar explícitamente en la enseñanza el formato lista, como herramienta representacional y unidad básica de la tabla. Referencias Brizuela, B., y Alvarado, M. (2010). First graders' work on additive problems with the use of different notational tools. Revista IRICE, 21, 37-43. Recuperado a partir desde https://ojs.rosario-conicet.gov.ar/index.php/revistairice/article/view/v21n21a04 Brizuela, B., y Lara-Roth, S. (2002). Additive relations and function tables. Journal of Mathematical Behavior, 20(3), 309-319. https://doi.org/10.1016/S0732-3123(02)00076-7 Coutanson, B. (2010). La question de l’éducation statistique et de la formation de l’esprit statistique à l’école primaire en France. Étude exploratoire de quelques caractéristiques de situations inductrices d’un enseignement de la statistique au cycle III (Tesis doctoral). Université de Lyon, Francia. Recuperado desde https://tel.archives-ouvertes.fr/tel-00494338/ Dibble, E. (1997). The Interpretation of Tables and Graphs. Seattle, WA: University of Washington. Duval, R. (2003). Comment Analyser le Fonctionnement Representationnel des Tableaux et leur Diversite? Spirale -Revue de Recherches en Éducation-, 32, 7-31. Recuperado desde http://spirale-edu-revue.fr/IMG/pdf/1_Duval_Spi32F.pdf Estrella, S. (2014). El formato tabular: una revisión de literatura. Revista Actualidades Investigativas en Educación, 14(2), 1-23. Estrella, S., e Isoda, M. (2020). Suma Primero: manual del docente, 1° básico. Valparaíso: Ediciones Universitarias de Valparaíso. Estrella, S., Mena-Lorca, A., y Olfos, R. (2017). Naturaleza del objeto matemático “Tabla”. Magis: Revista Internacional de Investigación en Educación, 10(20), 105-122. https://doi.org/10.15517/aie.v14i2.14817 Estrella, S., Olfos, R., Morales, S., y Vidal-Szabó, P. (2017). Argumentaciones de estudiantes de primaria sobre representaciones externas de datos: componentes lógicas, numéricas y geométricas. Revista Latinoamericana de Investigación en Matemática Educativa, 20(3), 345-370. https://doi.org/10.12802/relime.17.2034 Estrella, S., Olfos, R., Vidal-Szabó, P., Morales, S., y Estrella, P. (2018). Competencia meta-representacional en los primeros grados: representaciones externas de datos y sus componentes. Revista Enseñanza de las Ciencias, 36(2), 143-163. https://doi.org/10.5565/rev/ensciencias.2143 Estrella, S., Zakaryan, D., Olfos, R., y Espinoza, G. (2020). How teachers learn to maintain the cognitive demand of tasks through Lesson Study. Journal of Mathematics Teacher Education, https://doi.org/10.1007/s10857-018-09423-y Friel, S. N., Curcio, F. R., y Bright, G. W. (2001). Making sense of graphs: Critical factors influencing comprehension and instructional implications. Journal for Research in Mathematics Education, 124-158. https://psycnet.apa.org/doi/10.2307/749671 Gabucio, F., Martí, E., Enfedaque, J., Gilabert, S., y Konstantinidou, A. (2010). Niveles de comprensión de las tablas en estudiantes de primaria y secundaria. Cultura y Educación, 22(2), 183-197. https://doi.org/10.1174/113564010791304528 Kaufman, E. L., Lord, M. W., Reese, T. W., y Volkmann, J. (1949). The discrimination of visual number. The American journal of psychology, 62(4), 498-525. Lehrer, R., y Schauble, L. (2000). Inventing data structures for representational purposes: Elementary grade students' classification models. Mathematical Thinking and Learning, 2(1-2), 51-74. https://psycnet.apa.org/doi/10.1207/S15327833MTL0202_3 Martí, E. (2009). Tables as cognitive tools in primary education. En C. Andersen, N. Scheuer, M. Pérez Echeverría, y E.V. Teubal (Coord.), Representational systems and practices as learning tools (pp. 133-148). Rotterdam: Sense Publishers. Martí, E., García-Mila, M., Gabucio, F., y Konstantinidou, K. (2010). The construction of a double-entry table: a study of primary and secondary school students’ difficulties. European Journal of Psychology of Education, 26(2), 215-234. www.jstor.org/stable/23883606 Martí, E., Pérez, E., y De la Cerda, C. (2010). Alfabetización gráfica. La apropiación de las tablas como instrumentos cognitivos. Contextos, 10, 65-78. Martínez, M., y Brizuela, B. (2006). A third grader’s way of thinking about linear function tables. Journal of Mathematical Behavior, 25, 285-298. https://doi.org/10.1016/j.jmathb.2006.11.003 Ministerio de Educación de Chile. (2018). Bases Curriculares Primero a Sexto Básico. Santiago de Chile: Unidad de Currículum y Evaluación, Ministerio de Educación de Chile. Recuperado desde https://www.curriculumnacional.cl/614/articles-22394_bases.pdf Moore, D. S., y Cobb, G. W. (2000). Statistics and mathematics: Tension and cooperation. The American Mathematical Monthly, 107(7), 615-630. Nisbet, S., Jones, G., Thornton, C., Langrall, C., y Mooney, E. (2003). Children’s Representation and Organisation of Data. Mathematics Education Research Journal, 15(1), 42-58. https://doi.org/10.1007/BF03217368 Pérez-Echeverría, M., y Scheuer, N. (2009). External Representations as Learning Tools: An Introduction. En C. Andersen, N. Scheuer, M. Pérez-Echeverría, y E. Teubal (Eds.), Representational systems and practices as learning tools (pp. 1-17). Rotterdam: Sense Publishers. Pfannkuch, M., y Rubick, A. (2002). An exploration of students’ statistical thinking with given data. Statistics Education Research Journal, 1(2), 4-21. https://iase-web.org/documents/SERJ/SERJ1(2).pdf Sepúlveda, A., Díaz-Levicoy, D., y Jara, D. (2018). Evaluación de la comprensión sobre Tablas Estadísticas en estudiantes de Educación Primaria. Bolema: Boletim de Educação Matemática, 32(62), 869-886. http://dx.doi.org/10.1590/1980-4415v32n62a06 Tukey, J. (1977). Exploratory data analysis. Reading, MA: Addison-Wesley. Wu, H., y Krajcik, J. (2006). Inscriptional Practices in Two Inquiry-Based Classrooms: A Case Study of Seventh Graders’ Use of Data Tables and Graphs. Journal of Research in Science Teaching, 43(1), 63-95. https://doi.org/10.1002/tea.20092 Financiamiento: Esta investigación se ha realizado dentro del proyecto subvencionado por Agencia Nacional de Investigación y Desarrollo (ANID) / FONDECYT 1200346 y Proyecto VRIE-PUCV 039.439/2020

Bioclimatology is applied for growing tea in the West of Nghe An province, where the tea is considered as a high economic efficient plant to be priorly cultivated for reducing poverty and getting rich. Based on the bioclimatic characteristics of tea plant and regional climatic data from 1980 to 2014, the bioclimatic diagrams are built and the tea cultivability is mapped in term of annual average temperature and total precipitation, for this region with regarding its district of Con Cuong as an analytical key. The climate, including both temperature and precipitation, in Con Cuong is relatively suitable for the tea plantation. The Western Nghe An, a land of approx. 1.4 million ha, could be classified in five areas with different suitability for tea plant. The unfavorable area occupies only 1% of total region and the four favorable rests account for 99% of total, in which, the most favorable area is largest with about 746,355 ha, i.e. over 50% of whole region. The three other areas are cultivable but they are less favorable in terms of either temperature or precipitation. Growing tea in Western Nghe An, even in favorable areas, it should be taken into account of the weather disadvantages in certain moments of the year such as extreme dry, cold, hot and rainy events.ReferencesAhmed S., 2014. Tea and the taste of climate change, www.herbalgram.org, issue, 103, 44–51.Ahmed S., Stepp J.R., Orians C., Griffin T., Matyas C., 2014. Effects of extreme climate events on tea (Camellia sinensis) functional quality validate indigenous farmer knowledge and sensory preferences in tropical China. PloS one, 9(10), e109126.Bhagat R.M., Deb Baruah R., Safique S., 2010. climate and tea [camellia sinensis (l.) o. kuntze] Production with Special Reference to North Eastern India: A Review. Journal of Environmental Research And Development, 4(4), 1017–1028.Carr M., 1972. The Climatic Requirements of the Tea Plant: A Review. Experimental Agriculture, 8(01), 1–14. https://doi.org/10.1017/S0014479700023449.Carr M.K.V., Stephen W., 1992. Climate, weather and the yield of tea. In: Tea Cultivation to consumtpion. K.C. Wilson and M.N. Clifford (Eds). Chapman and Hall, 87–135.Daleen Lotter, David le Maitre, 2014. Modeling the distribution of Aspalathus linearis (Rooibos tea): implications of climate change for livelihoods dependent on both cultivation and harvesting from the wild. Ecology and Evolution, 4(8), 1209–1221.Ducan J.M.A., Saikia S.D., Gupta N., Biggs E.M., 2016. Observing climate impacts on tea yield in Assam, India. Applied Geogr., 77, 64–71.Institute of Geography, 2016. Department of Climatically Geography. The precipitation and temperature data at meteorological measuring stations in the West of Nghe An Province between 1984 and 2014. Data stored at Department of Climatically Geography, Institute of Geography, Ha Noi, 46p.Gaussen H., 1954. 8 ème Congrès international de Botanique. Section 7 et 3. Paris.Hadfield W., 1976. The effect of high temperature on some aspects of the physiology and cultivation of tea bush (Camellia sinensis) in North East India. In: Light as an Ecological factor. G.C. Evans, R. Bainbridge and O. Rackham (Eds.) Blackwel Sci. Publ., London, 477–495.Hoang Luu Thu Thuy, 2012. The comprehensive assessment of natural, socio-economic and environmental conditions for environmental protection planning in Nghe An Province. Doctoral Thesis. Institude of Geography, Hanoi, 150p.Huang Shoubo, 1989. Meteorology of tea plants in China: a review. Agri. Forest Meteorol., 47, 19–30.Huang Shoubo, 1991. A study on the ecological climates of some famous tea growing areas in high mountainous regions of China. Chinese Geographical Science, 1(2), 121–128.International Center for Tropical Agriculture, 2017. Identification of suitable tea growing areas in Malawi under climate change scenarios. Ciat report, Cali, Colombia, 39p.Kabir S.E., 2001. A study on Ecophysiology of Tea (Camellia sinensis) with special reference to the influence of climatic factors on physiology of a few selected Tea clones of Darjeering. International Journal of Tea Science, 1(4), 1–9.Kandiah S., Thevadasan T., 1980. Quantification of weather parameters to predict tea yields. Tea Q., Srilanka, 49(1), 25–33.Kaye L., 2014. Climate change threatens Sri Lanka’s tea industry. Triple Pundit: People, Planet, Profit. Available at: www.triplepundit.com/2014/06/climate-changethreatens-sri-lanka-tea-industry. Accessed July 25, 2014.Nakayama A., Harada S., 1962. Studies on the effect on the growth of tea plant. IV. The effect of temperature on the growth of young plants in summer. Bull. Tea Res. Station, Japan, 1, 28–40.Nguyen Bao Ve, 2005. The syllabus of industrial trees. Hanoi Argricultural Publishing House, 224p.Nguyen Dai Khanh, 2003. The assessment of agricultural climatic conditions for tea’s growth in major tea regions of Vietnam. Doctoral Thesis. Institute of Meteorology and Hydrology, 149p.Nguyen Khanh Van, Nguyen Thi Hien, Phan Ke Loc, Nguyen Tien Hiep, 2000. The bioclimatic diagrams of Vietnam. Vietnam National University Publishing House, Ha Noi, 126p.Nguyen Van Hong, 2017. Analyzing, assessing landscape for agriculture, forestry development and biodiversity conservation in the southwestern border districts in Nghe An province. Doctoral thesis. Vietnam National University, Hanoi, 150p.Nguyen Van Tao (ed.), 2004. Completing the asexual propagation process of LDP1 and LDP2 cultivars by cuttings in order to transfer to production. State Project of production pilot, coded KC.06.DA.09.NN. Institute of Tea Research, Phu Tho, 50p.Nkomwa E.C., Joshua M.K., Ngongondo C., Monjerezi M., Chipungu F., 2014. Assessing indigenous knowledge systems and climate change adaptation strategies in agriculture: A case study of Chagaka Village, Chikhwawa, Southern Malawi. Physics and Chemistry of the Earth, Parts A/B/C, 67–69, 164–172.Pham Hoang Ho, 2003. An Illustrated Flora of Vietnam, 2, 430–434. Youth Publishing House, 952p.Rebecca Boehm, Sean B. Cash, Bruce T. Anderson, Selena Ahmed, Timothy S. Griffin, Albert Robbat Jr., John Richard Stepp, Wenyan Han, Matt Hazel and Colin M. Orians, 2016. Association between Empirically Estimated Monsoon Dynamics and Other Weather Factors and Historical Tea Yields in China: Results from a Yield Response Model. Climate, 4, 20; doi:10.3390/cli4020020. www.mdpi.com/journal/climate.Schepp K., 2014. Strategy to adapt to climate change for Michimikuru tea farmers in Kenya. Adap CC Report. 2008. Available at: www.adapcc.org/en/kenya.htm. Accessed July 25, 2014.Sen A.R., Biswas A.K., Sanyal D.K., 1966. The Influence of Climatic Factors on the Yield of Tea in the Assam Valley, J. App. Meteo., 5(6), 789–800.Statistics Office of Nghe An Province, 2016. The annual abstracts of statistics 2015. Nghe An Publishing House, Nghe An, 453p.Tanton T.W., 1982. Environmental factors affecting yield of tea (camellia sinensis). Effect of air temperature. Expl. Agri., 18, 47–52.The People’s Committee of Nghe An Province, 2013. The Decision No. 448/QĐ-UBND dated 31/01/2013 to approve the hi-tech agriculture planning on the production of tea in Nghe An Province.The People’s Committee of Nghe An Province, 2013. The Decision No. 6290/QĐ-UBND dated 24/12/2013 to approve the adjustments and supplements for the development of Nghe An tea Industrial zone planning in 2013–2020.Walter H, Lieth, 1967. Klimadiagram - Weltatlas. Veb Gustav Fischer Verlag Jena.Wijeratne M.A., 1996. Vulnerability of Sri Lanka tea production to global climate change. Water, Air and Soil Pollution, 92(1-2), 87–94.Wijeratne M.A., Anandacoomaraswamy A., Amarathunga M., Ratnasiri J., 2007. Assessment of impact of climate change on productivity of tea (Camellia sinensis L.) plantations in Sri Lanka, 119–126.http://nghean.gov.vn, 05/06/2015. Many crops are withered in Con Cuong.http://baonghean.vn, 25/03/2013. Drought threaten rice and tea in Con Cuong. http://baonghean.vn/con-cuong-han-han-de-doa-lua-che-44581.html.

The effects of biochar and biochar combined with N-fertilizer on the content of soil organic matter in water-stable aggregates were investigated. A field experiment was conducted with different biochar application rates: B0 control (0 t ha-1), B10 (10 t ha-1) and B20 (20 t ha-1) and 0 (no N), 1st and 2nd levels of nitrogen fertilization on silt loam Haplic Luvisol (Dolna Malanta, Slovakia), in 2014. The N doses of level 1 were calculated on required average crop production using balance method. Level 2 included additional 100% of N in year 2014 and additional 50% of N in year 2016. The effects were investigated during the growing seasons of spring barley and spring wheat in 2014 and 2016, respectively. Results indicate that the B20N2 treatment significantly increased the proportion of water-stable macro-aggregates (WSAma) and reduced water-stable micro-aggregates (WSAmi). Aggregate stability increased only in the B20N1 treatment. The B20N2 treatment showed a robust decrease by 27% in the WSAma of 0.5-0.25 mm. On the other hand, an increase by 56% was observed in the content of WSAma with fractions 3-2 mm compared to the B0N0 treatment. The effect of N fertilizer on WSAma was confirmed only in the case of the B10N2 treatment. The proportion of WSAma with fractions 3-2 mm decreased by 42%, while the size fraction of 0.5-0.25 mm increased by 30% compared to the B10N0 treatment. The content of WSAma with fractions 1-0.5 mm decreased with time. On the contrary, the content of WSAma with particle sizes above 5 mm increased with time in all treatments except the B10N2 and B20N2 treatments. A statistically significant trend was identified in the proportion of WSA in the B10N2 and B20N2 treatments, which indicates that biochar with higher application levels of N fertilizer stabilizes the proportion of water-stable aggregates. In all treatments, the content of soil organic carbon (SOC) and labile carbon (CL) in WSAmi was lower than those in WSAma. A considerable decrease of SOC in the WSAma >5 mm and an increase of SOC in WSAmi were observed when biochar was applied at the rate of 10 t ha-1. Contents of SOC in WSAmi increased as a result of adding biochar combined with N fertilizer at first level. CL in WSA significantly increased in all size fractions of WSA.References Abiven S., Hund A., Martinsen V., Cornelissen G., 2015. Biochar amendment increases maize root surface areas and branching: a shovelomics study in Zambia. Plant Soil, 342, 1-11. Agegnehu G., Bass A.M., Nelson P.N., and Bird M.I., 2016. Benefits of biochar, compost and biochar–compost for soil quality, maize yield and greenhouse gas emissions in a tropical agricultural soil. Sci. Tot. Environ., 543, 295-306. Angers D.A., Samson N., Legere A., 1993. Early changes in water-stable aggregation induced by rotation and tillage in a soil under barley production. Can. J. Soil Sci., 73, 51-59. Atkinson Ch.J., Fitzgerald J.D., Hipps N.A., 2010. Potential mechanisms for achieving agricultural benefits from biochar application to temperate soils: a review. Plant Soil, 337, 1-18. Balashov E., Buchkina N., 2011. Impact of short- and long-term agricultural use of chernozem on its quality indicators. Int. Agrophys., 25, 1-5. Barrow C.J., 2012. Biochar: potential for countering land degradation and for improving agriculture. Appl. Geogr., 34, 21-28. Barthes B.G., Kouakoua E.T., Larre-Larrouy M.C., Razafimbelo T.M., De Luca E.F., Azontonde A., Neves C.S.V.J., De Freitas P.L., Feller C.L., 2008. Texture and sesquioxide effects on water-stable aggregates and organic matter in some tropical soils. Geoderma, 143, 14-25. Benbi D.K., Brar K., Toor A.S., Sharma S., 2015. Sensitivity of labile soil organic carbon pools to long-term fertilizer, straw and manure management in rice-wheat system. Pedosphere, 25, 534-545. Benbi D.K., Brar K., Toor A.S., Singh P., Singh H., 2012. Soil carbon pools under poplar-based agroforestry, rice-wheat, and maize-wheat cropping systems in semi-arid India. Nutr. Cycl. Agroecosys., 92, 107-118. Blanco-Canqui H., Lal L., 2004. Mechanisms of carbon sequestration in soil aggregates. Crit. Rev. Plant Sci., 23, 481-504. Brevik E.C., Cerda A., Mataix-Solera J., Pereg L., Quinton J.N., Six J., Van Oost K., 2015. The interdisciplinary nature of SOIL. SOIL, 1, 117-129. Brodowski S., John B., Flessa H., Amelung W., 2006. Aggregate-occluded black carbon in soil. Eur. J. Soil Sci., 57, 539-546. Bronick C.J., Lal R., 2005. The soil structure and land management: a review. Geoderma, 124, 3-22. Chenu C., Plante A., 2006. Clay-sized organo-mineral complexes in a cultivation chronosequece: revisiting the concept of the “primary organo-mineral complex”. Eur. J. Soil Sci., 56, 596-607. Dziadowiec H., Gonet S.S., 1999. Methodical guide-book for soil organic matter studies. Polish Society of Soil Science, Warszawa, 65p. Elliott E.T., 1986. Aggregate structure and carbon, nitrogen, and phosphorus in native and cultivated soils. Soil Sci. Soc. Am. J., 50, 627-633. Fischer D., Glaser B., 2012. Synergisms between compost and biochar for sustainable soil amelioration, In: Kumar S. (ed.): Management of Organic Waste, In Tech Europe, Rijeka, 167-198. Glaser B., Lehmann J., Zech W., 2002. Ameliorating physical and chemical properties of highly weathered soils in the tropics with charcoal - a review. Biol. Fertil. Soils., 35, 219-230. Heitkotter J., and B. Marschner, 2015. Interactive effects of biochar ageing in soils related to feedstock, pyrolysis temperature, and historic charcoal production. Geoderma, 245-246, 56-64. Herath H.M.S.K., Camps-Arbestain M., Hedley M., 2013. Effect of biochar on soil physical properties in two contrasting soils: an Alfisol and an Andisol. Geoderma, 209-210, 188-197. Hillel D., 1982, Introduction to soil physics. Academic Press, San Diego, CA , 364 p. Chenu C., Plante A., 2006. Clay-sized organo-mineral complexes in a cultivation chronosequence: revisiting the concept of the “primary organo-mineral complex”. Eur. J. Soil Sci., 56, 596-607. IUSS Working Group WRB., 2014. World reference base for soil resources 2014. International soil classification system for naming soils and creating legends for soil maps. World Soil Resources Reports, 106, FAO, Rome., 112p. Jeffery S., Verheijen F.G.A., Van der Velde M., Bastos A.C., 2011. A quantitative review of the effects of biochar application to soils on crop productivity using meta-analysis. Agr. Ecosys. Environ., 144, 175-187. Jien S.H., Wang Ch.S., 2013. Effects of biochar on soil properties and erosion potential in a highly weathered soil. Catena, 110, 225-233. Kammann C., Linsel S., Goßling J., Koyro H.W., 2011. Influence of biochar on drought tolerance of Chenopodium quinoa Willd and on soil-plant relations. Plant Soil, 345, 195-210. Kodesova R., Nemecek K., Zigova A., Nikodem A., Fer M., 2015. Using dye tracer for visualizing roots I pact on soil structure and soil porous system. Biologia, 70, 1439-1443. Krol, A., Lipiec, J., Turski, M., J. Kuoe, 2013. Effects of organic and conventional management on physical properties of soil aggregates. Int. Agrophys., 27, 15-21. Kurakov A.V., Kharin S.A., 2012. The Formation of Water-Stable Coprolite Aggregates in Soddy-Podzolic Soils and the Participation of Fungi in This Process. Eur. Soil Sci., 45, 429-434. Loginow W., Wisniewski W., Gonet S.S., Ciescinska B., 1987. Fractionation of organic carbon based on susceptibility to oxidation. Pol. J. Soil Sci., 20, 47-52. Lynch, J.M., and E. Bragg, 1985. Microorganisms and soil aggregate stability. Adv. Soil Sci., 2, 133-171. MHYPERLINK "about:blank"unkholm L.J., Schjonning P., Debosz K., Jensen H.E., Christensen B.T., 2002. Aggregate strength and mechanical behaviour of a sandy loam soil under long-term fertilization treatments. Eur. J. Soil Sci., 53, 129-137. Paradelo R., Van Oort F., Chenu C., 2013. Water-dispersible clay in bare fallow soils after 80 years of continuous fertilizer addition. Geoderma, 200-201, 40-44. Purakayastha T.J., Kumari S., Pathak H., 2015. Characterisation, stability, and microbial effects of four biochars produced from crop residues. Geoderma, 239-240, 293-303. Rees F., Germain C., Sterckeman T., Morel J.L., 2015. Plant growth and metal uptake by a non-hyperaccumulating species (Lolium perenne) and a Cd-Zn hyperaccumulator (Noccaea caerulescens) in contaminated soils amended with biochar. Plant Soil, 395, 57-73. Saha D., Kukal S.S., Sharma S., 2011. Land use impacts on SOC fractions and aggregate stability in typic Ustochrepts of Northwest India. Plant Soil, 339, 457-470. Six J., Bossuyt H., Degryze S., Denef K., 2004. A history of research on the link between (micro)aggregates, soil biota, and soil organic matter dynamics. Soil Till. Res., 79, 7-31. Six J., Elliott E.T., Paustian K., 2000. Soil macroaggregate turnover and microaggregate formation: A mechanism for C sequestration under no-tillage agriculture. Soil Biol. Biochem., 32, 2099-2103. Soinne H., Hovi J., Tammeorg P., Turtola E., 2014. Effect of biochar on phosphorus sorption and clay soil aggregate stability. Geoderma, 219-220, 162-167. Simansky V., 2013. Soil organic matter in water-stable aggregates under different soil management practices in a productive vineyard. Arch. Agron. Soil Sci., 59(9), 1207-1214. Simansky V., Jonczak J., 2016. Water-stable aggregates as a key element in the stabilization of soil organic matter in the Chernozems. Carp. J. Earth Environ. Sci., 11, 511-517. Simon T., Javurek M., Mikanova O., Vach M., 2009. The influence of tillage systems on soil organic matter and soil hydrophobicity. Soil Till, Res., 105, 44-48. Tiessen H., Stewart J.W.B., 1988. Light and electron microscopy of stainedmicroaggregates: the role of organic matter and microbes in soil aggregation. Biogeochemistry, 5, 312-322. Tisdall J.M., Oades J.M., 1980. The effect of crop rotation on aggregation in a red-brown earth. Austr. J. Soil Res., 18, 423-433. Vadjunina A.F., Korchagina Z.A., 1986. Methods of Study of Soil Physical Properties. Agropromizdat, Moscow, 415p. Vaezi A.R., Sadeghi S.H.R., Bahrami H.A., Mahdian M.H., 2008. Modeling the USLE K-factor for calcareous soils in northwestern Iran. Geomorphology, 97, 414-423. Von Lutzow M., Kogel-Knabner I., Ekschmitt K., Matzner E., Guggenberger G., Marschner B., Flessa H., 2006. Stabilization of organicmatter in temperate soils:mechanisms and their relevance under different soil conditions a review. Eur. J. Soil Sci., 57, 426-445.

The purpose of this article was to report on the experience of interdisciplinary practices where the seminar model was used as a methodological strategy for the debate of contemporary issues. In this sense, a description is given of the activities carried out in the Interdisciplinary Seminar ERGOLAB and LAPSIC (SIEL), event held at Faculdade de Ciências Aplicadas (FCA) of the Universidade Estadual de Campinas (UNICAMP), with the aim of contributing to the interdisciplinary treatment of contemporary problems, creating a space of reference for the various themes of research. The Seminar in question is monthly and is accessible to the academic community and professionals of the areas of interest in the topics addressed by the laboratories. The meetings are organized by a Committee that defines the theme and the dynamics of each meeting. The arrangement of each meeting is based on the following formats: round table; discussion of texts about interdisciplinarity; and, presentation of researchers and/or invited professionals. It was concluded that this practice has stimulated the debate and the interdisciplinary reflection, promoted an exchange of information between the participants and fomented the researches in development by the members, besides improving and strengthening partnerships and the involvement with the community.ResumoO presente artigo teve como objetivo relatar a experiência de práticas interdisciplinares onde o modal seminário foi utilizado como estratégia metodológica para o debate de temas contemporâneos. Neste sentido, tem-se a descrição sobre as atividades praticadas no Seminário Interdisciplinar ERGOLAB e LAPSIC (SIEL), realizado na Faculdade de Ciências Aplicadas (FCA) da Universidade Estadual de Campinas (UNICAMP), com o intuito de contribuir para o tratamento interdisciplinar dos problemas contemporâneos, criando um espaço de referência para os diversos temas de pesquisa. O Seminário em questão tem periodicidade mensal e está acessível à comunidade acadêmica e profissionais das áreas de interesse nos temas abordados pelos laboratórios. As reuniões são organizadas por uma comissão que define o tema e a dinâmica de cada encontro. O arranjo de cada encontro pauta-se nos seguintes formatos: mesa redonda; discussão de textos sobre interdisciplinaridade; e, apresentação de pesquisadores e/ou profissionais convidados. Concluiu-se que tal prática tem estimulado o debate e a reflexão interdisciplinar, promovido um intercâmbio de informações entre os participantes e fomentado as pesquisas em desenvolvimento pelos integrantes, além de aprimorar e fortalecer parcerias e o envolvimento com a comunidade.ResumenEl objetivo del presente artículo fue relatar una experiencia de prácticas interdisciplinares donde el modelo de seminario fue utilizado como estrategia metodológica para el debate de temas contemporáneos. Por consiguiente, presentamos una descripción de las actividades practicadas en el Seminario Interdisciplinar ERGOLAB y LAPSIC (SIEL), en la Faculdade de Ciencias Aplicadas (FCA) de la Universidade Estadual de Campinas (UNICAMP), con el propósito de contribuir con una visión interdisciplinar para el tratamiento de problemas contemporáneos, criando un espacio de referencia para los diversos temas de investigación. El seminario en referencia tiene una periodicidad mensual y es accesible a toda la comunidad académica y a profesionales de varias áreas que se interesan por los temas abordados en los laboratorios. Las reuniones son organizadas por una comisión que define el tema y la dinámica de cada encuentro. La organización de cada encuentro es pautada en los siguientes formatos: mesa redonda; discusión de textos sobre interdisciplinaridad; y presentaciones de investigadores y/o profesionales convidados. Se concluyó que tal práctica ha estimulado el debate y la reflexión interdisciplinar, promovido un intercambio de informaciones entre los participantes y fomentado las investigaciones en desarrollo por los integrantes, además de mejorar y fortalecer trabajos en conjunto y el envolvimiento con la comunidad.Keywords: Interdisciplinarity of education, Study seminar, Knowledge exchange.Palavras-chave: Interdisciplinaridade da educação, Seminário de estudo, Intercâmbio de conhecimentos.Palabras clave: Interdisciplinaridad de la educación, Seminario de estudio, Intercambio de conocimientos.ReferencesBERARDINELLI, Lina Márcia M.; SANTOS, Mauro Leonardo S. Caldeira dos. Repensando a interdisciplinaridade e o ensino de enfermagem. Texto Contexto Enferm., Santa Catarina, v.14, n.3, p.419-26, jul./set. 2005. Disponível em: <http://www.scielo.br/pdf/tce/v14n3/v14n3a14.pdf >. Acesso em: 25 mar. 2018.CERVO, Amado Luiz; BERVIAN, Pedro Alcino; SILVA, Roberto da. Metodologia científica. 6. ed. São Paulo: Pearson Prentice Hall, 2007. 242 p.CESCO, Susana; MOREIRA; Roberto José.; LIMA, Eli de Fátima Napoleão de. Interdisciplinaridade, entre o conceito e a prática: um estudo de caso. Revista Brasileira de Ciências Sociais, São Paulo, v.29, n.84, p.57-71, fev. 2014. Disponível em: <www.scielo.br/pdf/rbcsoc/v29n84/03.pdf>. Acesso em: 25 mar. 2018.D’AMBRÓSIO, Ubiratan. Educação para compartilhar desenvolvimento e sustentabilidade. Revista Desenvolvimento e Meio Ambiente, Editora UFPR, Curitiba, n.15, p.11-20, jan./jun. 2007. Disponível em: <revistas.ufpr.br/made/article/viewFile/11895/8389>. Acesso em: 24 out. 2016.FAZENDA, Ivani Catarina Arantes. Interdisciplinaridade-transdisciplinaridade: visões culturais e epistemológicas. In: FAZENDA, Ivani Catarina Arantes (org.). O que é interdisciplinaridade?. São Paulo: Cortez, 2008.FAZENDA, Ivani Catarina Arantes. A formação do professor pesquisador – 30 anos de pesquisa. R. Interdisc., São Paulo, v.1, n.0, p.01-10, out, 2010. Disponível em: < http://www.pucsp.br/gepi/downloads/revistas/revista-0-gepi-out10.pdf>. Acesso em: 05 abr. 2018.JAPIASSU, Hilton. Interdisciplinaridade e patologia do saber. Rio de Janeiro: Imago Editora, 1976. 220 p.LEIS, Héctor Ricardo. Sobre o conceito de interdisciplinaridade. Cadernos de Pesquisa Interdisciplinar em Ciências Humanas, Santa Catarina, n.73, ago. 2005. Disponível em: <ppgich.ufsc.br/files/2009/12/TextoCaderno73.pdf>. Acesso em: 26 out. 2016.LIMA, Kátia de Oliveira; MONTEIRO, Gilson Vieira. Epistemologia ecossistêmica e interdisciplinar: uma parceria necessária ao ensino escolar do século XXI. Interdisc., São Paulo, n.12, p.9-31, abr.2018. Disponível em: <https://revistas.pucsp.br/index.php/interdisciplinaridade/article/view/36782>. Acesso em: 25 mar. 2018.LUCK, Heloísa. Pedagogia da interdisciplinaridade: Fundamentos teórico-metodológicos. Petrópolis: Vozes, 2001.MINAYO, Maria Cecilia Souza. Interdisciplinaridade: funcionalidade ou utopia? Revista Saúde Sociedade, São Paulo, v.3, n.2, p. 42-63, 1994. Disponível em: <http://www.scielo.br/pdf/sausoc/v3n2/04.pdf>. Acesso em: 23 out. 2016.MORIN, Edgar. Educação e complexidade, os sete saberes e outros ensaios. São Paulo: Cortez, 2005.MORIN, Edgar. A cabeça bem-feita: repensar a reforma, reformar o pensamento. Rio de Janeiro: Bertrand Brasil, 2000, 128 p.NICOLESCU, Basarab. Um novo tipo de conhecimento: transdisciplinaridade. In: 1º Encontro Catalisador do CETRANS - Escola do Futuro - USP, Itatiba, São Paulo - Brasil: abr. 1999. Disponível em: <www.ufrrj.br/leptrans/arquivos/conhecimento.pdf>. Acesso em: 22 out. 2016.OLIVEIRA, Elisandra Brizolla de; SANTOS, Franklin Noel dos. Pressupostos e definições em interdisciplinaridade: diálogo com alguns autores. Interdisc., São Paulo, n.11, p.73-87, out. 2017. Disponível em: <https://revistas.pucsp.br/index.php/interdisciplinaridade/article/view/34709>. Acesso em: 25 mar. 2018.OLIVEIRA, Maria Amélia de Campos. A interdisciplinaridade no ensino e na pesquisa em Enfermagem. Rev. esc. enferm. USP, São Paulo, v.46, n.2, p.01-02, abr. 2012. Disponível em: <http://www.scielo.br/pdf/reeusp/v46n2/a01v46n2.pdf>. Acesso em: 25 mar. 2018.PIRES, Marília Freitas de Campos. Multidisciplinaridade, interdisciplinaridade e transdisciplinaridade no ensino. Interface - Comunicação, Saúde, Educação. UNESP, v. 2, n. 2, p. 173-182, 1998. Disponível em: <http://hdl.handle.net/11449/30363>. Acesso em: 20 mar. 2018.POMBO, Olga. Interdisciplinaridade e integração dos saberes. Liinc em Revista, v.1, n.1, p.3-15, 2005. Disponível em: <http://www.ibict.br/liinc>. Acesso em: 26 out. 2016.SANTOS, Boaventura de Sousa. V. Um discurso sobre as ciências. 5ed. São Paulo: Cortez, 2008. 93p.SCHWARTZMAN, Ulises Prieto y; MARTINS, Valney Claudino Sampaio; FERREIRA, Luciana Souto; GARRAFA, Volnei. Interdisciplinaridade: referencial indispensável ao processo de ensino-aprendizagem da bioética. Rev. Bioética, Brasília, n.25, v.3, p.536-43, 2017. Disponível em: <http://repositorio.unb.br/handle/10482/30900>. Acesso em: 25 mar. 2018.SEVERINO, Antônio Joaquim. Metodologia do trabalho científico. 21ed. São Paulo: Cortês, 2000. 320p.THIESEN, Juares da Silva. A interdisciplinaridade como um movimento articulador no processo ensino-aprendizagem. Rev. Bras. Educ., Rio de Janeiro, v. 13, n. 39, p. 545-554, dez. 2008. Disponível em: <http://www.redalyc.org/articulo.oa?id=275 03910>. Acesso em: 29 mar. 2018.TONET, Ivo. Interdisciplinaridade, formação humana e emancipação humana. Serv. Soc. Soc., São Paulo, n.116, p. 725-742, dez. 2013. Disponível em: <www.scielo.br/pdf/sssoc/n116/08 .pdf>. Acesso em: 26 out. 2016.VEIGA, Ilma Passos Alencastro. O seminário como técnica de ensino socializado. In: VEIGA, Ilma Passos Alencastro (org). Técnicas de ensino: por que não? Campinas: Papirus, 1991. p.103-113.VELLOSO, Marta Pimenta; GUIMARÃES, Maria Beatriz Lisbôa; CRUZ, Claudio Roberto Rodrigues; NEVES, Teresa Cristina Carvalho. Interdisciplinaridade e formação na área de Saúde Coletiva. Trab. Educ. Saúde, Rio de Janeiro, v.14 n.1, p.257-271, jan. / abr. 2016. Disponível em: <http://www.scielo.br/pdf/tes/v14n1/1981-7746-tes-14-01-0257.pdf>. Acesso em: 25 mar. 2018.WEIGERT, Célia; VILLANI, Alberto; FREITAS, Denise. A interdisciplinaridade e o trabalho coletivo. Ciência & Educação, Bauru, v.11, n.1, p.145-164, 2005. Disponível em: <www.scielo.br/pdf/ciedu/v11n1/12.pdf>. Acesso em: 25 mar. 2018.

One of the most important areas of mathematics education that must be developed from a young age is geometry. Various studies state that arithmetic, geometry, and measurement are three mathematical disciplines that must be prioritized in early childhood education. This research aims to determine the effect of the Somatic, Auditory, Visual, and Intellectual (SAVI) learning model on the geometric abilities of children aged 5-6 years. This research uses a pre-experimental experimental method with a one-group pretest-posttest design. The sample in this study was 18 children aged 5-6 years old Harapan Bunda Kindergarten Pancung Sol Pesisir Selatan. Data collection was obtained from observation and documentation, then the data was analyzed using paired sample tests. The results obtained in this research are that the SAVI model can improve the geometric abilities of children aged 5-6 years. This is known from the results of the paired sample t-test, which obtained a significance value of 0.000 < 0.05, which means Ho is rejected and Ha is accepted so that children's initial mathematical abilities, geometry, increase through the SAVI learning model. Children may become actively involved in their education with the help of the SAVI learning model, particularly when it comes to teaching them geometric forms. Because the teacher may utilize real items to aid in learning, children can recognize and retain the geometric forms around them as they grow older. Keywords: SAVI learning model, geometry ability, early childhood References: Alfiani, D. A. (2016). Penerapan Model Pembelajaran SAVI (Somatis, Auditori, Visual, Intelektual) Terhadap Hasil Belajar Aanak Usia Dini. Jurnal Pendidikan Anak, 2(1), 1-15. https://www.syekhnurjati.ac.id/jurnal/index.php/awlady/article/view/763 Amineh, R. J., & Asl, H. D. (2015). Review Of Constructivism And Social Constructivism. Journal of Social Sciences, Literature and Languages, 1(1), 9-16. Andrianti, R. Y., Irawati, R., & Sudin, A. (2016). Pengaruh Pendekatan SAVI (Somatic, Auditory, Visual, Intellectual) Dalam Meningkatkan Kemampuan Komunikasi Matematis Dan Motivasi Belajar Siswa Sekolah Dasar Pada Materi Pengolahan Data. Jurnal Pena Ilmiah, 1(1), 471-480. https://ejournal.upi.edu/index.php/penailmiah/article/view/2976 Birel, G. K., Deniz, D., & Onel, F. (2020). Analysis of primary school teachers’knowledge of geometry. International Electronic Journal of ElementaryEducation, 12(4), 303-309. Dewi, D. M. T., Masitoh, S., & Bachri, B. S. (2019). Improve Language And Cognitive Ability Through SAVI Learning Model With Lego Media For Preschool Child In Group A. Advances in Social Science, Education and Humanities Research, 212, 715-719. http://doi.org/10.2991/icei-18.2018.162 Elia, I., & Heuvel-panhuizen, M. V. D., & Gagatsis, A. (2018). Geometry Learning in the Early Years : Developing Understanding of Shapes and Space with a Focus on Visualization. 73–95. http://doi.org/10.1007/978-981-10-7153-9_5 Gejard, G., & Melander, H. (2018). Mathematizing in preschool: Children’sparticipation in geometrical discourse. European Early ChildhoodEducation Research Journal, 26(4), 495-511. Gilmore, J. H., Knickmeyer, R. C., & Gao, W. (2018). Imaging Structural And Functional Brain Development In Early Childhood. Nature Review: Neuroscience. 19, 123-137. Gohel, K. (2020). A Study of effectiveness of auditory learning style instructional strategy on science achievement with reference to study habit. Purakala (UGC Care Journal), 31(4), 412-420. Hardy, J. K., & Hemmeter, M. L. (2019). Systematic Instruction of Early Math Skill For Preschoolers At Risk For Math Delays. Topics in Early Childhood Special EducationI, 38(4), 234-247. https://doi.org/10.1177/0271121418792300 Hariawan, R., Nurul, U., Muhammad, H. A. Y., & Imron, A. (2019). Contributions Management of Parenting and Education Program to Strengthen The Service Three Early Childhood Education Center. International Education Studies. 12 (2). http://doi.org/10.5539/ies.v12n2p100 Hosain,M., & Wiest,L.R. (2013). Collaborative Middle School Geometry Through Blogs And Otherweb 2.0 Technologies. Journal of Computers in Mathematics and Science Teaching, 32(3), 337–352. https://eric.ed.gov/?id=EJ1006190 Hwang, W. Y., Hoang, A., & Tu, Y. (2019). Exploring Authentic Contexts With Ubiquitous Geometry To Facilitate Elementary School Students’ Geometry Learning. The Asia-Pacific Education Researcher, 29, 269-283. https://doi.org/10.1007/s40299-019-00476-y Hwang, W. Y., Liu, Y. F., Purba, S. W. D., & Zhang, Y. Y. (2018). Investigation On The Effects Of Measuring Authentic Contexts On Geometry Learning. IEEE Transactions on Learning Technologies, 12, 291-302. Ivrendi, A., Erol, A., & Atan, A. (2018). Developing a test for geometry andspatial perceptions of 5-6 year old. Kastamonu Education Journal, 26(6). Kencanawati, S. A. M. M., Sariyasa, S., & Hartawan, I. G. N. Y. (2020). Pengaruh penerapan model pembelajaran SAVI (Somatic, Auditory, Visual, Intellectual) terhadap kemampuan berpikir kreatif matematis. Pythagoras: Jurnal Pendidikan Matematika, 15(1), 13–23. https://doi.org/10.21831/pg.v15i1.33006 Lee, J. E. (2017). Preschool Teachers’ Pedagogical Content Knowledge In Mathematics. International Journal of Early Childhood. 49, 229-243. Meier, D. (2000). The Accelerated Learning Handbook A Creative Guide To Designing And Delivering Faster, More Effective Training Programs. United Kingdom: McGraw-Hill. Murti, E. D., Nasir, N., & Negara, H. S. (2019). Analisis Kemampuan Pemecahan Masalah Matematis : Dampak Model Pembelajaran SAVI ditinjau dari Kemandirian Belajar Matematis. Desimal: Jurnal Matematika, 2(2), 119–129.https://doi.org/10.24042/djm.v2i2.4072. National Research Council. (2009). Mathematics Learning In Early Childhood: Paths Toward Excellence And Equity.Washington, DC : National Academies Press. Ozcakir, B., Konca, A. S., & Arikan, N. (2019). Children’s Geometric Understanding Through Digital Activities: The Case Of Basic Geometric Shapes. International Journal of Progressive Education, 15(3), 108-122. Parks, A. N. (2015). Exploring Mathematics Through Play In The Early Childhood Classroom. Teachers College Press. Partini, K. E., Wirya, I. N., & Ujianti, P. R. (2017). Pengaruh Metode Proyek Terhadap Kemampuan Mengenal Bentuk Geometri Pada Kelompok B Gugus I Singaraja Semester I. e-Journal Pendidikan Anak Usia Dini: Universitas Pendidikan Ganesha, 5(2), 210-219. https://ejournal.undiksha.ac.id/index.php/JJPAUD/article/view/12606/12967 Pauli, C., & Reusser, K. (2015). Co-constructivism in educational theory andpractice. International Encyclopedia of the Social and Behavioral Sciences.(Second Edition). 913-917 Raiyn, J. (2016). The Role of Visual Learning in Improving Students’ High-Order Thinking Skills. Journal of Education and Practice, 7(24), 115-121. http://iiste.org/Journals/index.php/JEP/article/view/32607/33498. Reeve, R. A. (2019). Mathematical Learning And Its Difficulties In Australia. International Handbook of Mathematical Learning Difficulties, 253–264. http://doi.org/10.1007/978-3-319-97148-3 _16 Rohman, N., Rustono., & Rifa’i, A. (2016). Cooperative Learning Model To Increasing Mathematical Concept For Early Childhood. Indonesian Journal of Early Childhood Education Studies, 5(1), 54-58. https://doi.org/10.15294/ijeces.v5i1.11277 Sahara, R., Mardiyana., & Saputro, D. R. S. (2018). Discovery Learning With SAVI Approach In Geometry Learning. Journal of Physics: Conference Series, 1013, 1-5. https://iopscience.iop.org/article/10.1088/1742-6596/1013/1/012125 Sarnoko., Ruminiarti., & Setyosari, P. (2016). Penerapan Pendekatan SAVI Berbantuan Video Pembelajaran Untuk Meningkatkan Aktivitas Dan Hasil Belajar IPS Siswa Kelas IV SDN I Sanan Girimarto Wonogiri. Jurnal Pendidikan, 1(7), 1235-1241. http://journal.um.ac.id/index.php/jptpp/article/view/6524 Selmi, A. M., Gallagher, R. J., & More-Flores, E. R. (2014). Early Childhood Curriculum For All Learners: Integrating Play And Literacy Activities. SAGE Publications. Septia, P., Pandra, V., & Mandasari, N. (2023). Penerapan Model Pembelajaran SAVI Dalam Pembelajaran Bangun Ruang Untuk Mengukur Hasil Belajar Matematika, Journal of Elemantary School (JOES), 6(2), 468-476. https://doi.org/10.31539/joes.v6i2.6661 Shoimin, A. (2014). 68 Model Pembelajaran Inovatif Dalam Kurikulum 2013. Yogyakarta: Ar-ruzz Media. Sulaksana, Y. T., Margunayasa, I. G., & Wibawa, I. M. C. (2018). Pengaruh ModelPembelajaran SAVI (Somatic Auditory Visualization Intellectualy) Berbantuan LKS terhadap Hasil Belajar IPA. Jurnal Pedaagogi Dan Pembelajaran, 1(3).http://dx.doi.org/10.23887/jisd.v3i3.18895. Thersia, V., Arifuddin, M., & Misbah. (2019). Meningkatkan kemampuanpemecahan masalah melalui pendekatan somatis auditori visual intelektual(SAVI) dengan model pengajaran langsung. Berkala Ilmiah PendidikanFisika, 7(1), 19-27. Tutak, F. A., & Adams, T. L. (2015). A study of geometry content knowledge ofelementary preservice teachers. International Electronic Journal ofElementary Education, 7(3), 301-318. Utami, W. S., & Sri, I. H. (2023). Pengembangan Model Stimulasi Geometri Berbasis Pendekatan SAVI (Somatic, Auditory, Visual, Intellectual) untuk Anak Usia Dini. Jurnal PG-PAUD Trunojoyo: Jurnal Pendidikan dan Pembelajaran Anak Usia Dini, 10(1), 25-36. https://doi.org/10.21107/pgpaudtrunojoyo.v10i1.18879 Wijaya, I. K. P., Bayu, G. W., & Sumantri, M. (2021). Model Pembelajaran Somatis, Auditory, Visualization, Intellectualy (SAVI) Berbantuan Icebreaker Terhadap Hasil Belajar IPA Siswa. Jurnal Ilmiah Pendiddikan Profesi Guru, 4(1), 54-60. http://dx.doi.org/10.23887/jippg.v4i1 Yudiari, M. M., Parmiti, D. P., & Sudana, D. N. (2015). Pengaruh Model Pembelajaran SAVI Berbantuan Media Mind Mapping Terhadap Hasil Belajar IPA Siswa Kelas V. MIMBAR PGSD Undiksha, 3(1). http://dx.doi.org/10.23887/jjpgsd.v3i1.5683. Yuliana, D., & Sisma, R. U. A. (2019). Penerapan Model Pembelajaran Savi (Somatis,Auditori, Visual, Dan Intelektual) Untuk Meningkatkan Minat Dan Hasil BelajarPeserta Didik. Jurnal Pendidikan Dan Kewirausahaan, 7(1).https://doi.org/10.47668/pkwu.v7i1.19.

Insects represent a relevant didactic resource to work with artistic skills, concepts, attitudes and values in the Science teaching because they are diversified in forms and colors, and because they have different life styles. However, there are relatively few reports of experience with evidence of their importance as a didactic resource. In this sense, our main aims were to describe and analyze: (1) the perceptions of seventh-year elementary school students of a public school in Uberlândia-MG, Brazil, about insects; and (2) a didactic sequence in which insects are used to work concepts, artistic skills, attitudes and values, such as respect for life. In 2018, we applied and analyzed 47 questionnaires with five questions about insects; and after we prepared a didactic sequence to stimulate student’s learning through strategies such as reading, dictionary use, research, expository lecture, and drawing. We noticed that most students knew at least one insect, although they had little information on insects’ scientific and ecological importance. We also noticed from the reports, participation, and evaluation of the students that the didactic sequence was useful on several competencies abovementioned, suggesting that the use of different types of strategies can stimulate students to become interested and participate actively in the classes. Therefore, insects represent an excellent didactic resource to work conceptual, procedural and attitudinal concepts in Science teaching.ResumoPor serem diversificados em formas e cores, e também por possuírem variados modos de vida, os insetos representam um relevante recurso didático para trabalhar com habilidades artísticas, conceitos, atitudes e valores no ensino de Ciências. Contudo, há relativamente poucos relatos de experiência com evidências da importância deles como recurso didático. Neste contexto, os principais objetivos deste relato foram descrever e analisar: (1) as percepções de estudantes do sétimo ano do Ensino Fundamental de uma escola pública de Uberlândia-MG quanto aos insetos; e (2) uma sequência didática em que os insetos são utilizados para trabalhar conceitos, habilidades artísticas, atitudes e valores, como o respeito à vida. Em 2018 foram aplicados e analisados, em uma perspectiva quali-quantitativa, 47 questionários com cinco questões sobre os insetos. Depois, foi desenvolvida uma sequência didática envolvendo leitura com uso de dicionário, pesquisa, aula expositiva dialogada, momento musical e confecção de desenhos. De maneira geral, os questionários evidenciaram que a maior parte dos estudantes foi capaz de reconhecer pelo menos um tipo de inseto, embora soubessem pouco sobre sua importância científica e ecológica. Notou-se também, pelos relatos, participação, avaliação dos estudantes e comportamento deles para com os insetos, que a sequência didática foi útil para trabalhar as diferentes competências acima mencionadas, o que sugere que o uso dos insetos junto com variados tipos de estratégias pode estimular os estudantes a se interessarem e participarem ativamente das aulas. Portanto, os insetos representaram um excelente recurso didático para trabalhar conteúdos conceituais, procedimentais e atitudinais no ensino de Ciências.ResumenPor ser diversificados en formas y colores, y también por sus variados modos de vida, los insectos representan un relevante recurso didáctico para trabajar con habilidades artísticas, conceptos, actitudes y valores en la enseñanza de las Ciencias. Sin embargo, hay relativamente pocos relatos de experiencia con evidencias de su importancia como recurso didáctico. En este contexto, los principales objetivos de este estudio fueron: (1) describir y analizar las percepciones de estudiantes del séptimo año de la Enseñanza Fundamental de una escuela pública de Uberlândia-MG en cuanto a los insectos; y (2) describir una secuencia didáctica en la que los insectos se utilizan para trabajar conceptos, habilidades artísticas, actitudes y valores, como el respeto a la vida. En el año 2018 se aplicaron y analizaron 47 cuestionarios con cinco preguntas sobre los insectos y luego se preparó y analizó una secuencia didáctica que involucra lectura con uso de diccionario, investigación, clase expositiva dialogada y confección de dibujos. En general, los cuestionarios evidenciaron que la mayor parte de los estudiantes fue capaz de reconocer al menos un tipo de insecto, aunque supieron poco sobre su importancia científica y ecológica. Se ha notado también, por los relatos, participación y evaluación de los estudiantes, que la secuencia didáctica ha sido útil para trabajar diferentes competencias, lo que sugiere que el uso de variados tipos de estrategias puede estimular a los estudiantes a interesarse y participar activamente en las clases. Por lo tanto, los insectos representan un excelente recurso didáctico para trabajar contenidos conceptuales, procedimentales y actitudinales en la enseñanza de las Ciencias.Palavras-chave: Ensino de Ciências, Insetos na educação básica, Metodologias ativas, Recurso didático.Keywords: Active methodologies, Didactic resource, Insects in elementary school, Science teaching.Palabras claves: Enseñanza de Ciencias, Insectos en la educación básica, Metodologías activas, Recurso didáctico.ReferencesALMEIDA-NETO, José Rodrigues; COSTA-NETO, Eraldo Medeiros; SILVA, Paulo Roberto Ramalho; BARROS, Roseli Faria Melo. Percepções sobre os insetos em duas comunidades rurais da Serra do Passa-Tempo, Nordeste do Brasil. Revista Espacios, v. 36, n. 11, 2015.BRAGA; Ima Aparecida; VALLE, Denise. Aedes aegypti: histórico do controle no Brasil. Epidemiologia e Serviços de Saúde, v. 16, n. 2, 113-118, 2007.BRASIL. Ministério da Educação. Secretaria da Educação Básica. LDB: Lei de diretrizes e bases da educação nacional. Brasília: Senado Federal, Coordenação de Edições Técnicas, 2017. 58 p. Disponível em: http://www2.senado.leg.br/bdsf/bitstream/handle/id/529732/lei_de_diretrizes_e_bases_1ed.pdf. Acesso em: fev. 2018.BRASIL. Ministério da Educação. Secretaria da Educação Básica. BNCC: Base Nacional Comum Curricular. Brasília, DF, 2018. Disponível em: http://basenacionalcomum.mec.gov.br/wp-content/uploads/2018/02/bncc-20dez-site.pdf. Acesso em: fev. 2018.CARRECK Norman; WILLIAMS Ingrid. The economic value of bees in the UK. Bee World, v. 79, n. 3, p.115-23, 1998.COSTA, Marco Antonio Ferreira; COSTA, Maria Fátima Barrozo.; LIMA, Maria Conceição Almeida Barbosa.; LEITE, Sidnei Quezada Meireles. O desenho como estratégia pedagógica no ensino de ciências: o caso da biossegurança. Revista Electrónica de Enseñanza de las Ciencias, v. 5, n. 1, 2006.COSTA-NETO, Eraldo Medeiros. Manual de etnoentomología. Zaragoza: Manuales & Tesis SEA, 2002.COSTA-NETO, Eraldo Medeiros; CARVALHO, Paula Dib de. Percepção dos insetos pelos graduandos da Universidade Estadual de Feira de Santana, Bahia, Brasil. Acta Scientiarum, v. 22, n. 2, p. 423-428, 2000.COSTA-NETO, Eraldo Medeiros; RODRIGUES, Rosalina Maria Fatima Ribeiro. As formigas (Insecta: Hymenoptera) na concepção dos moradores de Pedra Branca, Santa Terezinha, estado da Bahia, Brasil. Boletín Sociedad Entomológica Aragonesa, n. 37, 353-364, 2005.DICKE, Marcel. Insects in western art. American Entomologist, v. 46, 228-236, 2000.DICKE, Marcel. From Venice to Fabre: insects in western art. Proceedings of the Netherlands Entomological Society, v. 15, 9-14, 2004.GALLO, Domingos; NAKANO, Octavio; NETO, Sinval Silveira; CARVALHO, Ricardo Pereira Lima; BAPTISTA, Gilberto Casadei; BERTI-FIHO, Evoneo; PARRA, José Roberto Postali; ZUCCHI, Roberto Antonio; ALVES, Sérgio Batista; VENDRAMIM, José Djair; MARCHINI, Luis Carlos; LOPES, João Roberto Spotti.; OMOTO, Celso. Entomologia Agrícola. Piracicaba: FEALQ, 2002. 920 p.GOULD, James L.; GOULD, Carol Grant. The honey bee. Scientific American Library, New York, 1988.GRIMALDI, David; ENGEL, Michael S. Evolution of the insects. New York: Cambridge University Press, 2005. 755p.GULLAN, Penny J.; CRANSTON, Peter S. The insects: an outline of entomology. 4 ed. Oxford: Willey Blackwell, 2010.HICKMAN, Cleveland P. Junior; ROBERTS, Larry S.; LARSON, Allan. Princípios Integrados de Zoologia. Rio de Janeiro: Guanabara Koogan, 2016.LENKO, Karol; PAPAVERO, Nelson. Insetos no Folclore. São Paulo: Secretaria de Cultura, Ciência e Tecnologia do Estado de São Paulo, 1979. 518p.LOZOYA, Xavier; BERNAL-IBAÑEZ, Sergio. A cien años de la Zoología medica de Jesús Sánchez. México: Instituto de Seguridad y Servicios Sociales de Los Trabajadores Del Estado, 1993.MACEDO, Indira Maria Estolano; VELOSO, Rodrigo Rossetti; MEDEIROS, Henri Adso Ferreira; PADILHA, Maria Rosário Fátima; FERREIRA, Gêneses Silva Ferreira; SHINOHARA, Neide Kazue Sakugawa. Entomophagy in different food cultures. Revista Geama, v. 3, n. 2, 58-62, 2017.MACÊDO, Margarete Valverde.; MONTEIRO, Ricardo Ferreira; FLINTE, Vivian; GRENHA, Viviane; GRUZMAN, Eduardo; NESSIMIAN, Jorge Luiz; MASUDA, Hatisaburo. Insetos na Educação Básica. Volume único. Rio de Janeiro: Fundação CECIERJ, 2009.MACHADO, Elaine Ferreira; MIQUELIN, Awdry Feisser. A construção coletiva de um insetário virtual inspirada na obra de Maria Sibylla Merian (1647-1717) e mediada pelos smartphones e o aplicativo instagram. Revista Tecnológica na Educação, ano 8, n. 14, 2016.MARTINS, Isabel; OGBORN, Jon; KRESS, Gunther. Explicando uma explicação. Ensaio: Pesquisa e Educação em Ciências, v. 1, n 1, 1-14, 1999.MATOS, Claudia Helena Cysneiros; OLIVEIRA, Carlos Romero Ferreira; SANTOS, Maria Patrícia França; FERRAZ, Célia Siqueira. Utilização de modelos didáticos no ensino de entomologia. Revista de Biologia e Ciências da Terra, v. 9, n. 1, 2009.PATTERSON, Jessica M.D.; SAMMON, Maura M.D.; GARG, Manish M.D. Dengue, zika and chikungunya: emerging arboviruses in the New world. Western Journal of Emergency Medicine, v. 17, n. 6, 671-679, 2016.PERRENOUD, Philippe. Construir as competências desde a escola. Porto Alegre: ARTMED, 1999.PINHO, Luiz C. Bringing taxonomy to school kids: Aedokritus adotivae sp. n. from Amazon (Diptera: Chironomidae). Zootaxa, v. 4399, n. 4, 586-590, 2018.PRICE, Peter W.; DENNO, Robert F.; EUBANKS, Micky D.; FINKE, Deborah L.; KAPLAN, Ian. Insect Ecology: behavior, populations and communities. New York: Cambridge University Press, 2011. 764p.RABAAN, Ali A; BAZZI, Ali M.; AL-AHMED, Shamsah H.; AL-GRAITH, Mohamed H.; AL-TAWFIQ, Jaffar A. Overwiew of zika infection, epidemiology, transmission and control measures. Journal of Infections and Public Health, v. 10, p. 141-149, 2017.SALLES, Frederico F.; MASSARIOL, Fabiana C.; NASCIMENTO, Jeane M.C.; BOLDRINI, Rafael; RAIMUNDI, Erikcsen A.; ANGELI, Kamila B.; SOUTO, Paula. Ephemeroptera do Brasil, 2004. Disponível em: http://ephemeroptera.com.br/. Acesso em: fev. 2019.SÁNCHEZ-BAYO, Francisco; WYCKUYS, Kris A.G. Worldwide decline of the entomofauna: a review of its drivers. Biological Conservation, v. 232, 8-27, 2019.SANTOS, Danielle Caroline de Jesus; SOUTO, Leandro Sousa. Coleção entomológica como ferramenta facilitadora para a aprendizagem de Ciências no ensino fundamental. Scientia Plena, v. 7, n. 5, 2011.SOUSA-LOPES, Bruno. Sobre o uso de uma coleção entomológica como ferramenta didática no ensino médio noturno e a percepção de fatores que influenciam o baixo rendimento escolar. Experiências em Ensino de Ciências, v. 12, n. 8, 250-260, 2017.SOUSA-LOPES, Bruno; ALVES-DA-SILVA, Nayane. O saber – Ciências e Biologia. Blog Científico, 2012. Disponível em: http://osaberciencias.blogspot.com/p/ciencia-com-arte.html. Acesso: fev. 2019.SOUZA, Matheus. Em São Paulo, projeto da USP empresta insetários para escolas públicas. Jornal da USP, 2018. Disponível em: jornal.usp.br/?p=200706. Acesso: fev. 2019.STORK, Nigel E. How many species of insects and other arthropods are there on earth? Annual Review of Entomology, v. 63, n. 1, 31-45, 2018.TRINDADE, Oziel S.N; SILVA JÚNIOR, Juvenal C; TEIXEIRA, Paulo M.M. Um estudo das representações sociais de estudantes do ensino médio sobre os insetos. Revista Ensaio, v. 14, n. 3, p. 37-50, 2012.WARDENSKI, Rosilaine F.; GIANNELLA, Tais R. Insetos no Ensino de Ciências: objetivos, abordagens e estratégias pedagógicas. In: XI Encontro Nacional de Pesquisa em Educação em Ciências, 2017, Florianópolis. ANAIS do XI Encontro Nacional de Pesquisa em Educação em Ciências, 2017. p. 1-10. 2017.WEISS, Harry B. The Scarabaeus of the Ancient Egyptians. The American Naturalist, v. 61, n. 675, 353-369, 1927.WILSON, Edward O. Biophilia: The human bond with other species. Cambridge, Mass.: Harvard University Press, 1984. 145p.ZABALA, A. A prática educativa: como ensinar. Porto Alegre: ArtMed, 1998. 224p.e3300078

Aerts, R. (1997). Nitrogen partitioning between resorption and decomposition pathways: a trade-off between nitrogen use efficiency and litter decomposability? Oikos, 80(3), 603−406. Ahmedna, M., Marshall, W. E. & Rao, R. O. (2000). Granular Activated Carbons from Agricultural By-Products: Preparation, Properties, and Application in Cane Sugar Refining. LSU AgCenter: Bulletin Number 869. Albiker, D. & Zweifel, R. (2019). Pflanzenkohle im Futter oder in der Einstreu und ihre Wirkung auf die Stickstoffretention und Leistung von Broilern. Wissenschaftstagung Ökologischer Landbau. Kassel: Stiftung Ökologie and Landbau, (15),276−283. Al-Kindi, A., Schiborra, A., Buerkert, A. & Schlecht, E. (2017). Effects of quebracho tannin extract and activated charcoal on nutrient digestibility, digesta passage and faeces composition in goats. Journal of Animal Physiology and Animal Nutrition, 101(3), 576−588. Alshannaq, A. & Yu, J. H. (2017). Occurrence, toxicity, and analysis of major mycotoxins in food. Australian Veterinary Journal, 68(4), 146−148. Anukul, N. Vangnai, K. & Mahakarnchandkul, W. (2013) Significance of regulation limits in mycotoxin contamination in Asia and risk management programs at the national level. Journal of Food and Drug Analysis, 21(3), 227−241. Bakr, B. E. A. (2008). The effect of using citrus wood charcoal in broiler rations on the performance of broilers. An-Najah University Journal for Research − Natural Sciences, 22, 17−24. Beguin, F. & Frackowiak, E. (Eds.). (2009). Carbons for Electrochemical Energy Storage and Conversion Systems, (1st ed.). CRC Press. https://doi.org/10.1201/9781420055405 Benabdeljelil, K. & Ayachi, A. (1996). Evaluation of Alternative Litter Materials for Poultry. Journal of Applied Poultry Research, 5, 203−209. Berk, J. (2009). Einfluss der Einstreuart auf Prävalenz und Schweregrad von Pododermatitis beimännlichen Broilern. (Effect of litter type on prevalence and severity of pododermatitis in male broilers). Berliner und Münchener tierärztliche Wochenschrift, 7, 257−263. Bisson, M. G., Scott, C. B. & Taylor, C. A. (2001). Activated charcoal and experience affect intake of juniper by goats. Journal of Range Management, 54, 274−278. Bolan, N. S., Szogi, A. A., Chuasavathi, T., Seshadri, B., Rothrock, M. J. & Panneerselvam, P. (2010). Uses and management of poultry litter. World's Poultry Science Journal, 66(4), 673−698. Burdock, G. A. (1997). Encyclopedia of Food and Color Additives. Boca Raton: CRC. Cheng, C. H. & Lehmann, J. (2009). Ageing of black carbon along a temperature gradient. Chemosphere, 75(8), 1021−1027. Choi, J. S., Jung, D. S., Lee, J. H., Choi, Y. I. & Lee, J. J. (2012). Growth performance, immune response and carcass characteristics of finishing pigs by feeding stevia and charcoal. Korean Journal for Food Science of Animal Resources, 32(2), 228−233. Christophersen, A. B., Levin, D., Hoegberg, L. C., Angelo, H. R. & Kampmann, J. P. (2002). Activated charcoal alone or after gastric lavage: a simulated large paracetamol intoxication. British Journal of Clinical Pharamacology, 53, 312−317. Chu, G. M., Jung, C. K., Kim, H. Y., Ha, J. H., Kim, J. H., Jung, M. S., Lee, S. J., Song, Y., Ibrahim, R. I. H., Cho, J. H., Lee, S. S. & Song, Y. M. (2013a). Effects of bamboo charcoal and bamboo vinegar as antibiotic alternatives on growth performance, immune responses and fecal microflora population in fattening pigs. Animal Science Journal, 84, 113−120. Chu, G. M., Kim, J. H., Kang, S. N. & Song, Y. M. (2013b). Effects of dietary bamboo charcoal on the carcass characteristics and meat quality of fattening pigs. Korean Journal for Food Science of Animal Resources, 33(3), 348−355. Daković, A., Tomašević-Čanović, M., Dondur, V., Rottinghaus, G. E., Medaković, V. & Zarić, S. (2005). Adsorption of mycotoxins by organozeolites. Colloids and Surfaces B: Biointerfaces, 46(1), 20−25. Darren, J. M., Beth, B. & Juan, J. V. (2020). Use of biochar by sheep: Impacts on diet selection, digestibility, and performance. Journal of Animal Science, 98(12), 1−9. Davidson, E. A., Chorover, J. & Dail, D. B. (2003). A mechanism of abiotic immobilization of nitrate in forest ecosystems: the ferrous wheel hypothesis. Global Change Biology, 9(2), 228−236. Di Natale, F., Gallo, M. & Nigro, R. (2009). Adsorbents selection for aflatoxins removal in bovine milks. Journal of Food Engineering, 95(1), 186−191. Diaz, S. (2004). The plant traits that drive ecosystems: Evidence from three continents. Journal of Vegetation Science, 15, 295−304. https://doi.org/10.1111/j.1654-1103.2004.tb02266.x Erickson, P. S., Whitehouse, N. L. & Dunn, M. L. (2011). Activated carbon supplementation of dairy cow diets: Effects on apparent total tract nutrient digestibility and taste preference. American Registry of Professional Animal Scientists, 27, 428−434. European Biochar Foundation (EBC). (2012). European biochar certificate − guidelines for a sustainable production of biochar. Version 8.2 of 19th April 2019: Accessed: 30th September, 2021. European Biochar Foundation (EBC). (2018). Guidelines for EBC-feed certification. http://www.european-biochar.org/biochar/media/doc/ebc-feed.pdf: Accessed: 30th September, 2021. Feng, F., Yang, F., Rong, W., Wu, X., Zhang, J., Chen, S., He, Ch. & Zhou, J. M. (2012). A Xanthomonas uridine 5'-monophosphate transferase inhibits plant immune kinases. Nature, 485(7396), 114−118. Galvano, F., Pietri, A., Fallico, B., Bertuzzi, T., Scirè, S., Galvano, M. & Maggiore, R. (1996). Activated carbons: in vitro affinity for aflatoxin B1 and relation of adsorption ability to physicochemical parameters. Journal of Food Protection, 59(5), 545−550. Galvano, F., Piva, A., Ritiene, A. & Galvano, G. (2001): Dietary strategies to counteract the effects of mycotoxins: A review. Journal of Food Protection, 64, 120−131. Gerlach, A. & Schmidt, H. P. (2012). Pflanzenkohle in der Rinderhaltung. Ithaka Journal, 1, 80−84. Guo, J. & Lua, A. C. (2003). Textual and chemical properties of adsorbent prepared from palm shell by phosphoric acid activation. Materials Chemistry and Physics, 80, 114−119. Hagemann, N., Joseph, S., Schmidt, H., Kammann, C. I., Harter, J., Borch, T., Young, R. B., Varga, K., Taherymoosavi, S., Elliott, K. W., Albu, M., Mayrhofer, C., Obst, M., Conte, P., Dieguez, A., Orsetti, S., Subdiaga, E., Behrens, S. & Kappler, A. (2018). Organic coating on biochar explains its nutrient retention and stimulation of soil fertility. Nature Communications, 8(1), 163. Hansen, J., Sato, M. & Ruedy, R. (2012). Perception of climate change. Proceedings of the National Academy of Sciences, 109(37), E2415−E2423. Hatch, T. P., Al-Hossainy, E. & Silverman, J. A. (1982). Adenine nucleotide and lysine transport in Chlamydia psittaci. Journal of Bacteriology, 150(2), 662−670. Hinz, K. S. J., Schättler, J. K., Spindler, B. & Kemper, N. (2019). Foot pad health and growth performance in broiler chickens as affected by supplemental charcoal and fermented herb extract (FKE): An on-farm study. European Poultry Science, 83, 13. https://doi.org/10.2136/sssaspecpub63.2014.0043.5 Hinz, K., Stracke, J., Schättler, J. K., Kemper, N. & Spindler, B. (2019). Effects of Enriched Charcoal as Permanent 0.2 % Feed-Additive in Standard and Low-Protein Diets of Male Fattening Turkeys: An On-Farm Study. Animals, 9(8), 1−15. Huwig, A., Freimund, S., Käppeli, O. & Dutler. H. (2001). Mycotoxin detoxification of animal feed by different adsorbents. Toxicology Letters, 122, 179−188. International Biochar Initiative (IBI). (2015). Standardized product definition and product testing guidelines for biochar that is used in soil. International Journal of Environmental Research and Public Health, 14(6), 632. Islam, M. M., Ahmed, S. T., Kim, Y. J., Mun, H. S., Kim, Y. J. & Yang, C. J. (2014). Effect of sea tangle (Laminaria japonica) and charcoal supplementation as alternatives to antibiotics on growth performance and meat quality of ducks. Asian-Australasian Journal of Animal Sciences, 27(2), 217–224. Johnson, K. A. & Johnson, D. E. (1995). Methane emissions from cattle. Journal of Animal Science, 73, 2483−2492. Joseph, S., Pow, D., Dawson, K., Mitchell, D., Rawal, A., Hook, J., Taherymoosavi, S., Zwieten, L., Rust, J., Donne, S., Munroe, P., Pace,B., Graber, E., Thomas, T., Nielsen, S., Ye, J., Lin, Y., Pan, G., Li, L. & Solaiman, Z. (2015). Feeding biochar to cows: an innovative solution for improving soil fertility and farm productivity. Pedosphere, 25(5), 666−679. Kana, J. R., Teguia, A., Mungfu, B. M. & Tchoumboue, J. (2011). Growth performance and carcass characteristics of broiler chickens fed diets supplemented with graded levels of charcoal from maize cob or seed of Canarium schweinfurthii Engl. Tropical Animal Health Production, 43, 51−56. Keller, A., Litzelman, K., Wisk, L. E., Maddox, T., Cheng, E. R., Creswell, P. D. & Witt, W. P. (2012). Does the perception that stress affects health matter? The association with health and mortality. Health Psychology, 31(5), 677−684. DOI: 10.1037/a0026743 Kracke, F., Vassilev, I. & Krömer, J. O. (2015). Microbial electron transport and energy conservation − the foundation for optimizing bioelectrochemical systems. Frontiers in Microbiology, 6, 575. Kutlu, H. R., Ünsal, I. & Görgülü, M. (2001). Effects of providing dietary wood (oak) charcoal to broiler chicks and laying hens. Animal Feed Science Technology, 90(3), 213−226. Lavrentyev, A., Sherne, V., Semenov, V., Zhestyanova, L. & Mikhaylova, L. (2021). Use of activated charcoal feed supplement in diets of pigs. Earth and Environmental Science, 935. Lee, J. J., Park, S. H, Jung, D. S., Choi, Y. I. & Choi, J. S. (2011). Meat quality and storage characteristics of finishing pigs by feeding stevia and charcoal. Korean Journal for Food Science of Animal Resources, 31(2), 296−303. Leng, R. A. (2013). Interactions between microbial consortia in biofilms: a paradigm shift in rumen microbial ecology and enteric methane mitigation. Perspectives on Animal Biosciences. Animal Production Science, 54(5), 519−543. https://doi.org/10.1071/AN13381 Leng, R. A., Inthapanya, S. & Preston, T. R. (2012). Biochar reduces enteric methane and improves growth and feed conversion in local "Yellow" cattle fed cassava root chips and fresh cassava foliage. Livestock Research for Rural Development, 24, 11. Li, Y., Yu, S., Strong, J. & Wang, H. (2012). Are the biogeochemical cycles of carbon, nitrogen, sulfur, and phosphorus driven by the "FeIII-FeII redox wheel" in dynamic redox environments? Journal of Soils and Sediments, 12(5), 683−693. Louis, A., Mohammed, A., Andreas, B. & Regina, R. (2018). Influence of dietary wood charcoal on growth performance, nutrient efficiency and excreta quality of male broiler chickens. International Journal of Livestock Production, 9(10), 286−292. Mabe, L. T., Su, S., Tang, D., Zhu, W., Wang, S. & Dong, Z. (2018). The effect of dietary bamboo charcoal supplementation on growth and serum biochemical parameters of juvenile common carp (Cyprinus carpio L.). Aquaculture Research, 49(3), 1142−1152. Maenz, D. D. & Classen, H. L. (1998). Phytase activity in the small intestinal brush border membrane of the chicken. Poultry Science, 77, 557−563. Majewska, T., Mikulski, D. & Siwik, T. (2009). Silica grit, charcoal and hardwood ash in turkey nutrition. Journal of Elements, 14, 489−500. Majewska, T., Pyrek, D. & Faruga, A. (2011). A note on the effect of charcoal supplementation on the performance of Big 6 heavy torn turkeys. Journal of Animal Feed Science, 11, 135−141. McFarlane, Z. D., Myer, P. R., Cope, E. R., Evans, N. D., Bone, T. C., Bliss, B. E. & Mulliniks, J. T. (2017). Effect of biochar type and size on in vitro rumen fermentation of orchard grass hay. West Central Research and Extension Center, North Platte. 110 McHenry, J. M. (2010). There is no trade-off between speed and force in a lever system. Biology Letters, 7(6), 878−879. McKenzie, R. A. (1991). Bentonite as therapy for Lantana camara poisoning of cattle. Medical Toxicology and Adverse Drug Experience, 3(1), 33−58. McLennan, M. W. & Amos, M. L. (1989). Treatment of lantana poisoning in cattle [Lantana camara; activated charcoal]. Australia Veterinarian Journal, 4(3), 45. Mekbungwan, A., Yamauchi, K. & Sakaida, T. (2004b). Intestinal villus histological alterations in piglets fed dietary charcoal powder including wood vinegar compound liquid. Anatomia, Histologia, Embryologia, 33(1), 11−16. Mekbungwan, A. Thongwittaya, N. & Yamauchi, K. (2004a). Digestibility of soyabean and pigeon pea seed meals and morphological intestinal alterations in pigs. Journal of Veterinary and Medical Sciences, 66(6), 627−633. Mézes, M., Balogh, K. & Tóth, K. (2010). Preventive and therapeutic methods against the toxic effects of mycotoxins − a review. Acta Veterinaria Hungarica, 58(1), 1−17. Misihairabgwi, J. M., Ezekiel, C. N., Sulyok, M., Shephard, G. S. & Krska, R. (2017) Mycotoxin contamination of foods in Southern Africa: A 10-year review (2007 – 2016). Critical Reviews in Food Science and Nutrition, 59(1), 43−58. DOI: 10.1080/10408398.2017.1357003 Naumann, H. D., Muir, J. P., Lambert, B. D., Tedeschi, L. O. & Kothmann, M. M. (2013). Condensed tannins in the ruminant environment: a perspective on biological activity. Journal of Agricultural Sciences, 1, 8−20. Neuvonen, P. J. & Olkkola, K. T. (1988). Oral activated charcoal in the treatment of intoxications. Journal of Animal Science, 83(8), 1939−1947. O'Toole, A., Andersson, D., Gerlach, A., Glaser, B., Kammann, C. I., Kern, J., Kuoppamäki, K., Piva, A., Casadei, G., Pagliuca, G., Cabassi, E., Galvano, F., Solfrizzo, M., Riley, R. T. & Diaz, D. E. (2005). Qualitative analysis of volatile organic compounds on biochar. Chemosphere, 85(5), 869−882. Odunsi, A. A., Oladele, T. O., Olaiya, A. O. & Onifade, O. S. (2007). Response of broiler chickens to wood charcoal and vegetable oil based diets. World Journal of Agricultural Sciences, 3(5), 572−575. Oso, A. O., Akapo, O., Sanwo, K. A. & Bamgbose, A. M. (2014). Utilization of unpeeled cassava (Manihot esculenta Crantz) root meal supplemented with or without charcoal by broiler chickens. Journal of Animal Physiology and Animal Nutrition, 98, 431−438. Phongphanith, S. & Preston, T. R. (2018). Effect of rice-wine distillers' byproduct and biochar on growth performance and methane emissions in local "Yellow" cattle fed ensiled cassava root, urea, cassava foliage and rice straw. Livestock Research for Rural Development, 28, 178. Pirarat, N., Pinpimai, K., Endo, M., Katagiri, T., Ponpornpisit, A., Chansue, N. & Maita, M. (2011). Modulation of intestinal morphology and immunity in nile tilapia (Oreochromis niloticus) by Lactobacillus rhamnosus GG. Research in Veterinary Science, 91, 92−97. Piva, A., Casadei, G., Pagliuca, G., Cabassi, E., Galvano, F., Solfrizzo, M., Riley, R. T. & Diaz, D. E. (2005). Qualitative analysis of volatile organic compounds on biochar. Chemosphere, 85(5), 869−882. Prasai, T. P., Walsh, K. B., Bhattarai, S. P., Midmore, D. J., Van, T. T. H., Moore, R. J. & Stanley, D. (2016b). Biochar, bentonite and zeolite supplemented feeding of layer chickens alters intestinal microbiota and reduces campylobacter load. PLOS ONE, 11(4), 406. Prasai, T. P., Walsh, K. B., Bhattarai, S. P., Midmore, D. J., Van, T. T., Moore, R. J. & Stanley, D., (2016a). Biochar, bentonite and zeolite supplemented feeding of layer chickens alters intestinal microbiota and reduces Campylobacter Load, PLOS ONE, 11(4), 0154061. Quaiyum, M., Jahan, R., Jahan, N., Akhter, T. & Islam, M. S. (2014). Effects of bamboo charcoal added feed on reduction of ammonia and growth of Pangasius hypophthalmus. Journal of Aquaculture Research and Development, 5, 69−76. Radostits, O. M., Gay, C. C., Blood, D. C. & Hinchcliff, K. W. (2000). Veterinary Medicine: A textbook of cattle, sheep, pigs, goats and horses, nona edizione. Saunders, London, UK. Rafiu, T. A., Babatunde, G. M., Akinwumi, A. O., Akinboro, A., Adegoke, Z. A. & Oyelola, O. B. (2014). Assessment of activated charcoal vs synthetic toxin-binder on performance, nutrient utilization and meat-quality utilization of broilers fed infected diets. International Journal of Agriculture and Biosciences, 3(5), 219−224. Rao, S. V. R., Raju, M. V. L. N., Reddy, M. R. & Panda, A. K. 2004. Replacement of yellow maize with pearl millet (Pennisetum typhoides), foxtail millet (Setaria italica) or finger millet (Eleusine coracana) in broiler chicken diets containing supplemental enzymes. Asian-Australian Journal Animimal Sciences, 17(6), 836−842. Rao, S. B. N. & Chopra, R. C. (2001). Influence of sodium bentonite and activated charcoal on aflatoxin M1 excretion in milk of goats. Small Ruminant Research, 41(3), 203−213. Totusek, R. & W. M. Beeson, W. M. (1953). The Nutritive Value of Wood Charcoal for Pigs. Journal of Animal Science, 12(2), 271−281. https://doi.org/10.2527/jas1953.122271x Ruttanavut, J., Yamauchi, K., Goto, H. & Erikawa, T. (2009). Effects of dietary bamboo charcoal powder including vinegar liquid on growth performance and histological intestinal change in Aigamo ducks. International Journal of Poultry Science, 8(3), 229−236. Saleem, M., Law, A. D., Sahib, M. R., Pervaiz, Z. H. & Zhang, Q. (2018). Impact of root system architecture on rhizosphere and root microbiome. Rhizosphere, 6, 47−51. Scharman, E. J., Cloonan, H. A. & Durback-Morris, L. F. (2001). Home administration of charcoal: can mothers administer a therapeutic dose? The Journal of Emergency Medicine, 21(4), 357−361. Schirrmann, U. (1984). Aktivkohle und ihre Wirkung auf Bakterien und deren Toxine im Gastrointestinaltrakt. Silivong, P. & Preston, T. R. (2016). Supplements of water spinach (Ipomoea aquatica) and biochar improved feed intake, digestibility, N retention and growth performance of goats fed foliage of Bauhinia acuminata as the basal diet. Livestock Research for Rural Development, 28, 113. Sivilai, B., Preston, T. R., Leng, R. A., Hang, D. T. & Linh, N. Q. (2018). Rice distillers' byproduct and biochar as additives to a forage-based diet for growing Moo Lath pigs; effects on growth and feed conversion. Livestock Research for Rural Development, 30, 113. Soo, J., Malik, B. A., Turner, J. M., Persad, R., Wine, E., Siminoski, K. & Huynh, H. Q. (2013). Use of exclusive enteral nutrition is just as effective as corticosteroids in newly diagnosed pediatric Crohn's disease. Digestive Diseases and Sciences, 58(12), 3584−3591. DOI: 10.1007/s10620-013-2855-y. Epub 2013 Sep 12. PMID: 24026403. Spokas, K. A., Novak, J. M., Stewart, C. E., Cantrell, K. B., Uchimiya, M., DuSaire, M. G. & Ro, K. S. (2011). Qualitative analysis of volatile organic compounds on biochar. Chemosphere, 85, 869−882. Steiner, C., Das, K. C., Melear, N. & Lakly, D. (2010). Reducing nitrogen loss during poultry litter composting using biochar. Journal of Environment Quality, 39(4), 1236. Steiner, C., Teixeira, W. G., Lehmann, J., Nehls, T., de Macêdo, J. L. V., Blum, W. E. & Zech, W. (2007). Long term effects of manure, charcoal and mineral fertilization on crop production and fertility on a highly weathered Central Amazonian upland soil. Plant and Soil, 291(1), 275−290. Struhsaker, T. T., Cooney, D. O. & Siex, K. S. (1997). Charcoal consumption by Zanzibar red colobus monkeys: its function and its ecological and demographic consequences. International Journal of Primatology, 18(1), 61–72. Sun, J., Hippo, E. J., Marsh, H., O'Brien, W. S. & Crelling, J. C. (1997). Activated carbon produced from an Illinois Basin 1080 Coal. Carbon, 35, 341−352. Moe, T. Shunsuke, K., Manabu, I. & Yokoyama Saichiro, Y. (2010). Effects of Supplementation of Dietary Bamboo Charcoal on Growth Performance and Body Composition of Juvenile Japanese Flounder, Paralichthys olivaceus. Journal of the World Aquaculture Society, 255−262. Toth, J. D. & Dou, Z. (2016). Use and Impact of Biochar and Charcoal in Animal Production Systems. In Guo, M., He, Z. and Uchimiya, M., Eds., Agricultural and Environmental Applications of Biochar: Advances and Barriers, Soil Science Society of America, Inc., Madison, 199−224. Van Der Zee, F. P. & Cervantes, F. J. (2009). Impact and application of electron shuttles on the redox (bio) transformation of contaminants: a review. Biotechnology Advances, 27(3), 256−277. Van Der Zee, F. P., Bisschops, I. A. E., Lettinga, G. & Field, J. A. (2003). Activated carbon as an electron acceptor and redox mediator during the anaerobic biotransformation of azo dyes. Environmental Science and Technology, 37(2), 402−408. Van, D. T. T., Mui, N. T. & Ledin, I. (2006). Effect of method of processing foliage of Acacia mangium and inclusion of bamboo charcoal in the diet on performance of growing goats. Animal Feed Science and Technology, 30(3−4), 242−256. Weber, K. & Quicker, P. G. (2018). Properties of biochar. Fuel, 217, 240−261. Wild, M., Folini, D., Hakuba, M. Z., Schar, C., Seneviratne, S. I., Kato, S. Rutan, D., Ammann, C., Wood, E. F. & Kong-Langlo, G. (2015). The energy balance over land and oceans: an assessment based on direct observations and CMIP5 climate models. Climate Dynamics, 44, 3393−3429. https://doi.org/10.1007/s00382-014-2430-z Wittstock, U. & Gershenzon, J. (2002). Constitutive plant toxins and their role in defense against herbivores and pathogens. Current Opinion in Plant Biology, 5(4), 300−307. DOI: 10.1016/s1369-5266(02)00264-9. PMID: 12179963. Youssef, M. A., El-Khodery, S. A., El-deeb, W. M. & El-Amaiem, W. E. A. (2010). Ketosis in buffalo (Bubalus bubalis): clinical findings and the associated oxidative stress level. Tropical Animal Health and Production, 42, 1771−1777. Yu, L., Yuan, Y., Tang, J., Wang, Y. & Zhou, S. (2015). Biochar as an electron shuttle for reductive dechlorination of pentachlorophenol by Geobacter sulfurreducens. Scientific Reports, 5(1), 1−10.

Rapid urbanization rates impact significantly on the nature of Land Cover patterns of the environment, which has been evident in the depletion of vegetal reserves and in general modifying the human climatic systems (Henderson, et al., 2017; Kumar, Masago, Mishra, & Fukushi, 2018; Luo and Lau, 2017). This study explores remote sensing classification technique and other auxiliary data to determine LULCC for a period of 50 years (1967-2016). The LULCC types identified were quantitatively evaluated using the change detection approach from results of maximum likelihood classification algorithm in GIS. Accuracy assessment results were evaluated and found to be between 56 to 98 percent of the LULC classification. The change detection analysis revealed change in the LULC types in Minna from 1976 to 2016. Built-up area increases from 74.82ha in 1976 to 116.58ha in 2016. Farmlands increased from 2.23 ha to 46.45ha and bared surface increases from 120.00ha to 161.31ha between 1976 to 2016 resulting to decline in vegetation, water body, and wetlands. The Decade of rapid urbanization was found to coincide with the period of increased Public Private Partnership Agreement (PPPA). Increase in farmlands was due to the adoption of urban agriculture which has influence on food security and the environmental sustainability. The observed increase in built up areas, farmlands and bare surfaces has substantially led to reduction in vegetation and water bodies. The oscillatory nature of water bodies LULCC which was not particularly consistent with the rates of urbanization also suggests that beyond the urbanization process, other factors may influence the LULCC of water bodies in urban settlements. Keywords: Minna, Niger State, Remote Sensing, Land Surface Characteristics References Akinrinmade, A., Ibrahim, K., & Abdurrahman, A. (2012). Geological Investigation of Tagwai Dams using Remote Sensing Technique, Minna Niger State, Nigeria. Journal of Environment, 1(01), pp. 26-32. Amadi, A., & Olasehinde, P. (2010). Application of remote sensing techniques in hydrogeological mapping of parts of Bosso Area, Minna, North-Central Nigeria. International Journal of Physical Sciences, 5(9), pp. 1465-1474. Aplin, P., & Smith, G. (2008). Advances in object-based image classification. The International Archives of the Photogrammetry, Remote Sensing and Spatial Information Sciences, 37(B7), pp. 725-728. Ayele, G. T., Tebeje, A. K., Demissie, S. S., Belete, M. A., Jemberrie, M. A., Teshome, W. M., . . . Teshale, E. Z. (2018). Time Series Land Cover Mapping and Change Detection Analysis Using Geographic Information System and Remote Sensing, Northern Ethiopia. Air, Soil and Water Research, 11, p 1178622117751603. Azevedo, J. A., Chapman, L., & Muller, C. L. (2016). Quantifying the daytime and night-time urban heat island in Birmingham, UK: a comparison of satellite derived land surface temperature and high resolution air temperature observations. Remote Sensing, 8(2), p 153. Blaschke, T., Hay, G. J., Kelly, M., Lang, S., Hofmann, P., Addink, E., . . . van Coillie, F. (2014). Geographic object-based image analysis–towards a new paradigm. ISPRS Journal of Photogrammetry and Remote Sensing, 87, pp. 180-191. Bukata, R. P., Jerome, J. H., Kondratyev, A. S., & Pozdnyakov, D. V. (2018). Optical properties and remote sensing of inland and coastal waters: CRC press. Camps-Valls, G., Tuia, D., Bruzzone, L., & Benediktsson, J. A. (2014). Advances in hyperspectral image classification: Earth monitoring with statistical learning methods. IEEE signal processing magazine, 31(1), pp. 45-54. Chen, J., Chen, J., Liao, A., Cao, X., Chen, L., Chen, X., . . . Lu, M. (2015). Global land cover mapping at 30 m resolution: A POK-based operational approach. ISPRS Journal of Photogrammetry and Remote Sensing, 103, pp. 7-27. Chen, M., Mao, S., & Liu, Y. (2014). Big data: A survey. Mobile networks and applications, 19(2), pp. 171-209. Cheng, G., Han, J., Guo, L., Liu, Z., Bu, S., & Ren, J. (2015). Effective and efficient midlevel visual elements-oriented land-use classification using VHR remote sensing images. IEEE transactions on geoscience and remote sensing, 53(8), pp. 4238-4249. Cheng, G., Han, J., Zhou, P., & Guo, L. (2014). Multi-class geospatial object detection and geographic image classification based on collection of part detectors. ISPRS Journal of Photogrammetry and Remote Sensing, 98, pp. 119-132. Coale, A. J., & Hoover, E. M. (2015). Population growth and economic development: Princeton University Press. Congalton, R. G., & Green, K. (2008). Assessing the accuracy of remotely sensed data: principles and practices: CRC press. Corner, R. J., Dewan, A. M., & Chakma, S. (2014). Monitoring and prediction of land-use and land-cover (LULC) change Dhaka megacity (pp. 75-97): Springer. Coutts, A. M., Harris, R. J., Phan, T., Livesley, S. J., Williams, N. S., & Tapper, N. J. (2016). Thermal infrared remote sensing of urban heat: Hotspots, vegetation, and an assessment of techniques for use in urban planning. Remote Sensing of Environment, 186, pp. 637-651. Debnath, A., Debnath, J., Ahmed, I., & Pan, N. D. (2017). Change detection in Land use/cover of a hilly area by Remote Sensing and GIS technique: A study on Tropical forest hill range, Baramura, Tripura, Northeast India. International journal of geomatics and geosciences, 7(3), pp. 293-309. Desheng, L., & Xia, F. (2010). Assessing object-based classification: advantages and limitations. Remote Sensing Letters, 1(4), pp. 187-194. Dewan, A. M., & Yamaguchi, Y. (2009). Land use and land cover change in Greater Dhaka, Bangladesh: Using remote sensing to promote sustainable urbanization. Applied Geography, 29(3), pp. 390-401. Dronova, I., Gong, P., Wang, L., & Zhong, L. (2015). Mapping dynamic cover types in a large seasonally flooded wetland using extended principal component analysis and object-based classification. Remote Sensing of Environment, 158, pp. 193-206. Duro, D. C., Franklin, S. E., & Dubé, M. G. (2012). A comparison of pixel-based and object-based image analysis with selected machine learning algorithms for the classification of agricultural landscapes using SPOT-5 HRG imagery. Remote Sensing of Environment, 118, pp. 259-272. Elmhagen, B., Destouni, G., Angerbjörn, A., Borgström, S., Boyd, E., Cousins, S., . . . Hambäck, P. (2015). Interacting effects of change in climate, human population, land use, and water use on biodiversity and ecosystem services. Ecology and Society, 20(1) Farhani, S., & Ozturk, I. (2015). Causal relationship between CO 2 emissions, real GDP, energy consumption, financial development, trade openness, and urbanization in Tunisia. Environmental Science and Pollution Research, 22(20), pp. 15663-15676. Feng, L., Chen, B., Hayat, T., Alsaedi, A., & Ahmad, B. (2017). The driving force of water footprint under the rapid urbanization process: a structural decomposition analysis for Zhangye city in China. Journal of Cleaner Production, 163, pp. S322-S328. Fensham, R., & Fairfax, R. (2002). Aerial photography for assessing vegetation change: a review of applications and the relevance of findings for Australian vegetation history. Australian Journal of Botany, 50(4), pp. 415-429. Ferreira, N., Lage, M., Doraiswamy, H., Vo, H., Wilson, L., Werner, H., . . . Silva, C. (2015). Urbane: A 3d framework to support data driven decision making in urban development. Visual Analytics Science and Technology (VAST), 2015 IEEE Conference on. Garschagen, M., & Romero-Lankao, P. (2015). Exploring the relationships between urbanization trends and climate change vulnerability. Climatic Change, 133(1), pp. 37-52. Gokturk, S. B., Sumengen, B., Vu, D., Dalal, N., Yang, D., Lin, X., . . . Torresani, L. (2015). System and method for search portions of objects in images and features thereof: Google Patents. Government, N. S. (2007). Niger state (The Power State). Retrieved from http://nigerstate.blogspot.com.ng/ Green, K., Kempka, D., & Lackey, L. (1994). Using remote sensing to detect and monitor land-cover and land-use change. Photogrammetric engineering and remote sensing, 60(3), pp. 331-337. Gu, W., Lv, Z., & Hao, M. (2017). Change detection method for remote sensing images based on an improved Markov random field. Multimedia Tools and Applications, 76(17), pp. 17719-17734. Guo, Y., & Shen, Y. (2015). Quantifying water and energy budgets and the impacts of climatic and human factors in the Haihe River Basin, China: 2. Trends and implications to water resources. Journal of Hydrology, 527, pp. 251-261. Hadi, F., Thapa, R. B., Helmi, M., Hazarika, M. K., Madawalagama, S., Deshapriya, L. N., & Center, G. (2016). Urban growth and land use/land cover modeling in Semarang, Central Java, Indonesia: Colombo-Srilanka, ACRS2016. Hagolle, O., Huc, M., Villa Pascual, D., & Dedieu, G. (2015). A multi-temporal and multi-spectral method to estimate aerosol optical thickness over land, for the atmospheric correction of FormoSat-2, LandSat, VENμS and Sentinel-2 images. Remote Sensing, 7(3), pp. 2668-2691. Hegazy, I. R., & Kaloop, M. R. (2015). Monitoring urban growth and land use change detection with GIS and remote sensing techniques in Daqahlia governorate Egypt. International Journal of Sustainable Built Environment, 4(1), pp. 117-124. Henderson, J. V., Storeygard, A., & Deichmann, U. (2017). Has climate change driven urbanization in Africa? Journal of development economics, 124, pp. 60-82. Hu, L., & Brunsell, N. A. (2015). A new perspective to assess the urban heat island through remotely sensed atmospheric profiles. Remote Sensing of Environment, 158, pp. 393-406. Hughes, S. J., Cabral, J. A., Bastos, R., Cortes, R., Vicente, J., Eitelberg, D., . . . Santos, M. (2016). A stochastic dynamic model to assess land use change scenarios on the ecological status of fluvial water bodies under the Water Framework Directive. Science of the Total Environment, 565, pp. 427-439. Hussain, M., Chen, D., Cheng, A., Wei, H., & Stanley, D. (2013). Change detection from remotely sensed images: From pixel-based to object-based approaches. ISPRS Journal of Photogrammetry and Remote Sensing, 80, pp. 91-106. Hyyppä, J., Hyyppä, H., Inkinen, M., Engdahl, M., Linko, S., & Zhu, Y.-H. (2000). Accuracy comparison of various remote sensing data sources in the retrieval of forest stand attributes. Forest Ecology and Management, 128(1-2), pp. 109-120. Jiang, L., Wu, F., Liu, Y., & Deng, X. (2014). Modeling the impacts of urbanization and industrial transformation on water resources in China: an integrated hydro-economic CGE analysis. Sustainability, 6(11), pp. 7586-7600. Jin, S., Yang, L., Zhu, Z., & Homer, C. (2017). A land cover change detection and classification protocol for updating Alaska NLCD 2001 to 2011. Remote Sensing of Environment, 195, pp. 44-55. Joshi, N., Baumann, M., Ehammer, A., Fensholt, R., Grogan, K., Hostert, P., . . . Mitchard, E. T. (2016). A review of the application of optical and radar remote sensing data fusion to land use mapping and monitoring. Remote Sensing, 8(1), p 70. Kaliraj, S., Chandrasekar, N., & Magesh, N. (2015). Evaluation of multiple environmental factors for site-specific groundwater recharge structures in the Vaigai River upper basin, Tamil Nadu, India, using GIS-based weighted overlay analysis. Environmental earth sciences, 74(5), pp. 4355-4380. Koop, S. H., & van Leeuwen, C. J. (2015). Assessment of the sustainability of water resources management: A critical review of the City Blueprint approach. Water Resources Management, 29(15), pp. 5649-5670. Kumar, P., Masago, Y., Mishra, B. K., & Fukushi, K. (2018). Evaluating future stress due to combined effect of climate change and rapid urbanization for Pasig-Marikina River, Manila. Groundwater for Sustainable Development, 6, pp. 227-234. Lang, S. (2008). Object-based image analysis for remote sensing applications: modeling reality–dealing with complexity Object-based image analysis (pp. 3-27): Springer. Li, M., Zang, S., Zhang, B., Li, S., & Wu, C. (2014). A review of remote sensing image classification techniques: The role of spatio-contextual information. European Journal of Remote Sensing, 47(1), pp. 389-411. Liddle, B. (2014). Impact of population, age structure, and urbanization on carbon emissions/energy consumption: evidence from macro-level, cross-country analyses. Population and Environment, 35(3), pp. 286-304. Lillesand, T., Kiefer, R. W., & Chipman, J. (2014). Remote sensing and image interpretation: John Wiley & Sons. Liu, Y., Wang, Y., Peng, J., Du, Y., Liu, X., Li, S., & Zhang, D. (2015). Correlations between urbanization and vegetation degradation across the world’s metropolises using DMSP/OLS nighttime light data. Remote Sensing, 7(2), pp. 2067-2088. López, E., Bocco, G., Mendoza, M., & Duhau, E. (2001). Predicting land-cover and land-use change in the urban fringe: a case in Morelia city, Mexico. Landscape and urban planning, 55(4), pp. 271-285. Luo, M., & Lau, N.-C. (2017). Heat waves in southern China: Synoptic behavior, long-term change, and urbanization effects. Journal of Climate, 30(2), pp. 703-720. Mahboob, M. A., Atif, I., & Iqbal, J. (2015). Remote sensing and GIS applications for assessment of urban sprawl in Karachi, Pakistan. Science, Technology and Development, 34(3), pp. 179-188. Mallinis, G., Koutsias, N., Tsakiri-Strati, M., & Karteris, M. (2008). Object-based classification using Quickbird imagery for delineating forest vegetation polygons in a Mediterranean test site. ISPRS Journal of Photogrammetry and Remote Sensing, 63(2), pp. 237-250. Mas, J.-F., Velázquez, A., Díaz-Gallegos, J. R., Mayorga-Saucedo, R., Alcántara, C., Bocco, G., . . . Pérez-Vega, A. (2004). Assessing land use/cover changes: a nationwide multidate spatial database for Mexico. International Journal of Applied Earth Observation and Geoinformation, 5(4), pp. 249-261. Mathew, A., Chaudhary, R., Gupta, N., Khandelwal, S., & Kaul, N. (2015). Study of Urban Heat Island Effect on Ahmedabad City and Its Relationship with Urbanization and Vegetation Parameters. International Journal of Computer & Mathematical Science, 4, pp. 2347-2357. Megahed, Y., Cabral, P., Silva, J., & Caetano, M. (2015). Land cover mapping analysis and urban growth modelling using remote sensing techniques in greater Cairo region—Egypt. ISPRS International Journal of Geo-Information, 4(3), pp. 1750-1769. Metternicht, G. (2001). Assessing temporal and spatial changes of salinity using fuzzy logic, remote sensing and GIS. Foundations of an expert system. Ecological modelling, 144(2-3), pp. 163-179. Miller, R. B., & Small, C. (2003). Cities from space: potential applications of remote sensing in urban environmental research and policy. Environmental Science & Policy, 6(2), pp. 129-137. Mirzaei, P. A. (2015). Recent challenges in modeling of urban heat island. Sustainable Cities and Society, 19, pp. 200-206. Mohammed, I., Aboh, H., & Emenike, E. (2007). A regional geoelectric investigation for groundwater exploration in Minna area, north west Nigeria. Science World Journal, 2(4) Morenikeji, G., Umaru, E., Liman, S., & Ajagbe, M. (2015). Application of Remote Sensing and Geographic Information System in Monitoring the Dynamics of Landuse in Minna, Nigeria. International Journal of Academic Research in Business and Social Sciences, 5(6), pp. 320-337. Mukherjee, A. B., Krishna, A. P., & Patel, N. (2018). Application of Remote Sensing Technology, GIS and AHP-TOPSIS Model to Quantify Urban Landscape Vulnerability to Land Use Transformation Information and Communication Technology for Sustainable Development (pp. 31-40): Springer. Myint, S. W., Gober, P., Brazel, A., Grossman-Clarke, S., & Weng, Q. (2011). Per-pixel vs. object-based classification of urban land cover extraction using high spatial resolution imagery. Remote Sensing of Environment, 115(5), pp. 1145-1161. Nemmour, H., & Chibani, Y. (2006). Multiple support vector machines for land cover change detection: An application for mapping urban extensions. ISPRS Journal of Photogrammetry and Remote Sensing, 61(2), pp. 125-133. Niu, X., & Ban, Y. (2013). Multi-temporal RADARSAT-2 polarimetric SAR data for urban land-cover classification using an object-based support vector machine and a rule-based approach. International journal of remote sensing, 34(1), pp. 1-26. Nogueira, K., Penatti, O. A., & dos Santos, J. A. (2017). Towards better exploiting convolutional neural networks for remote sensing scene classification. Pattern Recognition, 61, pp. 539-556. Oguz, H., & Zengin, M. (2011). Analyzing land use/land cover change using remote sensing data and landscape structure metrics: a case study of Erzurum, Turkey. Fresenius Environmental Bulletin, 20(12), pp. 3258-3269. Pohl, C., & Van Genderen, J. L. (1998). Review article multisensor image fusion in remote sensing: concepts, methods and applications. International journal of remote sensing, 19(5), pp. 823-854. Price, O., & Bradstock, R. (2014). Countervailing effects of urbanization and vegetation extent on fire frequency on the Wildland Urban Interface: Disentangling fuel and ignition effects. Landscape and urban planning, 130, pp. 81-88. Prosdocimi, I., Kjeldsen, T., & Miller, J. (2015). Detection and attribution of urbanization effect on flood extremes using nonstationary flood‐frequency models. Water resources research, 51(6), pp. 4244-4262. Rawat, J., & Kumar, M. (2015). Monitoring land use/cover change using remote sensing and GIS techniques: A case study of Hawalbagh block, district Almora, Uttarakhand, India. The Egyptian Journal of Remote Sensing and Space Science, 18(1), pp. 77-84. Rokni, K., Ahmad, A., Solaimani, K., & Hazini, S. (2015). A new approach for surface water change detection: Integration of pixel level image fusion and image classification techniques. International Journal of Applied Earth Observation and Geoinformation, 34, pp. 226-234. Sakieh, Y., Amiri, B. J., Danekar, A., Feghhi, J., & Dezhkam, S. (2015). Simulating urban expansion and scenario prediction using a cellular automata urban growth model, SLEUTH, through a case study of Karaj City, Iran. Journal of Housing and the Built Environment, 30(4), pp. 591-611. Santra, A. (2016). Land Surface Temperature Estimation and Urban Heat Island Detection: A Remote Sensing Perspective. Remote Sensing Techniques and GIS Applications in Earth and Environmental Studies, p 16. Shrivastava, L., & Nag, S. (2017). MONITORING OF LAND USE/LAND COVER CHANGE USING GIS AND REMOTE SENSING TECHNIQUES: A CASE STUDY OF SAGAR RIVER WATERSHED, TRIBUTARY OF WAINGANGA RIVER OF MADHYA PRADESH, INDIA. Shuaibu, M., & Sulaiman, I. (2012). Application of remote sensing and GIS in land cover change detection in Mubi, Adamawa State, Nigeria. J Technol Educ Res, 5, pp. 43-55. Song, B., Li, J., Dalla Mura, M., Li, P., Plaza, A., Bioucas-Dias, J. M., . . . Chanussot, J. (2014). Remotely sensed image classification using sparse representations of morphological attribute profiles. IEEE transactions on geoscience and remote sensing, 52(8), pp. 5122-5136. Song, X.-P., Sexton, J. O., Huang, C., Channan, S., & Townshend, J. R. (2016). Characterizing the magnitude, timing and duration of urban growth from time series of Landsat-based estimates of impervious cover. Remote Sensing of Environment, 175, pp. 1-13. Tayyebi, A., Shafizadeh-Moghadam, H., & Tayyebi, A. H. (2018). Analyzing long-term spatio-temporal patterns of land surface temperature in response to rapid urbanization in the mega-city of Tehran. Land Use Policy, 71, pp. 459-469. Teodoro, A. C., Gutierres, F., Gomes, P., & Rocha, J. (2018). Remote Sensing Data and Image Classification Algorithms in the Identification of Beach Patterns Beach Management Tools-Concepts, Methodologies and Case Studies (pp. 579-587): Springer. Toth, C., & Jóźków, G. (2016). Remote sensing platforms and sensors: A survey. ISPRS Journal of Photogrammetry and Remote Sensing, 115, pp. 22-36. Tuholske, C., Tane, Z., López-Carr, D., Roberts, D., & Cassels, S. (2017). Thirty years of land use/cover change in the Caribbean: Assessing the relationship between urbanization and mangrove loss in Roatán, Honduras. Applied Geography, 88, pp. 84-93. Tuia, D., Flamary, R., & Courty, N. (2015). Multiclass feature learning for hyperspectral image classification: Sparse and hierarchical solutions. ISPRS Journal of Photogrammetry and Remote Sensing, 105, pp. 272-285. Tzotsos, A., & Argialas, D. (2008). Support vector machine classification for object-based image analysis Object-Based Image Analysis (pp. 663-677): Springer. Wang, L., Sousa, W., & Gong, P. (2004). Integration of object-based and pixel-based classification for mapping mangroves with IKONOS imagery. International journal of remote sensing, 25(24), pp. 5655-5668. Wang, Q., Zeng, Y.-e., & Wu, B.-w. (2016). Exploring the relationship between urbanization, energy consumption, and CO2 emissions in different provinces of China. Renewable and Sustainable Energy Reviews, 54, pp. 1563-1579. Wang, S., Ma, H., & Zhao, Y. (2014). Exploring the relationship between urbanization and the eco-environment—A case study of Beijing–Tianjin–Hebei region. Ecological Indicators, 45, pp. 171-183. Weitkamp, C. (2006). Lidar: range-resolved optical remote sensing of the atmosphere: Springer Science & Business. Wellmann, T., Haase, D., Knapp, S., Salbach, C., Selsam, P., & Lausch, A. (2018). Urban land use intensity assessment: The potential of spatio-temporal spectral traits with remote sensing. Ecological Indicators, 85, pp. 190-203. Whiteside, T. G., Boggs, G. S., & Maier, S. W. (2011). Comparing object-based and pixel-based classifications for mapping savannas. International Journal of Applied Earth Observation and Geoinformation, 13(6), pp. 884-893. Willhauck, G., Schneider, T., De Kok, R., & Ammer, U. (2000). Comparison of object oriented classification techniques and standard image analysis for the use of change detection between SPOT multispectral satellite images and aerial photos. Proceedings of XIX ISPRS congress. Winker, D. M., Vaughan, M. A., Omar, A., Hu, Y., Powell, K. A., Liu, Z., . . . Young, S. A. (2009). Overview of the CALIPSO mission and CALIOP data processing algorithms. Journal of Atmospheric and Oceanic Technology, 26(11), pp. 2310-2323. Yengoh, G. T., Dent, D., Olsson, L., Tengberg, A. E., & Tucker III, C. J. (2015). Use of the Normalized Difference Vegetation Index (NDVI) to Assess Land Degradation at Multiple Scales: Current Status, Future Trends, and Practical Considerations: Springer. Yu, Q., Gong, P., Clinton, N., Biging, G., Kelly, M., & Schirokauer, D. (2006). Object-based detailed vegetation classification with airborne high spatial resolution remote sensing imagery. Photogrammetric Engineering & Remote Sensing, 72(7), pp. 799-811. Zhou, D., Zhao, S., Zhang, L., & Liu, S. (2016). Remotely sensed assessment of urbanization effects on vegetation phenology in China's 32 major cities. Remote Sensing of Environment, 176, pp. 272-281. Zhu, Z., Fu, Y., Woodcock, C. E., Olofsson, P., Vogelmann, J. E., Holden, C., . . . Yu, Y. (2016). Including land cover change in analysis of greenness trends using all available Landsat 5, 7, and 8 images: A case study from Guangzhou, China (2000–2014). Remote Sensing of Environment, 185, pp. 243-257.

Resumen: El presente artículo se encuentra dividido en cinco apartados que permiten que su lectura y comprensión sea mucho más amigable. Es interesante y entender que el tema del terrorismo es un tema de naturaleza dinámica y cambiante, en el artículo se estudiara los diferentes tipos de terrorismo que existe y el impacto que ha tenido en el establecimiento de los estados de seguridad pública, así como la afectación a los derechos humanos de las personas y los regímenes jurídicos en los cuales se tipifica esta figura. Abstract: This article is divides into five sections that allow its reading and understanding to be much more user-friendly. It is interesting to understand that the issue of terrorism is a dynamic and changing issue, the article will study the different types of terrorism that exist and the impact it has had on the establishment of states of publica security as well as the impact to the human rights of persons and the legal regimes in which this figure is typified. Fuentes de consulta: Arendt H. (2006) Sobre la revolución, Madrid: Alianza. Báez Corona, J. F. (2015). El realismo mágico jurídico (recreación legal de una ficción literaria con especial referencia a Latinoamérica). Justicia. (28), 15-31. doi:http://dx.doi.org/10.17081/just.20.28.1032 Báez, J. (2021). Tradición contra innovación en los modelos de formación jurídica universitaria en México. Revista de Derecho. (56). 137-153. https://dx.doi.org/10.14482/dere.56.340 Bakke E. (2015) Terrorism and Conterterrorism studies, comparing theory and practice, Netherlands, Leiden University Press. Bobbio N. (2004) Estado, Gobierno y Sociedad por una teoría general de la política, México, Fondo de Cultura Económica. Caillois R. (1973) La cuesta de la guerra (trad.) Rufina Bórquez, México, Fondo de Cultura Económica. Coteño Muñoz A. (2018) “Terrorismo individual los atentados perpetrados por actores solitarios” Eunomía. Revista en Cultura de la Legalidad, número 15 Madrid, Universidad Carlos III. Donner, F. (2007) “Fight for God- But Do So with Kindness: Reflections on War, Peace, and Communal Identity in Early Islam”. In War and Peace in the Ancient World, Oxford. Blackwell. Durham M. (2000) The Christian right, the far right and the Boundaries of American Conservatism. Manchester: Manchester University Press. Dworkin R, (2013) “Foreword”, in Extreme Speech and Democracy, Oxford, Oxford University Press. Essig, C. (2001). Terrorism: Criminal Act of Act of War? Implications for National Security in the 21st Century. Pennsylvania: US Army War College. Foucault, M. (2009) Historia de la sexualidad 1. La voluntad de saber, México, Siglo XXI. Friedman B, H., Harper J, Preble C. (2010) Terrorizing ourselves. Why U.S. Counterterrorism Policy is Failing and How to Fix It. Washington D.C. Instituto Cato. Gallego, C. (2012). El concepto de seguridad jurídica en el Estado social. Revistas jurídicas. Vol 2, Núm 9, Recuperado de http://juridicas.ucaldas.edu.co/downloads/Juridicas9(2)_6.pdf Griset, P. L., Mahan, S. (2003) Terrorism in perspective, United States of America. Sage Publications Inc. González Calleja, E. (2013). El Laboratorio del Miedo, Madrid, Crítica. Habermas J. (1998) Derechos humanos y soberanía popular. Las versiones liberal y republicana, en Rafael del Águila, Fernando Val, Madrid, Alianza Habermas J. (1994) La desobediencia civil, piedra de toque del Estado democrático de Derecho, en Ensayos políticos, Barcelona, Península. Heydar S. (2017) Islamic Peace Ethics. Legitimate and Illegitimate Violence in Contemporary Islamic Thought. United States of America, Baden-Baden: NomosAschendorff Verlag. Hoffman B., Howard R. (2011) Terrorism and counterterrorism: Understandin the new security environment readings and interpretations: 4a eth, United States of America, Mcgraw-Hill. Hoffman, B. (2006). Inside Terrorism. New York: Columbia University Press. Jackson, R, et al., (2011) Terrorism. A Critical Introduction, New York, Palgrave Macmillian Jassies N. (2009) Mrinus Van Der Lubbe y el incendio del Reichstag. Trad., García Velasco C., España, Editorial Alikornio. Jellinek G (1954) Teoría Geenral de los Estados. Trad. Fernando de los Ríos. Buenos Aires, ed. Albatroz. Jenkins, B.M. (1975), "International Terrorism: A New Mode of Conflict", in Garitón D, y Schaerf C. Internactional Terrorism and World Security, Londres, Cromm Helm. Johnston, T. D. (1981). Selective costs and benefits in the evolution of learning. En J. S. Rosenblatt, R .A. Hinde, C. Beer y M. C. Busnel (Eds.). Advances of the study of behavior. New York: Academic Press Kilpatrick J (2020) Quand un état d’urgence temporarire devient permanent, le cas de la France. París, Transnational Institute. Khadduri, M. (1955) War and Peace in the Law of Islam. Baltimore, The Johns Hopkins Press. Kyrou, A. (2012). L’imaginaire des Anonymous, des luddites à V pour Vendetta. París Folis esssays Lasoen, K. (2018). “War of Nerves: The Domestic Terror Threat and the Belgian Army”. In Studies in Conflict & Terrorism, vol. 42, no. 11. Le Goff J. (1984) La Civilisation d l’occident médiéval, París, Foils Essay. Lillich, B. R. (1985) Paris Minimum Standards of Human Rights Norms in a State of Emergency, The American Journal of International Law, Vol. 79, No. 4 Locke J. (1997), Segundo tratado sobre el gobierno civil, Madrid, Alianza. Loubet Del Bayle, J. L. (1992) La Police. Approche socio-politique. Paris, Montchrestien. Luhmann, N. (2005) El derecho de la sociedad, 2a ed., México, Herder, Universidad Iberoamericana. Majoran, A. (2015). The illusion of war: Is terrorism a criminal act or an act of war? International Politics Reviews, Vol.3 Issue 1 Martin J-C, (2006) Les règles internationales relatives à la lutte contre le terrorismo. París, edición Bruylant. Nateras González M, E. (2018) Colombia Las autodefensas en Michoacán, México: ¿rescate de la ciudadanía ante la violencia? Revista Opinión Jurídica, Universidad de Medellín, Vol. 17, Núm. 33 Placido A. P., y Perkins L K. (2010) Drug Trafficking violence in México implications for the United States. Washington D.C. U.S. Senate Caucus on International Narcotics Control Departmente of Justice Poczynok, I. (2019). Fuerzas armadas y contraterrorismo. Apuntes para renovar un “debate crónico” en la Argentina. Revista Relaciones Internacionales, Estrategia Y Seguridad, vol. 2, Núm. 14 Poland J. (2004) Understanding Terrorism: Groups, Strategies and responses. New York. Pretince Hall. Rawls J (1999) La justificación de la desobediencia civil, en Justicia como equidad. Materiales para una teoría de la justicia, Madrid, Tecnos. Reinares, F y García-Calvo, C. (2016) Estado Islámico en España. Madrid: Real Instituto Elcano. Rivas, P., y Rey, P. (2008) Las autodefensas y el paramilitarismo en Colombia (1964-2003), Bogotá, CON Fines. Rapoport, D. (2004). “The four waves of modern terrorism”. En Audrey, C. y James, L. Attacking Terrorism: Elements of a Grand Strategy. Washington D.C. George town University Press Rodley N. (1985) International Human Rights Law, dans Evans, M. D, International Law, Oxford, Oxford University Press. Reitberger M (2013) “License to kill: is legitimate authority a requirement for just war? in International Theory, Cambridge, Cambridge University Press, Vol. 5, Issue 1. Robespierre Maximilien (2005) Por la felicidad y por la libertad, discursos. España, El viejo topo. Rousseau J. J., (2013) Discurso sobre el origen y fundamento de la desigualdad entre los hombres, Madrid, Calpe. Tinnes J. (2020) Bibliography: Defining and Conceptualizing Terrorism Compiled PERSPECTIVES ON TERRORISM Volume 14, Issue 6, The Netherlands Universiteit Leiden. recuperado de https://www.universiteitleiden.nl/perspectives-on-terrorism/archives/2020#volume-xiv-issue-6 Toboso Buezo M. (2020) Colección Segmentos de Seguridad Terrorismo y antiterrorismo. España. Institut de Seguretat Pública de Catalunya.. Saint Thomas Aquinas (2003) On law, morality and Politics, translated by Regan Richard United States of America, Hackett publishing company. Sinai, J. (2008) “How to Define Terrorism”, Perspectives on Terrorism, Journal of the Terrorism Research Initiative and the Center for Terrorism and Security Studies, The Netherlands, Universiteit Leiden, Vol. 2, No.4, recuperado de http://www.terrorismanalysts.com/pt/index.php/pot/article/view/33/html Skinner, B. F. (1953) Science and human behavior. New York, The Macmillan Company. United States Department of State. (2004) Patterns of Global Terrorism 2003 Washington, DC: Office of the Secretary of State, Office of the Coordinator for Counterterrorism. Valadés D. (1974) La dictadura constitucional en América Latina, México, UNAM. Walther T C., Höhn A., (2020) El ejército alemán y sus graves problemas con la ultraderecha. DW noticiero recuperado de https://www.dw.com/es/el-ej%C3%A9rcito-alem%C3%A1n-y-sus-graves-problemas-con-la-ultraderecha/a-54044495 Wallace, D. (2008). Combatiendo el terrorismo bajo las leyes de la guerra. Military Review Hispan-American, Vol. 88, Issue 2 Weber M. (1986) El político y el científico. (trad) Francisco Rubio Llorente, Madrid, Alianza Editorial.

RESUMENLa presente investigación ahonda en el tratamiento integral de fuentes geohistóricas textuales. Está basada en la recuperación, el análisis y la apertura de nuevas fórmulas de conocimiento científico abiertas y extensivas a la sociedad global. Entre 1850 y 1940 se elaboran en España más de cuatrocientas obras médicas (geografías o topografías médicas), bajo influencia de las teorías higienistas en el urbanismo y la sociedad en su conjunto, que constituyen unas fuentes de información y documentación enormemente valiosas, y relativamente poco estudiadas, para el conocimiento de los espacios, urbanos y rurales, de la época. El uso del método hipotético-deductivo, modelo de amplia utilización en las ciencias geográficas y las humanidades, ha establecido como hipótesis fundamental que el paisaje y el territorio, y la información contenida en las obras médico-geográficas “Datos médico-topográficos de Ciudad Rodrigo” (1899) y “Datos para la geografía médica de Ciudad Rodrigo” (1920), se utilizarán como base para el análisis de la información que, a escala geográfica, aporta esta tipología documental, estableciendo una metodología para la extracción de información geográfica contenida en documentación histórica. Con ello, se pretende optimizar el uso de fuentes secundarias de conocimiento sobre el territorio y la sociedad, teniendo en cuenta la variedad y cantidad de información que se puede extraer de ellos, abriendo, a la vez, una vía de investigación que liga la salubridad del territorio y las estrategias para abordar problemas territoriales desde la geografía humana e histórica. Palabras clave: fuentes geohistóricas, topografías médicas, higienismo urbano, naturalismo terapéuticoTopónimos: Ciudad Rodrigo (Salamanca)Periodo: siglos xix y xx ABSTRACT This research delves into the comprehensive treatment of textual geohistorical sources based on the recovery, analysis and opening of new formulas of scientific knowledge open and extensive to global society. Between 1850 and 1940, more than four hundred medical works (medical geographies or topographies) were produced in Spain under the influence of hygienist theories in urban planning and constituting society a source of valuable information and documentation relatively little studied for the knowledge of the urban and rural spaces of the time. The use of the hypothetical-deductive method, a model widely used in geographical sciences and humanities, has established as a fundamental hypothesis that landscape and the territory and the information contained in the Medical-geographical works “Medical-topographical Data of Ciudad Rodrigo” (1899) and “Data for the Medical Geography of Ciudad Rodrigo” (1920), will be used as a basis for the analysis of the information that, on a geographical scale, provides this documentary typology and proposes a methodology for the extraction of geographic information contained in historical documentation. With this, it is intended to optimize the use of secondary sources of knowledge about the territory and society considering the variety and amount of information that can be extracted from them and opening, at the same time, a path of research that links health of the territory and the strategies to the approach territorial problems from the human and historical geography. Keywords: geohistorical sources, medical topographies, urban hygiene, therapeutic naturalismPlace names: Ciudad Rodrigo (Salamanca)Period: 19th and 20th centuries REFERENCIASArroyo Ilera, F. y Camarero Bullón, C., “Water for Madrid: The Problems of Water Supply in a Pre-industrial Capital”, en The History of Water Management in the Iberian Peninsula. Trends in the History of Science. Berlin, Birkhäuser, Cham, 2019, pp. 67- 88.Beattie, J. “Imperial landscapes of health: Place, plants and people between India and Australia, 1800´s‐1900´s”, Health and History, 14-1, (2012), pp. 100-120.Brügelmann, J. “Observations on the Process of Medicalization in Germany, 1770-1830, Based on Medical Topographies”, Réflexions historiques, 9 (1-2) (1982), pp. 131-149.Cárdenes, V., Ponce de León, M., Rodríguez, X. A., y Rubio-Ordóñez, A. “Roofing Slate Industry in Spain: History, Geology, and Geoheritage”, Geoheritage, vol. 11-1, (2019), pp.19-34.Casco Solis, J. “Las topografías médicas: revisión y cronología”, Asclepio, vol. LIII-1, (2001), pp. 213-244.Chías Navarro, P. y Abad Moreno, T., “La construcción del territorio: los puentes en Castilla y León”, en Historia de las obras públicas en Castilla y León: ingeniería, territorio y patrimonio. Madrid, Colegio de Ingenieros de Caminos, Canales y Puertos, 2008, pp. 360-361. Chun, Y., Kwan, M.P. y Griffith, D.A. “Uncertainty and context in GIScience and geography: challenges in the era of geospatial big data”, International Journal of Geographical Information Science, 32, (2019), pp. 12-24.Comelles, J.M. “The Role of Local Knowledge in Medical Practice: A Trans-historical Perspective”. Cult Med Psychiatry, 24, (2000), pp. 39-73.D’Onofrio R. y Trusiani E., “The Need for New Urban Planning for Healthy Cities: Reorienting Urban Planning Towards Healthy Public Policy”, en Urban Planning for Healthy European Cities. Berlin, Springer, Cham, 2018, pp. 31-41.García Juan, L. y Vallina Rodríguez, A. “SIG y bases de datos. Oportunidades y retos en la transición de los sistemas tradicionales al big data”, Espacio Tiempo y Forma Serie VI Geografía, 12, (2019), pp. 135-158.García Juan, L., “Ciudad Rodrigo: al servicio del rey para la defensa de la frontera portuguesa”, en El Catastro de Ensenada. Magna Averiguación Fiscal para alivio de los vasallos y mejor conocimiento de los reinos (1749-1756). Ciudad Rodrigo, 1750. Madrid, Dirección General del Catastro, 2019, pp. 62-119. Griffin, C. “Historical Geography of Environment”, en International Encyclopedia of Human Geography. Elsevier, Londres, 2019, pp. 169-174.Gurrutxaga, M. “Geografía de la salud: aplicaciones en la planificación territorial y urbana”, Estudios geográficos, 280-286, (2019), pp. 2-18.Huzui, A. E., Călin, I. y Pătru-Stupariu, I. “Spatial Pattern Analyses of Landscape using Multi-Temporal Data Sources”, Procedia Environmental Sciences, 14, (2012), pp. 98-110.Jepson, W. “Of soil, situation, and Salubrity: Medical topography and medical officers in early nineteenth‐century British India”, Historical Geography, 32, (2004), pp. 137-155.Jori, G. “El estadio de la salud y la enfermedad desde una perspectiva geográfica: temas, enfoques y métodos”, Biblio 3W Revista bibliográfica de geografía y ciencias sociales, Vol. XVIII, n.º 1029, 15 de junio de 2013.Kearns, K.A. y Joseph, A.E. “Space in its place: Developing the link in medical geography”, Social Science Medicine, vol. 37-6, (1993), pp. 711-717.Lorenzo Briega, A., “Geografía médica española: Datos médicos topográficos de Ciudad Rodrigo”. Ciudad Rodrigo: Imp. de la Vda. e Hijos de Cuadrado, 1899, 102 pp. Oosterom, J. “The importance of hygiene in modern society”, International Biodeterioration Biodegradation, Volume 41, Issues 3–4, (1998), pp. 185-189.Parr, H. “Medical geography: critical medical and health geography?”, Progress in Human Geography, 22-2, (2004), pp. 246-257.Piovan S.E. “The Geohistorical Approach in Environmental and Territorial Studies”, en The Geohistorical Approach. Berlin, Springer Geography, 2020, pp. 5-37. Porras Galló, M. I. “Luchando contra una de las causas de invalidez: antecedentes, contexto sanitario, gestación y aplicación del decreto de vacunación obligatoria contra la viruela de 1903”. Asclepio, vol. LVI-1 (2004), pp. 145- 168.Prats, L. “La Catalunya rància les condicions de vida materials de les classes populars a la Catalunya de la Restauració segons les topografies mèdiques”. Barcelona, Ed. Alta Fulla, 1996.Sánchez Manzano, M., “Datos para la geografía médica de Ciudad Rodrigo”. Ciudad Rodrigo: Imp. De Vicente Cuadrado, 1929, 118 pp. Smyth, F. “Medical geography: understanding health inequalities”, Progress in Human Geography, 32-1 (2008), pp. 119-127.Urteaga, L. “La teoría de los climas y los orígenes del ambientalismo”, Geo Crítica, 99, (1993), pp. 5-55.— “Higienismo y ambientalismo en la medicina decimonónica”, Dynamis, V-VI, (1985), pp. 417- 425.— “Miseria, miasmas y microbios: Las topografías médicas y el estudio del medio ambiente en el siglo xix”, Geo Crítica, 5-29, (1890), pp.1-40.Vallina Rodríguez, A. “La provincia de Salamanca en el siglo xviii”, en El Catastro de Ensenada. Magna averiguación fiscal para alivio de los vasallos y mejor conocimiento de los reinos (1749-1756): Ciudad Rodrigo 1750. Dirección General de Catastro. Ministerio de Hacienda y Función Pública, 2019, pp. 48- 61.Vallina Rodríguez, A. Macedo Ruiz, E. C. y Camarero Bullón, C. “Medical Topographies: Sources for the Evolutionary Study of Territory and Landscape”, Human Geographies, 14-1 (2020), pp. 21-38.

Background and Aims: Dukan diet, a popular diet with high content of protein and carbohydrate and fat restriction has been widely used for weight loss. We aimed to compare the effects of the Dukan diet with traditional low-calorie diet in nutritional, laboratory and vascular parameters in obese subjects. Methods and Results: Obese subjects classes I or II of both genders, aging 19 to 65 years were allocated into two groups: Traditional low-calorie diet (n=17) and Dukan Diet (n=17). Anthropometric, laboratory and vascular evaluations were performed at baseline, 3, 6 and 12 months. Body composition was evaluated by bioelectric impedance and endothelial function by flow-mediated dilation of the brachial artery, at same times. After 12 months, it was verified that Dukan diet was more effective (p<0.05) than traditional diet for: weight loss (-10.6 vs -2.9 kg), body mass index (-3.7 vs -1.1 kg/m2), waist circumference (-11.2 vs -2.1 cm), fat (-5.7 vs -2.0 kg) and lean mass (-4.8 vs 0.8 kg) and basal metabolic rate (-152 vs -28 cal). In Dukan diet group, improvement (p<0.05 vs baseline) was observed in triglyceride levels (172.40 to 111.90 mg/dL) and insulin resistance, based on HOMA-IR index (4.98 to 3.26). The glomerular filtration rate decreased in this group after 3 months (132.50 to 113.80 mL/min) and no changes in flow-mediated dilation were observed throughout the study with both diets. Conclusion: Dukan diet was more effective than traditional diet for weight loss and laboratory parameters and without changes in endothelial function, in the 12-months follow-up of obese subjects. Introduction Low-carbohydrate diets have been one of the most recently used dietary therapies in patients with diabetes and obesity in clinical studies(1). Among them, in addition to carbohydrate restriction, fat restriction and high protein concentration, as in the Diet Dukan, has been widely used by the general population, aiming at weight loss. The Dukan diet is designed to reduce carbohydrate and fat intake in the first phase of the diet, with exclusive intake of protein, followed by another Three phases, with progressive and slow reintroduction of other nutrients such as fiber, carbohydrates and fats. In recent years, there has been increasing interest in the effectiveness of very low carbohydrate diets, called ketogenic diets, in the effectiveness of weight loss in order to combat obesity and cardiovascular disease risk(2). In this diet, ketone bodies are formed and they are used as an alternative energy source in the absence of glucose. Ketogenic diet promotes weight loss reducing appetite, increasing satiety and thermogenesis, due to the high protein consumption(3) affect hormones that control appetite, such as ghrelin and leptin(4) reduces lipogenesis and increases lipolysis(5,6) and gluconeogenesis(7). Replacing carbohydrates by proteins in the diet have been the aim of several studies but with inconsistent results. High protein intake has positive effects on weight loss, acting on satiety, body composition, lipid profile and glucose homeostasis. Furthermore, it increases thermogenesis, energy expenditure(8) and the elevation in the amino acid level in the plasma acts on the satiety center, decreasing appetite, since amino acids also stimulate insulin secretion resulting in decreased or maintained blood glucose levels(9). Few studies have been published with Dukan diet. Freeman et al. were the first to publish an article with the Dukan Diet in 2014, describing adverse effects in one patient undergoing this diet(10). Nouvenne et al. reviewed studies about the influence of popular diets on kidney stone formation risk. In this article, the authors suggest that in the Dukan diet, due to the high consumption of animal protein, urinary calcium can increase and the citrate urinary excretion can decrease, increasing the risk of kidney stone formation(11). In 2015, Wyka et al. evaluated dietary consumption in women adopting the Dukan-diet, based on the menu consumed in each of 4 phases of diet. They observed weight loss of around 15 kg after 8 to 10 weeks of diet and higher intake of proteins, mainly of animal origin, high consumption of potassium, iron and vitamins A, D and B2 and reduced consumption of carbohydrates, vitamin C and folates. They suggest that this diet may be harmful to health if adopted for a long time, developing of kidney and liver disease, osteoporosis and cardiovascular disease(12). Considering that the Dukan Diet is widely disseminated and it is used by the population in general for weight loss and few scientific studies are found in the literature, we propose to evaluate the nutritional, laboratory parameters related to cardiovascular disease, comparing this diet with traditional hypocaloric diet in obese individuals. Methods Study design This study was a clinical trial with nutritional intervention, for one year. Patients were recruited from the Lipids, Atherosclerosis and Vascular Biology Division of the Universidade Federal de São Paulo (UNIFESP). The study conforms to the ethical guidelines and approval was obtained from the ethics committee and it was registered in the Brazilian Registry of Clinical Trials. All participants provided written informed consent and received no monetary incentive. A total of 40 subjects were initially recruited and the participants were followed up clinically by a cardiologist and nutritionist during the 12-month period with monthly visits. Of the 40 participants who started the study, 34 completed the 12-month follow-up, whose data are presented in this study. The inclusion criteria were: both genders, aging 19-65 years old, obesity grade I or II (body mass index between 30 kg/m² and 39.9 kg/m²), stable body weight in the previous 3 months and desire to lose weight. The main exclusion criteria were: patients in primary or secondary prevention of coronary heart disease with low-density lipoprotein cholesterol (LDL-C) levels greater than 190 mg/dL and triglycerides greater than 400 mg/dL; diabetes mellitus; untreated hypothyroidism; psychiatric and hepatic disease; chronic renal failure; cardiac and respiratory insufficiency; systemic infections; use of antidepressants, corticoids, diuretics and diabetes medications; bariatric surgery, cancer and failure to accept the conditions necessary to conduct the research. Two groups were constituted: Traditional low-calorie diet (TD): n=17, 14 females and 3 males, 45±11 years old, 90±11 Kg body weight and body mass index (BMI) 34±2Kg/m2; High protein/Low carbohydrate diet-Dukan Diet (DD): n=17, 10 females and 7 males, 38±11 years old, 95±9 Kg of body weight and BMI 34±2 Kg/m2. The TD group received orientations according to the Food Guideline for the Brazilian Population, with 1 500–1 800 calories/day. They were stimulated to improve healthy eating habits increasing the consumption of natural foods without preservatives, such as vegetables and fruits rich in fiber and antioxidants. Daily consumption of fruits and vegetables at meals was recommended; carry out the fractionation of the meals throughout the day, avoiding prolonged fasting. Hydration and regular physical activity were recommended, according to healthier life habits(13). The DD group followed the high-protein/low-carbohydrate diet as proposed by Dukan Diet, available at https://www.dietadukan.com.br and received an illustrated book about this diet(14). This diet is structured in four phases: two for weight loss (1st and 2nd phases) and two for weight maintenance (3rd and 4th phases): 1st stage - Attack: For 5 consecutive days, it is allowed to consume only proteins with lean meats, eggs, light cheese and milk, 1.5 tablespoons of oat bran per day and light physical activity for 20 minutes. 2nd stage - Cruise: This phase is maintained until the desired weight loss. The vegetables are introduced alternating with the pure protein day (first stage). It is recommended 2 tablespoons of oat bran per day and light physical activity for 30 minutes. 3rd phase - Consolidation: The time of this phase is equivalent to 10 days per kg of lost weight. In this stage carbohydrates and lipids are introduced by a controlled and moderate way, being divided in two parts: in the first part, corresponding to half of the period to be followed, is allowed: 1 fruit, 2 slices of bread (50 g) or 1 spoon of farinaceous per day and 1 gala dinner per week. In the second part, it is allowed 2 fruits, 4 slices of bread (100 g) or 2 spoons of farinaceous per day and 2 gala dinners per week. This phase has one rule: make one day of the week with pure protein (first stage) and it is recommended 2.5 tablespoons of oat bran per day and light physical activity for 35 minutes. 4th phase - Stabilization: In this phase, three rules must to be followed: one day a week it should follow up the pure protein diet, the daily consumption of 3 tablespoons of oat bran and at least 40 minutes of daily walking. From this phase, the participants followed up the low calorie diet. The adherence of the participants was monitored by the interview with the nutritionist and qualitative evaluation of ketone bodies in the urine, using Labtest UriAction 10 reagent strips. At baseline, 3, 6 and 12 months, the following evaluations were performed: nutritional assessment determining anthropometry, blood samples were collected for laboratory tests. Endothelial function was evaluated in fasting and 2-hours post prandial situations. In the periods between the predetermined visits, the participants were followed up by the nutritionist monthly and by telephone contact whenever requested and with medical attention whenever necessary. Nutritional evaluation Nutritional assessment was performed by anthropometric determinations of weight, height, BMI, abdominal circumference and bioelectric impedance (BIA). BIA was carried out using the Biodynamics Model 450 TBW® apparatus, with portable plethysmograph and patients were instructed according to the manufacturer's instruction(15). Laboratory parameters Peripheral blood samples were collected for dosages of total cholesterol and fractions, triglycerides, glucoses, insulin, iron, ferritin, ALT, AST, urea, creatinine, hemoglobin and hematocrit. Biochemical parameters were determined through the automated colorimetric enzymatic method in Cobas Mira® (Roche, Switzerland) and LDL-c was estimated by the Friedewald equation. Serum insulin concentration was determined by immunofluorometry and the insulin resistance calculated by the HOMA-IR – Homeostasis Model Assessment Insulin Resistance, and values ≥ 2.5 values were considered as presence of insulin resistance(16). Glomerular Filtration Rate (GFR) was estimated by the Cockroft-Gault equation adapted to obese patients(17). Endothelial function Endothelial function was assessed by Endothelial-dependent flow-mediated dilation (FMD) of the brachial artery(18), using an ultrasound system (Sonos5500; Hewlett-Packard-Phillips, Palo Alto, CA), equipped with vascular software for two-dimensional imaging, color and spectral Doppler ultrasound modes, internal electrocardiogram monitor and linear-array transducer with a frequency range from 7.5 to 12.0 MHz. FMD evaluation was performed in two stages: fasted at least 6 hours and 2 hours after the consumption of a small meal, according to each diet. These meals were consisted of 374.04 calories, 36g proteins, 16g carbohydrates and 18g lipids in the DD and in TD, it was composed by 361.20 calories, 24g of protein, 41g of carbohydrates and 11g of lipids. Statistical Analysis The variables were expressed as mean and standard deviation. The distribution of the date normality was analyzed by the Kolmogorov-Smirmov (KS) test. When they did not present normal distribution, a logarithm [log(Y)] transformation was performed prior to analysis. The comparison between the variables of two groups was performed using Student's t-test for independent numerical variables and Fisher's exact test for categorical variables. Comparisons between more than two groups were performed by analysis of variance (ANOVA) for repeated measures, followed by the Tukey test, if differences were found. For the sample power calculation, the Statistical Software, Statistica Ultimate Academic, version 12.7, Concurrent Network was used. Values of p ≤ 0.05 were considered for statistical significance and analysis was performed using the software [GraphPadPrism 4.0 (GraphPad Software, San Diego, CA, USA)]. Results Participants’ characteristics At the beginning of the study, the groups were matched for age, gender, weight and BMI. At 3 months, all participants of DD group (100%) were in phase 2; at 6 months, 13 participants (76.4%) were in phase 3 and 4 (23.5%) in phase 2; and at 12 months, all (100%) were already in phase 4. The TD group followed the same recommendation during the 12 months. The qualitative evaluation of the presence of ketone bodies in the urine of the DD group participants, which were still in phase 2, was positive in 94% at 3rd month and 80% at the 6th month. The following adverse effects have been reported during the course of the study: weakness, fatigue, dizziness, lack of concentration, irritability, constipation, ketone breath and social life impairment. These symptoms were of low intensity and transient, especially in the early stages of the DD diet. These adverse effects were not causes for withdrawal from the study. Anthropometry The changes in body weight, BMI, waist abdominal circumference and BMR were more effective in DD than TD group during all follow-up evaluations. The changes after 12 months in relation to baseline of the anthropometric parameters in the DD and DT groups respectively were: Weight loss (-10.6 Kg, p<0.0001 and – 2.9 Kg, p<0.0001), BMI (-3.7 Kg/m2, p<0.0001 and -1.1 Kg/m2, p<0.0001), waist abdominal circumference (-11.2 cm, p<0.0001 and -2.1 cm, p=0.0008) and BMR (-152 cal, p<0.0001 and -28 cal, p=0.0198). After 12 months, the participants of DD group reached the overweight level but the TD group was still within the obesity range. Reductions were observed in both groups, in fat mass (-5.7 Kg, p<0.0001 and -2.0 Kg, p<0.0001), and in lean mass (-4.8 Kg, p<0.0001 and -0.8 Kg, p=0.0196, in DD and DT group, respectively). Laboratory parameters and endothelial function In TD group, there was only hematocrit reduction after 6 months (p=0.0103) and glucose level after 3 months (p=0.0021) compared to baseline. In DD group, laboratory alterations occurred in relation to hemoglobin, hematocrit, triglycerides, insulin, HOMA-IR and GFR. It was observed an improvement in the triglycerides levels (172.40 ± 62.36 mg/dL and 111.90 ± 43.22 mg/dL, p=0.0001) and insulin resistance determined by HOMA-IR at all times of study (4.98 ± 3.03 and 3.26 ± 2.03, p=0.0008) at baseline and 12 months, respectively. GFR was reduced only after 3 months (132.50 ± 31.13 and 113.80 ± 24.25 mL/min, p=0.0063) in the DD group. No differences were observed in endothelial function in the two study groups, in both fasting and postprandial. Discussion This study demonstrated higher weight loss in the Dukan diet group, compared to the traditional low calorie diet. The effect of weight loss in the DD group was persistent and remained until 6th month, but in 12 months it was observed a gain around 3.41 ± 0.21 Kg. The DD is performed in phases, with severe restriction until the 3rd phase and at about the 6th month; carbohydrates and a gala meal are reintroduced, promoting a weight gain. Sacks et al. observed that regardless of the nutritional composition of the diet, obese participants that had a weight loss, after 12 months of treatment, they can gain weight, but with a reduction of approximately 11.4% of the initial weight(19). We observed that participants of TD group also presented significant weight reduction, suggesting the effectiveness of the close follow up with nutritionist and physician. Abdominal circumference is an indirect parameter of fat mass corresponding to visceral fat that is associated with a higher risk for cardiovascular diseases. In our data, we observed a reduction in waist circumference in both groups after 12 months. Moreno et al. comparing ketogenic diet with standard diet in a group of obese patients found an important reduction in abdominal circumference with partial recovery after 24 months(20). Although DEXA Scan is considered the gold standard for body composition determination, BIA is a non-invasive and relatively inexpensive method and widely used(21). A significant reduction in the relative values of body fat was observed at 3 and 6 months in the DD group and only after 3 months in the TD. Increase in percent of lean mass was observed in the DD group at 3 and 6 months, but this increase does not represent a gain of lean mass, since the relative increase is a result of the reduction of body weight, promoting a relative increase in the values of lean mass. The loss of lean mass in the DD group may be due to the low caloric intake of the diet, as Chaston et al. (2007) pointed out that diet with low-calorie diet promote marked weight loss, but there is a decline in lean mass resulting from this process(22) . In our study, in spite of consuming a large amount of protein, this nutrient alone is not enough to promote the maintenance of lean mass and exercise stimulation is still necessary, which did not happen in this study, since the participants were all sedentary. In obese individuals, weight gain after marked loss is common, with reduction in basal metabolic rate(23). Several studies have observed this phenomenon during rapid weight loss(24) and diets with low carbohydrate intake are among the factors that influence metabolic adaptation. Some studies suggest that low amounts of carbohydrate (<45%) decrease the basal metabolic rate during and after weight loss. This type of diet can promote fat mass loss and preservation of lean mass during weight loss, reducing the basal metabolic rate. Reduction in BMR was observed in both groups, but in the DD group, the reduction occurred at all times in relation to baseline whereas in TD group the reduction was greater only after 6 months of intervention. Improvement in insulin resistance and triglycerides were observed only in the DD group. Individuals with insulin resistance have greater difficulty to metabolize carbohydrates, diverting a greater amount of dietary carbohydrates to the liver, where much of it is converted to fat (lipogenesis), rather than being oxidized in energy in the skeletal muscle. For this reason, very low carbohydrate diets applied in obese individuals, in addition to leading to weight loss also improves glycemic and lipid control. The effects of the very prolonged ketogenic diet are still poorly investigated and for this reason this diet should only be used for a limited period (from 3 weeks to a few months) to stimulate fat loss, improve metabolism, and then adjusting a transition to a normal diet(25). No changes in levels of total cholesterol, HDL-c and LDL-c were observed in any group. However, only in the DD group there was a significant reduction in TG level. In general, diets with reduced carbohydrates and high levels of proteins and fats increase LDL-c and TG levels showing beneficial effects of the ketogenic diet on cardiovascular risk factors. Most studies show that reducing carbohydrates can bring significant benefits in reducing total cholesterol, increases in HDL-c and reduction of triglycerides in the blood. HMG-CoA reductase, a key enzyme in the synthesis of endogenous cholesterol is activated by insulin, so that a reduction in blood glucose and hence insulin levels, leads to lower cholesterol synthesis. Thus, a reduction in dietary carbohydrate associated with adequate cholesterol consumption leads to inhibition of cholesterol biosynthesis(26). When insulin is elevated, lipolysis is reduced and lipogenesis is increased, resulting in overproduction of VLDL containing TG, formation of small and dense LDL particles and reduction of HDL. Low concentrations of glucose and insulin also reduce the expression of the carbohydrate-sensitive response element binding protein (ChREBP) transcription factor, and expression of the binding protein of the sterol regulatory element (SREBP-1c), responsible for the synthesis of fatty acids, as well as their incorporation into triglycerides and phospholipids, activating the main lipogenic enzymes, reducing hepatic lipogenesis and VLDL production(27). When we evaluated the GFR, a reduction only in DD group was observed at 3 months of intervention, but still in normal reference levels. Our results did not show significant changes in serum creatinine levels, but GFR decrease in DD group. Carbohydrate-restricted diets have higher amounts of protein may affect glomerular filtration leading to progressive loss of renal function(28). In the study conducted by Brinkworfh et al. (2010), renal function was evaluated in 68 obese individuals without renal dysfunction who consumed two similar hypocaloric diets for one year, one with carbohydrate reduction and another with high carbohydrate content, and observed that creatinine serum levels and the GFR did not change in any of the dietary groups(29). In general, endothelial function improves after weight loss in obese individuals(30). However, associations between changes in endothelial function with anthropometric and biochemical parameters are still controversial(31). We observed that the endothelial function did not present a significant difference in the two study groups, both in fasting and in the 2 hours postprandial. Volek et al. (2009) observed that low-carbohydrate diet improves postprandial vascular function compared to a low-fat diet in overweight individuals with moderate hypertriglyceridemia(32). Low-carbohydrate diets, may improve vascular function in individuals with metabolic adaptations(32) and carbohydrate-restricted diets may induce benefits in endothelial function in the presence of insulin resistance, since impaired insulin action may be related to endothelial dysfunction. In our study, the meal offered for postprandial evaluation was not high in fat, but correspond to the diet proposed in each group. According to Nicholls et al. (2006), a single carbohydrate-restricted meal does not alter endothelial function(33) and this may be the reason we did not observe a change in endothelial function in the DD group in this study. Conclusion Comparing the nutritional and laboratory effects of traditional and hyper-protein diets with carbohydrate reduction, we can conclude that Dukan diet was more effective than traditional diet for weight loss, as well as for laboratory parameters and without changes in endothelial function, in the 12-months follow-up of obese subjects. Conflict of interest No conflict of interest. Acknowledgement Patricia Naomi Sakae had a scholarship from CAPES – Brazil. References Gogebakan O.; Kohl A.; Osterhoff MA.; van Baak MA.; Jebb SA.; Papadaki A.; et al. Effects of weight loss and long-term weight maintenance with diets varying in protein and glycemic index on cardiovascular risk factors: the diet, obesity, and genes (DiOGenes) study: a randomized, controlled trial. Circulation. 2011, 124(25), 2829-2838. Merino J.; Kones R.; Ferre R.; Plana N.; Girona J.; Aragones G.; et al. Low-carbohydrate, high-protein, high-fat diet alters small peripheral artery reactivity in metabolic syndrome patients. Clin Investig Arterioscler. 2014, 26(2), 58-65. Krieger JW.; Sitren HS.; Daniels MJ.; Langkamp-Henken B. Effects of variation in protein and carbohydrate intake on body mass and composition during energy restriction: a meta-regression 1. Am J Clin Nutr. 2006, 83(2), 260-274. Samaha FF.; Iqbal N.; Seshadri P.; Chicano KL.; Daily DA.; McGrory J.; et al. A low-carbohydrate as compared with a low-fat diet in severe obesity. N Engl J Med. 2003, 348(21), 2074-2081. Paoli A.; Rubini A.; Volek JS.; Grimaldi KA. Beyond weight loss: a review of the therapeutic uses of very-low-carbohydrate (ketogenic) diets. Eur J Clin Nutr. 2013, 67(8), 789-796. Nordmann AJ.; Nordmann A.; Briel M.; Keller U.; Yancy WS, Jr.; Brehm BJ.; et al. Effects of low-carbohydrate vs low-fat diets on weight loss and cardiovascular risk factors: a meta-analysis of randomized controlled trials. Arch Intern Med. 2006, 166(3), 285-293. Veech RL. The therapeutic implications of ketone bodies: the effects of ketone bodies in pathological conditions: ketosis, ketogenic diet, redox states, insulin resistance, and mitochondrial metabolism. Prostaglandins Leukot Essent Fatty Acids. 2004, 70(3), 309-319. Feinman RD.; Fine EJ. Nonequilibrium thermodynamics and energy efficiency in weight loss diets. Theor Biol Med Model. 2007, 4, 27. Veldhorst MA.; Westerterp-Plantenga MS.; Westerterp KR. Gluconeogenesis and energy expenditure after a high-protein, carbohydrate-free diet. Am J Clin Nutr. 2009, 90(3), 519-526. Freeman TF.; Willis B.; Krywko DM. Acute intractable vomiting and severe ketoacidosis secondary to the Dukan Diet(c). J Emerg Med. 2014, 47(4), e109-112. Nouvenne A.; Ticinesi A.; Morelli I.; Guida L.; Borghi L.; Meschi T. Fad diets and their effect on urinary stone formation. Transl Androl Urol. 2014, 3(3), 303-12. Wyka J.; Malczyk E.; Misiarz M.; Zolotenka-Synowiec M.; Calyniuk B.; Baczynska S. Assessment of food intakes for women adopting the high protein Dukan diet. Rocz Panstw Zakl Hig. 2015, 66(2), 137-42. Ministério da Saúde. Guia alimentar para a população brasileira: Promovendo a alimentação saudável. Brasília; 2006. Dukan P. O Método Dukan Ilustrado 1a edição ed. Rio de Janeiro; 2013. Heyward V Stolarczyk L. Métodos de dobras cutâneas. In: Heyward VV.; Stolarczyk LM. Avaliação da composição corporal aplicada. São Paulo; 2000. Sakae PN.; Ihara SS.; Ribeiro DA.; de Carvalho L.; Parise ER. Insulin resistance is associated with DNA damage in peripheral blood cells in non-diabetic patients with genotype 1 chronic hepatitis C. Free Radic Res. 2013, 47(9), 750-756. Salazar DE.; Corcoran GB. Predicting creatinine clearance and renal drug clearance in obese patients from estimated fat-free body mass. Am J Med. 1988, 84(6), 1053-1060. Fonseca HA.; Fonseca FA.; Monteiro AM.; Bianco HT.; Boschcov P.; Brandao SA.; et al. Obesity modulates the immune response to oxidized LDL in hypertensive patients. Cell Biochem Biophys. 2013, 67(3), 1451-1460. Sacks FM.; Bray GA.; Carey VJ.; Smith SR.; Ryan DH.; Anton SD.; et al. Comparison of weight-loss diets with different compositions of fat, protein, and carbohydrates. N Engl J Med. 2009, 360(9), 859-873. Moreno B.; Crujeiras AB.; Bellido D.; Sajoux I.; Casanueva FF. Obesity treatment by very low-calorie-ketogenic diet at two years: reduction in visceral fat and on the burden of disease. Endocrine. 2016, 54(3), 681-690. Matthie JR. Bioimpedance measurements of human body composition: critical analysis and outlook. Expert Rev Med Devices. 2008, 5(2), 239-261. Chaston TB.; Dixon JB.; O'Brien PE. Changes in fat-free mass during significant weight loss: a systematic review. Int J Obes (Lond). 2007, 31(5), 743-50. Muller MJ.; Bosy-Westphal A. Adaptive thermogenesis with weight loss in humans. Obesity (Silver Spring). 2013, 21(2), 218-228. Camps SG.; Verhoef SP.; Westerterp KR. Weight loss, weight maintenance, and adaptive thermogenesis. Am J Clin Nutr. 2013, 97(5), 990-994. Paoli A.; Bianco A.; Grimaldi KA.; Lodi A.; Bosco G. Long term successful weight loss with a combination biphasic ketogenic Mediterranean diet and Mediterranean diet maintenance protocol. Nutrients. 2013, 5(12), 5205-5217. Paoli A. Ketogenic diet for obesity: friend or foe? Int J Environ Res Public Health. 2014, 11(2), 2092-2107. Volek JS.; Fernandez ML.; Feinman RD.; Phinney SD. Dietary carbohydrate restriction induces a unique metabolic state positively affecting atherogenic dyslipidemia, fatty acid partitioning, and metabolic syndrome. Prog Lipid Res. 2008, 47(5), 307-318. Crowe TC. Safety of low-carbohydrate diets. Obes Rev. 2005, 6(3), 235-245. Brinkworth GD.; Buckley JD.; Noakes M.; Clifton PM. Renal function following long-term weight loss in individuals with abdominal obesity on a very-low-carbohydrate diet vs high-carbohydrate diet. J Am Diet Assoc. 2010, 110(4), 633-638. Mavri A.; Poredos P.; Suran D.; Gaborit B.; Juhan-Vague I. Effect of diet-induced weight loss on endothelial dysfunction: early improvement after the first week of dieting. Heart Vessels. 2011, 26(1), 31-38. Hamdy O.; Ledbury S.; Mullooly C.; Jarema C.; Porter S.; Ovalle K.; et al. Lifestyle modification improves endothelial function in obese subjects with the insulin resistance syndrome. Diabetes Care. 2003, 26(7), 2119-2125. Volek JS.; Ballard KD.; Silvestre R.; Judelson DA.; Quann EE.; Forsythe CE.; et al. Effects of dietary carbohydrate restriction versus low-fat diet on flow-mediated dilation. Metabolism. 2009, 58(12), 1769-1777. Nicholls SJ.; Lundman P.; Harmer JA.; Cutri B.; Griffiths KA.; Rye KA.; et al. Consumption of saturated fat impairs the anti-inflammatory properties of high-density lipoproteins and endothelial function. J Am Coll Cardiol. 2006, 48(4), 715-720.

RESUMENEl año 2021 se ha cumplido el VIII centenario del nacimiento del rey Alfonso X, acontecimiento que tuvo lugar en la ciudad de Toledo el 23 de noviembre de 1221. Nos encontramos ante la figura de uno de los reyes medievales hispanos de mayor relevancia, tanto por las ideas políticas innovadoras que intentó aplicar, aunque no lo consiguió, como, sobre todo, por la gran actividad intelectual que bajo su patronazgo se llevó entonces a cabo y que le ha merecido el apelativo de Sabio como es conocido. Son muchos los historiadores que, desde distintas ópticas (el Arte, el Derecho, la Astronomía, la Música, la Literatura, etcétera) se han acercado a su figura, lo que ha repercutido en que contemos con una bibliografía muy numerosa y de una gran variedad temática. Palabras clave: Historiografía, Imperio alemán, Partidas, Cantigas, Toledo.Topografía: Castilla y León.Periodo: siglo XIII ABSTRACTThe year 2021 has been the eighth centenary of the birth of King Alfonso X, an event that took place in the city of Toledo on November 21, 1221. We are faced with the figure of one of the most important Hispanic medieval kings both for the innovative political ideas that he tried to apply, although he did not succeed, as, above all, because of the great intellectual activity that took place under his patronage then and that has earned him the nickname of Wise as he is known. There are many historians who, from different perspectives (Art, Law, Astronomy, Music, Literature, etc.) have approached his figure, which has resulted in our having a very numerous bibliography and a great thematic variety. Keywords: Historiography, German Empire, Partidas, Cantigas, ToledoToponyms: Castilla y LeónPeriod: 13th century REFERENCIASÁlvarez Martínez, R. (1987), “Los instrumentos musicales en los códices alfonsinos: su tipología, su uso y su origen”, Revista de Musicología, 10/1, pp. 67-104.Ayala Martínez, C. de (2016), “El levantamiento de 1264: factores explicativos y desarrollo, en M. González Jiménez y R. Sánchez Saus (eds.), Arcos y el nacimiento de la frontera andaluza (1264-1330), Sevilla, Editorial UCA-Editorial Universidad de Sevilla, pp. 59-98.Ballesteros Beretta, A. (1935), El itinerario de Alfonso el Sabio, Madrid, Tipografía de Archivos Olózaga, I.— (1918), “Alfonso X, emperador electo de Alemania, Discurso de recepción de la Real Academia de la Historia, LXXII, Madrid.— (1959), La reconquista de Murcia por el infante don Alfonso de Castilla, Murcia.— (1934a), “Itinerario de Alfonso X, rey de Castilla”, Boletín de la Real Academia de la Historia, CIV, pp. 49-88, 455-516.— (1934b), “Itinerario de Alfonso X, rey de Castilla”, Boletín de la Real Academia de la Historia, CV, 1934, pp. 123-180.— (1963), Alfonso X el Sabio. Barcelona, Salvat Editores.— (1984), Alfonso X el Sabio, Barcelona, El Albir.Benito Ruano, E. (1989), “Alfonso X el Sabio y la ciudad de Toledo”, Alfonso X el Sabio, vida, obra y época, Madrid, Sociedad Española de Estudios Medievales, pp. 251-257.Chabás, J. y B. R. Goldstein (2008), Las tablas alfonsíes de Toledo, Toledo. Diputación Provincial.Craddock, J. R. (1974), “La nota cronológica inserta en el prólogo de las Siete Partidas”, Al-Andalus, 39, pp. 363-389.— (1981), “La cronología de las obras legislativas de Alfonso X el Sabio”, Anuario de Historia del Derecho Español, XLI, pp. 365-418.— (1986), “El Setenario: última e inconclusa refundición de la Primera Partida”, Anuario de Historia del Derecho Español, LVI, pp. 441-466.— (1990), “The Legislative Works of Alfonso el Sabio”, en R. I. Burns (ed.), Emperor of Culture: Alfonso X the Learned of Castile and His Thirteenth-Century Renaissance, Filadelfia, University of Pennsylvania Press, pp. 182-197.— (1998), “El texto del Espéculo”, Initium, 3, pp. 221-274.Domínguez Rodríguez, A. (1984), Astrología y arte en el Lapidario de Alfonso X el Sabio, Madrid, Edilán.— (1997), “Retratos de Alfonso X en sus manuscritos”, en Alfonso X el Sabio impulsor del arte, la cultura y el humanismo. El arpa en la Edad Media española. Madrid, Asociación Arpista Ludovico, pp. 95-107.— (2008-2009), “Retratos de Alfonso X el Sabio en la Primera Partida (British Library, Add. ms. 20.787). Iconografía y cronología”, Alcanate. Revista de estudios alfonsíes, VI, pp. 239-251.— (2010-2011), “Retratos de Alfonso X en el Libro de los Juegos de Ajedrez, Dados y Tablas”, Alcanate. Revista de estudios alfonsíes, VII, pp. 147-162.Estepa Díaz, C. (1997), “Alfonso X en la Europa del siglo XIII”, en M. Rodríguez Llopis (coord.), Alfonso X. Aportaciones de un rey castellano a la construcción de Europa, Murcia, pp. 11-30.Farré Olivé, E. (1997), “El libro de los relojes de Alfonso X el Sabio”, Arte y Hora, 124, pp. 4-10.Fernández Fernández, L. (2013), Arte y ciencia en el scriptorium de Alfonso X el Sabio, Puerto de Santa María, Cátedra Alfonso X el Sabio y Universidad de Sevilla.— (2010), “Transmisión del Saber-Transmisión del Poder. La imagen de Alfonso X en la Estoria de España, Ms. Y-I-2 RBME”, Anales de Historia del Arte, volumen extraordinario, pp. 187-210.— (2010-2011), “El Ms. 8322 de la Bibliothèque de l’Arsenal y su relación con las tablas alfonsíes. Hipótesis de trabajo”, Alcanate. Revista de Estudios alfonsíes, 7, pp. 235-267.Fernández Fernández, L. y Ruiz Souza, J. C. (coords.) (2011), Las Cantigas de Santa María. Códice Rico, Ms. T-I-1, Real Biblioteca del Monasterio de San Lorenzo del Escorial, Madrid, Patrimonio Nacional-Testimonio, 2 vols.Fernández-Ordóñez, I, (2011), “La lengua de los documentos del rey: del latín a las lenguas vernáculas en las cancillerías regias de la Península Ibérica”, en P. Martínez Sopena y A. Rodríguez López (eds.), La construcción medieval de la memoria regia, Valencia, Publicaciones Universidad de Valencia, pp. 325-363.— (1992), Las “Estorias” de Alfonso el Sabio, Madrid, Istmo.— (1993), “Versión crítica” de la “Estoria de España”: estudio y edición desde Pelayo hasta Ordoño II, Madrid, Seminario Menéndez Pidal, Fundación Ramón Menéndez Pidal y Universidad Autónoma de Madrid.— (1999), “El taller historiográfico alfonsí. La Estoria de España y la General estoria en el marco de las obras promovidas por Alfonso el Sabio”, en J. Montoya Martínez y A. Domínguez Rodríguez (coords.), El Scriptorium alfonsí: de los libros de astrología a las ‘Cantigas de Santa María’, Madrid, Editorial Complutense, pp. 105-126.— (2001), “El taller de las Estorias”, en I. Fernández-Ordóñez (ed.), Alfonso X el Sabio y las Crónicas de España. Valladolid, Universidad de Valladolid. Centro para la Edición de los Clásicos Españoles, pp. 61-82.Fidalgo Francisco, E. (2012/13), “La gestación de las Cantigas de Santa María en el contexto de la escuela poética gallego-portuguesa”, Alcanate. Revista de Estudios alfonsíes, 8, pp. 17-42.— (2019), “Viejos, viejas y alcahuetas. Consideraciones acerca de la vejez en las Cantigas de Santa María”, en E. Muñoz Raya y E. Nogueras Valdivieso (eds.), Et era muy acuçioso en allegar el saber: studia philologica in honorem Juan Paredes, pp. 323-338.Forcada, M. (1990), “El Picatrix, fuente del Lapidario”, en M. Comes, H. Mielgo y J. Samsó (eds.), ‘Ochava espera’ y ‘Astrofísica’. Textos y estudios sobre las fuentes árabes de astronomía de Alfonso X. Barcelona, Agencia Española de Cooperación Internacional-Instituto de Cooperación con el mundo árabe, Universidad de Barcelona, pp. 209-220.García Avilés, A. (1997), “La obra astromágica de Alfonso X y su difusión en la Europa bajomedieval”, en M. Rodríguez Llopis (coord.), Alfonso X. Aportaciones de un rey castellano a la construcción de Europa, Murcia, pp. 135-172.García-Gallo, A. (1951-1952), “El Libro de las leyes de Alfonso el Sabio. Del Espéculo a las Partidas”, Anuario de Historia del Derecho Español, XXI-XXII, pp. 345-528.Georges, M. (2006), “De nuevo sobre la fecha del Setenario”, e-Spania, 2. http://journals.openedition.org/e-spania/381. (Consultado: 09-10-2021)González Jiménez, M. (2004), Alfonso X el Sabio, Barcelona, Ariel.— (2006-2007), “La corte de Alfonso X”, Alcanate. Revista de Estudios Alfonsíes, V, pp. 13-30.— (2008), La repoblación del reino de Sevilla en el siglo XIII, Granada, Editorial Universidad de Granada/Publicaciones Universidad de Sevilla.— (2009), “La repoblación del ámbito gaditano en el siglo XIII”, Revista de historia de Jerez, 14/15, pp. 123-131.— (2011), “Jaime I el Conquistador y Alfonso X el Sabio: una compleja relación de encuentros y desencuentros”, Jaume I. Conmemoració del VIII centenari del naixement de Jaume. I, Vol. I, Barcelona, Institut d'Estudis Catalans, pp. 437-454.— (2012), “La repoblación de Andalucía: Inmigrantes y repoblación”, Cuadernos e Historia de España, LXXXV-LVXXXVI, Homenaje a María Estela González de Fauve, Buenos Aires, pp. 296-302.— (2013), “A fronteira entre Portugal e Castela no século XIII”, en Comendas das Ordens Miliutares: Perfil nacional e inserçao internacional, Porto, Fronteira de caos Editores, pp. 125-133.— (2014), Los repartimientos de Vejer de la Frontera (1288-1318), Vejer de la Frontera, Sociedad Económica de Amigos del País.— (2016), “La Sevilla de Alfonso X”, en A. Rodríguez Babío (coord.), Santa Ana de Triana. Aparato histórico-artístico, Sevilla, Fundación Cajasol, pp. 21-25.— (2021), “Alfonso X Emperador de España. La frustración de un proyecto irrealizable”, Andalucía en la Historia, julio, pp. 16-19.González Jiménez, M. y Carmona Ruiz, M. A. (2012), Documentación e itinerario de Alfonso X el Sabio. Sevilla, Universidad de Sevilla.González Mínguez, C. (1997), “A propósito del desarrollo urbano del País Vasco durante el reinado de Alfonso X”, Anuario de Estudios Medievales, 27, pp. 289-214.Guilty, G. (ed.) (1954), Libro conplido en los iudizios de las estrellas, Real Academia Española, Madrid.Haro Cortés, M. (2016), “Semblanza iconográfica de la realeza sapiencial de Alfonso X: las miniaturas liminares de los códices regios”, Revista de poética medieval, 30, pp. 131-153.Hernández Pérez, A. (2018a), Astrolabios en al-Andalus y los reinos medievales hispanos, Madrid, La Ergástula.— (2018b), Catálogo razonado de los astrolabios de la España medieval, Madrid, La Ergástula.Herriott, J. H. (1938), “A Thirteenth-Century Manuscript of the Primera Partida”, Speculum, 13 (3), pp. 278–294.Ibáñez de Segovia, G. (1777), Memorias Históricas del Rei D. Alonso el Sabio i observaciones a su Chrónica, Madrid.Iglesia Ferreirós, A. (1986), “La labor legislativa de Alfonso X el Sabio”, en A. Pérez Martín (ed.), España y Europa, un pasado jurídico común, Murcia, Universidad de Murcia, pp. 275-599.Iturmendi Morales, J. (1972), “En torno a la idea del Imperio de Alfonso X el Sabio”, Revista de Estudios Políticos, 182, pp. 83-158.Klein, J. (1918), “Los privilegios de la Mesta de 1273 y 1276”, Boletín de la Real Academia de la Historia, LXIV, pp. 191-207.Kleine, M. (2015), La cancillería real de Alfonso X. actores y prácticas en la producción documental, El Puerto de Santa María.Lacomba, M. (2011), “Les prologues scientifiques alphonsins et la symbolique du miroir”, en G. Founès y E. Canonica (eds.), Le Miroir du Prince. Écriture, transmission et réception en Espagne (XIIIe-XVIe siècles), Burdeos, Presses Universitaires de Bordeaux, pp. 113-129.Ladero Quesada, M. A. (1993), Fiscalidad y poder real en Castilla. 1252-1369, Madrid, Universidad Complutense.— (1997), “Las reformas fiscales y monetarias de Alfonso X como base del “Estado Moderno”, en M. Rodríguez Llopis (coord.), Alfonso X. Aportaciones de un rey castellano a la construcción de Europa, Murcia, pp.31-54.Lapesa, R, (1980), “Símbolos y palabras en el Setenario de Alfonso X”, Nueva revista de filología hispánica, 29, pp. 247-261,MacDonald, R. A. (1986), “El Espéculo atribuido a Alfonso X, su edición y problemas que plantea”, en A. Pérez Martín (ed.), España y Europa, un pasado jurídico común, Murcia, Universidad de Murcia, pp. 611-653.Mariana, J. de (1592), Historia de Rebus Hispaniae Libri XX, Toledo.Márquez Villanueva, F. (2004), El concepto cultural alfonsí. Edición revisada y aumentada, Barcelona, Ediciones Bellaterra.Martin, G. (1993-1994), “Alphonse X ou la science politique. Septénaire 1-11”, Cahiers de linguistique hispanique médiévale, 18-19, pp. 79-100.— (1995), “Alphonse X ou la science politique. Septénaire 1-11”, Cahiers de linguistique hispanique médiévale, 20, pp. 7-33.— (2000), “Alphonse X de Castille. Roi et empereur. Commentaire du premier titre de la Deuxième Partie”, Cahiers de linguistique hispanique médiévale, 23, pp. 323‒348.Martínez Díez, G. (1985), Leyes de Alfonso X, I. Espéculo. Ávila.Martínez, H. S. (2003), Alfonso X, el Sabio. Una biografía. Madrid, Polifemo.Menéndez Pidal, G. (1986), La España del siglo XIII: leída en imágenes, Madrid, Real Academia de la Historia, 1986.Mingo Lorente, A. de (2021), Alfonso X el Sabio. El primer gran rey, Madrid, La Esfera de los libros.North, J. D. (1997), “The Alfonsine Tables in England”, en Y. Maeyama y W.G. Saltzer (eds.), Wiesbaden, Prismata. Festschrift für Willy Hartner, pp. 269-301.O’Callaghan, J. (1971), “The Cortes and Royal taxation during the reign of Alfonso X of Castile”, Traditio, XXVII, pp. 379-398.O’Callaghan, J. E. (1996), El rey sabio. El reinado de Alfonso X de Castilla. Sevilla, Universidad de Sevilla.O’Callaghan, J. F. (2019), Alfonso X, the Justinian of his age. Law and justice in thirteenth-century Castile, Nueva York-Londres, Ithaca, Cornell University Press.Orfali, M. (1985), “Los traductores judíos de Toledo: nexo entre oriente y occidente”, en Actas del II Congreso Internacional Encuentro de las Tres Culturas, Toledo, pp. 253-260;Panateri, D. (2015), “El prólogo de las Siete partidas. Entropía, edición y uso político”, Medievalia, 47, pp. 54-81.Panateri, D. (2015), “Las imágenes del rey y del emperador en Las Siete Partidas y la glosa de Gregorio López”, Cuadernos de Historia del Derecho, 22, pp. 215-255.Pérez Embid, F. (1969), “La Marina real castellana en el siglo XIII”, Anuario de Estudios Medievales, 6, pp. 141-186.Pérez Martín, A, (1984), “El Fuero Real y Murcia”, Anuario de Historia del Derecho Español, 54, pp. 55-96.— (1997), “Hacia un Derecho Común Europeo: la obra jurídica de Alfonso X”, en M. Rodríguez Llopis (coord.), Alfonso X. Aportaciones de un rey castellano a la construcción de Europa, Murcia, pp. 109-134.Pingree, D. (1986), Picatrix. The Latin Version of the Ghayāt al-Ḥakīm, London, Warburg Institute.Poulle, E. (1987), “Les Tables Alphonsines sont-elles d’Alphonse X?”, en M. Comes, R. Puig y J. Samsó (eds.), De Astronomia Alphonsi Regis. Actas del Simposio sobre Astronomía Alfonsí celebrado en Berkeley, agosto 1985, Barcelona, Instituto MillásRodríguez García, J. M. (2014), La cruzada en tiempos de Alfonso X, Madrid.Rodríguez Montalvo, S. (1981), Alfonso X: Lapidario (según el manuscrito escurialense H.1.15), Madrid, Gredos.Rodríguez Velasco, J. (2010), “La urgente presencia de Las Siete Partidas”, La Corónica, 38.2, pp. 97-134. Romano, D. (1996), “Los hispanojudíos en la traducción y redacción de las obras científicas alfonsíes”, La Escuela de Traductores de Toledo, Toledo, pp. 35-50.Ruiz de la Peña Solar, J. I. (1981), Las "Polas" asturianas en la Edad Media, Oviedo, Universidad de Oviedo.Ruiz Gómez, F. (1986), “La carta puebla de Ciudad Real (1255). Comentario histórico-jurídico”, en Alfonso X y Ciudad Real, Ciudad Real, pp. 35-56.Sáenz-Badillos, A. (1996), “Participación de judíos en las traducciones de Toledo”, en La Escuela de Traductores de Toledo, Toledo, pp. 65-70.Samsó, J. (1983), “La primitiva versión árabe del Libro de las Cruces”, en J. Vernet (ed.), Nuevos Estudios sobre Astronomía Española en el siglo de Alfonso X, Madrid, CSIC, pp. 149-161.— (1987b), “Sobre el tratado de la azafea y de la lámina universal. Intervención de los colaboradores alfonsíes”, Al-Qantara, 8, pp. 29-43.— (2008-2009), “Las traducciones astronómicas alfonsíes y la aparición de una prosa científica castellana”, Alcanate. Revista de Estudios Alfonsíes, 6, pp. 39-51.Sánchez Pérez, J. A. (antes de 1936), Alfonso X el Sabio. Siglo XIII, Madrid, M. Aguilar editor.Schoen, W. F. von (1966), Alfonso X de Castilla, Madrid, Ed. Rialp.Solalinde, A. G. (1915), “Intervención de Alfonso X en la redacción de sus obras”, Revista de Filología Española, 2, pp. 283-288.Steiger, A. (1946), “Alfonso X el Sabio y la idea imperial”, Arbor, 18, pp. 391-402.Torres Fontes, J. (1960), Repartimiento de Murcia, CSIC, Madrid.— (1963), “Presencia de Alfonso X el Sabio”, Anales de la Universidad de Murcia. Filosofía y Letras, 21 núms. 3 y 4, pp. 37-45.— (1977), Repartimiento de Lorca, Academia Alfonso X el Sabio, Murcia.— (1987), La reconquista de Murcia en 1266 por Jaime I de Aragón, CSIC, Madrid.— (1988), Repartimiento de Orihuela, CSIC, Madrid.Torroja Menéndez, J. M. (1984), “La obra astronómica de Alfonso X el Sabio”, en Conmemoración del centenario de Alfonso X el Sabio en la Real Academia de Ciencias Exactas, Físicas y Naturales, Madrid, Instituto de Astronomía y Geodésica (CSIC-UCM), pp. 33-47.Urteaga Artigas, M. M. (2006), “Censo de las villas nuevas medievales en Álava, Bizkaia y Gipuzkoa”, en P. Martínez Sopena y M. M. Urteaga Artigas (coords.), Las villas nuevas medievales del suroeste europeo. De la fundación medieval al siglo XXI: análisis histórico y lectura contemporánea, Boletín Arkeolan, 14, pp. 37-98Valdeón Baruque, J. (1986), Alfonso X el Sabio, Valladolid.— (1997), “Alfonso X y las Cortes de Castilla”, en M. Rodríguez Llopis (coord.), Alfonso X. Aportaciones de un rey castellano a la construcción de Europa, Murcia, pp. 55-70.— (2004-2005) “Alfonso X y el Imperio”, Alcanate. Revista de estudios alfonsíes, IV, pp. 243-255.— (2003), Alfonso X: la forja de la España moderna, Madrid, Temas de Hoy.Varios (1984), Alfonso X, catálogo de la exposición conmemorativa del VII centenario de la muerte de Alfonso X, Toledo. Ministerio de Cultura.Varios (1997), Alfonso X. aportaciones de un rey castellano a la construcción de Europa, Murcia. Región de MurciaVarios (2009), Alfonso X el Sabio, catálogo de la exposición, Mª T. López de Guereño Sanz e I. G. Bango Torviso (coords.), Murcia.Varios (2020), Alfonso el Sabio en el VIII centenario, Madrid, Instituto de España.Vernet, J. (1985), “Alfonso X y la astronomía árabe”, en J. Mondéjar y J. Montoya (eds.), Estudios Alfonsíes. Lexicografía, lírica, estética y política de Alfonso el Sabio, Granada, Universidad de Granada, pp. 17-31.

Climate change induced sea-level rise (SLR) is on its increase globally. Regionally the lowlands of China, Vietnam, Bangladesh, and islands of the Malaysian, Indonesian and Philippine archipelagos are among the world’s most threatened regions. Sea-level rise has major impacts on the ecosystems and society. It threatens coastal populations, economic activities, and fragile ecosystems as mangroves, coastal salt-marches and wetlands. This paper provides a summary of the current state of knowledge of sea level-rise and its effects on both human and natural ecosystems. The focus is on coastal urban areas and low lying deltas in South-East Asia and Vietnam, as one of the most threatened areas in the world. About 3 mm per year reflects the growing consensus on the average SLR worldwide. The trend speeds up during recent decades. The figures are subject to local, temporal and methodological variation. In Vietnam the average values of 3.3 mm per year during the 1993-2014 period are above the worldwide average. Although a basic conceptual understanding exists that the increasing global frequency of the strongest tropical cyclones is related with the increasing temperature and SLR, this relationship is insufficiently understood. Moreover the precise, complex environmental, economic, social, and health impacts are currently unclear. SLR, storms and changing precipitation patterns increase flood risks, in particular in urban areas. Part of the current scientific debate is on how urban agglomeration can be made more resilient to flood risks. Where originally mainly technical interventions dominated this discussion, it becomes increasingly clear that proactive special planning, flood defense, flood risk mitigation, flood preparation, and flood recovery are important, but costly instruments. Next to the main focus on SLR and its effects on resilience, the paper reviews main SLR associated impacts: Floods and inundation, salinization, shoreline change, and effects on mangroves and wetlands. The hazards of SLR related floods increase fastest in urban areas. This is related with both the increasing surface major cities are expected to occupy during the decades to come and the increasing coastal population. In particular Asia and its megacities in the southern part of the continent are increasingly at risk. The discussion points to complexity, inter-disciplinarity, and the related uncertainty, as core characteristics. An integrated combination of mitigation, adaptation and resilience measures is currently considered as the most indicated way to resist SLR today and in the near future.References Aerts J.C.J.H., Hassan A., Savenije H.H.G., Khan M.F., 2000. Using GIS tools and rapid assessment techniques for determining salt intrusion: Stream a river basin management instrument. Physics and Chemistry of the Earth, Part B: Hydrology, Oceans and Atmosphere, 25, 265-273. Doi: 10.1016/S1464-1909(00)00014-9. Alongi D.M., 2002. Present state and future of the world’s mangrove forests. Environmental Conservation, 29, 331-349. Doi: 10.1017/S0376892902000231 Alongi D.M., 2015. The impact of climate change on mangrove forests. Curr. Clim. Change Rep., 1, 30-39. Doi: 10.1007/s404641-015-0002-x. Anderson F., Al-Thani N., 2016. Effect of sea level rise and groundwater withdrawal on seawater intrusion in the Gulf Coast aquifer: Implications for agriculture. Journal of Geoscience and Environment Protection, 4, 116-124. Doi: 10.4236/gep.2016.44015. Anguelovski I., Chu E., Carmin J., 2014. Variations in approaches to urban climate adaptation: Experiences and experimentation from the global South. Global Environmental Change, 27, 156-167. Doi: 10.1016/j.gloenvcha.2014.05.010. Arustienè J., Kriukaitè J., Satkunas J., Gregorauskas M., 2013. Climate change and groundwater - From modelling to some adaptation means in example of Klaipèda region, Lithuania. In: Climate change adaptation in practice. P. Schmidt-Thomé, J. Klein Eds. John Wiley and Sons Ltd., Chichester, UK., 157-169. Bamber J.L., Aspinall W.P., Cooke R.M., 2016. A commentary on “how to interpret expert judgement assessments of twenty-first century sea-level rise” by Hylke de Vries and Roderik S.W. Van de Wal. Climatic Change, 137, 321-328. Doi: 10.1007/s10584-016-1672-7. Barnes C., 2014. Coastal population vulnerability to sea level rise and tropical cyclone intensification under global warming. BSc-thesis. Department of Geography, University of Lethbridge, Alberta Canada. Be T.T., Sinh B.T., Miller F., 2007. Challenges to sustainable development in the Mekong Delta: Regional and national policy issues and research needs. The Sustainable Mekong Research Network, Bangkok, Thailand, 1-210. Bellard C., Leclerc C., Courchamp F., 2014. Impact of sea level rise on 10 insular biodiversity hotspots. Global Ecology and Biogeography, 23, 203-212. Doi: 10.1111/geb.12093. Berg H., Söderholm A.E., Sönderström A.S., Nguyen Thanh Tam, 2017. Recognizing wetland ecosystem services for sustainable rice farming in the Mekong delta, Vietnam. Sustainability Science, 12, 137-154. Doi: 10.1007/s11625-016-0409-x. Bilskie M.V., Hagen S.C., Medeiros S.C., Passeri D.L., 2014. Dynamics of sea level rise and coastal flooding on a changing landscape. Geophysical Research Letters, 41, 927-934. Doi: 10.1002/2013GL058759. Binh T.N.K.D., Vromant N., Hung N.T., Hens L., Boon E.K., 2005. Land cover changes between 1968 and 2003 in Cai Nuoc, Ca Mau penisula, Vietnam. Environment, Development and Sustainability, 7, 519-536. Doi: 10.1007/s10668-004-6001-z. Blankespoor B., Dasgupta S., Laplante B., 2014. Sea-level rise and coastal wetlands. Ambio, 43, 996- 005.Doi: 10.1007/s13280-014-0500-4. Brockway R., Bowers D., Hoguane A., Dove V., Vassele V., 2006. A note on salt intrusion in funnel shaped estuaries: Application to the Incomati estuary, Mozambique.Estuarine, Coastal and Shelf Science, 66, 1-5. Doi: 10.1016/j.ecss.2005.07.014. Cannaby H., Palmer M.D., Howard T., Bricheno L., Calvert D., Krijnen J., Wood R., Tinker J., Bunney C., Harle J., Saulter A., O’Neill C., Bellingham C., Lowe J., 2015. Projected sea level rise and changes in extreme storm surge and wave events during the 21st century in the region of Singapore. Ocean Sci. Discuss, 12, 2955-3001. Doi: 10.5194/osd-12-2955-2015. Carraro C., Favero A., Massetti E., 2012. Investment in public finance in a green, low carbon economy. Energy Economics, 34, S15-S18. Castan-Broto V., Bulkeley H., 2013. A survey ofurban climate change experiments in 100 cities. Global Environmental Change, 23, 92-102. Doi: 10.1016/j.gloenvcha.2012.07.005. Cazenave A., Le Cozannet G., 2014. Sea level rise and its coastal impacts. GeoHealth, 2, 15-34. Doi: 10.1002/2013EF000188. Chu M.L., Guzman J.A., Munoz-Carpena R., Kiker G.A., Linkov I., 2014. A simplified approach for simulating changes in beach habitat due to the combined effects of long-term sea level rise, storm erosion and nourishment. Environmental modelling and software, 52, 111-120. Doi.org/10.1016/j.envcsoft.2013.10.020. Church J.A. et al., 2013. Sea level change. In: Climate change 2013: The physical science basis. Contribution of working group I to the fifth assessment report of Intergovernmental Panel on Climate Change. Eds: Stocker T.F., Qin D., Plattner G.-K., Tignor M., Allen S.K., Boschung J., Nauels A., Xia Y., Bex V., Midgley P.M., Cambridge University Press, Cambridge, UK. Connell J., 2016. Last days of the Carteret Islands? Climate change, livelihoods and migration on coral atolls. Asia Pacific Viewpoint, 57, 3-15. Doi: 10.1111/apv.12118. Dasgupta S., Laplante B., Meisner C., Wheeler, Yan J., 2009. The impact of sea level rise on developing countries: A comparative analysis. Climatic Change, 93, 379-388. Doi: 10.1007/s 10584-008-9499-5. Delbeke J., Vis P., 2015. EU climate policy explained, 136p. Routledge, Oxon, UK. DiGeorgio M., 2015. Bargaining with disaster: Flooding, climate change, and urban growth ambitions in QuyNhon, Vietnam. Public Affairs, 88, 577-597. Doi: 10.5509/2015883577. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, 2015. Enhancement of coastal protection under the context of climate change: A case study of Hai Hau coast, Vietnam. Proceedings of the 10th Asian Regional Conference of IAEG, 1-8. Do Minh Duc, Yasuhara K., Nguyen Manh Hieu, Lan Nguyen Chau, 2017. Climate change impacts on a large-scale erosion coast of Hai Hau district, Vietnam and the adaptation. Journal of Coastal Conservation, 21, 47-62. Donner S.D., Webber S., 2014. Obstacles to climate change adaptation decisions: A case study of sea level rise; and coastal protection measures in Kiribati. Sustainability Science, 9, 331-345. Doi: 10.1007/s11625-014-0242-z. Driessen P.P.J., Hegger D.L.T., Bakker M.H.N., Van Renswick H.F.M.W., Kundzewicz Z.W., 2016. Toward more resilient flood risk governance. Ecology and Society, 21, 53-61. Doi: 10.5751/ES-08921-210453. Duangyiwa C., Yu D., Wilby R., Aobpaet A., 2015. Coastal flood risks in the Bangkok Metropolitan region, Thailand: Combined impacts on land subsidence, sea level rise and storm surge. American Geophysical Union, Fall meeting 2015, abstract#NH33C-1927. Duarte C.M., Losada I.J., Hendriks I.E., Mazarrasa I., Marba N., 2013. The role of coastal plant communities for climate change mitigation and adaptation. Nature Climate Change, 3, 961-968. Doi: 10.1038/nclimate1970. Erban L.E., Gorelick S.M., Zebker H.A., 2014. Groundwater extraction, land subsidence, and sea-level rise in the Mekong Delta, Vietnam. Environmental Research Letters, 9, 1-20. Doi: 10.1088/1748-9326/9/8/084010. FAO - Food and Agriculture Organisation, 2007.The world’s mangroves 1980-2005. FAO Forestry Paper, 153, Rome, Italy. Farbotko C., 2010. Wishful sinking: Disappearing islands, climate refugees and cosmopolitan experimentation. Asia Pacific Viewpoint, 51, 47-60. Doi: 10.1111/j.1467-8373.2010.001413.x. Goltermann D., Ujeyl G., Pasche E., 2008. Making coastal cities flood resilient in the era of climate change. Proceedings of the 4th International Symposium on flood defense: Managing flood risk, reliability and vulnerability, 148-1-148-11. Toronto, Canada. Gong W., Shen J., 2011. The response of salt intrusion to changes in river discharge and tidal mixing during the dry season in the Modaomen Estuary, China.Continental Shelf Research, 31, 769-788. Doi: 10.1016/j.csr.2011.01.011. Gosian L., 2014. Protect the world’s deltas. Nature, 516, 31-34. Graham S., Barnett J., Fincher R., Mortreux C., Hurlimann A., 2015. Towards fair outcomes in adaptation to sea-level rise. Climatic Change, 130, 411-424. Doi: 10.1007/s10584-014-1171-7. COASTRES-D-12-00175.1. Güneralp B., Güneralp I., Liu Y., 2015. Changing global patterns of urban expoàsure to flood and drought hazards. Global Environmental Change, 31, 217-225. Doi: 10.1016/j.gloenvcha.2015.01.002. Hallegatte S., Green C., Nicholls R.J., Corfee-Morlot J., 2013. Future flood losses in major coastal cities. Nature Climate Change, 3, 802-806. Doi: 10.1038/nclimate1979. Hamlington B.D., Strassburg M.W., Leben R.R., Han W., Nerem R.S., Kim K.-Y., 2014. Uncovering an anthropogenic sea-level rise signal in the Pacific Ocean. Nature Climate Change, 4, 782-785. Doi: 10.1038/nclimate2307. Hashimoto T.R., 2001. Environmental issues and recent infrastructure development in the Mekong Delta: Review, analysis and recommendations with particular reference to large-scale water control projects and the development of coastal areas. Working paper series (Working paper No. 4). Australian Mekong Resource Centre, University of Sydney, Australia, 1-70. Hibbert F.D., Rohling E.J., Dutton A., Williams F.H., Chutcharavan P.M., Zhao C., Tamisiea M.E., 2016. Coral indicators of past sea-level change: A global repository of U-series dated benchmarks. Quaternary Science Reviews, 145, 1-56. Doi: 10.1016/j.quascirev.2016.04.019. Hinkel J., Lincke D., Vafeidis A., Perrette M., Nicholls R.J., Tol R.S.J., Mazeion B., Fettweis X., Ionescu C., Levermann A., 2014. Coastal flood damage and adaptation costs under 21st century sea-level rise. Proceedings of the National Academy of Sciences, 111, 3292-3297. Doi: 10.1073/pnas.1222469111. Hinkel J., Nicholls R.J., Tol R.S.J., Wang Z.B., Hamilton J.M., Boot G., Vafeidis A.T., McFadden L., Ganapolski A., Klei R.J.Y., 2013. A global analysis of erosion of sandy beaches and sea level rise: An application of DIVA. Global and Planetary Change, 111, 150-158. Doi: 10.1016/j.gloplacha.2013.09.002. Huong H.T.L., Pathirana A., 2013. Urbanization and climate change impacts on future urban flooding in Can Tho city, Vietnam. Hydrol. Earth Syst. Sci., 17, 379-394. Doi: 10.5194/hess-17-379-2013. Hurlimann A., Barnett J., Fincher R., Osbaldiston N., Montreux C., Graham S., 2014. Urban planning and sustainable adaptation to sea-level rise. Landscape and Urban Planning, 126, 84-93. Doi: 10.1016/j.landurbplan.2013.12.013. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, 2011. Climate change vulnerability and risk assessment study for Ca Mau and KienGiang provinces, Vietnam. Hanoi, Vietnam Institute of Meteorology, Hydrology and Environment (IMHEN), 250p. IMHEN-Vietnam Institute of Meteorology, Hydrology and Environment, Ca Mau PPC, 2011. Climate change impact and adaptation study in The Mekong Delta - Part A: Ca Mau Atlas. Hanoi, Vietnam: Institute of Meteorology, Hydrology and Environment (IMHEN), 48p. IPCC-Intergovernmental Panel on Climate Change, 2014. Fifth assessment report. Cambridge University Press, Cambridge, UK. Jevrejeva S., Jackson L.P., Riva R.E.M., Grinsted A., Moore J.C., 2016. Coastal sea level rise with warming above 2°C. Proceedings of the National Academy of Sciences, 113, 13342-13347. Doi: 10.1073/pnas.1605312113. Junk W.J., AN S., Finlayson C.M., Gopal B., Kvet J., Mitchell S.A., Mitsch W.J., Robarts R.D., 2013. Current state of knowledge regarding the world’s wetlands and their future under global climate change: A synthesis. Aquatic Science, 75, 151-167. Doi: 10.1007/s00027-012-0278-z. Jordan A., Rayner T., Schroeder H., Adger N., Anderson K., Bows A., Le Quéré C., Joshi M., Mander S., Vaughan N., Whitmarsh L., 2013. Going beyond two degrees? The risks and opportunities of alternative options. Climate Policy, 13, 751-769. Doi: 10.1080/14693062.2013.835705. Kelly P.M., Adger W.N., 2000. Theory and practice in assessing vulnerability to climate change and facilitating adaptation. Climatic Change, 47, 325-352. Doi: 10.1023/A:1005627828199. Kirwan M.L., Megonigal J.P., 2013. Tidal wetland stability in the face of human impacts and sea-level rice. Nature, 504, 53-60. Doi: 10.1038/nature12856. Koerth J., Vafeidis A.T., Hinkel J., Sterr H., 2013. What motivates coastal households to adapt pro actively to sea-level rise and increased flood risk? Regional Environmental Change, 13, 879-909. Doi: 10.1007/s10113-12-399-x. Kontgis K., Schneider A., Fox J;,Saksena S., Spencer J.H., Castrence M., 2014. Monitoring peri urbanization in the greater Ho Chi Minh City metropolitan area. Applied Geography, 53, 377-388. Doi: 10.1016/j.apgeogr.2014.06.029. Kopp R.E., Horton R.M., Little C.M., Mitrovica J.X., Oppenheimer M., Rasmussen D.J., Strauss B.H., Tebaldi C., 2014. Probabilistic 21st and 22nd century sea-level projections at a global network of tide-gauge sites. Earth’s Future, 2, 383-406. Doi: 10.1002/2014EF000239. Kuenzer C., Bluemel A., Gebhardt S., Quoc T., Dech S., 2011. Remote sensing of mangrove ecosystems: A review.Remote Sensing, 3, 878-928. Doi: 10.3390/rs3050878. Lacerda G.B.M., Silva C., Pimenteira C.A.P., Kopp Jr. R.V., Grumback R., Rosa L.P., de Freitas M.A.V., 2013. Guidelines for the strategic management of flood risks in industrial plant oil in the Brazilian coast: Adaptive measures to the impacts of sea level rise. Mitigation and Adaptation Strategies for Global Change, 19, 104-1062. Doi: 10.1007/s11027-013-09459-x. Lam Dao Nguyen, Pham Van Bach, Nguyen Thanh Minh, Pham Thi Mai Thy, Hoang Phi Hung, 2011. Change detection of land use and river bank in Mekong Delta, Vietnam using time series remotely sensed data. Journal of Resources and Ecology, 2, 370-374. Doi: 10.3969/j.issn.1674-764x.2011.04.011. Lang N.T., Ky B.X., Kobayashi H., Buu B.C., 2004. Development of salt tolerant varieties in the Mekong delta. JIRCAS Project, Can Tho University, Can Tho, Vietnam, 152. Le Cozannet G., Rohmer J., Cazenave A., Idier D., Van de Wal R., de Winter R., Pedreros R., Balouin Y., Vinchon C., Oliveros C., 2015. Evaluating uncertainties of future marine flooding occurrence as sea-level rises. Environmental Modelling and Software, 73, 44-56. Doi: 10.1016/j.envsoft.2015.07.021. Le Cozannet G., Manceau J.-C., Rohmer J., 2017. Bounding probabilistic sea-level projections with the framework of the possible theory. Environmental Letters Research, 12, 12-14. Doi.org/10.1088/1748-9326/aa5528.Chikamoto Y., 2014. Recent Walker circulation strengthening and Pacific cooling amplified by Atlantic warming. Nature Climate Change, 4, 888-892. Doi: 10.1038/nclimate2330. Lovelock C.E., Cahoon D.R., Friess D.A., Gutenspergen G.R., Krauss K.W., Reef R., Rogers K., Saunders M.L., Sidik F., Swales A., Saintilan N., Le Xuan Tuyen, Tran Triet, 2015. The vulnerability of Indo-Pacific mangrove forests to sea-level rise. Nature, 526, 559-563. Doi: 10.1038/nature15538. MA Millennium Ecosystem Assessment, 2005. Ecosystems and human well-being: Current state and trends. Island Press, Washington DC, 266p. Masterson J.P., Fienen M.N., Thieler E.R., Gesch D.B., Gutierrez B.T., Plant N.G., 2014. Effects of sea level rise on barrier island groundwater system dynamics - ecohydrological implications. Ecohydrology, 7, 1064-1071. Doi: 10.1002/eco.1442. McGanahan G., Balk D., Anderson B., 2007. The rising tide: Assessing the risks of climate changes and human settlements in low elevation coastal zones.Environment and urbanization, 19, 17-37. Doi: 10.1177/095624780707960. McIvor A., Möller I., Spencer T., Spalding M., 2012. Reduction of wind and swell waves by mangroves. The Nature Conservancy and Wetlands International, 1-27. Merryn T., Pidgeon N., Whitmarsh L., Ballenger R., 2016. Expert judgements of sea-level rise at the local scale. Journal of Risk Research, 19, 664-685. Doi.org/10.1080/13669877.2015.1043568. Monioudi I.N., Velegrakis A.F., Chatzipavlis A.E., Rigos A., Karambas T., Vousdoukas M.I., Hasiotis T., Koukourouvli N., Peduzzi P., Manoutsoglou E., Poulos S.E., Collins M.B., 2017. Assessment of island beach erosion due to sea level rise: The case of the Aegean archipelago (Eastern Mediterranean). Nat. Hazards Earth Syst. Sci., 17, 449-466. Doi: 10.5194/nhess-17-449-2017. MONRE - Ministry of Natural Resources and Environment, 2016. Scenarios of climate change and sea level rise for Vietnam. Publishing House of Environmental Resources and Maps Vietnam, Hanoi, 188p. Montz B.E., Tobin G.A., Hagelman III R.R., 2017. Natural hazards. Explanation and integration. The Guilford Press, NY, 445p. Morgan L.K., Werner A.D., 2014. Water intrusion vulnerability for freshwater lenses near islands. Journal of Hydrology, 508, 322-327. Doi: 10.1016/j.jhydrol.2013.11.002. Muis S., Güneralp B., Jongman B., Aerts J.C.H.J., Ward P.J., 2015. Science of the Total Environment, 538, 445-457. Doi: 10.1016/j.scitotenv.2015.08.068. Murray N.J., Clemens R.S., Phinn S.R., Possingham H.P., Fuller R.A., 2014. Tracking the rapid loss of tidal wetlands in the Yellow Sea. Frontiers in Ecology and Environment, 12, 267-272. Doi: 10.1890/130260. Neumann B., Vafeidis A.T., Zimmermann J., Nicholls R.J., 2015a. Future coastal population growth and exposure to sea-level rise and coastal flooding. A global assessment. Plos One, 10, 1-22. Doi: 10.1371/journal.pone.0118571. Nguyen A. Duoc, Savenije H. H., 2006. Salt intrusion in multi-channel estuaries: a case study in the Mekong Delta, Vietnam. Hydrology and Earth System Sciences Discussions, European Geosciences Union, 10, 743-754. Doi: 10.5194/hess-10-743-2006. Nguyen An Thinh, Nguyen Ngoc Thanh, Luong Thi Tuyen, Luc Hens, 2017. Tourism and beach erosion: Valuing the damage of beach erosion for tourism in the Hoi An, World Heritage site. Journal of Environment, Development and Sustainability. Nguyen An Thinh, Luc Hens (Eds.), 2018. Human ecology of climate change associated disasters in Vietnam: Risks for nature and humans in lowland and upland areas. Springer Verlag, Berlin.Nguyen An Thinh, Vu Anh Dung, Vu Van Phai, Nguyen Ngoc Thanh, Pham Minh Tam, Nguyen Thi Thuy Hang, Le Trinh Hai, Nguyen Viet Thanh, Hoang Khac Lich, Vu Duc Thanh, Nguyen Song Tung, Luong Thi Tuyen, Trinh Phuong Ngoc, Luc Hens, 2017. Human ecological effects of tropical storms in the coastal area of Ky Anh (Ha Tinh, Vietnam). Environ Dev Sustain, 19, 745-767. Doi: 10.1007/s/10668-016-9761-3. Nguyen Van Hoang, 2017. Potential for desalinization of brackish groundwater aquifer under a background of rising sea level via salt-intrusion prevention river gates in the coastal area of the Red River delta, Vietnam. Environment, Development and Sustainability. Nguyen Tho, Vromant N., Nguyen Thanh Hung, Hens L., 2008. Soil salinity and sodicity in a shrimp farming coastal area of the Mekong Delta, Vietnam. Environmental Geology, 54, 1739-1746. Doi: 10.1007/s00254-007-0951-z. Nguyen Thang T.X., Woodroffe C.D., 2016. Assessing relative vulnerability to sea-level rise in the western part of the Mekong River delta. Sustainability Science, 11, 645-659. Doi: 10.1007/s11625-015-0336-2. Nicholls N.N., Hoozemans F.M.J., Marchand M., Analyzing flood risk and wetland losses due to the global sea-level rise: Regional and global analyses.Global Environmental Change, 9, S69-S87. Doi: 10.1016/s0959-3780(99)00019-9. Phan Minh Thu, 2006. Application of remote sensing and GIS tools for recognizing changes of mangrove forests in Ca Mau province. In Proceedings of the International Symposium on Geoinformatics for Spatial Infrastructure Development in Earth and Allied Sciences, Ho Chi Minh City, Vietnam, 9-11 November, 1-17. Reise K., 2017. Facing the third dimension in coastal flatlands.Global sea level rise and the need for coastal transformations. Gaia, 26, 89-93. Renaud F.G., Le Thi Thu Huong, Lindener C., Vo Thi Guong, Sebesvari Z., 2015. Resilience and shifts in agro-ecosystems facing increasing sea-level rise and salinity intrusion in Ben Tre province, Mekong Delta. Climatic Change, 133, 69-84. Doi: 10.1007/s10584-014-1113-4. Serra P., Pons X., Sauri D., 2008. Land cover and land use in a Mediterranean landscape. Applied Geography, 28, 189-209. Shearman P., Bryan J., Walsh J.P., 2013.Trends in deltaic change over three decades in the Asia-Pacific Region. Journal of Coastal Research, 29, 1169-1183. Doi: 10.2112/JCOASTRES-D-12-00120.1. SIWRR-Southern Institute of Water Resources Research, 2016. Annual Report. Ministry of Agriculture and Rural Development, Ho Chi Minh City, 1-19. Slangen A.B.A., Katsman C.A., Van de Wal R.S.W., Vermeersen L.L.A., Riva R.E.M., 2012. Towards regional projections of twenty-first century sea-level change based on IPCC RES scenarios. Climate Dynamics, 38, 1191-1209. Doi: 10.1007/s00382-011-1057-6. Spencer T., Schuerch M., Nicholls R.J., Hinkel J., Lincke D., Vafeidis A.T., Reef R., McFadden L., Brown S., 2016. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Global and Planetary Change, 139, 15-30. Doi:10.1016/j.gloplacha.2015.12.018. Stammer D., Cazenave A., Ponte R.M., Tamisiea M.E., 2013. Causes of contemporary regional sea level changes. Annual Review of Marine Science, 5, 21-46. Doi: 10.1146/annurev-marine-121211-172406. Tett P., Mee L., 2015. Scenarios explored with Delphi. In: Coastal zones ecosystems services. Eds., Springer, Berlin, Germany, 127-144. Tran Hong Hanh, 2017. Land use dynamics, its drivers and consequences in the Ca Mau province, Mekong delta, Vietnam. PhD dissertation, 191p. VUBPRESS Brussels University Press, ISBN 9789057186226, Brussels, Belgium. Tran Thuc, Nguyen Van Thang, Huynh Thi Lan Huong, Mai Van Khiem, Nguyen Xuan Hien, Doan Ha Phong, 2016. Climate change and sea level rise scenarios for Vietnam. Ministry of Natural resources and Environment. Hanoi, Vietnam. Tran Hong Hanh, Tran Thuc, Kervyn M., 2015. Dynamics of land cover/land use changes in the Mekong Delta, 1973-2011: A remote sensing analysis of the Tran Van Thoi District, Ca Mau province, Vietnam. Remote Sensing, 7, 2899-2925. Doi: 10.1007/s00254-007-0951-z Van Lavieren H., Spalding M., Alongi D., Kainuma M., Clüsener-Godt M., Adeel Z., 2012. Securing the future of Mangroves. The United Nations University, Okinawa, Japan, 53, 1-56. Water Resources Directorate. Ministry of Agriculture and Rural Development, 2016. Available online: http://www.tongcucthuyloi.gov.vn/Tin-tuc-Su-kien/Tin-tuc-su-kien-tong-hop/catid/12/item/2670/xam-nhap-man-vung-dong-bang-song-cuu-long--2015---2016---han-han-o-mien-trung--tay-nguyen-va-giai-phap-khac-phuc. Last accessed on: 30/9/2016. Webster P.J., Holland G.J., Curry J.A., Chang H.-R., 2005. Changes in tropical cyclone number, duration, and intensity in a warming environment. Science, 309, 1844-1846. Doi: 10.1126/science.1116448. Were K.O., Dick O.B., Singh B.R., 2013. Remotely sensing the spatial and temporal land cover changes in Eastern Mau forest reserve and Lake Nakuru drainage Basin, Kenya. Applied Geography, 41, 75-86. Williams G.A., Helmuth B., Russel B.D., Dong W.-Y., Thiyagarajan V., Seuront L., 2016. Meeting the climate change challenge: Pressing issues in southern China an SE Asian coastal ecosystems. Regional Studies in Marine Science, 8, 373-381. Doi: 10.1016/j.rsma.2016.07.002. Woodroffe C.D., Rogers K., McKee K.L., Lovdelock C.E., Mendelssohn I.A., Saintilan N., 2016. Mangrove sedimentation and response to relative sea-level rise. Annual Review of Marine Science, 8, 243-266. Doi: 10.1146/annurev-marine-122414-034025.

Introducción: La enfermedad renal crónica asociada a la obesidad (ERC-AO) es una enfermedad con aumento en la prevalencia en las últimas décadas. Se caracteriza por un exceso de desequilibrios hormonales adipocíticos (adipoquinas), desregulación del sistema de equilibrio energético y desequilibrios en la homeostasis metabólica. Propósito de la revisión: El objetivo de la revisión es delinear el papel de los diferentes mecanismos fisiopatológicos para el desarrollo de enfermedad renal funcional o anatómica en pacientes con obesidad. Buscamos reportes actualizados en donde se incluye los resultados de mejor supervivencia para los pacientes con ERC-AO. Recientes hallazgos: Actualmente sabemos la ERC-AO tiene un comportamiento pro inflamatorio crónico. La obesidad y sobrepeso se asocian alteraciones hemodinámicas, estructurales e histopatológicas en el riñón, así como alteraciones metabólicas y bioquímicas que predisponen a la enfermedad renal, aun cuando la función renal y las pruebas convencionales sean normales. Conclusiones: Clasificamos a la ERC-AO en Tipo 1: Obesidad y alteraciones funcionales potencialmente reversibles. Tipo 2: Obesidad y alteraciones estructurales histopatológicas potencialmente no reversibles (Incluye la Glomerulopatía asociada a obesidad y glomeruloesclerosis focal y segmentaria). Tipo 3: Obesidad en relacionada con enfermedades crónicas (Diabetes, Hipertensión, Hipertensión pulmonar. Insuficiencia Cardíaca). Tipo 4: Obesidad en el paciente con terapia sustitutiva de la función renal. Recibido: Agosto 03, 2022 Aceptado: Septiembre 30, 2022 Publicado: Septiembre 30, 2022 Editor: Dr. Franklin Mora Bravo. Introducción La obesidad es una enfermedad en crecimiento con un aumento en su prevalencia en las últimas décadas, asociándose a un elevada carga asistencial y económica para los sistemas sanitaros derivado de su relación con enfermedades cardiovasculares, endocrinas, psicológicas, renales entre otras [1, 2]. El incremento en las tasas de obesidad en distintos grupos etarios, desde niños hasta adultos jóvenes conlleva a asumir que en el futuro veremos más enfermedad renal relacionada con la obesidad (ERC-AO) en la población general, con implicaciones relevantes para los sistemas de atención [3]. Por ello el conocimiento y comprensión de esta interacción podría tener implicaciones en la prevención y tratamiento de las enfermedades renales. Dentro de la población general la obesidad se asocia a incremento en el riesgo de diversas condiciones patológicas, como la hipertensión arterial crónica (HTA), enfermedad renal crónica (ERC), artrosis, infecciones, síndrome de apnea hipopnea obstructiva del sueño (SAHOS) y diabetes mellitus (DM) entre otras [3]. No obstante, en el escenario de la ERC, la obesidad juega un rol dual y paralelo en el desarrollo de la enfermedad, tradicionalmente se ha denominado “paradoja de la obesidad”, donde por un lado actúa como un factor de riesgo modificable para el desarrollo de la enfermedad renal crónica (ERC) y por otro se ha asocia de manera consistente con mejores resultados de supervivencia en pacientes con enfermedad renal terminal [1]. Por lo anterior, en las próximas páginas describimos aspectos fisiopatológicos que involucran la obesidad en el desarrollo de la ERC. Definición y epidemiología La obesidad es una condición que se caracteriza por la acumulación anormal o excesiva de tejido adiposo con consecuencias patológicas adversas e incremento del riesgo cardiovascular [4]. Utilizando para su definición y diagnostico un indicador simple como es la relación entre el peso y la talla denominado índice de masa corporal (IMC), se calcula dividiendo el peso de una persona en kilos por el cuadrado de su talla en metros (kg/m2). Un IMC entre 18.5 y 25 kg/m2 es considerado por la Organización Mundial de la Salud (OMS) como peso normal, un IMC entre 25 y 30 kg/m2 como sobrepeso y un IMC > 30 kg/m2, como obesidad [5-7]. Además, la obesidad puede ser clasificada en tres niveles de severidad: clase I (IMC 30.0 – 34.9), clase II (IMC 35.0 – 39.9) y clase III (IMC > 40) [8]. Durante las últimas tres décadas, la prevalencia de adultos con sobrepeso y obesidad (IMC ≥ 25 kg/m2) en todo el mundo ha aumentado sustancialmente, convirtiendo a la obesidad en una epidemia y se prevé que su prevalencia crezca un 40% en la próxima década [6]. Actualmente, el problema de obesidad se ha visto en mayor aumento debido al incremento en la afectación en niños, lo que ocasiona una mayor prevalencia de patologías a edad temprana. En 2016, según las estimaciones de la OMS unos 41 millones de niños menores de cinco años tenían sobrepeso o eran obesos [7]. Esto afectando a todos los países, independiente de su nivel de ingresos [7]. La prevalencia del sobrepeso y la obesidad en niños y adolescentes (de 5 a 19 años) ha aumentado de forma espectacular, del 4% en 1975 a más del 18% en 2016. Este aumento ha sido similar en ambos sexos: un 18% de niñas y un 19% de niños con sobrepeso en 2016. Mientras que en 1975 había menos de un 1% de niños y adolescentes de 5 a 19 años con obesidad, en 2016 eran 124 millones (un 6% de las niñas y un 8% de los niños) [7]. La creciente prevalencia de la obesidad tiene implicaciones para las enfermedades cardiovasculares (ECV) y también para la ERC. Un IMC alto es uno de los factores de riesgo más fuertes para la ERC de nueva aparición [6]. Epidemiología de la enfermedad renal crónica asociada a obesidad (ERC-AO) La enfermedad renal crónica (ERC) es una condición de interés en salud pública, asociada a una elevada morbilidad y mortalidad a nivel mundial. Las guías KDIGO (Kidney Disease: Improving Global Outcomes), definen la ERC como la presencia de alteraciones en la estructura o función renal durante al menos tres meses y con implicaciones para la salud [9, 10]. Los principales elementos clasificatorios para definir la presencia de ERC son la tasa de filtración glomerular (TFG) estimada (G1 a G5) utilizando como umbral definitorio una TFG 60 ml/min/1,73m2 y la tasa de excreción de albúmina en orina (A1 a A3) según el cociente albúmina/creatinina en una muestra aislada de orina sea < 30, 30-300 o > 300 mg/g, respectivamente [9, 10]. Si bien inicialmente existía cierta controversia sobre el uso de la TFG para el diagnóstico de la ERC en fases iniciales, trabajos recientes han puesto en evidencia que tanto una TFG< 60 ml/min/1.73 m2 como un cociente albúmina/creatinina (CAC) ≥ 1.1 mg/mmol (10 mg/g) son predictores independientes del riesgo de mortalidad e insuficiencia renal terminal (IRT) en población general [11, 12]. En consecuencia, debido a estas categorías podemos determinar el pronóstico de cada paciente. Los datos globales sugieren que la prevalencia de la ERC se encuentra entre el 10 y el 16 %, pero la información sobre la prevalencia de la población por categoría de TFG y ACR es escasa [13]. La ERC es una afección asociada a una elevada carga de morbilidad, mortalidad y enfermedad cardiovascular (ECV). A medida que disminuye la función renal, surgen trastornos metabólicos y hemodinámicos que aumentan las tasas de hospitalización, ECV y muerte [4]. El conjunto de factores de riesgo conocidos para la progresión de la ERC es relativamente pequeño, y las terapias y estrategias efectivas para retrasar la progresión de la ERC son limitadas [14]. Por lo cual resulta necesario conocer y entender los diferentes factores de riesgo y su impacto en el daño renal, en aras de lograr minimizar la progresión del mismo, sobre todo en aquellos en los cuales se puede realizar intervenciones activas, evaluables, controlables y con seguimiento continuo como es la obesidad. A la fecha existe suficiente evidencia para asociar la obesidad con el desarrollo y progresión de la enfermedad renal crónica. Los datos granulares sobre la prevalencia de la obesidad en personas con ERC son limitados pero consistentes en todo el espectro de la enfermedad renal. En la Encuesta Nacional de Examen de Salud y Nutrición de 2011–2014, el 44.1 % de los pacientes con ERC en los Estados Unidos también tenían obesidad (21.9 % con obesidad de clase 1 y 11.1 % con clase 2 y obesidad clase 3, habiéndose incrementado el porcentaje global un 5% en los últimos 12 años [15]. La glomeruloesclerosis focal y segmentaria (GEFS) es el tipo de glomerulonefritis que se asocia con mayor frecuencia a la obesidad [16]. La enfermedad glomerular habitualmente asociada a la obesidad se denomina glomerulopatía relacionada con la obesidad (GRO). Esta condición suele presentarse con síndrome nefrótico y pérdida progresiva de la función renal. Con la epidemia mundial de obesidad, se produjo un aumento progresivo de la GRO del 0.2% entre 1986 y 1990 al 2% entre 1996 y 2000, y se ha convertido en un tema emergente en el ámbito de la nefrología [15]. Etiología y patogénesis de la ERC-AO La obesidad se caracteriza por un exceso de desequilibrios hormonales adipocíticos (adipoquinas), desregulación del sistema de equilibrio energético y desequilibrios en la homeostasis metabólica [12]. Hay dos tipos de tejido adiposo presentes en los humanos: tejido adiposo blanco (WAT) y tejido adiposo marrón (BAT) [17-19]. El depósito de grasa ectópica primariamente ocurre en lugares donde no se almacena fisiológicamente, como el hígado, el páncreas, el corazón y el músculo esquelético; secundariamente hay un cambio en la distribución del tejido adiposo visceral con almacenamiento de tejido adiposo en los espacios intraperitoneal y retroperitoneal; luego se presenta la desregulación inflamatoria y de adipoquinas; y por último la resistencia a la insulina [20]. Tejido adiposo blanco (WAT) El tejido adiposo blanco (WAT) se caracteriza por ser un tejido blanco o amarillo con menor vascularización e inervación que el tejido marrón. Las células grasas tienen un tamaño que oscila entre 20 y 200 µm y contienen una única vacuola lipídica (uniloculares). En dicha vacuola se almacenan lípidos para su uso cuando hay demanda energética. De la totalidad de los lípidos que abarca la vacuola lipídica del adipocito blanco, del 90 al 99% son triacilgliceroles. El tejido adiposo blanco genera una gran cantidad de adipocinas y lipocinas. Las adipocinas son péptidos que actúan como hormonas o mensajeros que regulan el metabolismo. El tejido adiposo blanco se localiza en el tejido omental, mesentérico, retroperitoneal, perirrenal, gonadal y pericárdico [19]. Este tejido al igual que el tejido adiposo de otros sitios, está compuesto por una variedad de células que incluyen macrófagos, neutrófilos, células T CD4 y CD8, células B, neutrófilos, mastocitos, células T reguladoras y células T asesinas naturales (NK) [21, 22]. El tejido adiposo es responsable de la secreción de muchas moléculas de señalización, incluidas adipocinas, hormonas, citocinas y factores de crecimiento, como leptina, adiponectina, resistina, factor de necrosis tumoral-α (TNF-α), interleucina 6 (IL-6), monocito, proteína quimioatrayente-1 (MCP-1), factor de crecimiento transformante-β (TGF-β) y angiotensina II [23]. Tejido adiposo marrón o pardo (BAT) La coloración marrón del tejido adiposo se debe a que está más vascularizado y tiene un alto contenido de mitocondrias, las células grasas que componen el tejido adiposo pardo son multiloculares o tienen varias vacuolas lipídicas. Estas células tienen forma poligonal y miden de 15 a 50 µm. A diferencia del tejido adiposo blanco, el tejido marrón no tiene la función de almacenar energía, sino que la disipa a través de la termogénesis. Para lograr la regulación de la temperatura corporal, el tejido adiposo pardo se localiza en sitios superficiales y profundos [18]. Clasificación de la ERC-AO Se ha establecido que la obesidad es una enfermedad con un comportamiento pro inflamatorio crónico con múltiples comorbilidades asociadas [19]. El tejido adiposo como se describió previamente funciona como un órgano con actividad endocrina y esta infiltrado por diferentes poblaciones celulares que incluyen macrófagos y otras células con actividad inmune como linfocitos T, B y células dendríticas [19]. La mayor parte de la grasa corporal total, se considera como un sistema de órganos endocrinos, la perturbación de este tejido tiene como resultado una respuesta patológica al balance calórico positivo en individuos susceptibles que directa e indirectamente contribuye a la enfermedad cardiovascular y metabólica, se tiene conocimiento de tres principales mecanismos de disfunción del tejido adiposo “adiposopatía” [20]. Estos mecanismos incluyen alteraciones hemodinámicas, metabólicas e inflamatorias, lo que es la base de la clasificación de la ERC-AO propuesta en esta revisión (Tabla 1). ERC-AO tipo 1 La obesidad produce un daño renal de forma directa a través de alteraciones hemodinámicas, inflamatorias, y desregulación de factores de crecimiento y adipocitoquinas, además de aumento de leptina y disminución de adiponectina, aun cuando la función renal y las pruebas convencionales sean normales [16]. La obesidad desencadena una serie de eventos, que incluyen resistencia a la insulina, intolerancia a la glucosa, hiperlipidemia, aterosclerosis e hipertensión, todos los cuales están asociados con un mayor riesgo cardiovascular [4, 16] (Figura 1). La obesidad conduce a un incremento en la reabsorción tubular de sodio, alterando la natriuresis y provocando una expansión de volumen extracelular debido a la activación del sistema nervioso simpático (SNS) y el sistema renina-angiotensina-aldosterona (SRAA)(16). El aumento en la reabsorción tubular de sodio y la consiguiente expansión de volumen extracelular es un evento central en el desarrollo de HTA en la obesidad [4, 16]. Algunos estudios sugieren que se produce un aumento de la reabsorción de sodio en algunos segmentos además del túbulo proximal, posiblemente en el asa de Henle. Además, hay un aumento del flujo sanguíneo renal, la tasa de filtración glomerular (TFG) y la fracción de filtración [16]. La hiperfiltración glomerular, asociada con el aumento de la presión arterial y otras alteraciones metabólicas como la resistencia a la insulina y la DM, finalmente resultan en daño renal y disminución del filtrado glomerular [16]. Por otro lado, la activación del SNS también contribuye a la hipertensión relacionada con la obesidad [4]. Hay evidencia de que la denervación renal reduce la retención de sodio y la hipertensión en la obesidad, lo que sugiere que la activación del SNS inducida por la obesidad aumenta la presión arterial principalmente debido al estímulo de retención de sodio, más que a la vasoconstricción [16]. Los mecanismos que conducen a la activación del SNS en la obesidad aún no se conocen por completo, pero se han propuesto varios factores como desencadenantes de este estímulo, entre ellos la hiperinsulinemia, la hiperleptinemia, el aumento de los niveles de ácidos grasos, los niveles de angiotensina II y las alteraciones del reflejo barorreceptor. El aumento de los niveles de leptina está asociado a la activación del SNS y su efecto sobre el aumento de los niveles de presión arterial incluye también la inhibición de la síntesis de óxido nítrico (potente vasodilatador) [16, 24, 25].También se ha descrito un aumento de la producción de endotelina-1 en sujetos obesos, lo que contribuye aún más a la elevación de los niveles de presión arterial y, en consecuencia, a la disfunción renal. Estudios recientes han demostrado que la endotelina-1 está aumentada en pacientes con hipertensión intradiálisis, lo que sugiere que esta sustancia juega un papel clave en la génesis de la hipertensión en pacientes con ERC y posiblemente esté asociada con la hipertensión en pacientes obesos [16, 25]. Por lo anterior, las alteraciones hemodinámicas en los pacientes con obesidad conllevan a progresión de la ERC e incremento del riesgo cardiovascular derivado del desarrollo de enfermedades adicionales como la HTA, potencialmente estos cambios son reversibles con el control de la obesidad. ERC-AO Tipo 2 Mantener el estado de obesidad más allá de los efectos renales funcionales produce cambios estructurales irreversibles a nivel glomerular [25]. El estudio de pacientes con ERC y obesidad ha permitido identificar la presencia de enfermedad glomerular asociada a la obesidad, denominada glomerulopatía relacionada con la obesidad (GRO). En esta condición la hipertrofia glomerular parece ser la lesión inicial que estimula el borramiento de los podocitos y desencadena la respuesta inflamatoria local [25, 26]. Es relevante mencionar que las señales profibrogénicas inducen la formación de depósitos en la matriz extracelular de las nefronas, que conduce al engrosamiento de la membrana basal glomeruloesclerosis y fibrosis tubulointersticial [26]. Dentro del curso patogénico de la enfermedad la expansión de la superficie glomerular conduce a que los podocitos sean incapaces de cubrirla, esto lleva a disfunción y borramiento de los mismos, generando ruptura de la barrera de filtración glomerular con sobrecarga de las células restantes, lo que finalmente conduce a hiperfiltración y proteinuria [25, 26]. No obstante, no todos los pacientes con obesidad o IMC aumentado desarrollan ERC, lo cual sugiere que el incremento del IMC por sí solo no genera aumento en la incidencia o progresión de la ERC, ameritando alteraciones metabólicas adicionales. En los siguientes apartados se describen algunas de estas vías fisiopatológicas comunes a todos los tipos de ERC-AO. ERC-AO Tipo 3 La obesidad produce daño renal de forma secundaria ya que aumenta el riesgo de diabetes mellitus, hipertensión y daño cardiovascular, estas patologías causan enfermedad renal diabética (ERD), nefroangioesclerosis, y glomerulopatía asociada a hipertensión pulmonar e insuficiencia cardíaca. La mortalidad no solo se ve afectada por la presencia de la obesidad sino por la presencia de diabetes tipo 2, hipertensión arterial, hipertensión pulmonar e insuficiencia cardíaca. Los peores resultados en supervivencia lo padecen los pacientes con falla cardíaca, obesidad e insuficiencia renal. ERC-AO Tipo 4 En pacientes en hemodiálisis los niveles más elevados de adiponectina se asocian paradójicamente con tres veces más riesgo de muerte [24]. La obesidad se asocia a niveles muy bajos adiponectina por lo que la obesidad en el grupo poblacional que se realiza hemodiálisis es un fuerte factor protector con mejores resultados de supervivencia a 3 años comparados con pacientes con índice de masa corporal normal o baja. Mecanismos fisiopatológicos comunes en la ERC-AO Lipotoxicidad derivada del tejido adiposo En pacientes obesos el exceso de energía conduce a un microambiente sometido a estrés crónico, lo cual resulta en hipertrofia del tejido adiposo hasta que los adipocitos alcanzan su límite de crecimiento [25]. En ese momento, el exceso de especies toxicas lipídicas se acumula ectópicamente en diferentes órganos, induciendo un efecto nocivo conocido como lipotoxicidad; especialmente a nivel renal [27]. La lipotoxicidad se asocia a cambios estructurales y funcionales de las células mesangiales, podocitos y células tubulares proximales [28]. En los podocitos, esto interferiría con la vía de la insulina, crítica para la supervivencia y el mantenimiento de la estructura de los podocitos, lo que conduciría a la apoptosis de los podocitos e induciría una respuesta hipertrófica compensatoria en los podocitos restantes [25]. En el riñón, los depósitos de lípidos ectópicos contribuyen tanto a la inflamación local como al estrés oxidativo [27]. En modelos de ERD, la dislipidemia puede favorecer la acumulación de lípidos ectópicos e intermediarios lipídicos, no solo en el riñón sino también en tejidos extrarrenales como hígado, páncreas y corazón [27]. La acumulación de lípidos en el parénquima renal, genera daño en varias poblaciones celulares, incluídos podocitos, células epiteliales tubulares proximales y el tejido tubulointersticial a través de distintos mecanismos descritos en las siguientes apartados, pudiendo general compromiso a largo plazo de la función renal [27]. El tejido adiposo es una fuente importante de producción de diferentes factores proteicos activos, conocidos como adipocitocinas, las cuales participan en diferentes procesos metabólicos. Alteraciones en la secreción y señalización de moléculas derivadas del tejido adiposo durante la obesidad en gran medida puede mediar en la patogenia de los trastornos metabólicos [25]. A continuaciones se describe el rol de las adipocinas en la patogenia de la ERC y obesidad. Adiponectina La adiponectina es una proteína secretada principalmente por los adipocitos WAT, las principales funciones biológicas de la adiponectina incluyen una mayor biosíntesis de ácidos grasos y la inhibición de la gluconeogénesis hepática [17]. Es probablemente la adipocina secretada más abundantemente, forma alrededor del 0.05 % de las proteínas séricas y mide de 3 a 30 mg/ml en humanos, para su activación utiliza dos isoformas del receptor (AdipoR1 y AdipoR2) son receptores de siete transmembranas y tienen una homología del 66.7 % en su estructura [17]. Sin embargo, AdipoR1 y AdipoR2 son estructural y funcionalmente distintos de los receptores acoplados a proteína G porque su terminal N es intracelular, mientras que el terminal C es extracelular [29, 30]. La señalización de adiponectina se basa principalmente en interacciones de tipo receptor-ligando, en las que la adiponectina se une a sus receptores afines e inicia la activación de varias cascadas de señalización intracelular a través de las vías AMPK, mTOR, NF-κB, STAT3 y JNK [17]. La adiponectina inicia la activación de la señalización de AMPK mediada por la proteína adaptadora APPL1, que se une al dominio intracelular de AdipoR. Eso produce la activación de la biosíntesis de moléculas, otras proteínas reguladoras e importantes factores de transcripción. AMPK es un regulador que participa principalmente en la proliferación celular [17]. Hay dos tipos de macrófagos, M1 participan en la estimulación de los factores pro inflamatorios e induce la resistencia a la insulina y M2 bloquean una respuesta inflamatoria y promueve el metabolismo oxidativo; En los macrófagos, la adiponectina promueve la diferenciación celular de monocitos a macrófagos M2 y suprime su diferenciación a macrófagos M1, lo que muestra efectos pro inflamatorios y antiinflamatorios. Además, también activa los factores antiinflamatorios IL-10 pero reduce las citoquinas pro inflamatorias como IFN-γ, IL-6 y TNF-α en los macrófagos humanos [17]. Los pacientes con ERC muestran niveles elevados de proteína C reactiva (PCR), IL-6 y TNF-α y tienen una activación aberrante de receptor tipo toll (TLR)-4 [25]; en un estudio realizado en el año 2005 en 29 pacientes con ERC no diabéticos en etapa 5 y 14 controles sanos, se identificó que los pacientes con ERC tenían una expresión elevada del gen y la proteína TLR4, la estimulación de TLR-4 in vitro indujo la activación de TNF-α y NF-κB en células C2C12. Esto sugiere indirectamente que la activación de TLR-4 podría promover la inflamación muscular de los pacientes con ERC [31]. Los niveles de adiponectina se consideran predictivos de ERC, dado que estos se encuentran aumentados en pacientes con etapa pre diálisis [17, 29, 32]. Adicionalmente, en un estudio prospectivo realizado en el año 2008 en pacientes con ERC primaria no diabética identificó niveles elevados de adiponectina como un predictor novedoso de progresión de la ERC en hombres [33]. En estudios realizados en animales (ratones) muestran que la deficiencia de adiponectina se relaciona con varias alteraciones histológicas, incluida la fusión segmentaria procesos podocitarios, albuminuria y aumento del estrés oxidativo en los riñones [34]. Por otro lado, en pacientes obesos la producción de adiponectina se encuentra disminuida por lo que se cree que puede generar una función protectora sobre el riñón [29]. No obstante, paradójicamente, algunos estudios muestran que los pacientes con ERC y enfermedad renal crónica en diálisis (ERCT) tienen altos niveles de adipocinas, las explicaciones a esta situación son controversiales, se ha planteado podrían corresponder a un mecanismo compensatorio, otras consideraciones sugieren una disminución de la sensibilidad a la adiponectina o una reducción en el aclaramiento de la misma [35]. Leptina En pacientes con ERC independiente de la presencia de obesidad o no, se asocian a niveles elevados de leptina sérica. La leptina es una proteína de 167 aminoácidos, con una masa molecular de aproximadamente 16 kDa que está codificada por el gen LEP [23] secretada principalmente por los adipocitos, es una adipocina pleiotrópica. La leptina circulante llega a los órganos diana, donde se une a receptores específicos (conocidos como ObR, LR o LEPR), se conocen cinco isoformas del receptor de leptina en humanos (ObRa, ObRb, ObRc, ObRd y ObRe), de estas solo la isoforma ObRb (isoforma larga) se considera un receptor completamente activo, ya que es capaz de transducir completamente una señal de activación en la célula. Esta isoforma se encuentra altamente expresada en el sistema nervioso central (SNC), especialmente en el hipotálamo, donde participa en la regulación de la actividad secretora de este órgano. Los efectos de la leptina están mediados por cinco vías principales de señalización. Estas vías incluyen las vías de señalización JAK-STAT, PI3K, MAPK, AMPK y mTOR [23]. Por esta razón la principal función fisiológica de la leptina es transmitir información al hipotálamo sobre la cantidad de energía almacenada, como la masa de tejido adiposo, e influir en el gasto de energía al reducir el apetito. Regula el metabolismo energético, tiene efecto sobre la ingesta de alimentos, procesos de coagulación, angiogénesis, funciones relacionadas con la insulina y la remodelación vascular, además funciona como un pro inflamatorio molecular [36]. La leptina tiene efectos sobre el apetito y se ha demostrado que la hiperleptinemia contribuye a la hipertensión asociada a la obesidad por sobre activación del sistema nervioso simpático [37]. En cuanto al curso de la ERC, la leptina puede modular diferentes vías de señalización en el riñón, debido a que las células endoteliales glomerulares y mesangiales expresan abundantes receptores de leptina [25]. La leptina inducirá un incremento en la expresión de genes profibróticos, como TGF-β1 y citocinas pro inflamatorias [25]. El aumento en la expresión de TGF-β1, también contribuirá al desarrollarlo de la fibrosis renal, al unirse a receptores específicos a nivel renal, estimulara la expresión de factores profibróticos en un ciclo de retroalimentación positiva. Además, TGF-β1 es un potente iniciador de proliferación de células mesangiales renales [25]. Debido a su tamaño relativamente pequeño, la leptina atraviesa libremente el filtro glomerular de los riñones y luego se reabsorbe en la parte proximal de los túbulos contorneados [23]. Por lo que el estado elevado de leptina puede indicar una función renal deficiente [36]. Promueve la inflamación y trastorno de los lípidos, que contribuyen al riesgo de ERC [36]; se considera como “toxina urémica”, estando implicada tanto en la progresión de la enfermedad renal a través de efectos pro-hipertensivos y profibróticos, como en el desarrollo de complicaciones relacionadas con la ERC (inflamación crónica, pérdida de proteínas) [38]. Como se mencionó previamente, la leptina estimula la proliferación de células endoteliales glomerulares renales y aumenta la expresión de TGF-β1, un mediador clave de la hidrogénesis en estas células, el aumento de los niveles de leptina también contribuye al aumento de la expresión de colágeno tipo IV en el riñón, induce la proliferación de células mesangiales glomerulares mediante la activación de la vía PI3K, la hipertrofia de las células mesangiales aumenta la cantidad de proteína filtrada y albúmina que llega a las células del túbulo proximal y, como resultado, activa las vías inflamatorias y la fibrosis [23]. Puede presentarse un aumento en la síntesis del receptor TGFβ-1 secretado por las células endoteliales, este actúa de manera parácrina sobre el mesangio uniéndose a su receptor y activando la síntesis de proteínas de la matriz extracelular (ECM), incluyendo colágeno, fibronectina, tenazina y proteoglicanos; consiguientemente, un aumento en el nivel de TGFβ-1 conduce a la acumulación de MEC y, en consecuencia, a fibrosis glomerular y glomeruloesclerosis. En los podocitos, la leptina contribuye a la disminución de la expresión de las proteínas responsables de la filtración glomerular adecuada, incluidas la podocina, la nefrina, la podoplanina y la podocalixina. En las células del túbulo contorneado proximal (PTC), la leptina reduce la actividad metabólica de las células al activar la vía de señalización de mTOR [23]. Por otro lado, la leptina inhibe el apetito y aumenta el gasto de energía conduciendo a anorexia y desnutrición en pacientes con ERC, particularmente en casos de hemodiálisis de mantenimiento [36]. Por ende, una elevación de la leptina no solo nos indicaría daño renal, sino que además nos indica mayor progresión de complicaciones secundarias [39]. La obesidad aumenta la carga sobre los riñones y es un factor de riesgo de lesión renal, además de contribuir en los trastornos metabólicos asociados. Por lo que, teniendo en cuenta los efectos inhibitorios de la leptina sobre la obesidad, se puede considerar que puede proteger contra la lesión renal [39, 40]. Un estudio experimental publicado en el año 2017 demostró que la leptina disminuyó la ingesta calórica y los niveles de glucosa en ratas diabéticas [41], ese mismo año se publicó un estudio retrospectivo donde demostraron que la metreleptina, una metionil leptina humana recombinante, reduce el peso corporal y la dosis diaria de insulina en la diabetes mellitus tipo 1 [42]. La metreleptina ejerce efectos terapéuticos en la lipodistrofia [43], lo que indica que es probable que la leptina se aplique en los trastornos metabólicos [36]. Otras adipocinas Las principales adipocinas corresponden a la adiponectina y leptina como se ha descrito previamente. Además de estas, se distinguen la actividad de la visfatina y resistina, las cuales muestran propiedades pro-inflamatorias y efectos aterogénicos [25]. La visfatina estimula la expresión de TGF-β1, inhibidor del activador del plasminógeno-1 (PAI-1) y colágeno tipo I, los cuales han demostrado un rol importante como agentes profibróticos. Por otro lado, la resistina estimula la producción de las moléculas de adhesión como la molécula de adhesión intracelular 1 (ICAM-1) y la proteína de adhesión celular vascular 1 (VCAM-1) y promueve la activación del sistema renal simpático. Los niveles de estas adipocinas están marcadamente elevados en la obesidad y ERC correlacionándose con parámetros proinflamatorios y disminución de la tasa de filtración glomerular (TFG) [25, 37]. Durante el curso de la obesidad se presenta una sobre activación del SRAA, el tejido adiposo también estaría involucrado en la producción o estimulación de algunos de los componentes del RAS. Por ello la sobre estimulación del SRAA en obesos, asociado a la glomerulomegalia y desregulación de la reabsorción de sodio/glucosa, generalmente conlleva a hipertensión glomerular e hiperfiltración [25]. Otra adipocina a considerar, es la actividad de la adipocina proinflamatoria lipocalina 2 (LCN2), también denominada lipocalina asociada con la gelatinasa de neutrófilo (NGAL), estudiada como biomarcador funcional tanto para la enfermedad renal aguda como ERC(25). LCN2 es conocido por su papel en la respuesta inmune innata a través de su unión a sideróforos derivados de una infección bacteriana. Sin embargo, LCN2 no es secretada únicamente por neutrófilos sino también por otros tejidos como hígado, pulmones y de interés para este artículo, a nivel renal [25]. Se han informado niveles elevados de LCN2 en suero y orina en la lesión renal, debido a una expresión aumentada de LCN2 en el túbulo distal renal y una reabsorción alterada en el túbulo proximal [44]. El tejido adiposo, también puede producir factores angiogénicos como el factor de crecimiento del endotelio vascular (VEGF). Este elemento podría inducir la formación de novo de capilares glomerulares en gran parte defectuosos dentro del riñón, lo que contribuye a la hipertrofia glomerular característica de GRO [25] (Figura 2). Conclusiones La obesidad y el sobrepeso se asocian a alteraciones hemodinámicas, estructurales e histopatológicas en el riñón, así como alteraciones metabólicas y bioquímicas que predisponen a la enfermedad renal, aun cuando la función renal y las pruebas convencionales sean normales. Por lo tanto, los efectos renales de la obesidad son estructurales y funcionales. Hay varios mecanismos actualmente descritos que involucran a la obesidad como generador de alteraciones renales. Teniendo en cuenta las bases fisiopatológicas, proponemos una clasificación de la ERC-AO basadas en 4 tipos. Abreviaturas ERC: enfermedad renal crónica. ERC-AO: enfermedad renal crónica-asociada a enfermedad. VEGF: factor de crecimiento del endotelio vascular. OR: Odds ratio. Información suplementaria Materiales suplementarios no han sido declarados. Agradecimientos No aplica. Contribuciones de los autores Jorge Rico-Fontalvo: Conceptualización, Curación de datos, Análisis formal, Adquisición de fondos, Investigación, Metodología, Administración de proyecto, Recursos, Software, Escritura – borrador original. Rodrigo Daza-Arnedo: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. Tomás Rodríguez-Yanez: Metodología, validación, supervisión, redacción: Revisión y edición. Washington Osorio: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. Beatriz Suarez-Romero: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. Oscar Soto: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. Juan Montejo-Hernandez: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. María Cardona-Blanco: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. Juan Camilo Gutiérrez: Conceptualización, Supervisión, Validación, Visualización, Redacción: revisión y edición. Todos los autores leyeron y aprobaron la versión final del manuscrito. Financiamiento Los autores proveyeron los gastos de la investigación. Disponibilidad de datos o materiales Los conjuntos de datos generados y analizados durante el estudio actual no están disponibles públicamente debido a la confidencialidad de los participantes, pero están disponibles a través del autor correspondiente a pedido académico razonable. Declaraciones Aprobación del comité de ética y consentimiento para participar No aplica para revisiones narrativas. Consentimiento para publicación No aplica cuando no se publican imágenes o fotografías del examen físico o radiografías/tomografías/resonancias de pacientes. Conflictos de interés Los autores reportan no tener conflictos de interés. Referencias Azhar A, Hassan N, Tapolyai M, Molnar MZ. Obesity, Chronic Kidney Disease, and Kidney Transplantation: An Evolving Relationship. Semin Nephrol. marzo de 2021;41(2):189-200. DOI: 10.1016/j.semnephrol.2021.03.013. PMID: 34140097. Barbieri D, Goicoechea M, Sánchez-Niño MD, Ortiz A, Verde E, Verdalles U, Pérez de José A, Delgado A, Hurtado E, Sánchez-Cámara L, Lopez-Lazareno N, García-Prieto A, Luño J. Obesity and chronic kidney disease progression-the role of a new adipocytokine: C1q/tumour necrosis factor-related protein-1. Clin Kidney J. 2018 Oct 11;12(3):420-426. DOI: 10.1093/ckj/sfy095. PMID: 31198543; PMCID: PMC6543966. Kopp JB, Rosenberg AZ, Levi M. Introduction: Obesity and the kidney. Semin Nephrol. 2021 Jul;41(4):295. DOI: 10.1016/j.semnephrol.2021.06.001. PMID: 34715959. Hall JE, Mouton AJ, da Silva AA, Omoto ACM, Wang Z, Li X, do Carmo JM. Obesity, kidney dysfunction, and inflammation: interactions in hypertension. Cardiovasc Res. 2021 Jul 7;117(8):1859-1876. DOI: 10.1093/cvr/cvaa336. PMID: 33258945; PMCID: PMC8262632. Kovesdy CP. Epidemiology of chronic kidney disease: an update 2022. Kidney Int Suppl (2011). 2022 Apr;12(1):7-11. DOI: 10.1016/j.kisu.2021.11.003. Epub 2022 Mar 18. PMID: 35529086; PMCID: PMC9073222. Kovesdy CP, Furth S, Zoccali C; World Kidney Day Steering Committee. Obesity and kidney disease: Hidden consequences of the epidemic. Saudi J Kidney Dis Transpl. 2017 Mar-Apr;28(2):241-252. DOI: 10.4103/1319-2442.202776. PMID: 28352003. Organización mundial de la salud -OMS. Obesidad y sobrepeso [Internet]. Disponible en: https://www.who.int/es/news-room/fact-sheets/detail/obesity-and-overweight Lin X, Li H. Obesity: Epidemiology, Pathophysiology, and Therapeutics. Front Endocrinol (Lausanne). 2021 Sep 6;12:706978. DOI: 10.3389/fendo.2021.706978. PMID: 34552557; PMCID: PMC8450866. Gorostidi M, Santamaría R, Alcázar R, Fernández-Fresnedo G, Galcerán JM, Goicoechea M, et al. Spanish Society of Nephrology document on KDIGO guidelines for the assessment and treatment of chronic kidney disease. Nefrologia. 2014 May 21;34(3):302-16. English, Spanish. DOI: 10.3265/Nefrologia.pre2014.Feb.12464. Epub 2014 Mar 6. PMID: 24798565. Kidney Disease: Improving Global Outcomes (KDIGO) Diabetes Work Group. KDIGO 2020 Clinical Practice Guideline for Diabetes Management in Chronic Kidney Disease. Kidney Int. 2020 Oct;98(4S):S1-S115. DOI: 10.1016/j.kint.2020.06.019. PMID: 32998798. Salvador González B, Rodríguez Pascual M, Ruipérez Guijarro L, Ferré González A, Cunillera Puertolas O, Rodríguez Latre LM. Enfermedad renal crónica en Atención Primaria: prevalencia y factores de riesgo asociados [Chronic kidney disease in Primary Health Care: prevalence and associated risk factors]. Aten Primaria. 2015 Apr;47(4):236-45. Spanish. DOI: 10.1016/j.aprim.2014.06.003. Epub 2014 Sep 9. PMID: 25212720; PMCID: PMC6985625. Lakkis JI, Weir MR. Obesity and Kidney Disease. Prog Cardiovasc Dis. 2018 Jul-Aug;61(2):157-167. DOI: 10.1016/j.pcad.2018.07.005. Epub 2018 Jul 5. PMID: 29981350. Stevens PE, Levin A; Kidney Disease: Improving Global Outcomes Chronic Kidney Disease Guideline Development Work Group Members. Evaluation and management of chronic kidney disease: synopsis of the kidney disease: improving global outcomes 2012 clinical practice guideline. Ann Intern Med. 2013 Jun 4;158(11):825-30. DOI: 10.7326/0003-4819-158-11-201306040-00007. PMID: 23732715. Anderson AH, Xie D, Wang X, Baudier RL, Orlandi P, Appel LJ, et al; CRIC Study Investigators. Novel Risk Factors for Progression of Diabetic and Nondiabetic CKD: Findings From the Chronic Renal Insufficiency Cohort (CRIC) Study. Am J Kidney Dis. 2021 Jan;77(1):56-73.e1. DOI: 10.1053/j.ajkd.2020.07.011. Epub 2020 Aug 28. PMID: 32866540; PMCID: PMC7752839. Friedman AN, Kaplan LM, le Roux CW, Schauer PR. Management of Obesity in Adults with CKD. J Am Soc Nephrol. 2021 Feb 18;32(4):777–90. DOI: 10.1681/ASN.2020101472. Epub ahead of print. PMID: 33602674; PMCID: PMC8017542. Silva Junior GB, Bentes AC, Daher EF, Matos SM. Obesity and kidney disease. J Bras Nefrol. 2017 Mar;39(1):65-69. Portuguese, English. DOI: 10.5935/0101-2800.20170011. PMID: 28355395. Choi HM, Doss HM, Kim KS. Multifaceted Physiological Roles of Adiponectin in Inflammation and Diseases. Int J Mol Sci. 2020 Feb 12;21(4):1219. DOI: 10.3390/ijms21041219. PMID: 32059381; PMCID: PMC7072842. Frigolet ME, Gutiérrez-Aguilar R. The colors of adipose tissue. Gac Med Mex. 2020;156(2):142-149. English. DOI: 10.24875/GMM.M20000356. PMID: 32285854. Chen Y, Dabbas W, Gangemi A, Benedetti E, Lash J, Finn PW, Perkins DL. Obesity Management and Chronic Kidney Disease. Semin Nephrol. 2021 Jul;41(4):392-402. DOI: 10.1016/j.semnephrol.2021.06.010. PMID: 34715968. Neeland IJ, Poirier P, Després JP. Cardiovascular and Metabolic Heterogeneity of Obesity: Clinical Challenges and Implications for Management. Circulation. 2018 Mar 27;137(13):1391-1406. DOI: 10.1161/CIRCULATIONAHA.117.029617. PMID: 29581366; PMCID: PMC5875734. Bjørndal B, Burri L, Staalesen V, Skorve J, Berge RK. Different adipose depots: their role in the development of metabolic syndrome and mitochondrial response to hypolipidemic agents. J Obes. 2011;2011:490650. DOI: 10.1155/2011/490650. Epub 2011 Feb 15. PMID: 21403826; PMCID: PMC3042633. Johnson AR, Milner JJ, Makowski L. The inflammation highway: metabolism accelerates inflammatory traffic in obesity. Immunol Rev. 2012 Sep;249(1):218-38. DOI: 10.1111/j.1600-065X.2012.01151.x. PMID: 22889225; PMCID: PMC3422768. Korczynska J, Czumaj A, Chmielewski M, Swierczynski J, Sledzinski T. The Causes and Potential Injurious Effects of Elevated Serum Leptin Levels in Chronic Kidney Disease Patients. Int J Mol Sci. 2021 Apr 28;22(9):4685. DOI: 10.3390/ijms22094685. PMID: 33925217; PMCID: PMC8125133. Goicoechea M. Obesidad y Progresión de la Enfermedad Renal. Nefrología al día 2022(febrero):nefrologia_al_dia Martin-Taboada M, Vila-Bedmar R, Medina-Gómez G. From Obesity to Chronic Kidney Disease: How Can Adipose Tissue Affect Renal Function? Nephron. 2021;145(6):609-613. DOI: 10.1159/000515418. Epub 2021 Apr 21. PMID: 33882488. D'Agati VD, Chagnac A, de Vries AP, Levi M, Porrini E, Herman-Edelstein M, Praga M. Obesity-related glomerulopathy: clinical and pathologic characteristics and pathogenesis. Nat Rev Nephrol. 2016 Aug;12(8):453-71. DOI: 10.1038/nrneph.2016.75. Epub 2016 Jun 6. PMID: 27263398. Opazo-Ríos L, Mas S, Marín-Royo G, Mezzano S, Gómez-Guerrero C, Moreno JA, Egido J. Lipotoxicity and Diabetic Nephropathy: Novel Mechanistic Insights and Therapeutic Opportunities. Int J Mol Sci. 2020 Apr 10;21(7):2632. DOI: 10.3390/ijms21072632. PMID: 32290082; PMCID: PMC7177360. Zhu Q, Scherer PE. Immunologic and endocrine functions of adipose tissue: implications for kidney disease. Nat Rev Nephrol. 2018 Feb;14(2):105-120. DOI: 10.1038/nrneph.2017.157. Epub 2017 Dec 4. PMID: 29199276. Akingbemi BT. Adiponectin receptors in energy homeostasis and obesity pathogenesis. Prog Mol Biol Transl Sci. 2013;114:317-42. DOI: 10.1016/B978-0-12-386933-3.00009-1. PMID: 23317789. Zha D, Wu X, Gao P. Adiponectin and Its Receptors in Diabetic Kidney Disease: Molecular Mechanisms and Clinical Potential. Endocrinology. 1 de julio de 2017;158(7):2022-34. DOI: 10.1210/en.2016-1765. PMID: 28402446. Verzola D, Bonanni A, Sofia A, Montecucco F, D'Amato E, Cademartori V, Parodi EL, Viazzi F, Venturelli C, Brunori G, Garibotto G. Toll-like receptor 4 signalling mediates inflammation in skeletal muscle of patients with chronic kidney disease. J Cachexia Sarcopenia Muscle. 2017 Feb;8(1):131-144. DOI: 10.1002/jcsm.12129. Epub 2016 Oct 18. PMID: 27897392; PMCID: PMC5326826. Guebre-Egziabher F, Drai J, Fouque D. Adiponectin and chronic kidney disease. J Ren Nutr. 2007 Jan;17(1):9-12. DOI: 10.1053/j.jrn.2006.10.003. PMID: 17198925. Kollerits B, Fliser D, Heid IM, Ritz E, Kronenberg F; MMKD Study Group. Gender-specific association of adiponectin as a predictor of progression of chronic kidney disease: the Mild to Moderate Kidney Disease Study. Kidney Int. 2007 Jun;71(12):1279-86. DOI: 10.1038/sj.ki.5002191. Epub 2007 Apr 25. PMID: 17457380. Sharma K, Ramachandrarao S, Qiu G, Usui HK, Zhu Y, Dunn SR, Ouedraogo R, Hough K, McCue P, Chan L, Falkner B, Goldstein BJ. Adiponectin regulates albuminuria and podocyte function in mice. J Clin Invest. 2008 May;118(5):1645-56. DOI: 10.1172/JCI32691. PMID: 18431508; PMCID: PMC2323186. Navarro-Díaz M, Serra A, López D, Granada M, Bayés B, Romero R. Obesity, inflammation, and kidney disease. Kidney Int Suppl. 2008 Dec;(111):S15-8. DOI: 10.1038/ki.2008.518. PMID: 19034319. Mao S, Fang L, Liu F, Jiang S, Wu L, Zhang J. Leptin and chronic kidney diseases. J Recept Signal Transduct Res. 2018 Apr;38(2):89-94. DOI: 10.1080/10799893.2018.1431278. Epub 2018 Feb 1. PMID: 29388492. Briffa JF, McAinch AJ, Poronnik P, Hryciw DH. Adipokines as a link between obesity and chronic kidney disease. Am J Physiol Renal Physiol. 2013 Dec 15;305(12):F1629-36. DOI: 10.1152/ajprenal.00263.2013. Epub 2013 Oct 9. PMID: 24107418. Katsiki N, Mikhailidis DP, Banach M. Leptin, cardiovascular diseases and type 2 diabetes mellitus. Acta Pharmacol Sin. 2018 Jul;39(7):1176-1188. DOI: 10.1038/aps.2018.40. Epub 2018 Jun 7. PMID: 29877321; PMCID: PMC6289384. de Luis DA, Perez Castrillón JL, Dueñas A. Leptin and obesity. Minerva Med. 2009 Jun;100(3):229-36. Epub 2008 Apr 4. PMID: 19182739. Mao S, Fang L, Liu F, Jiang S, Wu L, Zhang J. Leptin and chronic kidney diseases. J Recept Signal Transduct Res 2018 Apr; 38(2):89-94. DOI: 10.1080/10799893.2018.1431278. PMID: 29388492 da Silva AA, Hall JE, do Carmo JM. Leptin reverses hyperglycemia and hyperphagia in insulin deficient diabetic rats by pituitary-independent central nervous system actions. PLoS One. 2017 Nov 30;12(11):e0184805. DOI: 10.1371/journal.pone.0184805. PMID: 29190687; PMCID: PMC5708697. Vasandani C, Clark GO, Adams.HUet B, Quiiner C, Garg A. Efficacy and Safety of Metreleptin Therapy in Patients With Type 1 Diabetes: A Pilot Study. Diabetes care 2017 May;40(5): 694-697. PMID: 28223297 Brown RJ, Meehan CA, Cochran E, Rother KI, Kleiner DE, Walter M, Gorden P. Effects of Metreleptin in Pediatric Patients With Lipodystrophy. J Clin Endocrinol Metab. 2017 May 1;102(5):1511-1519. DOI: 10.1210/jc.2016-3628. PMID: 28324110; PMCID: PMC5443330. Abella V, Scotece M, Conde J, Gómez R, Lois A, Pino J, Gómez-Reino JJ, Lago F, Mobasheri A, Gualillo O. The potential of lipocalin-2/NGAL as biomarker for inflammatory and metabolic diseases. Biomarkers. 2015;20(8):565-71. DOI: 10.3109/1354750X.2015.1123354. Epub 2015 Dec 15. PMID: 26671823; PMCID: PMC4819811. Nota del Editor La REV SEN se mantiene neutral con respecto a los reclamos jurisdiccionales sobre mapas publicados y afiliaciones institucionales.

Aunque la arqueología de Al-Andalus no se constituyó como disciplina propia hasta hace unos cuarenta años, el interés hacia las fortalezas llamadas por entonces “hispano-musulmanas” se manifestó mucho antes, centrado esencialmente en los aspectos arquitectónicos y de poliorcética. Más recientemente, la aproximación al proceso de la fortificación medieval se ha ido diversificando. No son pocos los trabajos que buscan en él unas respuestas a preguntas más ambiciosas, relativas a la organización de la sociedad campesina, a las estructuras de poblamiento y a la ordenación del territorio, o a las formas adoptadas por el control estatal.Después de unas breves observaciones introductorias sobre el cambio metodológico experimentado a finales de los años 1970, el artículo hace hincapié en la polisemia de los términos árabes referidos a la arquitectura defensiva. A continuación, se centra en las polémicas surgidas a propósito de uno de estos términos, el ḥiṣn (en el ámbito rural) y en las hipótesis avanzadas al respecto. Finalmente, plantea la cuestión de la existencia en al-Andalus de graneros colectivos fortificados y de ribāṭ-s, estructuras mejor documentadas en África del Norte. Palabras claves: fortificación, estructura social islámica, ordenación del espacioTopónimos: al-AndalusPeriodo: siglos VIII-XV ABSTRACTUntil about forty years ago, the archeology of al-Andalus was not regarded as a discipline in itself. However, interest in the so-called “Moorish” fortresses had been expressed much earlier, focused primarily on architectural and polyorcetic aspects. More recently, the approach to the process of medieval fortification has become more diverse: today many scholars seek within it answers to more ambitious questions, related to the organization of peasant society, settlement structures, land-use planning, or formulae of state control.After some preliminary remarks on the methodological change that occurred in the late 1970s, this paper emphasizes the polysemy of Arabic terms referring to defensive architecture. It then focuses on the debates that arose with regard to one of these terms, the ḥiṣn (in rural areas), and on the hypotheses proposed in this respect. Finally, the paper raises the question of the existence in al-Andalus of ribāṭ-s and fortified collective granaries, structures long considered to be specific to North Africa. Keywords: fortification, Islamic social structure, spatial planningPlace names: al-AndalusPeriod: 8th-15th centuries REFERENCIASAcién Almansa, M. (1992a), “Poblamiento y fortificación en el sur de al-Andalus. La formación de un país de ḥuṣūn”, en III Congreso de Arqueología Medieval Española. Oviedo. 27 de marzo - 1 abril 1989, I, Oviedo, Universidad de Oviedo, pp. 135-150.— (1992b), “Sobre la función de los ḥuṣūn en el sur de al-Andalus. La fortificación en el califato”, en Coloquio hispano-italiano de arqueología medieval, Granada, Patronato de la Alhambra y el Generalife, pp. 263-274.— (1995), “Los ṯugūr del reino de Granada. Ensayo de identificación”, en A. Bazzana (ed.), Castrum 5. Archéologie des espaces agraires méditerranéens au Moyen Âge, Madrid-Roma, Casa de Velázquez-École française de Rome, pp. 427-438.— (2006), “Las torres/burūŷ en el poblamiento andalusí”, Al-Ándalus, espaço de mudança. Balanço de 25 anos de história e arqueología medievais, Mértola, Campo Arqueológico de Mértola, pp. 21-28.— (2008), “Un posible origen de la torre residencial en al-Andalus”, en R. Martí Castelló (ed.), Fars de l’Islam. Antigues alimares d’al-Andalus, Barcelona, EDAR, pp. 57-88.Albarrán, J. y Daza, E. (eds.) (2019), Fortificación, espiritualidad y frontera en el islam medieval: ribāṭs de al-Andalus, el Magreb y más allá, Cuadernos de Arquitectura y fortificación, 6, (número monográfico), Madrid, La Ergástula ediciones.Almagro Gorbea, A. (1991), “La torre de Romilla. Una torre nazarí en la Vega de Granada”, Al-Qanṭara, XII (1), pp. 225-250.Amigues, F. y De Meulemeester, J. (1995), “Archéologie d’un grenier collectif fortifié hispano-musulman : le Cabezo de la Cobertera (vallée du río Segura, Murcie)”, en A. Bazzana (ed.), Archéologie des espaces agraires méditerranéens au Moyen Âge, Madrid-Roma-Murcia, Casa de Velázquez-École Français de Rome-Ayuntamiento de Murcia, pp. 347-359.Amri, N. (2011), “Ribāṭ et idéal de sainteté à Kairouan et sur le littoral Ifrīqiyen du IIe/VIIIe au IVe/Xe siècle d’après le Riyāḍ al-Nufūs d’al-Mālikī”, en D. Valérian (ed.), Islamisation et arabisation de l’Occident musulman médiéval (VIIe-XIIe siècle), París, Éditions de la Sorbonne, pp. 336-368.Azuar Ruiz, R. (1982), “Una interpretación del ḥiṣn musulmán en el ámbito rural”, Revista del Instituto de Estudios Alicantinos, 37, pp. 33-41.— (1989), La Rábita Califal de las dunas de Guardamar (Alicante). Cerámica. Epigrafía. Fauna. Malacofauna, Memorias de excavaciones, Alicante : Museo arqueológico de Alicante.— (dir.) (1994), El Castillo del Río (Aspe, Alicante). Arqueología de un asentamiento andalusí y la transición al feudalismo (siglos XII-XIII), Alicante, Diputación Provincial, Colección “ExcavacionesArqueológicas-Memorias” 2.Barceló, M. (1998), “Los ḥuṣūn, los castra y los fantasmas que aún los habitan”, en A. Malpica Cuello (ed.), Castillos y territorio en al-Andalus, Granada, Athos-Pérgamos, pp. 10-42.Barroso Cabrera, R., Malalana Ureña, A., Carrobles Santos, J. y Morín de Pablo, J. (2021), “Ribāṭ-s y ḥuṣūn en la marca media toledana: del ṯagr al-awsaṭ a la transierra de Castilla”, Boletín de arqueología medieval, 19, pp. 89-138.Bazzana, A. (1992), “Le ḥiṣn et le ma’aqil dans l’organisation du peuplement musulman d’al-Andalus”, Château Gaillard, 15, pp. 19-31.— (1998), “Ḥiṣn et territoire dans l’organisation du peuplement islamique dans al-Andalus”, en M. Barceló y P. Toubert (eds.), «L’incastellamento». Actas de las reuniones de Girona (26-27 noviembre 1992) y de Roma (5-7 de mayo 1994), Roma, Escuela Española de Historia y Arqueología en Roma pp. 179-205.— (2009), “Castillos y sociedad en al-Andalus: cuestiones metodológicas y líneas actuales de investigación”, en Á. L. Molina Molina y J. Eiroa Rodríguez (eds.), El castillo medieval en tiempos de Alfonso X el Sabio, Murcia, Universidad de Murcia, pp. 9-40.Bazzana, A. y Guichard, P. (1978), “Les tours de défense de la Huerta de Valence au XIII s.”, Mélanges de la Casa de Velázquez, 14, pp. 73-105.Bazzana, A., Cressier, P. y Guichard, P. (1988), Les châteaux ruraux d’al-Andalus. Histoire et archéologie des ḥuṣūn du sud-est de l’Espagne, Madrid, Casa de Velázquez.Belatik, M. (2019), “Lkāy, une ville-forteresse médiévale dans le Pré-Rif marocain”, Bulletin d’Archéologie Marocaine, 24, pp. 93-109.Beltrán Martinez, A. (coord.) (2008), La Aljafería, Zaragoza, Cortes de Aragón.Benhima, Y. (2000), “L’habitat fortifié au Maroc médiéval. Éléments d’un bilan et perspectives de recherche”, Archéologie islamique, 10, pp. 79-102.Bertrand, M. (1987), “Los covarrones-refugio de Guadix. Primeros datos cronológicos”, en II Congreso de Arqueología Medieval Española, Madrid, Comunidad de Madrid, II, pp. 451-465.Bokbot, Y, Cressier, P., Delaigue, M.-Ch., Izquierdo Benito, R., Mabrouk, S. y Onrubia Pintado, J., (2002), “Enceintes refuges, greniers fortifiés et qasaba-s: fonctions, périodisation et interprétation de la fortification en milieu rural pré-saharien”, en I. C. Ferreira Fernandes (ed.), Mil anos de fortificações na Península ibérica e no Magreb (500-1500). Actas do Simposio Internacional sobre Castelos, Lisbonne-Palmela, Colibri, pp. 213-227.Caballero Zoreda, L. y Mateo Sagasta, A. (1990), “El grupo de atalayas de la sierra de Madrid”, Madrid del siglo IX al XI, Madrid, Comunidad de Madrid, Consejería de Cultura, Dirección General de Patrimonio Cultural, pp. 65-77.Castaño Aguilar, J. M. (2016), “El final de la villa y la continuidad del poblamiento, un debate entre turres y ḥuṣūn: el caso de la Serranía de Ronda”, Mainake, 36, pp. 111-136.— (2019), “¿Torres sin alquerías? De nuevo sobre el origen de la torre residencial en Al-Ándalus”, Arqueología y Territorio Medieval, 26, pp. 7-30.Castrum 1 (1983), “Habitats fortifiés et organisation de l’espace en Méditerranée médiévale”, en A. Bazzana, J.-M. Poisson y P. Guichard (eds.), Travaux de la Maison de l’Orient 4, Lyon, 1983.Castrum 2 (1988), Structures de l’habitat et occupation du sol dans les pays méditerranéens. Les méthodes et l’apport de l’archéologie extensive, en G. Noyé (ed.), Collection de l’École française de Rome 105 - Publications de la Casa de Velázquez/Série archéologie IX, Roma - Madrid.Castrum 3 (1988), Guerre, fortification et habitat dans le monde méditerranéen au Moyen Âge (1988), en A. Bazzana (ed.), Collection de la Casa de Velázquez/Série archéologie XII - Collection de l’École française de Rome 105, Madrid - Roma.Castrum 4 (1992), Frontière et peuplement dans le monde méditerranéen au Moyen Âge, en J.-M. Poisson (ed.), Collection de l’École française de Rome 105 - Collection de la Casa de Velázquez 38, Madrid - Roma.Castrum 5 (1999), Archéologie des espaces agraires méditerranéens au Moyen Âge, en A. Bazzana (ed.), Collection de la Casa de Velázquez 55 - Collection de l’École française de Rome 105, Madrid - Murcia - Roma.Castrum 6 (2000), Maisons et espace domestique dans le monde méditerranéen au Moyen Âge, en A. Bazzana y É. Hubert (dirs.), Collection de l’École française de Rome 105/6 - Collection de la Casa de Velázquez 72, Roma - Madrid.Castrum 7 (2001), Zones côtières littorales dans le monde méditerranéen au Moyen Âge : défense, peuplement, mise en valeur, en J.-M. Martin (ed.), Collection de l’École française de Rome 105/7 - Collection de la Casa de Velázquez 76, Roma - Madrid.Castrum 8 (2008), El castillo y la ciudad. Espacios y redes (siglos VI-XI), en P. Cressier (ed.), Collection de la Casa de Velázquez 108, Madrid.Clément, F. (2007), “La terminologie castrale dans les sources du Moyen Âge : l’approche philologique”, en Ph. Sénac (ed.), Le Maghreb, al-Andalus et la Méditerranée occidentale (VIIIe-XIIIe siècle), Toulouse, Méridiennes, pp. 237-251.Cressier, P. (1984), “Le château et la division territoriale dan l’Alpujarra médievale: du ḥiṣn à la tā‘a”, Mélanges de la Casa de Velázquez, 20, pp. 115-144.— (1986), “Dalías et son territoire : un groupe d’alquerías musulmanes de la basse Alpujarra (province d’Almería)”, Actas del XII congreso de la U.E.A.I. , Málaga, 1984, Madrid, pp. 205-228.— (1991) “Agua, fortificaciones y poblamiento. El aporte de la arqueología a los estudios sobre el Sureste peninsular”, Aragón en la Edad Media, 9, pp. 403-428.— (1995), “Châteaux et terroirs irrigués dans la province d’Alméria (Xe-XVe siècles)”, en A. Bazzana (ed.), Castrum 5. Archéologie des espaces agraires méditerranéens au Moyen Âge, Madrid-Roma-Murcia, Casa de Velázquez-École française de Rome-Ayuntamiento de Murcia, pp. 439-453.— (1998a), “Remarques sur la fonction du château islamique dans l’actuelle province d’Alméria à partir des textes et de l’archéologie”, en M. Barceló y P. Toubert (eds.), «L’incastellamento». Actas de las reuniones de Girona (26-27 noviembre 1992) y de Roma (5-7 de mayo 1994), Roma, Escuela Española de Historia y Arqueología en Roma pp. 233-245.— (1998b), “Apuntes sobre fortificación islámica en Marruecos”, en Actas. I Congreso internacional. Fortificaciones en al-Andalus (Algeciras, Noviembre–Diciembre, 1996). Actas, Algeciras, pp. 129-145.— (2004), “Capítulo X. De un ribāṭ a otro. Una hipótesis sobre los ribāṭ-s del Maġrib al-Aqṣà (siglo IX-inicios siglo XI)”, en R. Azuar Ruiz (ed.), Fouilles de la Rábita de Guardamar I. El ribāṭ califal. Excavación e investigaciones (1984-1992), Collection de la Casa de Velázquez 85, Madrid, pp. 203-221.— (2019), “Lecturas arqueológicas del ribāṭ en Ifrīqiya y el Magreb occidental”, en Fortificación, espiritualidad y frontera en el islam medieval: ribāṭs de al-Andalus, el Magreb y más allá, Cuadernos de Arquitectura y fortificación, 6 (número monográfico), Madrid, La Ergástula ediciones pp. 107-126.Cressier, P., El Boudjay, A. El Figuigui, H y Vignet-Zunz, J. (1998), “Haǧar al-Nasr, capitale idrisside du Maroc septentrional : archéologie et histoire (IVe H,/Xe ap. J.-C.)”, en P. Cressier y M. García-Arenal (eds.), M. Meouak (colab.), Genèse de la ville islamique en al-Andalus et au Maghreb occidental, Madrid, Casa de Velázquez-CSIC, pp. 305-334.Dallière-Benelhadj, V. (1983), “Le château en al-Andalus: un problème de terminologie”, en A. Bazzana, J.-M. Poisson y P. Guichard (eds.), Castrum 1. Habitats fortifiés et organisation de l’espace en Méditerranée médiévale, Travaux de la Maison de l’Orient 4, Lyon, 1983, pp. 63-67.Delaigue, M.-C, Onrubia Pintado, J., Bokbot, Y. y Amarir, A. (2011), “Une technique d’engrangement, un symbole perché”, Techniques Culture, 57 | 2011, mis en ligne le 30 juin 2012, consulté le 19 avril 2019. URL: http://journals.openedition.org/tc/5875; DOI: 10.4000/tc.5875Delaigue, M.-C., Onrubia Pintado, J. y Bokbot, Y. (2013), “El agadir de Id Aysa (Amtudi, Marruecos). Materialidad y espacio social”, en S. Gutiérrez Lloret e I. Grau Mira (eds.), De la estructura domestica al espacio social. Lecturas arqueológicas del uso social del Espacio, Alicante, Universidad de Alicante, pp. 299-312.De Meulemeester, J. y Matthys, A. (1995), “Un grenier collectif fortifié hispano-musulman? Le Cabezo de la Cobertera (Vallée du Río Segura / Murcie). Bilan provisoire d’une approche ethnoarchéologique”, en A. Bazzana y M.-Ch. Delaigue (eds.), Ethnoarchéologie mediterranéenne, Madrid, Casa de Velázquez, pp. 181-196.— (1998), “The conservation of grain and the fortified granaries from the Maghreb to Central Europe”, Ruralia II, Památky archeologické – Supplementum 11, Praga, pp. 161-171.Dozy, R. (1927), Supplément au dictionnaires arabes, Leiden-París, Brill-Maisonneuve Frères, 2 vols.Eiroa Rodríguez, J. (2011), “Fortified granaries in southeastern al-Andalus”, en J. Klápště y P. Sommer (eds.), Processing, Storage, Distribution of Food. Food in the Medieval Rural Environment. Ruralia VIII, pp. 1-9, Turnhout, Brepols.El Bahi, A. (2018), “Les ribats aghlabides: un essai d’identification”, en G. D. Anderson, C. Fenwick y M. Rosser-Owen (eds.), The Aghlabids and their Neighbors: Art and Material Culture in Ninth-Century North Africa, Boston-Leiden, Brill, pp. 321-337.Epalza, M. de (1984), “Funciones ganaderas de los albacares, en las fortalezas musulmanas”, Sharq Al-Andalus, 1, pp. 47-54.Escudé-Lacroix, H. (2016-2017), “Alcalá la Real/Qal‛at Banī Sa‛īd, una fortificación andalusí clave en las Subbéticas centrales (siglos XI-XIV)”, Alcazaba, 16-17, pp. 21-54Ettahiri, A. S., Fili, A. y Van Staëvel, J.-P. (2013), “Contribution à l’étude de l’habitat des élites en milieu rural dans le Maroc médiéval : quelques réflexions à partir de la Qasba d’Îgîlîz, berceau du mouvement almohade”, en S. Gutiérrez Lloret, S. e I. Grau (eds.), De la estructura doméstica al espacio social. Lecturas arqueológicas del uso social del espacio, Alicante, Universidad de Alicante, pp. 265-278Fábregas García, A. y González Arévalo, R. (2015), “Los espacios del poder en el medio rural: torres de alquería en el mundo nazarí”, Arqueología y Territorio Medieval, 22, pp. 63-78.Fernandes, I. C. Ferreira (ed.) (2002), Mil Años de Fortificações na Península Ibérica e no Magreb (500-1500). Actas do Simpósio Internacional sobre Castelos, Palmela, Ediçoes Colibrí.— (ed.) (2013), Fortificações e território na Península Ibérica e no Magreb (séculos VI a XVI), Palmela-Mértola, Ediçoes Colibri-Campo Arqueológico de Mértola.Franco Sánchez, F. (ed.) (2004), La rábita en el islam. Estudios interdisciplinares. Congresos Internacionals de Sant Carles de la Ràpita 1989-1997, Alicante, Ajuntament de Sant Carles de la Ràpita-Universitat d’Alacant.— (2017), “Toponimia árabe de los espacios viales y los espacios defensivos en la península ibérica”, en C. Carvalho, M. Planelles Ivánez, E. Sandakova y M. Aragón Cobo (coords.), De la langue à l’expression. Le parcours de l’expérience discursive. Hommage à Marina Aragón Cobo, Estudios románicos, 20, pp. 167-190.García Porras, A. (2015), “Nasrid Frontier Fortresses and Manifestations of Power: The Alcazaba of Moclín Castle as Revealed by Recent Archaeological Research”, en A. Fábregas García y F. Sabaté (eds.), Power and rural communities in al-Andalus, Turnhout. Brepols, pp. 113- 133.— (2016), “La implantación del poder en el medio rural nazarí. Sus manifestaciones materiales en las fortalezas fronterizas granadinas”, en A. Echevarría Arsuaga y A. Fábregas García (eds.), De la alquería a la aljama, Madrid, UNED, pp. 223-259.— (2020), “El Castillo de Moclín. De ḥiṣn a villa fronteriza”, en J. Navarro Palazón y L. García Pulido (eds.), Defensive Architecture of the Mediterranean, Valencia-Granada, Universidad Politécnica de Valencia-Universidad de Granada-Patronato de la Alhambra y Generalife, pp. 45- 52.Guichard, P. (1976), Al-Andalus. Estructura antropológica de una sociedad islámica en Occidente, Barcelona, Barral Editores.— (1977), Structures sociales «orientales» et «occidentales» dans l’Espagne musulmane, París-La Haya, Mouton.— (1998a), “Château et pouvoir politique”, en Actas I Congreso Internacional. Fortificaciones en al-Andalus, Algeciras. Noviembre-Diciembre 1996, Algeciras, Fundación municipal de Cultura “José Luis Cano”, pp. 25-31.— (1998b), “Château tribal, château féodal: la Méditerranée occidentale entre deux mondes”, en M. Barceló y P. Toubert (eds.), «L’incastellamento». Actas de las reuniones de Girona (26-27 noviembre 1992) y de Roma (5-7 de mayo 1994), Roma, Escuela Española de Historia y Arqueología de Roma, pp. 307- 316.Gutiérrez Lloret, Sonia (1996), La Cora de Tudmir de la Antigüedad tardía al mundo islámico: poblamiento y cultura material, Madrid-Alicante, Casa de Velázquez-Instituto Juan Gil Albert.Hernández Giménez, F. (1994), Estudios de geografía histórica española. I, Madrid, Ediciones Polifemo (Biblioteca de Arqueología Medieval Hispánica, 3.— (1997), Estudios de geografía histórica española. II, Madrid, Ediciones Polifemo.Juan Ares, J. de (2016), Análisis arqueológico de un centro de poder: La alcazaba de Ciudad de Vascos, Tesis de doctorado, Madrid, Universidad Complutense.Les Illes Orientals d’al-Andalus (1987), V Jornades d’Estudis històrics locals, Palma de Mallorca, Institut d’Estudis Baleàrics.Kirchner, H. (1998), “Redes de alquerías sin ḥuṣūn. Una reconsideración a partir de los asentamientos campesinos andalusíes de las islas orientales”, en A. Malpica Cuello (ed.), Castillos y poblamiento en al-Andalus, Granada, Athos-Pergamos, pp. 450-469.Lévi-Provençal, É. (1932), L’Espagne musulmane au Xe siècle, París, Larose.— (1953), Histoire de l’Espagne musulmane, III. Le Siècle du califat de Cordoue, París, Éditions G. P. Maisonneuve.Malpica Cuello, A. (ed.) (1998), Castillos y territorio en al-Andalus, Granada, Athos-Pérgamos.— (2003), Los castillos en al-Andalus y la organización del territorio, Badajoz, Universidad de Extremadura.Marín, M. (1995), “Documentos jurídicos y fortificaciones”, en Actas I Congreso Internacional. Fortificaciones en al-Andalus, Algeciras. Noviembre-Diciembre 1996, Algeciras, Fundación municipal de Cultura “José Luis Cano”, pp. 79-87.Martí, R. (2008), “Los faros en al-Andalus: un sistema original de transmisión de señales”, en R. Martí Castelló, Fars de l’Islam. Antigues alimares d’al-Andalus, Barcelona, EDAR, pp. 189-218.Martí, R. y Viladrich, M. M. (2018), “Les torres de planta circular de la frontera extrema d’al-Andalus a Catalunya (segles VIII-X)”, Treballs d’Arqueologia, 22, pp. 51-81.Martín Civantos, J. M. (2013), “Del distrito castral a la alquería: las fortificaciones andalusíes en el Sureste de la Península Ibérica (Granada-Almería)”, en I. C. Ferreira Fernandes (ed.), Fortificações e territorio na Península Ibérica e no Magreb (séculos VI a XVI), Lisboa-Palmela, Ediçoes Colibrí, t. 1, pp. 133-140.Mazzoli-Guintard, Ch. (1998), “Ḥiṣn, qal‘a, qaṣaba... chez al-Idrīsī”, Qurṭuba, 3, pp. 95-111.Navarro Palazón, J. y Jiménez Castillo, P. (1995), “El Castillejo de Monteagudo: Qaṣr ibn Sa‘d”, en Casas y palacios de al-Andalus (siglos XII y XIII), Barcelona-Granada, Lunwerg-El Legajo andalusí, pp. 63-104.Negre, J., Pérez-Polo, M., Falomir, F., Aguilella, G., Medina, P. y Blasco, M. (2020), “Una lectura contextual del recinto emiral del Tossal de la Vila (Castelló). Algunas reflexiones sobre el origen, morfología y funciones de los asentamientos en altura en el extremo septentrional del Šarq al-Andalus”, en C. Doménech Belda y S. Gutiérrez Lloret (eds.), El sitio de las cosas. La Alta Edad Media en contexto, Alicante, Universidad de Alicante, pp. 195-217.Negre Pérez, J., Falomir Granell, F., Pérez-Polo, M. y Aguilella Arzo, G. (2022), “La mezquita del fortín emiral del Tossal de la Vila (Castellón). Secuencia estratigráfica y diseño arquitectónico de un edificio religioso rural en los albores del islam andalusí”, Lucentum, Online First, 1-19. https://doi.org/10.14198/LVCENTVM.20030Pavón Maldonado, B. (1999), Tratado de arquitectura hispano-musulmana. Tomo II. Ciudades y fortalezas, Madrid, CSIC.Retuerce Velasco, M. y Hervás Herrera, M. Á. (2020), “Calatrava la Vieja (Ciudad Real). Resultados de las últimas campañas de excavación arqueológica (2015-2019)”, en Actualidad de la investigación arqueológica en España I (2018-2019). Conferencias impartidas en el Museo Arqueológico Nacional, Madrid, Ministerio de Cultura pp. 551-569.Ribera Gómez, A. (2016), Covetes dels Moros: Cuevas-ventanas del Xarq al-Andalus. Arqueología de las cuevas colgadas artificiales valencianas, tesis de doctorado, Alicante, Universidad de Alicante.Rouco Collazo, J. y Martín Civantos, J. M. (2020), “Análisis espacial del sistema defensivo de la costa granadina en época nazarí y su transformación tras la conquista castellana”, en J. Navarro Palazón y L. J. García-Pulido (eds.), Defensive Architectur of the Mediterranean 10, Valencia-Granada, Universidad Politécnica de Valencia-Universidad de Granada, pp. 189-196.Sénac, P. (2000), La frontière et les hommes. Le peuplement musulman au nord de l’Èbre et les débuts de la reconquête aragonaise (VIIIe-XIIe siècle), París, Maisonneuve et Larose.— (2012), “De la madîna à l’almunia. Quelques réflexions autour du peuplement musulman au nord de l’Èbre”, Annales du Midi, 124 (278), pp. 183-201.Souto Lasala, J. A. (2005), Conjunto fortificado islámico de Calatayud, Zaragoza, Instituto de Estudios Islámicos y del Próximo OrienteTerrasse, H. (1954), “Les forteresses de l’Espagne musulmane”, Boletin de la Real Academia de la Historia, CXXXIV, pp. 455-483.Torres Balbás, L. (1953), “La torre de Gabia”, Al-Andalus, XVIII (1), pp. 187-198,— (1954), “La arquitectura militar hispanomusulmana. Cercos de ciudades y de castillos”, África, 151, pp. 327-329.— (1981-1983), Obra dispersa. I. Al-Andalus. Crónica de la España musulmana, Madrid, Instituto de España (8 vols.).Torró, J. (1998), “Fortificaciones en Ŷibal Balansiya. Una propuesta de secuencia”, en A. Malpica Cuello (ed.), Castillos y territorio en al-Andalus, Granada, Athos-Pérgamos, pp. 385-418.Torró, J. y Segura, J. M. (2000), “El Castell d’Almizra y la cuestión de los graneros fortificados”, Recerques del Museu d’Alcoi, 9, pp. 145-164.Varela Gomes, R. y Varela Gomes, M. (2004), O Rîbat da Arrifana (Aljezur, Algarve), Aljezur, Município de Aljezur (separata de la Revista Portuguesa de Arqueologia, VII).— (2007), Ribât da Arrifana. Culura material e espiritualidade, Aljezur, Município de Aljezur-Associação da Defesa do Património Histórico e Arqueológico de Aljezur.Vidal Castro, F. (2004), “Terminología castral árabe en la frontera de Jaén y Granada”, en F. Toro Ceballos y J. Rodríguez Molina (eds.), V Estudios de frontera. Funciones de la red castral de frontera: homenaje a don Juan Torres Fontes. Congreso celebrado en noviembre de 2003, Jaén, pp. 785-794.

RESUMENLa historiografía sobre la muerte, desarrollada entre finales de los años setenta y noventa de la pasada centuria, tuvo especial interés y proyección a partir de las investigaciones trazadas por la tercera generación de Annales. Los planteamientos de esta corriente, en sintonía con los modelos de dicha escuela y avalados por la renovación del objeto histórico tras el estructuralismo, giraron alrededor del estudio de las condiciones materiales, actitudes, imágenes y gestualidad del hombre medieval ante la muerte. El cuerpo de esta fructífera reflexión, como parcela de la “historia de las mentalidades”, albergó novedades metodológicas, facilitando una visión y proyección heurística, debido al impacto que tuvo dentro del diálogo de la historia con las ciencias sociales y otras disciplinas del quehacer humanístico. A finales del siglo xx y comienzo del presente, el giro producido en el quehacer histórico ha otorgado un mayor protagonismo a lo social y cultural, colocando en el lugar protagonista ocupado durante décadas por la “historia de la muerte” otros intereses. Compete, por tanto, plantearse qué horizontes cabría dibujar, dentro de las coordenadas historiográficas de la actualidad, para las investigaciones sobre la muerte, cuyas paradojas siguen vigentes como recurso para conocer los fenómenos y manifestaciones propias de la civilización medieval.Palabras clave: Muerte medieval, historiografía de la muerte ABSTRACTThe historiography of death developed between the late 1970s and the 1990s was of special interest and projection. It was based on research carried out by the third generation of the Annales. The approaches developed in line with the models of this school of thought and underpinned by the renewal of the historical object following structuralism, revolved around the study of material conditions, attitudes, images and gestures of the medieval man in the face of death. The core of this prolific reflection as part of the “history of mentalities” contained methodological novelties facilitating a heuristic vision and projection due to the impact it had on the dialogue between History and Social Sciences and other humanistic disciplines. At the end of the 20th century and the beginning of the current the shift in historical endeavour has given greater prominence to what is social and cultural, placing other interests in the key role for decades occupied by the “history of death”. For researching into death, it is necessary therefore to consider what perceptions can be drawn within the historiographical coordinates of the present day whose paradoxes are still valid as a resource to understand the phenomena and manifestations of medieval civilisation.Keywords: mediaeval death, historiography of death REFERENCIASActas de las I Jornadas de Metodología Aplicada de las Ciencias Históricas. V. Paleografía y archivística, Santiago de Compostela, Universidade de Santiago de Compostela, Servicio de Publicaciones, 1975.Alexandre-Bidon, D., La mort au Moyen Âge: xiiie-xvie, París, Editorial Hachette, 1998.Alexandre-Bidon, D. y Treffort, C. (dirs.), A reveiller les morts. La mort au quotidien dans l’Occident médieval, Lyon, Presses Universitaires de Lyon, 1993.Ariès, P., Essais sur l’histoire de la mort en Occident du Moyen Âge á nous jours, París, Éditions du Seuil, 1975 (trad. Historia de la muerte en Occidente. Desde la Edad Media hasta nuestros días, 2000).—“Mourir autrefois”, en A. Brien et M. Lienhart (dirs.), La Mort au coeur de la vie, Colmar, Éditions Alsatia; Strasbourg, Oberlin, 1976, pp. 23-35.—L’homme devant la mort, París, Éditions du Seuil, 1977.—En face de la mort, París, Éditions du Cerf, 1983.—Images de l´homme devant la mort, París, Seuil, 1983.Aurell, J., Balmaceda, C., Burke, P. y Soza, F., Comprender el pasado, Madrid, Akal, 2013.Azpeitia Martín, M., “Historiografía de la ‘historia de la muerte’”, Studia historica. Historia medieval, 26 (2008), pp. 113-132.Baloup. D., “La mort au Moyen Âge (France e Espagne). Un bilan historiographique”, en I. Bazán y C. González Mínguez, El discurso legal ante la muerte durante la Edad Media en el nordeste peninsular, Bilbao, Universidad del País Vasco, 2006, pp. 13-32.Binski, P., Medieval Death. Ritual and Representation, Londres, British Museum Press, 1996.Boase, T. S. R., Death in the Middle Ages: mortality, judgment and remembrance, London, Thames and Hudson, 1972.Borsari, E., Trujillo, J. R. (eds.), La muerte en las literaturas medievales europeas (dosier monográfico), Revista de Literatura Medieval, 36, 2002.Braet, H. y Verbeke, W. (eds.), Death in the Middle Ages, Lovaina, Leuven University Press, 1987.Burgess, C., “By Quick and by Dead»: Wills and Pious Provision in late Medieval Bristol”, English Historical Review, 405 (1987), pp. 837-858.Carlé, M.ª C., Una sociedad del siglo xiv: los castellanos en sus testamentos, Buenos Aires, Universidad Católica Argentina, 1993.Carozzi, C., “La géographie de l’au-delà et sa signification pendant le Haut Moyen Âge”, en XXIX Settimana di Studi Sull’Alto Medievo, Spoleto, Centro Italiano di Studi sull’Alto Medioevo, 1983, pp. 423-481.—Le voyage de l’âme dans l’au-delà, d’après la littérature latine (ve-xiiie siècle), Roma, École Française de Rome, 1994.Chaunu, P., “Mourir à Paris (xvie-xviie-xviiie siècles)”, Annales. Économies, sociétes, civilisations, 31.I (1976), pp. 29-50.—Histoire quantitative, histoire sérielle. París, Armand Colin, 1978.Chiffoleau, J., La compatibilité de l’Au-delà. Les hommes, la mort et la religion dans la region d’Avignon à la fin du Moyen Âge, Roma, École Française de Rome, 1980.Choron, J., Death and Modern Man, Nueva York, Collier Books, 1964.—La Mort dans la pensée occidentale, París, Editions Payot, 1969.Daniell, C., Death and dying in England, Oxford, Oxford Bibliographies, 2014. http://www.oxfordbibliographies.com/view/document/obo-9780195396584/obo-9780195396584-0149.xml (recuperado 07.II.2023).Doudet, E. (textes recueillis), La mort écrite. Rites et rhétoriques du trépas au Moyen Âge, París, Presses de l’ Université Paris-Sorbonne, 2005.Eiras Roel, A. (coord.), Actas del II Coloquio de Metodología histórica aplicada. La documentación notarial y la historia, Santiago de Compostela, Secretariado de Publicaciones de la Universidad de Santiago de Compostela, 1982.Erlande-Brandenburg, A., Le roi est mort. Étude sur les funérailles, les sépultures et les tombeaux des rois de France jusqu’á la fin du xiiie siècle, Ginebra, Société Française d’Archéologie, 1975.Español, F., “El encuentro de los tres vivos y los tres muertos y su repercusión en la Península Ibérica”, en J. Yarza Luaces (ed. lit.), Estudios de Iconografía Medieval Española, Bellaterra, Universidad Autónoma de Barcelona, 1984, pp. 53-136—Lo macabro en el gótico hispano. Cuadernos de Arte Español, 70, Madrid, Historia 16, 1992. Favre, R., La mort au Siècle des Lumières dans la littérature et la pensée françaises, Lyon, Presses Universitaires de Lyon, 1978.Febvre, L., “Comment reconstituer la vie affective d´autrefois? La sensibilité et l´histoire”, Annales d´Histoire Sociale, 3.1/2 (1941), pp. 5-20. García-Fernández, M., “Familia, poder y religiosidad de una aristócrata bajomedieval gallega. Las últimas voluntades de doña Xoana de Castro (1467)”, Madrygal: Revista de Estudios Gallegos, 21 (2018), pp. 133-156.García-Fernández, M., “Testamentos femeninos para el estudio de la realidad señorial gallega a finales de la Edad Media: una aproximación comparada a las últimas voluntades de Guiomar Méndez de Ambia (1484) y doña Isabel González Noguerol (1527-1533), en M. Cabrera Espinosa y J. A. López Cordero (coord.), XI Congreso Virtual sobre Historia de las Mujeres, Jaén, Archivo Histórico Diocesano de Jaén, 2019, pp. 279-330.Gaude-Ferragu, M., D´or et de cendres: la mort et les funérailles des princes dans le royaume de France au Bas Moyen Âge, Presses Universitaires du Septentrion, Villeneuve d’Ascq, 2005.González Lopo, D. L., “Historia de las mentalidades. Evolución historiográfica de un concepto complejo y polémico”, Obradoiro de Historia Moderna, 11 (2002), pp. 135-190.Guiance, A., Muertes medievales, mentalidades medievales: un estado de la cuestión sobre la historia de la muerte en la Edad Media, Buenos Aires, Universidad de Buenos Aires, 1989.—Los discursos sobre la muerte en la Castilla medieval (siglos vii-xv), Valladolid, Consejería de Educación y Cultura de la Junta de Castilla y León, 1998.—“Introducción. Veinte años de historiografía sobre la muerte: un balance y un nuevo comienzo”, en F. Miranda García y M.ª T. López de Guereño Sanz (dir.), La muerte de los príncipes en la Edad Media, Madrid, Casa de Velázquez, 2020, pp. 1-16.Hadley, D. M., Death in Medieval England, Stroud, Tempus, 2001.Hernández Sandoica, E., Los caminos de la historia. Cuestiones de historiografía y método, Madrid, Síntesis, 1994.Huizinga, J., El otoño de la Edad Media. Estudios sobre las formas de vida y el espíritu durante los siglos xiv y xv en Francia y los Países Bajos, Madrid-Buenos Aires, Alianza Editorial-Revista de Occidente Argentina, 1930 y reeds. de 1947 y 1985.Joyce, P., “The return of history: postmodernism and the politics of academic history in Britain”, Past and Present, 158 (1998), pp. 207-235.Ladero Quesada, M. A., “Trayectorias y generaciones. Un balance crítico: la Edad Media”, en Pellistrandi, B. (ed..), La historiografía francesa del siglo xx y su acogida en España, Madrid, Casa de Velázquez, 2002, pp. 311-335.Lapesa, R., “El tema de la muerte en el Libro de Buen Amor”, en R. Lapesa, De la Edad Media a nuestros días, Madrid, Editorial Gredos, 1967, pp. 53-75.Lauwers, M., “Le sépulcre des pères et les ancêtres. Notes sur le culte des défunts à l’âge seigneurial”, Medievales. Langue. Textes. Histoire. La mort des grandes. Hommage à Jean Devisse, 31 (1996), pp. 67-78.—La Mémoire des ancêtres, le souci des morts. Morts, rites et société au Moyen Âge (Diocèse de Liège xie-xiiie siècle), París, Archives de sciences sociales des religions, 1997.Lavanchy, L., Écrire sa mort, décrire sa vie. Testaments de laics laussannois (1400-1450), Laussane, Université de Laussane, 2003.Lebrun, F., Les hommes et la mort en Anjou aux 17e et 18e siècles: essai de démographie et de psychologie historiques, Paris-La Haye, Mouton, 1971.Le Goff, J., La naissance du Purgatoire, París, Gallimard, 1981.Lemaître, J. L. (ed.), L’Église et la mémoire des morts dans la France Médiévale: communications présentées à la Table Ronde du CNRS, le 14 juin 1982, París, Études Augustiniennes, 1986.López de Guereño Sanz, M.ª T., Miranda García, F. y Cabrera, M. (eds.), Migravit a seculo. Muerte y poder de príncipes en la Europa medieval. Perspectivas comparadas, Madrid, Ed. Sílex, 2021.Lorcin, M. T., Vivre et mourir en Lyonnais à la fin du Moyen Âge, Paris, CNRS, 1981.Mâle, E., L´art religieux du xiiie siècle en France, París, Colin, 1898.—L´art religieux de la fin du Moyen Âge en France. Étude sur l´iconographie du Moyen Âge et sur ses sources d´inspiration, París, Librairie Armand Colin, 1908.Marandet, M. C., Le souci de l´au-delà: la pratique testamentaire dans la région toulosaine (1300-1450), Perpignan, Presses Universitaires, 1998.Mattoso, J., “O culto dos mortos na Península Ibérica (seculos vii a xi)”, Lusitania Sacra, 4 (1992), 2ª serie, pp. 13-37.—“A morte dos reis na Cronistica Pré-Alfonsina”, Estudos Medievais, 10 (1993), pp. 79-95.—“O poder e a morte”, Anuario de Estudios Medievales, 25/2 (1995), pp. 395-427.—(dir.), O Reino dos mortos na Idade Média peninsular, Lisboa, Edições João Sá da Costa, 1996.McManners, J., “Death and the French Historians”, en Whaley, J. (ed.), Mirrors of Mortality: Studies in the Social History of Death, London, Routledge, 1981, pp. 106-130.Miranda García, F. y López de Guereño Sanz, M.ª T., La muerte de los príncipes en la Edad Media: balance y perspectivas historiográficas, Madrid, Casa de Velázquez, 2020.Mitre Fernández, E., “El sentido medieval de la muerte. Reflexiones desde el prisma del siglo xx”, Anuario de Estudios Medievales, 16 (1986), pp. 621-639.—La muerte vencida. Imágenes e historia en el Occidente medieval (1200-1348), Madrid: Ediciones Encuentro, 1988.—“La muerte del rey: La historiografía hispánica (1200-1348) y la muerte entre las élites”, En la España Medieval, 11 (1988), pp. 167-183.—“Muerte y memoria del rey en la Castilla bajomedieval”, en G. Duby, G. (et al.), La idea y el sentimiento de la muerte en la historia y en el arte de la Edad Media (II), Santiago de Compostela, Secretariado de Publicaciones de la Universidad de Santiago de Compostela, 1992, pp. 17-26.—“Actitudes del hombre ante la muerte”, en González Mínguez, C. (ed.), La otra historia: Sociedad, cultura y mentalidades, Bilbao, Servicio Editorial de la Universidad del País Vasco, 1993, pp. 25-36.—“La muerte y sus discursos dominantes entre los siglos xiii y xv (reflexiones sobre recientes aportes historiográficos)”, en Serrano Martín, E. (coord.), Muerte, religiosidad y cultura popular, Zaragoza: Institución Fernando el Católico, 1994, pp. 15-34.Morin, E., L’Homme et la Mort. París, Seuil, 1970 (ed. rev. et augm. de 1950).La mort au Moyen Âge (Colloque de l´Association des Historiens Médiévistes Français réunis à Strasbourg en juin 1975 au Palais Universitaire), Strasbourg, Libraire Istra, 1977.La morte et l´au-delà en France méridionale (xiie-xve siècle), Tolouse, Privat, 1998.Nieto Soria, J. M., Ceremonias de la realeza. Propaganda y legitimación en la Castilla Trastámara, Madrid, Nerea, 1993.Nora, P., Les lieux de mémoire, Paris, Gallimard, 1984.Otero Piñeyro Maseda, P. S. y García-Fernández, M., “Los testamentos como fuente para la historia social de la nobleza. Un ejemplo metodológico: tres mandas de los Valladares del siglo xv”, Cuadernos de estudios gallegos, 60 (2013), pp. 125-169.Pasamar Alzuria, G., “La influencia de Annales en la historiografía española durante el franquismo: un esbozo de explicación”, Historia Social, 48 (2004), pp. 149-172.Pasche, V., Pour le salut de mon âme. Les Lausannois face à la mort, xiv siècle, Lausanne, Université de Lausanne, 1989.Pavón Benito, J. y García de la Borbolla, A., Morir en la Edad Media. La muerte en la Navarra medieval, Valencia, Universitat de València, 2007.Platelle, H., Présence de l’au-delà: une vision médiévale du monde, Villeneuve-d´Ascq, Presses Universitaires du Septentrion, 2004.Peiró Martín, I., “Historiadores en el purgatorio. Continuidades y rupturas en los años sesenta”, Cercles: revista d’història cultural, 16 (2013), pp. 53-81.—Historiadores en España: historia de la historia y memoria de la profesión, Zaragoza, Prensas de la Universidad de Zaragoza, 2013.La religion populaire. Colloque international du Centre National de la Recherche Scientifique (Paris, 17-19 octobre 1977), Paris, CNRS, 1979.Royer de Cardinal, S., Morir en España. (Castilla Baja Edad Media), Buenos Aires, Universidad Católica Argentina, 1992.Sabatè i Curull, F., Lo senyor rei és mort: actitud i cerimònies dels municipis catalans baix-medievals davant la mort del monarca, Lleida, Universitat de Lleida, 1994.—Cerimònies fúnebres i poder municipal a la Catalunya baixmedieval, Barcelona, Dalmau, 2003.Serna Alonso, J., La historia cultural: autores, obras, lugares, Madrid, Akal, 2013.Sharpe, J., “Historia desde abajo”, en P. Burke (ed.), Formas de Hacer Historia, Madrid, Alianza, 1996 (1ª ed. inglesa, 1991), pp. 38-58.Schmitt, J. C., “Le suicide au Moyen Âge”, Annales. Économies. Sociétés. Civilisations, 31 (1976), pp. 3-28.Spiegel, G., “La historia de la práctica: nuevas tendencias en historia tras el giro lingüístico”, Ayer 62/2 (2006), pp. 19-50.Sutto, C. (ed.), Le sentiment de la mort au Moyen Âge, Quebec, L’ Aurore, 1979.Tenenti, A., La vie et la mort à travers l´art du xve siècle, Armand Colin, París, 1952.—Il senso della morte e l´amore della vita nel Rinascimento (Francia e Italia), Giulio Einaudi, Torino, 1957.—Piété baroque et déchristianisation en Provence au dix-huitième siècle: les attitudes devant la mort d´après les clauses des testaments, París, Seuil, 1973.—Mourir autrefois. Attitudes collectives devant la mort aux xviie et xviiie siècles, Paris, Gallimard, 1974.—“Les attitudes devant la mort: problèmes de méthode, approches et lectures différentes”, Annales Économies, Sociétés, Civilisations, 31. 1 (1976), pp. 120-132.—“Encore la mort: un peu plus qu’une mode? Annales Économies, Sociétés, Civilisations, 37 (1982), pp. 276-287.—La mort et l’Occident de 1300 à nos jours, París, Gallimard, 1983.Vovelle, M., “La mort et l’au-delà en Provence d’après les autels des âmes du Purgatoire xv-xx siècles”, Annales Économies, Sociétés, Civilisations, 24 (1969), pp. 1602-1634.Yarza Luaces, J., “Despesas que fazen los omnes de muchas guisas en soterrar los muertos”, en J. Yarza Luaces, Formas Artísticas de lo Imaginario, Barcelona, Anthropos, 1987, pp. 260-292—“La capilla funeraria hispana en torno a 1400”, en M. Núñez Rodríguez, M. y E. Portela (coords.), La idea y el sentimiento de la muerte, Santiago de Compostela, Secretariado de Publicaciones de la Universidad de Santiago de Compostela, 1988, pp. 95-117.

El uso de murallas desde los primeros momentos de la sedentarización ha buscado el cierre de asentamientos y, aunque generalmente estas construcciones procuraban la protección de sus habitantes, pudieron jugar también un papel importante en aspectos como la demostración de fuerza o de independencia política, jurídica e incluso como ornamento. En el presente trabajo realizamos una visión diacrónica de las estructuras en piedra, con especial interés de aquellas estudiadas en el marco de los proyectos de investigación desarrollados por el Departamento de Prehistoria y Arqueología de la Universidad de Granada, mostrándose nuevos datos procedentes de nuestros archivos recientemente digitalizados y que permiten observar de una manera más detallada la fábrica de algunas de ellas, lo que demuestra los cambios de hábitos constructivos y su adaptación a los cambios culturales. Palabras Clave: Estructuras defensivas, Edad del Cobre, Edad del Bronce, Bronce FinalTopónimos: Península IbéricaPeriodo: Edad del Cobre, Edad del Bronce ABSTRACTThe use of walls from the earliest moments of sedentarisation has sought to enclose settlements and, although the goal of these constructions has generally been the protection of their inhabitants, they may have played an important role in aspects such as the demonstration of strength or political and legal independence, and even as ornamentation. This paper presents a diachronic view of stone wall structures, with particular focus on those studied within the framework of the research projects carried out by the Department of Prehistory and Archaeology of the University of Granada. New data from our recently digitalised archives are included, enabling us to observe in greater detail the construction of some of these structures, evidencing changes in building habits and their adaptation to cultural changes. Keywords: Defensive structures, Copper Age, Bronze Age, Argar Culture, Late Bronze Age.Place names: Iberian PeninsulaPeriod: Chalcolithic, Bronze Age REFERENCIASAguayo de Hoyos, P. (1977), “Construcciones defensivas de la Edad Del Cobre peninsular. El Cerro de los Castellones (Laborcillas, Granada)”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 2, pp. 87-104. https://doi.org/10.30827/cpag.v2i0.722.Altamirano García, M. (2014), “Not only bones. Hard animal tissues as a source of raw material in 3rd millenium BC south-eastern Iberia”, Menga: Revista de prehistoria de Andalucía, 5, pp. 43-67.Aranda Jiménez, G. (2001), El análisis de la relación forma-contenido de los conjuntos cerámicos del yacimiento arqueológico del Cerro de la Encina (Granada, España), BAR International Series 957, Oxford, Archaeopress.Aranda Jiménez, G., Montón-Subías, S. y Sánchez Romero, M. (2015), The Archaeology of Bronze Age Iberia. Argaric Societies, New York, Routleadge.Arribas Palau, A. (1977), “El Ídolo de El Malagón (Cullar Baza, Granada)”. Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 2, pp. 63-86. https://doi.org/10.30827/cpag.v2i0.721Arribas Palau, A. (2011), “El ídolo de El Malagón (Cúllar-Baza, Granada)”, Péndulo. Papeles de Bastitania, 12, pp. 33-48.Arribas, A., Molina, F., Saez, L., De La Torre, F., Aguayo, P. y Nájera, T. (1981), “Excavaciones en Los Millares (Santa Fe de Mondújar, Almería). Campana de 1981”, Cuadernos de Prehistoria de la Universidad de Granada, 6, pp. 91-121. https://doi.org/10.30827/cpag.v6i0.1182— (1979), “Excavaciones en Los Millares (Santa Fe de Mondújar, Almería)”, Cuadernos de Prehistoria de la Universidad de Granada, 4, pp. 61-109. https://doi.org/10.30827/cpag.v6i0.1182Arribas, A., Pareja, E., Molina González, F., Arteaga, O. y Molina Fajardo, F. (1974), Excavaciones en el poblado de la Edad del Bronce del Cerro de la Encina (Monachil, Granada). El corte estratigráfico nº 3, Excavaciones Arqueológicas en España 81, Madrid, Ministerio de Educación.Arribas, A., Molina, F., Carrión, F., Contreras, F., Martínez, G., Ramos, A., Sáez, L., De la Torre, F., Blanco, I. y Martínez, J. (1987), “Informe preliminar de los resultados obtenidos durante la VI Campaña de excavaciones en el poblado de Los Millares (Santa Fe de Mondújar, Almería, 1985)”, Anuario Arqueológico de Andalucía 1985, II, Sevilla, Junta de Andalucía, pp. 245-262.Arteaga, O. (1987), “Excavaciones arqueológicas sistemáticas en El Cerro de los Alcores (Porcuna, Jaén). Informe preliminar sobre la campaña de 1985”, Anuario Arqueológico de Andalucía 1985, II, Sevilla, Junta de Andalucía, pp. 279-288.Becker, H. y Brandherm, D. (2010), “Eine Testmessung zur magnetischen Prospektion am Cerro de la Virgen 1998 (Prov. Granada, Spanien)”, en T. Armbruster y M. Hegewish (eds.), Beiträger zur Vor- und Frühgeschichte der Iberischen Halbinsel und Mittleleuropas: Studien in honorem Philine Kalb. Studienzur Archäologie Europas 11, Bonn, pp. 267-272Benítez De Lugo, L., Mejías Moreno, M., López Gutiérrez, J., Álvarez García, H. J., Palomares Zumajo, N., Mata Trujillo, E. Moraleda Sierra, J., Menchén Herreros, G., Fernández Martín, S. Salazar García, D. C., Odriozola Lloret, C., Benito Sánchez, M. y López Sáez, J. A. (2014), “Aportaciones hidrogeológicas al estudio arqueológico de los orígenes del Bronce de La Mancha: la cueva monumentalizada de Castillejo del Bonete (Terrinches, Ciudad Real, España)”, Trabajos de Prehistoria, 71 (1), pp. 76-94. https://doi.org/10.3989/tp.2014.12125Caballero Cobos, A. (2014), Vías de comunicación en las comarcas de Baza y Huéscar: una aproximación histórico-arqueológica desde la prehistoria reciente a la Edad Media. Granada, Universidad de Granada. http://hdl.handle.net/10481/38469Cabré, J. (1922), “Una necrópolis de la Primera Edad de los metales en Monachil, Granada”, Memorias de la Sociedad Española de Antropología, Etnología y Prehistoria I, Madrid.Cámara, J. A. y Molina, F. (2009), “El análisis de la ideología de emulación: el caso de El Argar”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 19, pp. 163-194. https://doi.org/10.30827/cpag.v19i0.188— (2013), “Indicadores de conflicto bélico en la Prehistoria Reciente del cuadrante sudeste de la Península Ibérica: el caso del Calcolítico”. Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 23, pp. 99-132. https://doi.org/10.30827/cpag.v23i0.3104Cámara, J. A., Molina, F., Pérez, C. y Spanedda, L. (2018), “Una nueva lectura de las fortificaciones calcolíticas del Cerro de la Virgen (Orce, Granada, España)”, Ophiussa. Revista do Centro de Arqueologia da Universidade de Lisboa, 2, pp. 25-37.Castro, P. V., Lull, V. y Micó, R. (1996), Cronología de la Prehistoria Reciente de la Península Ibérica y Baleares (c. 2800-900 cal ANE), BAR International Series 652, Oxford, Archeopress.Contreras, F. (1982), “Una aproximación a la urbanística del Bronce Final en la Alta Andalucía: El Cerro de Cabezuelos (Úbeda, Jaén)”, Cuadernos de Prehistoria de la Universidad de Granada, 7, 307-329. https://doi.org/10.30827/cpag.v7i0.1204Contreras, F., Capel, J., Esquivel, J. A., Molina, F. y De La Torre, F. (1987-88), “Los ajuares cerámicos de la necrópolis argárica de la Cuesta del Negro (Purullena, Granada). Avance al estudio analítico y estadístico”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 12-13, pp. 135-155. https://doi.org/10.30827/cpag.v12i0.1278De La Torre, F., Molina, F., Carrión, F., Contreras, F, Blanco, L., Moreno, M. A., Ramos, A. y De La Torre, M. A. (1984), “Segunda campaña de excavaciones (1983) en el poblado de la Edad del Cobre de «El Malagón» (Cúllar-Baza, Granada)”, Cuadernos de Prehistoria de la Universidad de Granada, 9, pp. 131-146. https://doi.org/10.30827/cpag.v9i0.1231Delibes de Castro, G., Fernández-Miranda Árbol, M., Fernández-Posse, M.D. y Martín Morales, C. (1986), “El poblado de Amizaraque”, en O. Arteaga (ed.), Homenaje a Luis Siret (1934-1984), Sevilla, Junta de Andalucía, pp. 167-177.Delibes de Castro, G., Fernández-Miranda, M., Martín, C. y Fernández-Posse, M. D. (1985), “Almizaraque (Cuevas de Almanzora, Almería)”, XVII Congreso Nacional de Arqueología. Zaragoza, pp. 221-232.Dorado, A. (2019), Caracterización de las producciones cerámicas de Andalucía Oriental y el Sudeste de la Península Ibérica: del Bronce Tardío al Hierro Antiguo (1550/1500 – 550 cal AC), Granada, Universidad de Granada. http://hdl.handle.net/10481/55777Dorado, A., Molina, F., Cámara, J. A. y Gámiz, J. (2017), “La cerámica campaniforme del Cerro de la Encina (Monachil, Granada). Nuevas aportaciones al complejo cultural del Sureste”, en V. S. Gonçalves (coord.), Sinos e taças junto ao oceano e mais longe: aspectos da presença campaniforme na Peninsula Ibérica (Estudos Memórias 10), Lisboa, Universidade de Lisboa, pp. 268-279.Dorado, A., Molina, F., Contreras, F., Nájera, T., Carrión, F., Sáez, L., De La Torre, F. y Gámiz, J. (2015), “El Cerro de Cabezuelos (Jódar, Jaén): Un asentamiento del Bronce Final en el Alto Guadalquivir”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 25, pp. 257-347. https://doi.org/10.30827/cpag.v25i0.5368Dorado, A., Sol, J. F. y Adroher, A. M. (2020), “La transformación de las estructuras defensivas entre el Bronce Final y los primeros momentos de la Edad del Hierro en el sudeste de la Península Ibérica”, en A. Guerrero Martín (ed.), Imperialismo y Ejércitos, Granada, Universidad de Granada, pp. 39-60Fernández Martín, S. (2010), Los complejos cerámicos del yacimiento arqueológico de la Motilla del Azuer (Daimiel, Ciudad Real). Universidad de Granada, Granada. http://hdl.handle.net/10481/6643Fernández-Posse, M. D., Gilman, A. y Martín, C. (1996), “Consideraciones cronológicas sobre la Edad del Bronce en La Mancha”, Complutum Extra, 6 (2), pp. 111-137. https://revistas.ucm.es/index.php/CMPL/article/view/CMPL9696330111AGonzález Quintero, P., Mederos Martín, A., Díaz Cantón, A., Bashore Acero, C., Chamón Fernández, J. y Moreno Benítez, M. A. (2018), “El poblado fortificado metalúrgico del Calcolítico Medio y final de Puente de Santa Bárbara (Huércal-Overa, Almería)”, Zephyrvs, 81, pp. 71-91. https://doi.org/10.14201/zephyrus2018817191Hernández Pérez, M. S., López, J. A. y Jover, F. J. (2021), “En los orígenes de El Argar: la cerámica decorada como indicador arqueológico de su espacio social inicial”, Trabajos de Prehistoria, 78 (1), pp. 86-103. https://doi.org/10.3989/tp.2021.12266Jakowski, A. E., Schröder-Ritzrau, A., Frank, N. y Alonso Blanco, J. M. (2021), “Nuevas investigaciones sobre el «Acueducto» de Los Millares (Santa Fe de Mondújar, Almería)”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 31, pp. 255-284. https://doi.org/10.30827/cpag.v31i0.17848Kalb, Ph. (1969), “El poblado del Cerro de la Virgen de Orce (Granada)”, X Congreso Nacional de Arqueología (Mahón, 1967), Zaragoza, pp. 216-225.Lenguazco, R. (2016a), Ocupación del territorio y aprovechamiento de recursos en el Bronce de La Mancha: Las Motillas y su territorio de explotación directa, Madrid, Universidad Autónoma de Madrid. http://hdl.handle.net/10486/671726— (2016b), “El concepto de motilla en la bibliografía arqueológica: ¿qué entendemos por motilla como yacimiento arqueológico? ¿cuántas se conocen hasta la fecha?”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 26, pp. 379-406. https://doi.org/10.30827/cpag.v26i0.7407Lizcano, R., Cámara, J. A., Contreras, F., Pérez, C. y Burgos, A. (2004), “Continuidad y cambio en comunidades calcolíticas del Alto Guadalquivir”, en Simposios de Prehistoria Cueva de Nerja. II. La problemática del Neolítico en Andalucía. III. Las primeras sociedades metalúrgicas en Andalucía, Fundación Cueva de Nerja, Nerja, pp. 159-175.Lull, V., Micó, R., Rihuete, C. y Risch, R. (2013), “La fortificación de La Bastida y los orígenes de la violencia militarizada en Europa”, Cuadernos de La Santa Totana (Murcia), 14, pp. 247-254.Lull, V., Micó, R., Rihuete, C., Risch, R., Celdrán, E., Fregeiro, M. I., Oliart, C. y Velasco, C. (2015), La Almoloya (Pliego, Murcia), Ruta Argárica. Guías Arqueológicas 2, Integral, Sociedad para el Desarrollo Rural, Murcia.Martín, C., Fernández Miranda, M., Fernández-Posse, M. D. y Gilman, A. (1993), “The Bronze Age of La Mancha”, Antiquity, 67, pp. 23-45.Martínez, C. y Botella, M. (1980), El Peñón de la Reina (Alboloduy, Almería), Excavaciones Arqueológicas en España 112. Madrid, Ministerio de Cultura.Mederos Martin, A. Schuhmacher, T. X., Falkenstein, F., Ostermeier, N., Bashore, C., Vargas, J. M., Ruppert, M. (2021), “El poblado de la Edad del Cobre de Valencina de la Concepción (Sevilla): nuevos datos sobre sus recintos y espacios domésticos. Campaña de 2018”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 31, pp. 285-331. https://doi.org/10.30827/cpag.v31i0.18024Molina, F. y Pareja, E. (1975), Excavaciones en la Cuesta del Negro (Purullena, Granada). Campaña de 1971, Excavaciones Arqueológicas en España 86, Madrid, Ministerio de Educación y Ciencia.Molina, F., Afonso, J. A., Cámara, J. A., Dorado, A., Martínez Sánchez, R. M. y Spanedda, L. (2020), “The chronology of the defensive systems at Los Millares (Santa Fe de Mondújar, Almería, Spain)”, en D. Delfino, F. Coimbra, G. Cruz y D. Cardoso (eds.), Late Prehistoric Fortifications in Europe: Defensive, symbolic and territorial aspects from the Chalcolithic to the Iron Age. Proceeding of ‘FortMetalAges’, International Colloquium, Guimarães, Portugal, London, Archaeopress Archaeology, pp. 31-43.Molina, F., Aguayo, P., Fresneda, E. y Contreras, F. (1986), “Nuevas investigaciones en yacimientos de la Edad del Bronce en Granada”, en Homenaje a L. Siret (1934-1984), Sevilla, Junta de Andalucía, pp. 353-360.Molina, F., Aguayo, P., Carrasco, J., Nájera, T., y Dorado, A. (2018), “Cerro de los Castellones (Laborcillas, Granada)”, en F. Contreras y A. Dorado (coords.) (2018), Yacimientos arqueológicos y artefactos. Las colecciones del Departamento de Prehistoria y Arqueología (I), Cuaderno Técnico de la Universidad de Granada 7, Granada, Universidad de Granada, pp. 46-49Molina, F., Cámara, J. A., Afonso, J. A. y Spaneda, L. (2019), “Análisis estadístico de las dataciones radiocarbónicas de la Motilla del Azuer (Daimiel, Ciudad Real)”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 29, pp. 309-351. https://doi.org/10.30827/cpag.v29i0.9780Molina, F., Camara, J. A., Capel, J., Najera, T. y Saez, L. (2004), “Los Millares y la periodización de la Prehistoria Reciente del Sudeste”, en Simposios de Prehistoria Cueva de Nerja. II. La problemática del Neolítico en Andalucía. III. Las primeras sociedades metalúrgicas en Andalucía, Nerja, Fundación Cueva de Nerja, pp. 142-158Molina, F., Carrion, F., Blanco, I. y Contreras, F. (1983), “La Motilla de la Isla de las Cañas (Daimiel, Ciudad Real)”, Cuadernos de Prehistoria de la Universidad de Granada, 8, pp. 301-324. https://doi.org/10.30827/cpag.v8i0.1217Molina, F., De La Torre, F. y Moreno, A. (2018), “El Malagón (Cúllar, Granada)”, en F. Contreras Cortés y A. Dorado Alejos (coords.), Yacimientos arqueológicos y artefactos. Las colecciones del Departamento de Prehistoria y Arqueología (I), Cuaderno Técnico de la Universidad de Granada, 7, Granada, Universidad de Granada, pp. 38-40Molina, F., Nájera, T., Aranda, G., Sánchez, M. y Haro, M. (2005), “Recent field-work at the Bronze Age fortified site of Motilla del Azuer (Daimiel, Spain)”, Antiquity, 79, pp. 306.Molina, F., Cámara, J. A., Dorado, A. y Villarroya, M. (2017), “El fenómeno campaniforme en el Sudeste de la Península Ibérica: el caso del Cerro de la Virgen (Orce, Granada)”, en V. S. Gonçalves (coord.), Sinos e taças junto ao oceano e mais longe: aspectos da presença campaniforme na Peninsula Ibérica (Estudos Memórias 10), Lisboa, Universidade de Lisboa, pp. 112-129.Moreno, M. A. y Haro, M. (2008), “Castellón Alto (Galera, Granada). Puesta En Valor De Un Yacimiento Argárico”, Cuadernos de Prehistoria y Arqueología de la Universidad de Granada, 18, pp. 371-395. https://doi.org/10.30827/cpag.v18i0.751Morgado, A. (2018), “Poblado Amurallado de Villavieja (Fuentes De Cesna-Algarinejo, Granada)”, en F. Contreras Cortés y A. Dorado Alejos (coords.), Yacimientos arqueológicos y artefactos. Las colecciones del Departamento de Prehistoria y Arqueología (I), Cuaderno Técnico de la Universidad de Granada, 7, Granada, Universidad de Granada, pp. 34-37.Morgado, A., García, A., Bueno, J. A., López, R., Santamaría, U., Garzón, J., Aguiló, C., Bermúdez, R., Marín, T. R., Navero, M., Pérez, D., Piriz, A., Soto, T., De La Torre, A. y Vivar, D. (2020), “Prehistoria del subbético de Granada el conjunto arqueológico de los Tajos de Marchales (Colmera-Montillana, Granada)”, Antiquitas, 32, pp. 7-22.Muñoz Amilibia, A. M. (1986), “Las fortificaciones eneolíticas en la Península Ibérica. El Cabezo del Plomo (Mazarrón, Murcia)”, Congreso de Historia Militar, T. I, Zaragoza, pp. 53-62.— (1993), “Neolítico Final-Calcolítico en el Sureste Peninsular. El Cabezo del Plomo (Mazarrón-Murcia)”, Espacio, Tiempo y Forma, Prehistoria, 6, pp. 133-180.Nájera, T. (1982), La Edad del Bronce en La Mancha Occidental, Tesis doctoral. Granada, Universidad de Granada. http://hdl.handle.net/10481/32595Nájera, T. y Molina, F. (1977), “La Edad del Bronce en La Mancha. Excavaciones en las motillas del Azuer y de Los Palacios (Campaña de 1974)”, Cuadernos de Prehistoria de la Universidad de Granada, 2, pp. 251-300. https://doi.org/10.30827/cpag.v2i0.727— (2004a), “La Edad del Bronce en La Mancha: problemática y perspectivas de la investigación”, en L. Hernández y M. Hernández (eds.), La Edad del Bronce en tierras levantinas y limítrofes, Villena, Instituto de Cultura Juan Gil-Albert, pp. 531-540.— (2004b), “Las Motillas. Un modelo de asentamiento con fortificación central en la Llanura de La Mancha”, en M. R. García Huerta y J. Morales Hervás (eds.), La Península Ibérica en el II milenio a.C.: Poblados y fortificaciones, Cuenca, Ediciones de la Universidad de Castilla-La Mancha, pp. 173-214.Nicas Perales, J. y Cámara Serrano, J. A. (2017), “Fortificación y ritual en el yacimiento calcolítico de Marroquíes (Jaén). Los fosos del Paseo de la Estación”, Antiquitas, 29, pp. 39-57.Nocete, F., Crespo, J. M. y Zafra, N. (1986), “El Cerro del Salto. Historia de una periferia”, Cuadernos de Prehistoria de la Universidad de Granada, 11, pp. 171-198. https://doi.org/10.30827/cpag.v11i0.1264Schubart, H., Pingel, V. y Arteaga, O. (2000), Fuente Álamo. Las excavaciones arqueológicas 1977-1991 en el poblado de la Edad del Bronce, Arqueología Monografías 8, Sevilla, Junta de Andalucía.Schüle, W. (1980), Orce und Galera. Zwei Siedlungen aus dem 3. bis l. Jahrtausend v. Chr. im Südosten der Iberischen Halbinsel. I Übersicht über die Ausgrabungen 1962-1970, Philipp von Zabern. Mainz am Rheim.Schüle, W. y Pellicer, M. (1966), El Cerro de la Virgen, Orce (Granada), Excavaciones Arqueológicas en España 46. Madrid, Ministerio de Educación.Siret, E. y Siret, L. (1890), Las primeras edades del metal en el Sudeste de España. Resultados obtenidos en las excavaciones hechas por los autores desde 1881 á 1887, Barcelona.Sol Plaza, J. F., Dorado Alejos, A., Adroher Auroux. A. M. y Molina González, F. (2020), “¿Sólo indígenas? Reinterpretando algunos artefactos del Cerro de los Infantes a la luz de las nuevas investigaciones”, Antiquitas, 32, pp. 37-55.Spanedda, L., Cámara, J. A., Molina, F., Nájera, T. y Dorado, A. (2020), “Pianificazione e specializzazione negli insediamenti della preistoria recente nel sud-est della Penisola Iberica (3300-1350 cal a.C.)”, en Archeologia dell’abitare. Insediamenti e organizzazione sociale prima della città. Dai monumenti ai comportamenti. Ricerche e scavi (Vol I). Milan, Centro Studi di Preistoria e Archeologia, pp. 457-466.Tarradell, M. (1947-1948), “Investigaciones arqueológicas en la provincia de Granada”, Ampurias, IX-X, pp. 223-236. https://raco.cat/index.php/Empuries/article/view/97671

Introducción: El cáncer de próstata (CP) el segundo cáncer diagnosticado en hombres, con mayor incidencia a los 66 años. La obesidad, el tabaquismo, alcoholismo y antecedentes familiares de CP se han encontrado asociados al riesgo de metástasis. El objetivo del presente estudio fue medir la asociación entre factores y el estado metastásico en pacientes con CP en un centro único de referencia en Ecuador. Metodología: El presente estudio analítico, se realizó en el Hospital “Teodoro Maldonado Carbo”, en Guayaquil-Ecuador, en el período enero-diciembre del 2019. El cálculo muestral fue no probabilístico, tipo censo. Se incluyeron casos con CP. Las variables fueron: edad, PSA, escala de Gleason, presencia de metástasis, sintomatología, tabaquismo, obesidad y antecedentes. Se presenta Odds Ratio como medida de asociación con intervalo de confianza del 95% y valor P. Resultados: El estudio incluyó 363 pacientes, con edad promedio de 75.2 ± 9.6 años. El grupo con metástasis fue de 202 casos (55.65%). Metástasis ósea 32.5%, pulmonar 9.6%, ganglionar 8.8% y hepático 4.75%. En la sintomatología la más frecuente fue, disuria (44.4%); el 33.6% con polaquiuria, un 13.2% hematuria y 8.8% tenesmo. El estadio Gleason-9 OR=24.85 (IC 95% 1.47-419.8) P=0.0259. El nivel de PSA >19 ng/ml OR= 6.996 (IC 95% 2.68-18.29) P=0.0001. El tabaquismo OR=2.34 (IC 95% 1.52-3.60) P=0.0001. Fueron factores protectores el valor de PSA <19 ng/ml OR=0.082 (IC 95% 0.043-0.157) P<0.0001, acudir a consulta de Hipertensión arterial OR=0.33 (IC 95% 0.161-0.691) P=0.0032 y el estadío Gleason-6 OR=0.108 (IC 95% 0.0665-9.1736) P<0.0001. Conclusión: Los niveles de PSA >19 ng/ml y el estadio Gleason >9 se asocian a la presencia de metástasis en pacientes con CP. Recibido: Julio 14, 2022 Aceptado: Octubre 27, 2022 Publicado: Diciembre 2, 2022 Editor: Dra. Evelyn Valencia Espinoza. Introducción El cáncer de próstata es el segundo cáncer más diagnosticado en hombres alrededor del mundo, con mayor incidencia promedio a los 66 años [1]. En países desarrollados, el cáncer de próstata se diagnostica a edades más tempranas cuando este se confina a la glándula prostática, debido al uso del antígeno prostático específico (PSA) [2]. El antígeno prostático específico es proteína creada por el epitelio prostático, el cual, es específico de órgano, más no de cáncer, debido a que el mismo puede estar elevado en patologías como prostatitis, hiperplasia prostática benigna, entre otras. Sin embargo, es el mejor biomarcador hasta ahora para el diagnóstico temprano del cáncer de próstata. Según la American Academy of Family Physicians, se ha determinado que 3 de cada 10 hombres con elevado PSA, tienen un alto riesgo de sufrir de cáncer de próstata que va a depender de la edad y el nivel del PSA que se encuentre. Algunos estudios demuestran que las pruebas de rutina de PSA en hombres entre 55 a 66 años disminuyen la mortalidad por cáncer de próstata, de manera significativa. Sin embargo, la baja especificidad para Cáncer de Próstata de la prueba, hace que la interpretación de ella no sea concluyente [3]. La Escala de Gleason es un sistema de graduación que sirve, una vez establecido el diagnóstico de adenocarcinoma de próstata, para medir la agresividad histopatológica de la neoplasia [4]. Está plenamente establecido que la escala de Gleason, de acuerdo a los hallazgos histopatológicos del tumor, nos permite categorizar a los pacientes de una manera más precisa y de esta manera tener una idea clara del pronóstico de dicho paciente. Con estos antecedentes se estableció el objetivo de determinar los factores de riesgo asociados a metástasis en pacientes con cáncer de próstata en un centro de referencia regional en Guayaquil-Ecuador. Materiales y métodos Diseño del estudio El presente estudio es observacional-analítica. La fuente es retrospectiva. Área de estudio El estudio se realizó en el servicio de urología del Hospital de Especialidades “Teodoro Maldonado Carbo”, del Instituto Ecuatoriano de Seguridad Social, en Guayaquil-Ecuador. El período de estudio fue del 1ro de Enero del 2019 hasta el 31 de diciembre del 2019. Universo y muestra El universo fue conformado por todos los pacientes registrados en la institución. El cálculo del tamaño muestral fue no probabilístico, tipo censo, en donde se incluyeron todos los casos incidentes en el período de estudio. Participantes Se incluyeron casos de pacientes adultos diagnosticados con cáncer de próstata en quienes se contó con valoración de PSA y la escala de Gleason. Se excluyeron registros incompletos para el análisis. Variables Las variables fueron edad, PSA, escala de Gleason, presencia de metástasis, sintomatología, métodos diagnósticos. Procedimientos, técnicas e instrumentos. Los datos fueron recogidos de la historia clínica en un formulario diseñado exclusivamente para tal propósito. Los diagnósticos de CP se realizaron por punción aspiración por aguja fina (PAAF) guiada por ecografía. Las placas fueron leídas por Patólogos distintos. Se usó el sistema AS400 para la pesquisa de casos usando los diagnósticos codificados: C61. Evitación de sesgos Para garantizar la confiabilidad de la información los investigadores fueron entrenados sobre la recolección de los datos. Se usó una lista de doble chequeo para incluir los casos. Los datos fueron validados y curados por el investigador principal. Análisis estadístico Recopilada la información en una hoja electrónica Excel, se ingresó en una matriz de datos del software SPSS™ 22.0 (IBM, Chicago, USA). Se utilizó estadística descriptiva en base a frecuencias y porcentajes para las variables cualitativas y para las cuantitativas medidas de tendencia central. Se presenta Odds Ratio como medida de asociación con intervalo de confianza del 95% y valor P. Resultados El estudio incluyó 363 pacientes. Caracterización clínica Fueron 363 pacientes, con edad promedio de 75.2 ± 9.6 años. La edad mínima fue de 49 años, y la máxima de 98 años. Los pacientes con metástasis fueron 202 casos (55.65%). Con respecto al lugar de diseminación metastásica, se encontró mayor predilección a desarrollar metástasis ósea en el 32.5% de los pacientes, seguido de metástasis pulmonar con el 9.6%, metástasis ganglionar con el 8.8% y a nivel hepático 4.75% de los casos. En la sintomatología la más frecuente fue, disuria con el 44.4%; el 33.6% con polaquiuria, un 13.2% hematuria y 8.8% tenesmo. El estudio más frecuente utilizado, fue el eco prostático, con un 42.7%; la tomografía 20.4%), gammagrafía prostática 25.6%, la resonancia magnética con el 11.3%. Factores clínicos El 44.4% de los pacientes padecía alcoholismo, el 27.5% presentaba tabaquismo, el 23.1% eran consumidores de carnes y lácteos; otros hábitos poco frecuentes se relacionaron con el 4.7%; 0.3% no refería ningún hábito de importancia. Dentro de los antecedentes patológicos se evidenció que, 54.5% de los pacientes tenían antecedentes familiares de Cáncer de próstata, 29.2% presentaba obesidad y sobrepeso, en tercer lugar, con 9.9% de los pacientes padecía de hipertensión arterial y entre otros antecedentes asociados tenían un porcentaje del 5.5% (Tabla 1). De la totalidad de los evaluados, el 45.2% tuvieron Gleason 6, mientras que aquellos con valores en la Escala de Gleason de 10, alcanzaban el 1.4%. La medición del riesgo se presenta en la tabla 1. Se constituyeron factores de riesgo para el desarrollo de metástasis el tabaquismo, y el estadío clínico Gleason 7, 8 y 9, los valores de PSA en rangos de 19-49 ng/ml, de 50 a 99 ng/ml y 100-299 ng/ml. Se establecieron como factores de protección estadísticamente significativos al antecedente personal de Hiperplasia prostática benigna, a la condición de hipertensión arterial, al estadio clínico Gleason 6, al valor de PSA <19 ng/ml (Tabla 1). Discusión Al comparar el presente estudio con investigaciones previas se constató que la edad constituye un factor de riesgo no modificable para padecer cáncer prostático, según el Instituto Nacional de Cáncer en Estados Unidos, en su programa estadístico de Vigilancia, Epidemiología y Resultados (SEER) entre los años 2015-2019 se encontró una mayor incidencia de casos en los pacientes que tenían entre 70-74 años de edad [5], así también lo describió el trabajo de Leitzmann et al, en los años correspondientes a 2000-2008 donde la incidencia comienza a aumentar desde los 40-44 años de edad para llegar a su pico máximo de 984.8 pacientes por cada 100.000 hombres con edades entre 70-74 años [6], similarmente en este estudio el mínimo de edad fue 49 años en la población con un máximo de 98 y un media de 75.15 respectivamente. En cuanto a la distribución de regiones anatómicas donde se suele presentar la metástasis en el cáncer prostático; en primer lugar se determinó a los huesos (84%) en segundo lugar a nódulos linfáticos distantes (10.6%) y hepático (10.2%) [7] según un estudio conducido por Gandaglia et al. lo cual en similitud a este estudio el sitio más frecuente fue a nivel óseo con un 32.5% de todos los pacientes, seguido de la metástasis pulmonar con 9.6% y ganglionar 8.8%. A su vez Auz y Brito (2018) encontraron en su investigación realizada en el Hospital Solca Núcleo de Quito-Ecuador que incluyó a 1713 pacientes donde el sitio más frecuente de metástasis fue el óseo en un 82.25%, seguido del ganglionar linfático con 7.05% y luego 2.8% a nivel pulmonar [8]. En lo que corresponde a los hábitos de los pacientes, un 44.4% de pacientes en este estudio consumía de alcohol regularmente, mientras que el 27.5% consumía tabaco y el 23.1% eran consumidores de carnes y lácteos, lo cual se contrasta con el estudio de Auz y Brito (2018) detallado anteriormente donde 31.1% de los pacientes consumían alcohol regularmente y el 28.3% de los pacientes consumían tabaco al momento de diagnóstico, no se midieron datos en relación al consumo de lácteos y carnes rojas [8]. Un factor de riesgo no modificable muy importante fue la presencia de antecedentes familiares de cáncer de próstata en este estudio con un 54.5% de los pacientes lo cual en el trabajo de Auz y Brito (2018) solamente 9% tuvieron antecedentes familiares de cáncer prostático y un 23.2% de otros tipos de cánceres [23]. Según Barber et al. en su estudio se identificó que pacientes con historia familiar de cáncer prostático únicamente, tienen un riesgo aumentado del 68% de padecer lo mismo (95% CI 1.53-1.83) y un 72% de enfermedad letal [9]. Así también lo describió Powell IJ (2011) en su publicación que dice que hombres con relativos de primer grado (Padre, hermano, hijo) tienen un riesgo de desarrollar cáncer prostático que es aproximadamente del doble a la población general [10]. En el presente estudio 29.2% de los pacientes presentaba sobrepeso y 9.9% de los pacientes padecía hipertensión arterial, así mismo en el estudio de Möller et al. se encontró que un IMC alto (26) en comparación a 20-22 a la edad de 21 años fue asociada con riesgo menor de cáncer prostático letal o avanzado y Gleason 7 [11], también se habla sobre que de los componentes del síndrome metabólico incluyendo la hipertensión arterial ninguno tiene relación con el desarrollo de cáncer prostático [10]. Dentro de los síntomas más frecuentes en esta investigación se encontraron la disuria con un 44.4% de todos los pacientes, le siguió la polaquiuria (33.6%) y finalmente la hematuria (13.2%). De manera similar el estudio de Birtle et al. llevado a cabo entre los años 2000-2001 con bases de datos de la Asociación Británica de Cirujano Urológicos determinó que de 33 pacientes con cáncer metastásico de próstata con PSA <10 ng/ml 51% se presentó con síntomas urinarios y/o dolor pélvico, 21% presentó dolor óseo, 18% retención urinaria y 10% caquexia y malasia [12]. En el presente estudio de la totalidad de pacientes, 45.2% de ellos tuvieron puntajes de Gleason de 6 y en menor medida con 1.4% de los pacientes puntajes de Gleason 10, esto se puede comparar con el estudio de Thomsen et al. donde se encontró que altos puntajes en la escala de Gleason se relacionaron a la presencia de metástasis, así en ese estudio los pacientes que presentaron metástasis a distancia según la escala TNM (M1), 41% tenía un puntaje de Gleason 5, mientras que solo el 3% tenía Gleason 1 [13]. El método de imagen más utilizado en este estudio fue el de la ecografía prostática con un 42.7% y en menor medida la resonancia magnética con el 11.3%. En la investigación de Huang et al. se encontró que el uso de la Resonancia Magnética con el sistema PI-RADS v2 fue el sistema más preciso para predecir la metástasis a nódulos linfáticos en la zona pélvica, los pacientes con PI-RADs <5 fueron asociados con un riesgo muy bajo de metástasis ganglionar [14]. La ecografía prostática 3D se demostró un 84% de sensibilidad y 96% de especificidad para identificar extensión tumoral extra capsular macroscópica y fue capaz de identificar a 14/16 diseminaciones a la vesícula seminal según Mitterberger et al. en el año 2008 [15]. Finalmente con respecto a valoraciones de PSA que se presentaron en los pacientes diagnosticados con cáncer de próstata, se pudo evidenciar, que el 100% de los pacientes con PSA mayor de 500 ng/ml tuvo metástasis, así como el grupo de pacientes con 300-499 ng/ml PSA, a diferencia del grupo con menos de 19 ng/ml PSA donde solo el 40.6% tuvo metástasis, lo cual se puede comparar al estudio de Thomsen et al. donde de los pacientes con más de 400 ng/ml, el 64.9% presentó metástasis, le sigue el grupo con valores de 200-399 ng/ml donde el 54% desarrolló metástasis y al final el grupo con menos de 19 ng/ml tuvo solo al 1.45% de pacientes con metástasis, podemos así deducir que el valor de PSA es directamente proporcional al riesgo de metástasis, sin embargo, recomendamos tomar en cuenta más factores de riesgos de manera conjunta para una evaluación integral del paciente [13]. Conclusiones En orden de importancia estadística los factores asociados a metástasis en cáncer prostático son el estadio clínico Gleason 9 y 8, Los niveles de PSA entre 50 a 299 ng/ml, y el tabaquismo. Fueron factores protectivos el antecedente clínico de Hiperplasia Prostática benigna, hipertensión y el nivel de PSA <19 ng/ml. Nota del Editor La Revista Oncología Ecu permanece neutral con respecto a los reclamos jurisdiccionales en mapas publicados y afiliaciones institucionales. Agradecimientos Los autores agradecen a todas las personas de la Institución que colaboraron en el desarrollo de esta investigación. Información administrativa Abreviaturas APP: antecedentes patológicos personales. APF: Antecedentes patológicos familiares. HPB: hiperplasia prostática benigna. Ca: Cáncer. PSA: Antígeno prostático específico. OR: Odds ratio. IC: intervalo de confianza Archivos Adicionales Ninguno declarado por los autores. Fondos Los autores no recibieron ningún tipo de reconocimiento económico por este trabajo de investigación. Disponibilidad de datos y materiales Existe la disponibilidad de datos bajo solicitud al autor de correspondencia. No se reportan otros materiales. Contribuciones de los autores Emily Gabriela Chimbo Acuña: conceptualización, validación, visualización, metodología, administración de proyecto, escritura: revisión y edición. Karen Gabriela Valverde Zambrano: conceptualización, curación de datos, análisis formal, adquisición de fondos, investigación, recursos, software, redacción - borrador original. Iván Altamirano: conceptualización, curación de datos, análisis formal, adquisición de fondos, investigación, recursos, software. Todos los autores leyeron y aprobaron la versión final del manuscrito. Aprobación del comité de ética No aplica a estudios de bases de datos o historias clínicas. Consentimiento para publicación El presente estudio es un análisis de base de datos, no aplica para este tipo de estudio. Referencias Professionals S-O. EAU Guidelines: Prostate Cancer [Internet]. [citado 20 de octubre de 2021]. Disponible en: https://uroweb.org/guideline/prostate-cancer/#note_11 Barry MJ, Nelson JB. Patients Present with More Advanced Prostate Cancer since the USPSTF Screening Recommendations. J Urol. diciembre de 2015;194(6):1534-6. DOI: 1016/j.juro.2015.09.033 PMid: 26384450 Catalona WJ, Richie JP, Ahmann FR, Hudson MA, Scardino PT, Flanigan RC, et al. Comparison of digital rectal examination and serum prostate specific antigen in the early detection of prostate cancer: results of a multicenter clinical trial of 6,630 men. J Urol. mayo de 1994;151(5):1283-90. DOI: 1016/S0022-5347(17)35233-3 PMid: 7512659 Schröder FH, Hugosson J, Roobol MJ, Tammela TL, Ciatto S, Nelen V, Kwiatkowski M, Lujan M, Lilja H, Zappa M, Denis LJ, Recker F, Berenguer A, Määttänen L, Bangma CH, Aus G, Villers A, Rebillard X, van der Kwast T, Blijenberg BG, Moss SM, de Koning HJ, Auvinen A; ERSPC Investigators. Screening and prostate-cancer mortality in a randomized European study. N Engl J Med. 2009 Mar 26;360(13):1320-8. DOI: 10.1056/NEJMoa0810084. Epub 2009 Mar 18. PMID: 19297566. Surveillance, Epidemiology, and End Results Program (SEER) of the National Cancer Institute. Fast Stats: An interactive tool for access to SEER cancer statistics. Bethesda, MD: SEER, National Cancer Institute; nd. Available from: www.seer.cancer.gov/faststats. Leitzmann MF, Rohrmann S. Risk factors for the onset of prostatic cancer: age, location, and behavioral correlates. Clin Epidemiol. 5 de enero de 2012;4:1 DOI: 2147/CLEP.S16747 PMid: 22291478 PMCid: PMC3490374 Gandaglia G, Abdollah F, Schiffmann J, Trudeau V, Shariat SF, Kim SP, et al. Distribution of metastatic sites in patients with prostate cancer: A population-based analysis. Prostate. febrero de 2014;74(2):210-6. DOI: 1002/pros.22742. PMid:24132735 Auz Fierro E, Brito Chasiluisa H. Factores relacionados con la supervivencia de pacientes con cancer de prostata en el hospital solca nucleo de quito durante el periodo 2003 - 2018. [Internet]. [Hospital Solca Nucleo de Quito]: Pontificia Universidad Católica del Ecuador; 2018. Disponible en: 22000 Barber L, Gerke T, Markt SC, Peisch SF, Wilson KM, Ahearn T, et al. Family History of Breast or Prostate Cancer and Prostate Cancer Risk. Clinical Cancer Research. 1 de diciembre de 2018;24(23):5910-7. DOI: 1158/1078-0432.CCR-18-0370. PMid: 30082473 PMCid: PMC6279573 Powell IJ. The precise role of ethnicity and family history on aggressive prostate cancer: a review analysis. Arch Esp Urol. 2011 Oct;64(8):711-9. PMID: 22052754; PMCID: PMC3859428. Möller E, Wilson KM, Batista JL, Mucci LA, Bälter K, Giovannucci E. Body size across the life course and prostate cancer in the Health Professionals Follow-up Study: Body size and prostate cancer. Int J Cancer. 15 de febrero de 2016;138(4):853-65. DOI: 1002/ijc.29842 PMid: 26355806 PMCid: PMC5042346 Birtle AJ, Freeman A, Masters JRW, Payne HA, Harland SJ, BAUS Section of Oncology Cancer Registry. Clinical features of patients who present with metastatic prostate carcinoma and serum prostate-specific antigen (PSA) levels < 10 ng/mL: the «PSA negative» patients. Cancer. 1 de diciembre de 2003;98(11):2362-7. DOI: 1002/cncr.11821 PMid: 14635070 Thomsen FB, Westerberg M, Garmo H, Robinson D, Holmberg L, Ulmert HD, et al. Prediction of metastatic prostate cancer by prostate-specific antigen in combination with T stage and Gleason Grade: Nationwide, population-based register study. PLoS One. 2020;15(1):e0228447. DOI: 1371/journal.pone.0228447 PMid: 31995611 PMCid: PMC6988964 Huang C, Song G, Wang H, Lin Z, Wang H, Ji G, et al. Preoperative PI-RADS Version 2 scores helps improve accuracy of clinical nomograms for predicting pelvic lymph node metastasis at radical prostatectomy. Prostate Cancer Prostatic Dis. marzo de 2020;23(1):116-26 DOI: 1038/s41391-019-0164-z PMid: 31383954 Mitterberger M, Pinggera GM, Pallwein L, Gradl J, Frauscher F, Bartsch G, et al. The value of three-dimensional transrectal ultrasonography in staging prostate cancer. BJU Int. julio de 2007;100(1):47-50. DOI: 1111/j.1464-410X.2007.06845.x PMid: 17433033.

PRIKAZI – REVIEWS Geoadria, vol. 8/1, 161-166, 2003. IZVJEŠĆA SA ZNANSTVENIH SKUPOVA - CONFERENCE REPORTS 3rd International Conference CLIMATE CHANGES: THE KARST RECORDS III, 11.-15. svibnja 2003., Montpellier, Francuska Od 11. do 15. svibnja 2003. u Montpellieru (Francuska) održana je treća međunarodna konferencija Climate Changes: The Karst Records III. Prvi ovakav skup održan je 1996. u Bergenu (Norveška), sljedeći 2000. u Krakowu (Poljska), nakon čega je zbog pojačanog interesa za ovu tematiku, a time i veće znanstvene produkcije, dogovoreno da se konferencija održava svaku treću godinu. Nakon Franuske (2003.), za domaćina konferencije 2006. godine predložena je Rumunjska. Ovaj skup okupio je znanstvenike iz 27 država sa 6 kontinenata koji su kroz 62 usmena izlaganja i 37 postera prezentirali svoja recentna znanstvena dostignuća iz područja paleoklimatologije temeljena na istraživanju krša, točnije speleoloških objekata i njihovih akumulacijskih oblika – siga. Sige, prepoznate kao medij koji zbog zaštićenosti i stabilnih mikroklimatskih uvjeta vrlo dobro "pamti" klimatska stanja šireg okoliša za vrijeme taloženja (a osim toga su i puno dostupnije od jezgri dubokomorskih bušotina i polarnih ledenih pokrova), zadnjih su desetljeća u središtu znanstvenog interesa različitih znanstvenih disciplina. Stoga su i teme radova bile doista raznolike; najveći je dio radova obuhvaćao paleoklimatske varijacije utvrđene na temelju omjera stabilnih izotopa siga iz gotovo svih klimatskih područja, te njihovo datiranje različitim metodama. Sige kao objekt istraživanja bile su obrađene i vezano uz petrografska svojstva, fluidne inkluzije, luminiscenciju, sezonske varijacije intenziteta taloženja itd., dok se kod speleoloških objekata proučavao stupanj okršavanja, utjecaj tektonike, špiljski sedimenti kao i paleontološki i arheološki nalazi. Dio radova obuhvaćao je rezultate monitoringa trenutnog stanja špilja, hidrologije, geokemije, atmosferskih uvjeta itd., a bilo je riječi i o promjenama morske razine kao posljedici klimatskih fluktuacija tijekom geološke prošlosti.Osim već tiskane knjige izvadaka u pripremi je i zbornik, dok se u međuvremenu kvalitetniji radovi recenzirani tiskaju u respektabilnom časopisu Francuskoga geološkog društva Bulletin de la Société Géologique de France.A gdje je Hrvatska, zemlja "klasičnog krša", u svemu tome? Država s 46% nacionalnog teritorija prekrivenog kršem (26000 km2) i još mnogo više pod morem, bila je zastupljena samo s jednim (1) radom – zapaženim, ali gotovo "pionirskim" u odnosu na radove sofisticiranih laboratorija i instituta zapadnih zemalja. Rad Isotope records in submarine speleothems from the Adriatic Coast, Croatia, autora Maše Surić, Nade Horvatinčić, Axela Suckowa, Mladena Juračića i Jadranke Barešić, analizira paleoklimatske promjene na istočnoj obali Jadrana koje su kroz omjere stabilnih izotopa kisika i ugljika ostale zabilježene u danas potopljenim sigama. Terenski dio konferencije obuhvatio je posjet mjestu Saint-Guilhem-le-Désert (tradicionalnoj postaji hodočasnika na putu prema svetištu Santiago de Compostella), te špiljskom sustavu Grotte de Clamouse, ukupne dužine oko 4 km od čega je 1965. gotovo 1 km uređen za turističke posjete. Osim impozantnih primjeraka špiljskog nakita, čija je raznolikost posljedica izmjena kalcitnih, aragonitnih i dolomitnih karakteristika nadsloja, ovaj objekt može biti i primjer kako se prekrasan špiljski prostor može upropastiti prilagođivanjem turističkim posjetima brojnim metalnim, staklenim i električnim instalacijama. Na trenutke posjetitelj može dobiti dojam da se kreće kroz muzej ili zbirku, a ne kroz više od stotinu metara dubok speleološki objekt. Dojam dodatno pojačava i ambiciozno zamišljen, ali kičasto izveden sound & light show. Obične turiste može fascinirati, ali istinske prirodnjake, zaljubljenike u krš – jedino ogorčiti. U svakom slučaju, terenski dio skupa i ovaj put bio je iskorišten za stvaranje novih i obnavljanje starih poznanstava koja će rezultirati međunarodnom znanstvenom suradnjom, posebno kad su u kombinaciji oprema i financije bogatijih zemalja i neistražena područja "onih drugih" zemalja. Ostaje nada da će takvim oblikom suradnje, na sljedećoj konferenciji Climate Changes: The Karst Records IV, Hrvatska biti malo bolje predstavljena svojim prirodnim i ljudskim potencijalima. Maša Surić 161 PRIKAZI - REVIEWS Geoadria, vol. 8/1, 161-166, 2003. PRIKAZI Atlas svijeta za 21. stoljeća, urednik: M. Lapaine i suradnici, Naklada Fran, Zagreb, 2003., 751 str. Nakladnik Fran iz Zagreba objavio je hrvatsko izdanje atlasa The 21 st Century World Atlas, koji je izvorno publicirao izdavač Trident Press International. Hrvatsko izdanje uredio je M. Lapaine sa suradnicima. Atlas nije tek hrvatski prijevod izvornika jer su pojedini stručnjaci dopunili i izmijenili neke sadržaje, a osim toga, S. Frangeš preveo je velik broj toponima na hrvatski jezik. Prijevodi su ispisani uz gornji rub karte kako se ne bi mijenjao izvorni jezik karata (engleski). Atlas je podijeljen u deset glavnih cjelina: Geopolitički okvir, Klimatologija, geologija i biogeografija, Demografija i socijalni pokazatelji , Osnovne ekonomske djelatnosti, Industrija, trgovina i promet, Afrika, Amerika, Azija, Europa i Oceanija. Na kraju je dodan rječnik osnovnih geografskih pojmova s odgovarajućim prijevodima (npr. perz. Kavir = solna pustinja) i kazalo s preko 60 000 geografskih imena. U općegeografskom dijelu atlasa na brojnim tematskim kartama zorno je prikazana prostorna raspodjela različitih prirodnih i socio-ekonomskih pojava i procesa. Iscrpnost kartografskih prikaza može se uočiti na primjeru poglavlja Socijalni i ekonomski pokazatelji, u kojemu su objavljene sljedeć i tematski zemljovidi: Potrošnja kalorija, Donacije hrane, Proizvodnja hrane, Smrtnost dojenčadi, Zdravstvena zaštita, Bolnička infrastruktura, Telefoni, Potrošnja energije, Pismenost, Izdavanje knjiga, Tiskanje novina, Broj upisa u školu, Omjer đaka i nastavnika u osnovnim školama, Znanstvenici i tehničari, Ekonomski aktivno stanovništvo, Dječja radna snaga, Struktura ekonomski aktivnog stanovništva, Ekonomska aktivnost, Ekonomska aktivnost žena, Ekonomska aktivnost muškaraca, Nezaposlenost, Bruto nacionalni dohodak, Bruto nacionalni dohodak po osobi, Struktura bruto nacionalnog dohotka, Inflacija, Ekonomski rast, Inozemni dug, Sredstva potrošena na obrazovanje, Sredstva potrošena na zdravstvenu zaštitu, Vojni izdaci, Izvoz i uvoz oružja, Trgovinska razmjena oružja i Logistika nuklearnog oružja. Kartogrami i kartodijagrami su jasni, pregledni i informativni.Kartografsko -geografski pregled po kontinentima ima jedinstvenu shemu. Ponajprije se nižu satelitske snimke, a potom digitalni modeli reljefa kopna i podmorja, geografske karte i kratki, ali sadržajni prikazi pojedinih zemalja. Na geografskim kartama kontinenata sitnim su slovima ispisani brojni toponimi. Njihova je čitljivost, na žalost, mala na prikazima planinskih predjela, koji su označeni nijansama sme đe i plavo-ljubičaste boje. Korisnik može doznati osnovne geografske informacije o svakoj državi putem kratkog geografskog uvodnika, zemljovida i različitih dijagrama.U hrvatskom izdanju atlasa svijeta mogao bi se očekivati iscrpniji prikaz Hrvatske. Priređivači nisu htjeli odstupati od izvornika, ali u reprintu zemljovida mogla se obratiti pozornost na pogrešno ispisane toponime (npr. naselje Sali na Dugom otoku ucrtano je u uvali Telašćica, Golfo di Venezia neobično se proteže duž zapadne obale Istre, naveden je stari naziv Požege – Slavonska Požega i sl.) . Međutim, navedene pogrješke ne umanjuju vrijednost atlasa, koji doista čini izvrstan kompendij najnovijih znanstvenih spoznaja o državama svijeta i Zemlji u cjelini, pa ga zbog toga rado preporučujem. Josip Faričić Nikola STRAŽIČIĆ: Svi hrvatski otoci, Descriptio Croatiae, Hrvatska revija, časopis Matice hrvatske, godište 1/2001., broj 3-4, Zagreb, 77-103. Hrvatska obala je najrazvedenija na Jadranskom moru, jer obuhvaća 97,2% jadranskog arhipelaga. S ponosom se ističe da je Hrvatska "zemlja tisuću otoka". Stvarni broj je i ve ći. Na pitanje koliko ih je unutar granica suvremene Hrvatske najmjerodavniji odgovor dao je prof. dr. sc. Nikola Stražičić. 162 PRIKAZI - REVIEWS Geoadria, vol. 8/1, 161-166, 2003. U uvodu se razmatraju podatci o ukupnom broju hrvatskih otoka kritički prema pojedinim autorima. U nastavku izložene su teškoće oko kategorizacije osnovnih pojmova "otok" - "otočić" - "greben" i "hrid". Posebno je zanimljiv dio članka u kojem su opisani i predočeni "zaboravljeni" - "novi" i nekadašnji otoci. U timskom radu autora iz Hidrografskog instituta Republike Hrvatske u Splitu (2000.) navodi se, na temelju topografskih karata u razmjeru 1:25000, da unutar granica Hrvatske postoje 79 otoka, 526 otočića i 641 grebena i hridi; ukupno 1246 otoka.Prof. Stražičić upozorio je kritič ki i dokumentirano na manjkavost dosadašnjih rezultata i naglasio da je ukupan broj hrvatskih otoka i dalje otvoren. U zaklju čnim razmišljanjima dao je niz svrhovitih prijedloga. Ponajprije predlaže, uz potporu državnih službi, imenovanje interdisciplinarne ekipe (od geografa, hidrogeologa, oceanografa, kartografa, lingvista i drugih specijalnosti) koja bi odredila kriterije za kategorizaciju pojedinih otoka, prema veličini i nazivu, te za određivanje kategorija naseljenosti. Nadalje, kako nazvati najmanji oblik stalno nad razinom mora "greben" ili "hrid", o tome posavjetovati se s lingvistima, ali i sa stanovništvom dotičnog otoka. Problem se javlja i kod napučenosti otoka, primjerice "stalno naseljen", da li prema domaćem (autohtonom) ili doseljenom stanovništvu, kako razlikovati pojmove "sezonski naseljen" i "povremeno naseljen"...Na kraju, uz pomoć lučkih kapetanija njihovim plovilima potrebno je obići i snimiti sve otoke unutar granica Hrvatske, istodobno provjeriti stanje na topografskim i posebice pomorskim kartama i planovima. Prof. Stražičić je otočanin, rođen na Mljetu, a čitav radni vijek proveo je u Rijeci. Najveći dio svoga života posvetio je istraživanju mora u najširem smislu, posebice Jadrana i nadasve naših hrvatskih otoka. Godine 1968. izradio je magistarsku tezu Otok Mljet – primjer izoliranog otoka. Deset godina kasnije (1978.) obranio je disertaciju Otok Cres – prilog poznavanju geografije naših otoka. Za sveukupan životni opus godine 1998. Senat Sveuč ilišta u Rijeci dodijelio mu je počasno zvanje "profesor emeritus". prof. Stražičić prvi je geograf u Hrvatskoj koji je dobio to visoko priznanje. U reprezentativnoj Hrvatskoj reviji s novim glavnim urednikom, ambicioznim magistrom Mladenom Klemenčić em, izašao mu je i najnoviji rad Svi hrvatski otoci ilustriran s 27 jedinstvenih panoramskih snimaka u boji. Članak Svi hrvatski otoci sinteza je dugogodišnjih minucioznih istraživanja u kojima je prof. Stražičić, na sebi svojstven na čin, prenio jezgrovito, veliko i bogato iskustvo, istodobno i poruka, kako bi trebalo nastaviti s interdisciplinarnim istraživanjima tih dragulja na pročelju Hrvatske i u trećem mileniju.Josip Riđanović Tihomir KOVAČEVIĆ Tihi: Baraćeve špilje, Turistička zajednica općine Rakovica, Rakovica, 2003., 48 str. Baraćevim špiljama pripada počasno mjesto u povijesti istraživanja hrvatskog krša i speleologiji. Davne godine 1892. u Rakovici je osnovan "Odbor za istraživanje i uređenje Baraćevih špilja", prva takva udruga na tlu Hrvatske i u ovom dijelu svijeta. Od prvih podataka objavljenih u literaturi 1874. do danas špilje su više puta bile predmetom speleoloških, hidrogeoloških, paleonotoloških, arheoloških i biospeleoloških istraživanja. Na temelju njihovih rezultata i rezultata najnovijih istraživanja nastala je i ova knjiga u kojoj nam autor otkriva njezine ljepote i tajne.Knjigu čini 8 poglavlja. Zanimljiv tekst bogato je ilustriran sa 65 fotografija, crteža i nacrta špilja. Opisan je položaj špilja, osnovni podatci o geološkim značajkama terena, nazivlje i podatci o dimenzijama različitih istraživača. Slijedi poglavlje o povijesti istraživanja s nizom zanimljivih podataka – od prvih opisa do suvremenih istraživanja. Opći dio zaokružen je poglavljem o paleontološkim i arheološkim istraživanjima. Dosad su nađeni ostatci pleistocenske faune i tragovi boravka ljudi iz srednjeg vijeka i razdoblja turskih ratova. 163 PRIKAZI - REVIEWS Geoadria, vol. 8/1, 161-166, 2003. U drugom dijelu knjige detaljno su opisane značajke Donje, Gornje i Nove Baraćeve špilje. Opisan im je položaj, a u iznošenju značajki autor se poslužio citatima Dragutina Hirca i Ivana Krajača s početka 20. stoljeć a. Navedeni su i najnoviji rezultati istraživanja prema kojima je Donja Baraćeva špilja dugačka 565 metara, Gornja 520 metara, a Nova 94,5 metara. Poglavlje o biospeleologiji napisao je dipl. ing. Roman Ozimec. Objavio je dosad poznate podatke o povijesti biospeleoloških istraživanja, podatke o ekološkim uvjetima, pregled i analizu špiljske faune te istaknuo važnost nastavka istraživanja i zaštite. Poglavlje je opremljeno odličnim fotografijama te tablicama s kronologijom biospeleoloških istraživanja, preliminarnim taksonomskim popisom kavernikolnih vrsta i biospeleološkom bibliografijom špilja. Završno poglavlje posvećeno je rezultatima Međunarodne speleološke ekspedicije "Rakovica 2002.". Na samom početku ekspedicije otvoren je Prvi speleološki dom Republike Hrvatske u Novoj Kršlji. Tijekom ekspedicije istraživani su sustav Panjkov ponor - Varićakova špilja, vrelo Sinjac i Kusa i dr. Na kraju knjige objavljena je speleološka bibliografija koja dodatno pridonosi vrijednosti ove knjige. Nenad Buzjak Milenko M. PASINOVIĆ: Područ je Kotora na listi svjetske i prirodne baštine UNESCO. "Cicero" – Cetinje, kompjutorska priprema "Tricen", Kotor, 2001., 110 str. Autor je rođeni Bokelj, redoviti sveučilišni profesor na Fakultetu za turizam i hoteljerstvo u Kotoru. Knjižica je praktičnog formata (23x15 cm), otisnuta je na kvalitetnom papiru. Opremljena je s 14 reprezentativnih fotosa u boji i 7 crno-bijelih slika i crteža. Upotrijebljeno je 20 bibliografskih jedinica literature i 4 izvora podataka uključujući i vlastita istraživanja. Kratak izvadak dat je na engleskom, talijanskom, francuskom i njemačkom jeziku.Poslije predgovora slijede u tekstu: Boka kotorska (prikaz granica, prostorni pojam i pregled glavnih dijelova, Morfogenetske i morfološke karakteristike, Kotorsko-Risanski zaliv – embrion Boke kotorske, Područje Kotora na listi svjetske prirodne baštine UNESCO, Simbioza prirode i čovjeka stara pet milenijuma i Dvije decenije nakon zemljotresa.Bokokotorski zaljevi duboko su oko 30 km (29,6) uvučeni na sjeveru između Orjena (1893 m), najviše obalne planine u istočnoj regiji Jadrana, Katunskog krša (1308 m, 1228 m i 1212 m) na istoku i Lovćenu (Štirovnik, 1749 m) na jugu. Impozantan okvir krševitih planina s izrazitim strmcima zatvara plitko more (površine 87,3 km2 i dubine do 60 m), u stvarnosti čudesan i jedinstven sklop Bokokotorskih zaljeva. Boka kotorska je horizontalno najrazvedeniji kraj (105,7 km duljina obale) i vertikalno najraščlanjeniji dio u najvišoj reljefnoj strukturi Jadranskog primorja. Geografski položaj Boke je specifičan. Na njezinu prostoru dodiruje se prirodno visoki i najljući krš izravno s najdubljim dijelom morske pučine Jadrana. Društveno, povijesno i gospodarski u Boki se isprepliću utjecaji milenijskog stvaralaštva Mediterana, posebice u gradskoj arhitekturi, s tradicionalnim i suvremenim kulturama Istoka. Boka kotorska je izraziti primjer jedinstva suprotnosti. Pri određ ivanju prostornog pojma Boke logič ki je kriterij "slijevno područ je" tj. prostor odakle voda teče prema zaljevima odnosno prema moru. "Slijevno područje" odre đuje se razvodnicom. U vododrživim stijenama to je površinska ili topografska razvodnica, koja se povlači najvišim vrhovima na terenu. U karbonatnim stijenama na kojima je razvijen krški reljef, što se pretežno odnosi na prostor Boke kotorske, mjerodavna je dubinska ili hidrogeološka razvodnica. Preuzeti brojčani podatci o veličini slijevnog područja na osnovi površinske (topografske) razvodnice za Boku kotorsku ne odgovaraju stvarnosti. O postanku Boke kotorske Pasinović iznosi kritički i potanko gledanja ranijih autora. Znakovito, me đutim, ističe sadašnji izgled zaljeva, koji je relativno mlad i posljedica je izdizanja razine mora u holocensko doba. Navodi činjenice da je prije 25 tisuća godina razina Jadrana bila niža za 96,4 m od sadašnjeg. Boka je tada bila kopno. Na Orjenu i Lovčenu snježna granica spuštala 164 PRIKAZI - REVIEWS Geoadria, vol. 8/1, 161-166, 2003. se do visine 600 m odnosno 900 m. Dno Boke kotorske u to vrijeme karakterizirala su izolirana udubljenja prekrivena rastresitim materijalom. Dokazano je da je prije 10 tisuća godina razina Jadranskog mora bila niža za 31 m od današnjega. Tada se već počeo nazirati složeni izgled današnjih zaljeva Boke kotorske. Batimetrijska istraživanja u najnovijem razdoblju potvrđuju postojanje izdvojenih krških udubljenja na morskom dnu, posebice na lokalitetu Verige, gdje je maksimalna dubina od 45 m veća za 4 m i u kumburskom suženju od 50 m veća, najveća dubina 5 m od okolnog dna mora.U najvećem dijelu zaljeva žalo je ograničeno na uski pojas ili ga uopć e nema (Risan – Perast i Orahovac). Na tom potezu obalni strmci spuštaju se izravno ispod mora do njegova dna. Prosje čna dubina mora u Boki je 27,6 m. Srednje dubine u pojedinim zaljevima iznose u Kotorskom 27 m, Risanskom 25,7 m, Tivatskom 25,5 m i Toplanskom 31 m. Opća značajka batometrije svih zaljeva Boke kotorske je da su male dubine. Posebna je zanimljivost horizontalne razvedenosti Boke kotorske 7 otoka. To su u Kotorskom zaljevu ispred Perasta Sveti Đorđe (Juraj) i umjetni otok Gospa od Škrpjela. U Tivatskom zaljevu: Stradioti (Sveti Marko), otok Gospe od Milosrđa i Prevlaka (otok cvijeća). U Toplanskom zaljevu su otok Lastvica (Mamula) i otok Mala Gospa (Gospa od Žanjice).Boka sa svojim zaleđem prima najveć e količ ine padalina u Europi. Crkvice, mjerna stanica u Malovom dolu na 1050 m nadmorske visine u Krivošijama na Orjenu, zabilježila je količinu od 5317 mm i to tijekom mokrog dijela godine! Boka je najvećim dijelom u stijenama karbonatnog sastava, koje dosežu dubinu i do 5 km! Na toj podlozi razvijen je najizrazitiji krški reljef, kako na površini, tako još više u podzemlju, odnosno u podmorju. Tu je najveće izvorište vode istodobno i najsušniji kraj u istočnoj regiji Jadrana. Prema podatcima skupa stručnjaka za opskrbu vodom 1986. godine u Risnu s navedenog prostora u sušnim mjesecima godine svake sekunde dotječe u more oko 1000 litara vode od koje se tek 220 litara (22%) iskoristi za pitku vodu! Zaključeno je, da Boka spada u "najžednije" krajeve u Europi! Hidrografske karakteristike Boke kotorske u skladu su s prevladavajućim litološkim značajkama karbonatnih stijena, geološkom građom i hidrogeološkom funkcijom terena. Od hidro-pojava najviše su rašireni izvori, vrulje, povremene tekućice i jedna katavotra (Gurdić). Katavotra je specifični izvor, zapravo otvor kroz koji poslije dugotrajnih kiša izbija na površinu slatka voda, a u doba hidrološkog minimuma tim istim otvorom voda ponire u dublje dijelove podmorja. Ukratko su opisani i predočeni izvori Ljute u Dobroti, Sopota i Spile kod Risna, Morinjske rijeke, koja odvodnjava zapadne i jugozapadne strane Orjena, te Gurdić i Škurda kod Kotora. Škurda je svojevrsna hidrografska specifičnost Boke kotorske. To je krška rječica. Izvori su joj na Lovćenu, a odvodnjava Njeguško polje. Škurda je usjekla korito kanjonskog tipa u masivnim i dobro uslojenim vapnencima lovćenskog strmca. Vodostaj Škurde ovisan je od količine i duljine trajanja kiše. Bez obzira na godišnje doba, poslije izdašnijih kiša teče Škurda čitavom duljinom toka kao bujica. Na ušću je nataložila obilje šljunčanih nanosa u obliku manje delte zvane Benovo. U blizini mora Škurda se račva u dva rukava. Jednim rukavom otječe sjevernom stranom gradskih zidina. To je kotorska Škurda, obično stalan tok, jer ga napajaju izvori iz vlastitog korita. Drugim rukavom teče dobrotska Škurda jedino poslije dužih kiša. S izvora Škurde opskrbljuje se ponajprije i ponajviše gradski vodovod u Kotoru. Poslije potresa 1979. pokušalo se ugradnjom betonske zavjese izolirati utjecaj mora. U ljetnim mjesecima ponovno je zaslanila voda. Škurda je tipična krška tekućica podložna naglim i znatnim promjenama. U zadnje vrijeme znalo se dogoditi da na njezinom izvorištu potpuno nestane vode čak u trajanju jednoga dana! Boka kotorska svojim smještajem je u geotektonski vrlo labilnom kraju, štoviše, u pojasu razornih potresa. Značajniji potresi u južnom Jadranu jezgrovito su opisani. O katastrofalnom potresu 15. travnja 1979. dat je iscrpan prikaz. U općini Kotor na spomenicima kulture procijenjena je golema šteta u visini od 18.658,930 USA dolara!Područje Kotora na listi prirodne i kulturne baštine UNESCO najopsežniji i najzanimljiviji je dio sveukupnog teksta. Autor nas potanko i dokumentirano upoznaje s brojnim postupcima koji su prethodili upisu Kotora na listu svjetske prirodne i kulturne baštine UNESCO. 165 PRIKAZI - REVIEWS Geoadria, vol. 8/1, 161-166, 2003. Odluka je usvojena na Skupštini op ćine Kotor, 14. lipnja 1979. i glasi: "Ovom odlukom kao prirodno, kulturno i istorijsko dobro od posebnog zna čenja, proglašava se Kotor s područjem: Dobrote, Orahovca, Perasta, Risna, Morinja, Kostanjice, Stoliva, Prčanja, Mula, Škaljara i morskog bazena ovog područja, koje obuhvaća 12000 ha kopna i 2600 ha mora." Katastrofalni potres 15. travnja 1979. pospješio je prijam Kotora za upis u svjetsku prirodnu i kulturnu baštinu UNESCO, štoviše i za kulturnu baštinu u opasnosti. Prijedlog je prihvaćen na sjednici Međunarodnog komiteta od 22. do 26. listopada 1979. u Kairu i Luksoru. Također, u Berlinu 10. ožujka 1997. Boka kotorska uvrštena je među 28 najljepših zaljeva na svijetu. Prema podatcima Regionalnog zavoda za zaštitu spomenika kulture u općini Kotor izvršena je kategorizacija od prvog do trećeg stupnja za 104 spomenika kulture. Zanimljivo je da je 12 spomenika uvršteno u prvu, najvišu kategoriju spomeničkog blaga. Simbioza prirode i čovjeka u Boki kotorskoj stara je pet milenija. Prvi tragovi ljudskog postojanja, oko 3000 godina prije Krista, iz mlađeg kamenog doba, otkriveni su na lokalitetu Spila, 300 m nad morem, sjeveroistočno od Perasta.Na obali Risanskog zaljeva, točnije u mjestu Lipci, pronađeni su na svodu otisci između kojih se posebno ističe brod na jedra. To potvrđuje rani početak pomorstva u Boki kotorskoj. Najstariji ostatci likovnog izražavanja tadašnjih stanovnika datirani su u rano brončano doba.Prof. Pasinović je geograf društveno-gospodarskog usmjerenja s posebnim interesom za pomorstvo i turizam. Poslije obranjene disertacije "Pomorstvo i turizam s posebnim osvrtom na crnogorsko primorje" (1977.) i nakon objavljivanja reprezentativnog vodiča: Kotor – vjekovi sačuvani za budućnost" (1988.) poklonio je javnosti i najnovije djelo "Područje Kotora na listi svjetske prirodne i kulturne baštine UNESCO". Prof. Pasinović je jedan od osnivača Fakulteta za turizam i hotelijerstvo u Kotoru i najzaslužniji je što je ta visokoškolska, sveučilišna institucija ostala u Kotoru. Svojim je radom i organizacijskim sposobnostima znač ajno pridonio da se Kotor upiše u listu svjetske prirodne i kulturne baštine UNESCO. Sada se zalaže da se to priznanje mjerodavnih stručnjaka zapamti i blago sačuva za mlađi naraštaj. Čestitamo profesoru Pasinoviću i želimo mu puno daljnjih uspjeha. Josip Riđanović 166

La siguiente investigación tiene como finalidad analizar las publicaciones antológicas de los últimos dieciséis años en la literatura peruana respecto a la creación de microrrelatos/minificción, género que al parecer ha comenzado a cultivarse en las últimas décadas. Sin embargo, en las diversas publicaciones que se analizarán, la inclusión de ciertos escritos fechados a mitad e inicios del siglo XX, y anteriores a este, pretenden ir en contra de lo mencionado y conocido por la crítica. Es por este motivo que, en la revisión de las antologías existentes, se evaluarán los criterios utilizados por los autores para la reunión de los escritos y el catalogado de estos como microrrelatos/minificción, al mismo tiempo que se trazarán las diferencias en los parámetros utilizados para la selección de los textos entre cada antología, mostrando progreso o evolución en el entendimiento del género del microrrelato y abriendo el panorama para un estudio más profundo del fenómeno. Palabras clave: microrrelato, género literario, antología, literatura peruana, crítica, canon Summary: The following research aims to analyze the anthological publications of the last sixteen years in Peruvian literature regarding the creation of micro-stories/minifiction, a genre that apparently has begun to be cultivated in recent decades. However, in the various publications that will be analyzed, the inclusion of certain writings dated to the middle and beginning of the twentieth century, and prior to this, intend to go against what is mentioned and known by critics. It is for this reason that, in the review of the existing anthologies, the criteria used by the authors for the collection of the writings and the cataloguing of these as micro-stories / minifiction will be evaluated, at the same time that the differences in the parameters used for the selection of the texts between each anthology will be traced, showing progress or evolution in the understanding of the genre of the micro-story and opening the panorama for a deeper study. of the phenomenon. Keywords: microfiction, literary genre, anthology, Peruvian literature, criticism, canon. Introducción La narrativa peruana desde sus orígenes ha trabajado diversos tipos de escrituras y géneros que aparecieron, trascendieron y, de la misma manera, desaparecieron de las letras peruanas. Cabe mencionar que, desde inicios y mediados del siglo pasado, diversos autores empezaron a desarrollar con mucha más habitualidad en su escritura los géneros que gozan de mucha tradición y desarrollo en el extranjero y que, por distintos factores (principalmente económicos, sociales y por qué no, personales) en nuestro suelo no tienen la relevancia y el aprecio que deberían. Estos géneros, considerados menores, pueden fácilmente reconocerse en nuestro medio escritural y se relacionan con la ciencia ficción, lo policial, lo fantástico y, para motivos de nuestra investigación, la particularidad del microrrelato. Contrariamente a las intuiciones iniciales que condujeron a la presente investigación hacia el desarrollo y análisis de los casos que se propondrán, este género (todavía en interminables sustentos de validación y teorización) goza, cada vez más, con una carga apreciativa que proviene desde los comentarios de la crítica y la alta recepción de los lectores, quienes prefieren y optan por narrativas más breves, concisas y directas. El ejercicio que pretende realizar este artículo recae no en la evaluación sistemática y problemática del mencionado género, por el contrario, pretende incidir en cuestiones mucho más prácticas y con resultados más tangibles: evaluar las diversas publicaciones antológicas comprendidas entre el año 2006 y 2021 que aglomeran, agrupan o clasifican microrrelatos, bajo ciertas condiciones temáticas, fines de exposición, o con la clara intención de formar una tradición mucho más estructurada y que fundamente y valide la presencia y extensión del mencionado género dentro de la literatura peruana. Entender la aparición constante de diversos autores en distintas publicaciones antológicas señala ya la formación de un canon, autores vinculados precisamente a la naturaleza del género, el cual se manifiesta en la escritura y preocupaciones literarias de los escritores para el desarrollo del género. Antes de empezar con la revisión de los textos antológicos, es necesario señalar algunos problemas iniciales que, resueltos, darán mayor precisión a lo que se pretende lograr en este breve artículo: a) la fundamentación teórica del microrrelato como un género propio de la narrativa, b) la divergencia nominal respecto a la categorización de la ficción breve: el heterogéneo uso de los términos microrrelato, minificción, minicuento, microcuento, nanocuento, etc., c) el corpus de la investigación: los textos antológicos escogidos y los apartados del análisis y, por último, d) la evolución del paradigma antológico: criterios y fundamentos para la creación de la antología. Teniendo las rutas claras a recorrer, la investigación cobrará forma en tanto se vayan solucionando las incógnitas planteadas líneas arriba y, con ello, el perfilamiento del carácter evolutivo y crítico que va adquiriendo la recuperación de textos de carácter breve. Estatuto genérico del Microrrelato Debemos señalar, en primera instancia, el carácter marginal que tiene el microrrelato en suelo peruano: son escasas las publicaciones teóricas que acerquen al mencionado género hacia la validación teórica y creativa que goza en los demás países de la región y que comparten conexión lingüística con nosotros, sea el caso de Argentina (país donde ampliamente el microrrelato ha tenido acogida), México (país que posee, en la actualidad, la mayor proliferación de microrrelatos en América Latina) y, finalmente, España (nación en la que desde antes del siglo XIX ya existían preocupaciones por el mencionado género). Teniendo esto en cuenta, son contados los especialistas que ofrecen espacio al análisis del microrrelato en las letras peruanas, siendo algunos de ellos: Rony Vásquez, Carlos López Degregori, Richard Leonardo-Loayza, Jorge Ramos Cabezas, Giovanna Minardi y Óscar Gallegos (sobre este último volveremos en la brevedad). Caso singular es el de Harry Belevan (1996), uno de los primeros escritores que muestran una preocupación sólida respecto al estudio y recopilación de lo que él denomina “ficción breve”. Desde esta premisa, Belevan comienza a desglosar las características más importantes de esta nueva y, para su tiempo, atípica narrativa que surgía en suelo peruano. Belevan menciona que el punto de inflexión para el género mencionado, es la aparición de un texto singular en las letras castellanas: el texto de Augusto Monterroso, cuyo título poseía una particular descripción: Obras completas y otros cuentos. Belevan indica que, el cuento destacado de este libro, “El dinosaurio” es el que apertura el pensamiento crítico en los expertos en narrativa, quienes al principio caracterizaban al escrito de una “graciosa pirueta literaria de quien, por fortuna, tiene algo más en qué sustentar la fama de excelente narrador de la que merecidamente goza este autor mexicano-guatemalteco” (p. 96), para luego mencionar que esta lectura del cuento fue cambiando en tanto se fue comparando su contenido, con las características más básicas que posee una narración: con las del cuento. El resultado de este análisis es revelador ya que el texto posee todas las cualidades que se puede brindar a una narración de corte ficcional: personajes, argumento o trama, conflicto y un desenlace. El investigador es preciso con su postura: no considera al microrrelato como un género independiente, sino como una extensión o forma en la que verbalmente se recrea una narración, y en el caso del mencionado, de la nouvelle. Belevan toma a Epple para aclarar mejor su posición respecto a lo que entiende por microrrelato: En todo caso, el criterio fundamental para reconocerlos como relatos no es su brevedad sino su estatuto ficticio, atendiendo específicamente al estrato del mundo narrado... y el minicuento parece ser, a la postre, un concentrado ejercicio destinado a poner en tensión nuestras convicciones y hábitos de lectura (pp. 18-19). (p. 98) Para Belevan, la condición genérica del microrrelato no se encuentra en la extensión que posee este, sino en la cualidad ficcional que pueda o no tener en su contenido, por ello precisa con mucha argucia en las características que no precisan en las condiciones de amplitud. Para el crítico, entonces, el criterio de la amplitud es pasado por alto ya que únicamente entiende que el texto debe estar conformado con pocas palabras. No decide tomar posición respecto a la cualidad cuantitativa del microrrelato, sino en el estatuto de ficción que estos poseen o no. Sin embargo, si queremos definir la cualidad del microrrelato o escritos de la ficción breve, debemos remitirnos a los escritos de David Lagmanovich, crítico argentino dedicado al estudio del género dentro de Latinoamérica de manera asidua y prolífica. Lagmanovich (2001) señala con precisión algunas de las características que serán tomadas por la mayoría de la crítica especializada para determinar si un texto breve es o no ficcional y resulta adecuado nombrarlo microrrelato. El crítico argentino decide partir desde una premisa interesante: “¿por qué escribimos y por qué leemos microrrelatos?” (p. 88). Las primeras respuestas gaseosas de Lagmanovich parecen indicar las cualidades del género: la brevedad (concisión), ya que esto supone un lector no tan exigente y que busca un producto de fácil acceso económico e intelectual, la cualidad fantástica que posee el texto, al presentar mundos que no existen y que “tuercen el orden natural de las cosas” y la misma sensación del escritor cuando produce un microrrelato. Esta conciencia que posee el escritor interviene de manera significativa en la creación del microrrelato, ¿el motivo? Es el lector quien llena , en gran parte, de sentido al texto construido por el escritor de microrrelatos (pp. 90-91). Estas cualidades de interacción y extensión son válidas para el crítico argentino, quien no ve al microrrelato como una simple modalidad narrativa, sino como un género sólido en el que se ejecutan procesos de significación y representación distintos a los de la novela y el cuento, no componiéndose como una mera expresión de alguno de estos. Raúl Brasca (2000) concuerda con Lagmanovich en el sentido práctico de la definición genérica: “es una forma muy breve que posee suficiencia narrativa y cuyas principales características son la concisión y la intensidad expresiva” (p. 3). Brasca pasa a indicar con mayor precisión las cualidades mencionadas y que considera reiterativas, en los textos que son considerados microrrelatos (microcuentos, para él); respecto a la suficiencia narrativa, el investigador precisa en un aspecto importante y único del microrrelato: Llamo suficiencia narrativa a la autonomía de lo narrado, a la independencia del microcuento respecto de todo dato externo a él como no sean referencias culturales comunes al universo de lectores al que va dirigido. Esto vale incluso para los cuentos brevísimos recortados de textos mayores, en los que el recorte mismo y el título que, en general, se le provee resignifican el texto. (p. 3) Brasca señala con autonomía, la particular capacidad de significación que posee para sí mismo y del que se puede hablar, únicamente cuando no se utilizan referentes de la cultura. Entendamos que existen microrrelatos que, en base a la intertextualidad, toman referentes culturales y literarios de otras partes del mundo, pero esto sigue sin afectar la solidez que posee el microrrelato con la cualidad interactiva que propone el teórico. La autonomía del microrrelato recae en la capacidad única que tiene el texto, debido a su poca extensión, de situar en un único contexto a la obra, lo demás se llena con la interacción del lector y la capacidad del lector para completar esos vacíos que intencionalmente se han creado y que ya señalaba Lagmanovich. Añadido a esto, Brasca indica la condición de brevedad muy vinculada al microrrelato, pero esta no se encuentra ligada a la amplitud del texto, sino también al despliegue de los enunciados que conforman a esta misma: Concisión reúne los conceptos de brevedad y precisión. La intensidad expresiva está ligada a la concisión (en el sentido de que aquello que se encuentra más concentrado es también más potente) y depende mucho de la estrategia que sigue el narrador para lograr eficacia. (p. 4) Sin embargo, quien reúne con mayor eficacia y sistematiza al microrrelato desde hombros de gigantes es Óscar Gallegos, quien en su amplia tesis dedicada al estudio del microrrelato en el Perú señala con mucha exactitud las características que constantemente dan vida a lo que podría considerarse como microrrelato. Será el mismo Gallegos quien, en la segunda sección de esta investigación, brinde claridad respecto a la cuestión nominal que aqueja la categorización de los escritos breves. El investigador sanmarquino propone un listado de cualidades que debe poseer el microrrelato para ser considerado como tal, la primera, es quizá la más importante: a) hiperbrevedad: destaca aquí la condición más llamativa y por la cual se conoce al microrrelato, añadido a esto se propone descubrir los límites de lo breve, para lo cual establece criterios cuantitativos (mediados por la cantidad de palabras que posee el texto) y aspectos cualitativos (mediados por el criterio singular de lo que se considera breve al momento de crear). Reconoce entonces que los cuentos son y poseen brevedad, y marca, entonces, la diferencia abismal que existe con el microrrelato: este es mucho más breve. Así, plantea una solución eclética para el problema inicial: acepta que la brevedad es subjetiva, pero no se encuentra ajeno al recuento de palabras del microrrelato, por ello establece una marca de 300 palabras como máximo para estos escritos (pp. 27-31); b) narratividad virtual: como el elemento que otorga la capacidad comunicativa del texto hacia los lectores y que posee, dentro de sí, la intención de interacción y, en donde se pasan por alto distintos momentos en los que la narración se compone y ejecuta y que sirven al lector para completar el sentido de significación que puede dejar el microrrelato (pp. 34- 36); por último, c)ficcionalidad: como la cualidad de entender que lo que se encuentra ante nosotros carece de estatuto de verdad, que operativiza las narraciones literarias y se promulga como una de las características esenciales de un texto literario (pp. 41-43). Luego de mencionar lo anterior, Gallegos incide en la problematización del concepto de género en la modernidad y, con ello, pretender introducir al microrrelato dentro la categoría de género literario. El crítico peruano indica que el microrrelato es un género en tanto respeta y comulga con las consideraciones fundamentales de los géneros literarios: la naturaleza estética, lo pragmático (visión semiótica que entiende al texto como un horizonte en el que colisionan las expectativas del lector, con lo que ofrece el texto, desencadenando una significación única) y el proceso de recepción de la obra (cuya trascendencia va creciendo con el paso de los años) (p. 61). Dicho esto, Gallegos fundamenta metódicamente la cuestión inicial respecto al microrrelato y con ello, la necesidad de incidir en el siguiente aspecto. Las distintas denominaciones para la ficción breve Es también Gallegos quien da luces respecto a la terminología que se usa respecto a la ficción breve. En el apartado dedicado a la cuestión nominal, el crítico peruano dice lo siguiente: “Microrrelato, minificción, minicuento, microcuento, historia mínima, ficción súbita, ficción relámpago, cuento ultracorto, hiperbreve, textículo…De todas las formas literarias, la ficción brevísima es, sin duda, la que ha recibido más etiquetas que ninguna.” (p. 15). El problema, en los ojos de Gallegos es sumamente serio y ante ello, se dedica extensamente a rebuscar e identificar la proveniencia original de cada término y su funcionalidad. Dicho esfuerzo lo lleva a organizar a los mencionados término de dos maneras: Para dar un orden al bosque de significantes de la ficción brevísima, vamos a categorizar las dos perspectivas más relevantes que se han adoptado hasta el momento: las literarias y las extraliterarias. En la primera hemos dividido tres formas de acercamiento: 1) los nombres que se relacionan con el par brevedad-ficcionalidad, 2) aquellos que se mueven entre: extensión-genealogía con el cuento y 3) los que nacen como una invención espontánea o libre. Los dos primeros están más cerca de una aproximación crítico-teórica y, el último (sin desmerecerlo), al mundo de la metáfora o el arte. En cuanto a la perspectiva extraliteraria, encontramos también tres formas de abordaje: 1) las científicas, 2) las connotaciones peyorativas y 3) su relación con el ciberespacio. (pp. 18-19) Los pertenecientes al primer grupo (las denominaciones literarias) se dividen bajo los aspectos de “Breve-ficcionalidad”[1], “Extensión con el cuento”[2] e “Invención libre”[3] y, para las del segundo grupo (las denominaciones extraliterarias) ofrece los siguientes grupos: “Científicas”[4], “Connotación peyorativa”[5] y “Relación con el ciberespacio”[6]. Las disertaciones principales respecto al aspecto nominal que caracteriza a la ficción breve, recaen en los subgrupos de corte literario ligados a la extensión y a la brevedad. Gallegos señala que la preferencia de un término sobre otro es puramente contextual y de acuerdo a lo que utiliza desde antes la tradición crítica (pp. 18-19). En el caso peruano, predominan los términos minificción, gracias a los primerizos intentos de exploración y exposición del microrrelato en el país en revistas como Plesiosaurio y las primeras publicaciones antológicas del mencionado Género. Gallegos explica la condición especial del microrrelato desde el siguiente raciocinio: los textos que suelen revisarse son concretamente pequeños textos en sí, de ello se desprende el término microtexto, considerando que el término “mini” no señala con exactitud esta noción de subjetiva brevedad que posee la ficción breve. Teniendo al microtexto para señalar las creaciones verbales y textuales que son brevísimas, se propone clasificarlos de manera simple bajo criterios ficcionales (teniendo en cuenta que, lo que caracteriza a la ficción breve es la, valga la redundancia, la brevedad y la ficcionalidad): microtextos ficcionales[7] y microtextos no ficcionales[8] (pp. 23-25). Aquí valdrán las injerencias de Irene Andrés-Suárez (1995), quien menciona la naturaleza poligenérica de la ficción breve; indica Andrés-Suárez que no existe una distinción clara entre algunos de los términos que Gallegos clasificó bajo el rótulo de microtextos ficcionales, y se pregunta: “son el microrrelato, el minirrelato, el microcuento, el minicuento, la microficción y la minificción significantes distintos para designar un mismo significado o poseen una naturaleza diferente” (p. 24) La solución es práctica y Gallegos coincide con la crítica española: los primeros términos son indistintamente iguales, lo cual no hace posible una separación clara entre una y otra. Entonces para evitar “confusiones sería preferible optar por el más extendido en el ámbito hispánico, es decir: microrrelato” (p. 29) Añadido a esto Andrés-Suárez despotrica contra la imprecisión del término minificción y su variente, microficción por ser imprecisa al englobar prácticas ficcionales breves que engloba también a la poesía (pp. 30-31). Gallegos se apoya en Andrés-Suárez para la injerencia del término microrrelato en la narrativa peruana y con ello, indicar su preferencia respecto a las demás nominaciones que posee la ficción breve. Se debe entender que se encuentra conveniente utilizar la categoría sugerida por Gallegos y propuesta por Andrés-Suárez para unanimizar el análisis de las antologías que se presentarán a continuación. Cabe mencionar que dichas antologías no utilizan de manera homogénea el término microrrelato para realizar la selección de textos que conformarán su publicación, esto indicaría una concepción que podría o no estar cercana a lo propuesto en este artículo, señalar una elección indistinta y poco rigurosa o, en otros casos, sustentar con extensión, la pertinencia de un término sobre otro. Ninguna antología se ha escogido o rechazado por coincidir teóricamente con los planteamientos de esta investigación. Las antologías de microrrelatos peruanos (2006-2021) De manera inicial, debemos precisar que existen alrededor de 30 publicaciones antológicas de microrrelato en el país; sin embargo, su producción no está, necesariamente, conectada con el proceso de antologar microrrelatos netamente peruanos. Este es, entonces, el primer criterio de selección para los textos de nuestro análisis: antologías que contengan en sus haberes únicamente microrrelatos peruanos. Por este motivo se descarta la primera publicación respecto al microrrelato organizado en una antología en el Perú: Antología del cuento breve (2003) de Gerardo Temoche ya que, dentro de sus páginas encontramos textos de Monterroso, Borges y, de manera posterior, la inclusión de peruanos como Cronwell Jara Jiménez, Antonio Gálvez Ronceros, Luis Loayza, Mario Paredes, Juan Rivera Saavedra, Andrés Zevallos, Hilda Cherres Córdova y, el mismo antólogo, Gerardo Temoche. Así mismo se descartan las siguientes antologías: Colección minúsucula. Cinco espacios para la ficción breve (2007), de Ricardo Sumalavia; 201. Antología de microrrelatos. Lado A (2013) y 201. Antología de microrrelatos. Lado B (2014), realizados por David Roas y José Donayre, etc. Debemos añadir que, se optó por manejar antologías de microrrelatos peruanos sin ninguna precisión temática, asumiendo el riesgo de excluir del análisis las preocupaciones que se manifiestan en cada uno de los siguientes microrrelatos y la necesidad de los distintos autores de escribir siguiendo una sola unidad. Se incidió en trabajar con antologías lo más generales posibles, en son de revelar la manera en la que se forma el canon debido a la aparición de estas mismas antologías. Dicho esto, no se incluyeron en el análisis: 69 Antología de microrrelatos eróticos I (2016) y 69 Antología de microrrelatos eróticos II (2016), de Carolina Cisneros; Bibliotecuento. Antología de microrrelatos (2018), realizado por Liliana Polo y Jaime Vargas Luna; Cuenta Lima al mundial. Historias de fútbol (2018) de la Municipalidad de Lima; Desnudos del tabú. 102 minicuentos eróticos (2019), etc. Asimismo, se dejan fuera las antologías que si bien no presentan una temática definida respecto a la escritura de los textos, se emparentan por poseer vínculos regionales o por pertenecer a un grupo específico de individuos: Pocas pulgas. Imagen de la microficción ancashina (2010), de Ricardo Ayllón; En pocas palabras. Antología del microcuento cajamarquino (2013), de Rony Vásquez; Nidal de colibríes. Minificción en la Región de Cajamarca (2014) y Fe de erratas. Corrupción en la minificción de Cajamarca (2017), de José López Coronado; Cincuenta microrrelatos de la Generación del 50 (2014), de Óscar Gallegos y En el laberinto. Muestra de microrrelatos escolares (2017), de Paolo Astorga.[9] Finalmente, los textos escogidos serán: Breves, brevísimos. Antología de la minificción peruana (2006), de Giovanna Minardi Circo de pulgas. Minificción peruana (2012), de Rony Vásquez Toque corto. Antología de Microcuentos (2015), de Julio Benavides Diez por diez. Antología de microrrelatos peruanos (2016), de Miguel Ángel Vallejo Extrañas criaturas. Antología del microrrelato peruano moderno (2019), de José Güich Rodríguez, Carlos López Degregori y Alejandro Susti El microrrelato peruano. Antología general (2021), de Ricardo González Vigil. Las antologías como maneras de crear tradición Giovanna Minardi, realizó la que consideramos, la primera antología del microrrelato peruano en nuestro país, esto luego de publicar un año antes una, también, antología de microrrelatos a nivel latinoamericano[10]. Es en el trabajo de búsqueda de microrrelatos de escritores peruanos para la inclusión de estos en sus libros, en los que Minardi entiende que hay una falta severa en el estado del género en el país. Este no se ha trabajado para nada, y lo confiesa tajantemente: “Escribe Harry Belevan el único [las negritas son mías] artículo sobre el cuento breve que he encontrado en el Perú […]” (p.17). Asimismo, continúa con las precisiones teóricas que hemos mencionado ya y que toma de Lagmanovich y Andrés-Suárez para su formulación. Sin embargo, como menciona Leticia Bustamante (2012): En general, las antologías se erigen como recursos fundamentales para el conocimiento de un género literario o de la producción textual de ese género dentro de unas determinadas coordenadas espacio-temporales. Además, son excelentes indicadores del tipo de lectura e interpretación realizadas por lectores especializados, es decir, por los antólogos que las elaboran y con frecuencia añaden valiosas aportaciones teóricas y críticas. (pp. 256-256) El carácter de la antología tiene más relevancia que la de un simple texto que recopila otros textos, y en esta misma línea trabaja Minardi, quien en el prólogo a la antología que trabajó indica cuáles son los paradigmas que se pueden encontrar en la estructura y en la percepción que tiene respecto al microrrelato. La mencionada autora recoge textos de 45 narradores o de “poetas que han incursionado en la narrativa (como Ana María Intili o Armando Arteaga”, que tengan publicado por lo menos un libro (de cuentos o poesía)” (p. 20), para luego mencionar cómo está estructurada su antología: esta tiene un carácter progresivo, histórico, y va desde Garcilaso de la Vega, hasta autores más recientes de la época como Jack Flores Vega o Grecia Cáceres. Añade también que el criterio de extensión de los microrrelatos varía entre las 300 y 400 palabras y señala la condición de una antología: esta es personal y siempre abierta a la crítica para la inclusión de ciertos autores y textos por sobre otros. Incide en la distinción nominal que ha utilizado internamente para escoger el término minificción y que extiende para los textos contenidos en su publicación: minicuentos (de carácter narrativo simple y sin muchas complicaciones bajo el mismo nivel) y los microrrelatos (de carácter alegórico y de intrincada complejidad narrativa, siempre ligados a lo fantástico y bastante lejanos del concepto que brindamos). Sus textos no presentan una unidad temática y, por el contrario, son bastante diversos y polifacéticos. Debemos entender que, por ser el primer esfuerzo por organizar al microrrelato peruano, los permisos que se toma Minardi son bastante comprensibles y sitúa la primera piedra para las posteriores antologías. Caso distinto es el de Circo de pulgas (2012) extensa publicación antológica que es antecedida, bajo buena decisión, por un estudio detenido y necesario del microrrelato peruano. Este contiene, en primer lugar, una periodización del microrrelato peruano, lo que remite al autor del libro, Rony Vásquez, hacia inicios del siglo XIX, yendo en contra de lo propuesto por Minardi quien también organizó su antología desde un aspecto progresivo histórico. Vásquez decide no ser anacrónico y verter los conceptos modernos de la narrativa en los autores anteriores o cercanos del siglo XX. En lo que respecta a nuestra investigación consideramos adecuada la decisión de Vásquez, ya que se encuentra consecuente con la propuesta teórica que ofrece del tema: él entiende que la precisión sobre el término a escogerse para la ficción breve tiene que recaer en la cualidad ficcional de estos textos, y bajo esa idea plantea el término minificción para caracterizar así a la escritura de la ficción breve de nuestro país. La selección de textos no presenta una unidad temática, únicamente está mediada bajo periodos que el mismo investigador propone: Periodo de iniciación o experimentación (aprox. 1900-1952), Periodo de arquitectura mínima o de las primeras estructuras (1953-1989) y el Periodo de fortalecimiento o vigorización (1990-2011). El periodo que abarca Vásquez es monumental, y la recopilación que tiene para queda periodo es igual de extensa, teniendo en el primer grupo a escritores como Manuel González Prada, Ricardo Palma, Adolfo Vienrich, Abraham Valdelomar, César Vallejo, Serafín del Mar, Gamaliel Churata, Xavier Abril, Martín Adán, etc.; en el segundo, José Durand, Luis Loayza, Carlos Germán Belli, Felipe Buendía, Carlos Mino Jolay, Héctor Velarde, Miguel Lladó, Luis León Herrera, Antonio Cisneros, Sofocleto, Omar Ames, Alfonso La Torre, Emilio Adolfo Westphalen, Carlos López Degregori, etc.; y en el último a escritores como Walter Zans, Nilo Espinoza Haro, Ricardo Virhuez, Luis Silva Canales, Doris Inés, Carmen Ollé, María Gómez Cortez, Cesar Ferreyros, Luis, Jochamowitz, Gerardo Temoche Temoche, Ricardo Sumalavia, Sócrates Zuzunaga, Ana María Gazzolo, Fernando Iwasaki, etc. El circo de pulgas se compone bajo la necesidad de organización primaria que, en el tiempo de Vásquez, era totalmente necesaria para el microrrelato. Debemos mencionar como dato añadido que, al año siguiente de esta publicación (con fuerte presencia en el apartado de estudio, periodización y conceptualización del microrrelato peruano) aparece la tesis de Óscar Gallegos, la cual recoger el enorme aporte de Vásquez entre sus páginas. Asimismo, debemos añadir que el trabajo de Vásquez no solo significa la formación estructural de un género nuevo para la narrativa peruana: es en este mismo esfuerzo donde hallamos la importancia de la publicación, en fijar a la ficción breve dentro del panorama literario actual. El trabajo de Vásquez no se limita a la búsqueda de autores con escritos de corte breve, brevísimos, por el contrario, acusa en la necesidad de construir al género en nuestra literatura la revelación de la cuantiosa producción de esta misma. El trabajo de Vásquez determina un antes y después respecto sobre cómo antologar adecuadamente a la ficción breve y sus cuantiosas denominaciones, bajo el espectro sesudo, teórico, consciente y de constante recojo de información ya no primaria, sino también ajena a esta. El investigador peruano le da espacio a la inspección de las antologías anteriores a su publicación, con la intención de entender el mismo proceso de antologar y, también, a la naturaleza de la ficción breve en el país. La revisión de revistas, círculos y espacios en los que comienza a tener relevancia e importancia el microrrelato constituyen, de igual manera, parte de la reflexión que antecede a la antología en sí, convirtiendo al libro como un referente para las antologías posteriores. Para la siguiente antología, Toque corto, del escritor y periodista Julio Benavides presenta un caso bastante especial y es que, si bien cuenta con la presencia de escritores de trascendencia como Carlos Calderón Fajardo, Sócrates Zuzunaga y Maynor Freyre, el autor del texto utiliza la antología para cumplir netamente lo que proponía Bustamante: abrir un espacio para los escritores y textos que no tienen la posibilidad de hacerlo por sus propios medios. Bajo esta prerrogativa, la mencionada antología carece de un prólogo o sección dedicada al estudio o reflexión del microrrelato y prioriza únicamente la noción expositiva que pretende figurarse siempre una antología. El formato pequeño de la publicación no indica precisamente una decisión estética que juegue o interaccione con el microrrelato y su concepto, parece indicar el carácter independiente que, fuera de presentarse como una antología que empuje el estudio de este género, muestra otra manera de utilizar las antologías para mostrar al microrrelato ya no como objeto de estudio, sino como producto económico. Cabe mencionar que Benavides posee otras antologías dedicadas al microrrelato y que presentan la misma distinción estructural: la mayoría de sus autores presentes son menores y/o no tienen mucha influencia/presencia en el panorama literario, editorial y comercial actual. No podría decirse lo mismo de Minardi y Vásquez, ya que ambos antologistas anteceden a los textos y autores con estudios y comentarios que fundamentan y explican la naturaleza de la selección que tienen. Esta precisión liminar marca una clara referencia entre antologar de manera académica y la creativa/expositiva, que como bien notaremos en las dos últimas antologías, siguen el mismo patrón que la comenzada por Minardi y excelentemente ejecutada por Vásquez. Un año después aparece la peculiar publicación de Miguel Ángel Vallejo, Diez por diez, una antología que carece de tamaño pero que sigue, como bien cita el mismo autor, una de las máximas del microrrelato: “Lo bueno, si breve, dos veces bueno”. La publicación de Vallejo (2016) es quizá de las más personales e interesantes antologías respecto al microrrelato peruano que ya revela el título del texto: tendremos a disposición de lectura diez textos de diez autores diferentes. Vallejo repara, con justicia y exactitud, la noción del microrrelato hasta en la introducción que inserta en la antología: esta es breve, brevísima y contiene, con exactitud, los lineamientos teóricos con los que comulga, los criterios que utilizó para seleccionar a los autores y, de manera posterior, los utilizados para la selección de textos. El escritor peruano menciona las cualidades que pautan, en primera instancia, los textos escogidos para su antología haciendo referencia a una cualidad del microrrelato ya descrita: este exige la participación del lector para completar y jugar con el sentido del texto. De manera seguida menciona que, los autores escogidos para la antología tienen entre “cincuentaiséis y veintiún años” y cuyas líneas temáticas son diversas: religiosas, navideñas, fantásticas y algunas poquísimas, realistas. Los autores que conforman esta antología son nombres conocidos para el género: Ricardo Ayllón, Ricardo Calderón, Willy del Pozo, José Donayre, Óscar Gallegos, Rodrigo Maruy, Ítalo Morales, Ricardo Sumalavia, Alejandro Susti y Félix Terrones. Los textos escogidos no presentan una línea narrativa; sin embargo, poseen una naturaleza irónica, sarcástica y ácida, lo cual invita al lector a dialogar de manera constante con los microrrelatos, acudir a las intertextualidades que conocen o buscar las conexiones que el texto plantea. Ninguno de las microrrelatos excede las 180 palabras, siendo “los más breves dentro de las más breves” y con ello, la posibilidad de pasar de un microrrelato a otro. La particularidad de esta publicación es lo personal que puede llegar a ser, ya que el mismo autor señala también que uno de los requisitos para la selección de los escritos es la calidad que poseen, un criterio que, fuera de presentar un aspecto técnico-característico concreto, reposa en la subjetividad de lo que se encuentra bueno o no. Los textos, además, como se mencionó, poseen una característica de interacción que no es aleatoria, sino poseen la cualidad intencional de generar interrelación entre el texto y el lector, sea el nivel y grado que fuera. Esta decisión es acertada por parte del autor quien, lejos del academicismo, muestra una propuesta interesante para la formación de antologías sobre el microrrelato. Hasta este punto, y si tomamos como excepción el monumental trabajo de Rony Vásquez, las antologías sobre el microrrelato peruano tienen una corta dimensión. Fuera de contener un sistema y organización del género en nuestro país y literatura, la noción de la antología reside en la capacidad de formar tradición, de reafirmarla en la coincidencia, en aperturar el debate sobre el correcto entendimiento del género y la naturaleza de este mismo en nuestras letras. Quizá, y motivados en esta premisa, las siguientes antologías que serán brevemente analizadas, resaltan por su volumen, siendo publicaciones con grandes cantidades de autores y textos. López Degregori, Susti y Güich emprenden en el 2019 la interesante labor de antologar una serie de microrrelatos orientados periódicamente desde la modernidad hasta la posmodernidad. El conglomerado de autores que presentan, entonces, son más cercanos a nuestra época, ya siendo afianzados desde Minardi, tomando presencia con la publicación de Vásquez y afianzándose en el libro publicado en colaboración por la Universidad de Lima: Extrañas criaturas. Antología del microrrelato peruano moderno. El mencionado libro tiene tres secciones muy marcadas: la distinción conceptual del microrrelato y sus características: ficcionalidad, brevedad, narratividad, hibridación y unidad (algunas de ellas adicionales a las que ya mencionamos). Los autores no precisan en la cualidad nominal de los textos de ficción breve, le asignan el término microrrelato sin realizar una distinción formal respecto a sus congéneres y, por el contrario, se pasa a explicar al microrrelato bajo las características mencionadas. López Degregori señala una cuestión importante para el estudio de los textos en la antología: “Es posible, desde nuestra perspectiva de lectores, reconocer microrrelatos en algunos autores anteriores, aunque no fue el propósito con el que fueron concebidos dichos textos.” (p. 41). Precisamente esta cuestión no está claramente mencionada en las antologías anteriores, únicamente se establecen como tales bajo la comprobación de si las características que se plantean logran imprimirse en los textos. En esta antología, a diferencia de las anteriores, se presentan pocos autores, pero más textos de estos (entre 8 y 10), mostrando mucho del trabajo de los escritores en diferentes temáticas. Algunos de los escritores son: Sebastián Salazar Bondy, Manuel Mejía Valera, Carlos Eduardo Zavaleta, Carlos Meneses, Juan Rivera Saavedra, Antonio Gálvez Ronceros, José B. Adolph Luis Loayza, José Miguel Oviedo, Jorge Díaz Herrera, Julio Ortega, Harry Belevan, Alejandro Susti, Enrique Prochazka, Fernando Iwasaki, José Donayre, Daniel Salvo, Ricardo Sumalavia, Luis Zúñiga y Carlos Enrique Saldívar. Es quizá este texto una de las mejores antologías que se han publicado en el medio peruano respecto al microrrelato. La fortaleza del texto reside en la selección de los autores, escritores que tienen mediana o gran importancia en la literatura peruana, con ello, la reafirmación de la importancia del microrrelato en nuestras letras. Además, los textos poseen una concordancia respecto a la alta capacidad de interacción que requieren por parte del lector, incitándolo a entrar a la historia de maneras varias, profundas y diferentes. No se encuentra guiado por una temática única ni recorre un amplio espacio temporal, con lo que se hace sencillo pasar de un autor a otro sin notar las diferencias que podrían generar las distancias entre un autor y otro. La última antología es la correspondiente a Ricardo González Vigil, con El microrrelato peruano. Antología general (2021), y no se debe pasar por alto la indicación que da sobre este esfuerzo. González Vigil, en el estudio preliminar que tiene para la edición que antologa, le dedica mucho espacio a sustentar las cualidades de los textos que distan temporalmente de los conceptos narrativos del microrrelato pero que podrían considerarse como tales, aludiendo que las intuiciones o transgresiones de la prosa en estos autores (que no sabían que escribían microrrelatos) no los exime de haber creado estos mismos (p.48) Así, dentro de los autores considerados se encuentra Garcilaso de la Vega, Concolorcorvo (como referentes a la colonia), Adolfo Vienrich, Ciro Alegría, José María Arguedas, Francisco Izquierdo Ríos (como algunos representantes de la tradición oral), Ricardo Palma, Clorinda Matto, Manuel Moncloa y Covarrubias, Eguren, Valdelomar, Vallejo, Churata, Magda Portal, Serafín Delmar, Oquendo de Amat, Martín Adán, Xavier Abril (como los escritores en proceso de formación del microrrelato) y la mayor parte de los narradores de los 50 como parte del proceso de maduración del microrrelato, teniendo a escritores como Zavaleta, Mejía, Rey de Castro, Rivera Saavedra, Gálvez Ronceros, Loayza, Adolph, Díaz Herrera, Ortega, Cronwell Jara, Pilar Dughi, Nilo Espinoza, Luis Jochamowitz. Finalmente, los que denomina como “los del auge actual”, teniendo nombres ya conocidos como Prochazka, Susti, Donayre, Forsyth, Ollé, Aramayo, Iwasaki, David Arce, José Beltrán, Margarita Saona, Daniel Salvo, Sumalavia, Victoria Guerrero, entre otros. Esta antología es la más extensa de todas las mencionadas, supera el millar de hojas y alberga una cantidad exorbitante de autores, con una cantidad nada despreciable de textos por cada autor. El barrido temporal que realizar González Vigil es impresionante, una labor titánica cuando se piensa en el rastreo de textos de cada etapa establecida por el autor. Sin embargo, debemos precisar en ciertas cuestiones respecto a este publicación. En primera instancia, la extensión de la publicación invita a pensar al texto como un estudio histórico sobre la presencia del microrrelato dentro de la literatura peruana, antes de entenderla como una antología general del microrrelato peruano. De esta manera, solo con la llegada al contenido del texto se corrobora la naturaleza de la publicación. Fuera de poseer un amplio y extenso estudio que sustente la introducción de ciertos autores en su corpus, la parte teórica del texto decide, acertadamente, en precisar respecto a las cuestiones genéricas del microrrelato, así como las características que posee este en la literatura. Esta decisión, podría entenderse en tanto se utiliza esta sustentación para obviar explicaciones respecto a si cierto texto, de cierto autor, puede considerarse microrrelato o no. Entender al microrrelato, sería, entonces, entender la introducción de ciertos textos dentro de la antología, lo que apertura, para la crítica, la revalorización de los conceptos que definen y delimitan la línea delgada que separa al microrrelato de las demás especies narrativas y, al mismo tiempo, repensar las maneras de componer antologías respecto al microrrelato. Es necesario incidir, llegado a este punto, en la cualidad editorial de las antologías de este particular género: teniendo en cuenta la naturaleza del microrrelato, ¿no resulta contradictorio tener extensas antologías que alejen a los lectores de la naturaleza del microrrelato? ¿debería respetarse también la brevedad, el concepto primario de la ficción breve para la formación de las antologías? La función de antologar como ejercicio de recuperación de textos y la exposición de estos debe ser primaria en cualquier intento por realizar una publicación de este tipo. Sin embargo, la mayoría de estos trabajos tienen una noción teórica como parte de su estructura, la cual se vuelve cada vez más crítica, específica y, en algunos casos, introductoria. Este esfuerzo no es incorrecto en tanto no se vuelva el apartado más dedicado y compacto de la publicación antológica, asimismo, los extensos trabajos en los que se recopilan textos desde antes de la etapa colonial y que llevan el nombre de antología, únicamente tienen de antológico el factor que se quiere evitar: ser un texto que recopile otros textos. La idea del microrrelato, según la crítica, parece ser moderna, al menos desde el entendimiento del género narrativo y la capacidad del escritor para formar narraciones reduciendo el espectro de la palabra y ampliando más el sentido a completar por parte del lector. En ese sentido, comenzar a catalogar los escritos de algunos autores lejanos a este espacio temporal en el que se tiene conciencia del género narrativo, es debatible, ergo, debatible su catalogado como microrrelato. Debemos concluir con este artículo mencionado que, si bien los criterios no son los mismos para cada antología, todas comparten la cualidad de formación de tradición. A su manera todas buscan afianzar el estatus del microrrelato dentro de la literatura peruana como un género que no le debe nada a ninguno de los considerados mayores. Comprobar esto es sencillo al notar cuáles son las nociones que se utilizan para crear una antología: el caso de Minardi es explorativo, compone la primera piedra para el estudio e interés en la búsqueda del microrrelato en la literatura peruana, sus mismas preocupaciones por no tener mucha presencia del género a nivel latinoamericano insta a la investigadora a rastrear los textos que recopila en su antología. Este esfuerzo es superado con creces con los demás antologistas: Vásquez con el genial análisis histórico del microrrelato en el Perú, el detallado programa que delimita para el microrrelato; los esfuerzos en Extrañas criaturas, están mas bien orientados en un particular periodo de tiempo en el que se comienzan a notar patrones para señalar a los componentes modernos del microrrelato peruano, teniendo mucha más producción en los haberes de estos escritores y, finalmente, la cuantiosa publicación de González Vigil, quien pretende fundamentar la necesidad de incluir al microrrelato dentro de la narrativa peruana, justificando la presencia del mencionado género desde la época colonial, manifestándose en cada uno de los procesos literarios grandes que ha tenido nuestra escritura. El perfilamiento serio de las antologías que contribuyan a la divulgación y estudio del microrrelato tiene que ir de la mano con las antologías ya publicadas. No debería existir un retroceso cuando se ejecutan este tipo particular de antologías y el indicativo sobre estas es siempre positivo: cada vez resultan más numerosas y copiosas las publicaciones dedicadas a recopilar y estudiar brevemente al microrrelato peruano. [1] Minificción, microficción, ficción brevísima, ficción súbita, ficción rápida, ficción minimalista. [2] Cuento breve, brevicuento, cuento cortísimo, cuento ultracorto, cuento en miniatura, cuento diminuto, minicuento, microcuento, minirrelato e historias mínimas. [3] Capricho, disparate, varia invención, cuento bonsái, textículo, pigmeocuento, cuento largo, descuento, instantánea, cuento de bolsillo, cápsula. [4] Nanocuento, cuento cuántico, relato microscópico. [5] Relato enano, embrión de texto, resumen de cuento, cagatura narrativa, chistecito. [6] Twiticuento, hiperbreve. [7] Microrrelato, microcuento, minicuento, cuento brevísimo, hiperbreve, fábula, parábola, escena, haiku, poema en prosa, bestiario, estampo, microtextos dramáticos. [8] Caso, anécdota, aforismo, máximas, sentencias, miniensayos, microcrónicas [9] La selección de textos principia en contribuir con el estudio crítico de las antologías de microrrelatos, esto implica, ergo, trabajar con un corpus de textos que sigan ciertas condiciones, lo cual no invalida ni desprestigia los demás textos mencionados y que quedaron fuera de este. Contrario a esta idea, la exposición de estos textos invita a la crítica especializada a la revisión de estos trabajos con el fin de estudiar de manera más precisa cada fenómeno que involucra al microrrelato y la manera en la que se antologa dicho género. Es en la especificidad donde comenzará a revelarse la relevancia, el carácter y la importancia que tiene el microrrelato en la literatura peruana. [10] Se trata de Cuentos pigmeos. Antología de la minificción latinoamericana (2005).

El objeto de este trabajo es el estudio del simbolismo de las aves en el ámbito tartésico y fenicio-púnico en la península ibérica durante el Bronce Final y el Hierro I. Se han recogido y analizado aquellas piezas con representaciones de aves, así como los restos orgánicos de éstas, si bien esto último no ha dado muchos frutos debido a las dificultades que existen tanto para su conservación como para la posterior identificación de especies. En total se han podido determinar ánades, gallos, palomas, flamencos, cisnes, lechuzas y halcones, todas ellas representadas en el Mediterráneo oriental y cuya iconografía se vincula al mundo funerario, al tránsito al Más Allá y a las divinidades. Gran parte de esa iconografía llegó a la península de mano de los fenicios, si bien su acogida y aceptación entre la población local fue variable. Palabras clave: aves, simbolismo, tartesios, fenicios, púnicosTopónimos: península ibéricaPeriodo: Hierro I. ABSTRACTThe aim of this paper is to study the symbolism of birds in Tartessian and Phoenician-Punic cultures within the Iberian Peninsula during the late Bronze and early Iron Age. To this end, items with any sort of symbolism connected with birds have been analysed. Organic remains have also been examined, although the latter did not make a relevant contribution to the study due to problems of conservation of the organic remains and subsequent identification of species. I have identified ducks, roosters, pigeons, flamingos, swans, owls and hawks, all located around the East Mediterranean basin and related to funerary contexts, the journey to the hereafter and deities. Most of this iconography reached the Iberian Peninsula via Phoenician culture, albeit its acceptance among the local population varied. Keywords: birds, symbolism, Tartesian, Phoenicians, PunicPlace names: Iberian PeninsulaPeriod: Iron Age REFERENCIASAlmagro Gorbea, M. J. (1986), Orfebrería fenicio-púnica, Madrid.Almagro Gorbea, M. (1977), El Bronce Final y el Periodo Orientalizante en Extremadura (Bibliotheca Praehistorica Hispana, 14), Madrid.— (dir.) (2008), La necrópolis de Medellín. II Estudio de los hallazgos, (Bibliotheca Archaeologica Hispana, 26-2), Madrid.Almagro Gorbea, M. y Torres, M. (2006), “Plástica sirio-fenicia en occidente: la sirena de Villaricos y el origen de la plástica ibérica”, Madrider Mitteilungen, 47, pp. 59-82.— (2009), “Los escarabeos fenicios de Portugal. Un estado de la cuestión”, Estudos Arqueológicos de Oeiras, 17, pp. 521-554.Akimova, L. I., Kunze, M. y V. Kästner, V. (1988), Die Welt der Etrusker. Archäeologische Denkmäler aus Museen der sozialististischen Länder, Berlin.Arnold, D. (1995), An Egyptian Bestiary, New York.Arruda, A. M. (2016), “À vol d´oiseau. Pássaros, passarinhos e passarocos na Idade do Ferro do Sul de Portugal”, en Terra e Água. Escolher sementes, invocar a Deusa. Estudos em homenagem a Victor S. Gonçalves, Lisboa, pp. 403-423.Aubet, M. E. (1978), “Los marfiles fenicios del Bajo Guadalquivir. I, Cruz del Negro”, Boletín del seminario de Arte y Arqueología, 44, pp. 15-88.— (1981-82), “Los marfiles fenicios del Bajo Guadalquivir (y III): Bencarrón, Santa Lucía y Setefilla”, Pyrenae, 17-18, pp. 231-287.Blázquez, J. M. (1983), Primitivas religiones ibéricas. Religiones prerromanas, Madrid.Blázquez, J. M. y Jordá, F. (1978), Historia del Arte Hispánico. I: La Antigüedad, Madrid.Blázquez, J. M., Luzón, J. M., Gómez, F. y Clauss, K. (1970), Las cerámicas del Cabezo de San Pedro (Huelva Arqueológica, 1), Madrid.Belén, M. y Escacena, J. L. (2002), “La imagen de la divinidad en el mundo tartésico”, en Ex oriente lux. Las religiones orientales antiguas en la península ibérica (Spal monografías, 21), Sevilla, pp. 159-184.Bendala, M. (1988), Los albores de Grecia. Historias del Viejo Mundo (Historia 16, 9), Madrid.Buero, M. (1984), “Los motivos naturalistas en la cerámica pintada del Bronce Final del suroeste peninsular”, Habis, 15, pp. 345-364.Carriazo, J. de M. (1969), “El cerro del Carambolo”, en Tartessos y sus problemas. V Symposium Internacional de Prehistoria Peninsular. Jerez de la Frontera. Barcelona, pp. 311-340.Celestino, S. y Blanco, J. L. (2006), “Edad del Hierro: Del Periodo Orientalizante al mundo prerromano”, en La joyería en los orígenes de Extremadura: el espejo de los dioses, Mérida, pp. 116-125.Celestino, S. y Salgado, J. A. (2007), “Fenicios e indígenas a través del tesoro de Aliseda”, en Las aguas primigenias. El Próximo Oriente Antiguo como fuente de civilización. Actas del IV Congreso Español de Antiguo Oriente Próximo (Zaragoza, 17 al 21 de octubre de 2006), Zaragoza, pp. 587-601.Celestino, S. y Rodríguez González, E. (2017), “De lo invisible a lo visible. La Transición entre el Bronce Final y la Primera Edad del Hierro en el valle medio del Guadiana”, en Territorios comparados: Los valles del Guadalquivir, el Tajo y el Guadiana en época tartésica (Anejos de AEspA, 80), Mérida, pp. 183-212.Coldstream, J. N. (2003), Geometric Greece, 900-700 BC, London-New York.Corzo, R. (1988), Los fenicios, señores del mar. Historias del Viejo Mundo (Historia 16, 8), Madrid.— (1991): Arte fenicio y púnico. Cuadernos de arte español (Historia 16, 9), Madrid.De Deus, M. y Correira, J. (2005), “Corte Margarida. Mais uma necrópole orientalizante no Baixo Alentejo”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental, Mérida, pp. 615-618.Díez, F. (2017), “Cuerpos imaginarios: poder y descorporeización en el paso al más allá imaginado en las lécitos áticas de fondo blanco”, Res Publica, 20.3, pp. 493-506.Diogo, C. y Kesser, C. (2018), “The Iconography of Death: continuity and change in the Prothesis ritual through iconographical techniques, motifs, and gestures depicted in Greek pottery”, Classica, 31.1, pp. 61-87.Fantar, M. H. (1970), Eschatologie phénicienne et punique. Tunis.Fernández Flores, A. y Rodríguez Azogue, A. (2007), Tartessos desvelado. La colonización fenicia del suroeste peninsular y el origen y ocaso de Tartessos, Córdoba.Frankfort, H. (2010), Arte y arquitectura del Oriente Antiguo, Madrid.Garrido, J. P. (1970), Excavaciones en la necrópolis de “La Joya”, Huelva (1ª y 2ª campañas) (Excavaciones Arqueológicas en España, 71), Madrid.González Prats, A. (1983), Estudio arqueológico del poblamiento antiguo de la sierra de Crevillente (Alicante) (Anejos de la Revista Lucentum, 1), Alicante.Grosman, L. y Munro, N. D. (2016), “A Natufian ritual event”, Current Anthropology, 57.3, pp. 311-331.Guerrero, V. M. (1986), “El impacto de la colonización púnica en la cultura talayótica de Mallorca”, en Los Fenicios en la peninsula ibérica, Sabadell, pp. 339-375.Hachmann, R. (1983), Frühe Phöniker im Libanon. 20 Jahre deutsche Ausgrabungen in Kāmid el-Lōz. Mainz.Hernández Carrasquilla, F. y Jonsson, L. (1994), “Las aves”, en Castillo de doña Blanca. Archaeo-environmental investigations in the Bay of Cádiz, Spain (750-500 B.C.) (BAR International Series, 593), Oxford, pp. 81-90.Horn, F. (2005), “Les terres cuites d´origine orientale de la peninsule iberique (VIIIᵉ-VIᵉ s. av. J.-C.)”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental (Anejos de AEspA, 35) vol 2. Mérida, pp. 1405-1415.Ikram, S. (2012), “An eternal aviary: Bird mummies from Ancient Egypt”, en Between heaven and Earth. Birds in Ancient Egypt (Oriental Institute Museum Publications, 35), Chicago, pp. 41-48.Jiménez Ávila, J. (2002), La toréutica orientalizante en la peninsula ibérica (Bibliotheca Archaeologica Hispana, 16), Madrid.Jiménez Guijarro, J., Sánchez Marco, A. y García Díez, M. (2011), “Nuevo examen de los grabados paleolíticos de El Pendo (Cantabria, España). Consideraciones sobre las aves del arte paleolítico de la península ibérica”, Trabajos de Prehistoria, 68.1, pp. 147-158.Karageorghis, V. y Des Gagniers, J. (1974), La Céramique Chypriote de Style Figuré. Âge du Fer (1050-500 AV. J.-C.) (Biblioteca di antichità cipriote, 2.1), Roma.Lacalle, R. (2019), Los símbolos de la Prehistoria. Mitos y creencias del Paleolítico Superior y del Megalitismo europeo, Córdoba.Le Meaux, H. (2010), L´iconographie orientalisante de la Péninsule Ibérique. Questions de styles et d´échanges (VIIIᵉ-VIᵉ siècles av. J.-C.) (Bibliothèque de la Casa de Velázquez, 47), Madrid.Liseau, C., Blasco, C., Ríos, P., Vega, J., Menduiña, R., Francisco, J., Baena, J., Herrera, T., Petri, A. y Gómez, J.L. (2008), “Un espacio compartido por vivos y muertos: el poblado calcolítico de fosos de Camino de las Yeseras (San Fernando de Henares, Madrid)”, Complutum, 19.1, pp. 97-120.López García, P., López Sáez, J. A. y Hernández, A. (2005), “El paleoambiente del suroeste peninsular en la protohistoria”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental (Anejos de AEspA, 35) vol 1. Mérida, pp. 383-403.López Grande M. J. y Trello, J. (2001-2002), “Pervivencias iconográficas egipcias en las imágenes de damas sagradas del ámbito fenicio-púnico”, en Actas del II Congreso internacional de mundo púnico (Cartagena, 2000). El Mundo púnico: religión, antropología y cultura material, Murcia, pp. 337-352.Maluquer de Motes, J. (1958), Excavaciones Arqueológicas en el Cerro del Berrueco (Salamanca) (Acta Salamanticensia. Filosofía y Letras, XIV.1), Salamanca.— (1981), El santuario protohistórico de Zalamea de La Serena, Badajoz 1978-1981 (Programa de Investigaciones Protohistóricas, IV), Barcelona.— (1983), El santuario protohistórico de Zalamea de La Serena, Badajoz 1981-1982 (Programa de Investigaciones Protohistóricas, V), Barcelona.Marín, M. C. (2013), “La diosa astral ibérica y sus antecedentes orientales”, en Ritual, Religion and Reasons. Studies in the Ancient World in Honour of Paolo Xella, Münster, pp. 561-580.Marín, M. C. y Jiménez, A. M. (2014), Imagen y culto en la Iberia prerromana II. Nuevas lecturas sobre los pebeteros en forma de cabeza femenina (Spal Monografías, 18), SevillaMonge Soares, R., Baptista, L., Pinheiro, R., Rodrigues, L. y Vale, N. (2017), “A necrópole da I Idade do Ferro do Monte do Bolor 1-2 (São Brissos, Beja)”, en Sidereum Ana III. El río Guadiana y Tartessos, Mérida, pp. 263-301.Miguel Azcárraga, B. (2015), “Bronces púnicos en la isla de Ibiza”, en J. Jiménez (ed.), Phoenician Bronzes in Mediterranean (Bibliotheca Archaeologica Hispana, 45). Madrid, pp. 453-478.Miguel Naranjo, P. (2020), Definición y caracterización de las cerámicas a mano con decoración pintada del sur de la península ibérica en época tartésica. Oxford.Molina, F. (1986), “Almuñécar a la luz de los nuevos hallazgos fenicios”, en Los Fenicios en la peninsula ibérica. Sabadell, pp. 193-216.Moscati, S. (ed.) (1988), I Fenici. Milano.Murillo, J. F. (1994), La cultura tartésica en el Guadalquivir Medio (Ariadna, 13-14), Córdoba.Neri, S. (2010), Il tornio e il penello. Ceramica depurata di tradizione geometrica di época orientalizante in Etruria meridionale (Officina etruscologia, 2). Roma.Nauert, J. P. (1965), “The Hagia Triada sarcophagus. An iconographical study”, Antike Kunst, 8.2, pp. 91-98.Nicolás, J. C. (2017), “Gallos, labrys y campanillas, elementos simbólicos de la religión púnico-peninsular”, en El Oriente de Occidente. Fenicios y púnicos en el área ibérica. VIII edición del coloquio internacional del CEFYP en Alicante, Alicante, pp. 433-464.Olmos, R. y Fernández Miranda, M. (1987), “El timiaterio de Albacete”, Archivo Español de Arqueología, 60, pp. 211-219.Padró, J. (1981), “Las divinidades egipcias en la Hispania romana y sus precedentes”, Simposio de la religión romana en Hispania, Madrid, pp. 335-344.Pachón, J. A. y Carrasco, J. (2005), Las cerámicas polícromas orientalizantes y del Bronce Final desde la perspectiva granadina. Granada.Pellicer, M. (2007), La necrópolis Laurita (Almuñécar, Granada) en el contexto de la colonización fenicia (Cuadernos de Arqueología Mediterránea, 15), Barcelona.Perdigones, L., Muñoz, A. y Pisano, G. (1990), La necrópolis fenicio-púnica de Cádiz, (Studia Punica, 7), Roma.Pérez Blasco, M.F. (2012), “El kalathos del gallo: una decoración simbólica singular en un vaso de Lucentum”, MARQ. Arqueología y Museos, 5, pp.133-153.Peyras, J. (1999), Aspects de Hermès-Mercure dans l´Afrique Mineure, en J. Peyras y G. Tirologos (eds.). L´Afrique du Nord Antique. Cultures et paysages, Paris, pp. 127-150.Plaza, L. de la, Martínez, J. M. y Vaquero, J. I. (2019), Guía para identificar los personajes de la mitología clásica, Madrid.Prados, F. (2008), Arquitectura púnica. Los monumentos funerarios (Anejos de Archivo Español de Arqueología, 44), Madrid.Regoli, P. (1991), I brucuaprofumi a testa femminile dal Nuraghe Lugherras (Paulilatino) (Studia Punica, 8), Roma.Rodríguez Díaz, A., Pavón, I. y Duque, D. M. (2015), “El Tesoro de Aliseda: aproximación a su contexto arqueológico y a su tiempo histórico”, en El tiempo del Tesoro de La Aliseda. II. Aproximación a su contexto arqueológico, Cáceres, pp. 205-224.Rodríguez González, E. y Celestino, S. (2019), “Primeras evidencias de un banquete: análisis arquitectónico y material de la estancia S-1 del yacimiento de Casas del Turuñuelo (Guareña, Badajoz)”, Cuadernos de Prehistoria y Arqueología de la Universidad Autónoma de Madrid, 45, pp. 179-202.Ruiz, L. A. (2004), “Appendice. El huevo de avestruz: símbolos, epigrafía y contextos culturales”, en Le uova di struzzo dipinte nella cultura punica (Bibliotheca Archaeologica Hispana, 22 Studia Hispano-Phoenicia, 3), Madrid, pp. 111-118.Russell, N. y McGowan, K. J. (2003), “Dance of the Cranes: Crane symbolism at Çatalhöyük and beyond”, Antiquity, 77.297, pp. 445-455.Salvador, R. M. y Pereira, J. (2017), “A Paisagem funerária a oeste de Beja no período orientalizante. As necrópoles de Carlota (São Brissos) e Cinco Reis 8 (Santiago Maior)”, en Sidereum Ana III. El río Guadiana y Tartessos, Mérida, pp. 333-352.Santos, F., Antunes, S., De Deus, M. y Grillo, C. (2017), “A Necrópole de Palhais (Beringel, Beja)”, en Sidereum Ana III. El río Guadiana y Tartessos, Mérida, pp. 227-261.Schmidt, K. (2010), “Göbekli Tepe- The Stone Age Sanctuaries. New results of ongoing excavations with a special focus on sculptures and high reliefs”, Documenta Praehistorica, 37, pp. 239-256.Schmitz, Ph. (2009), “The owl in Phoenician Mortuary practice”, JANER, 9.1, pp. 51-85.Soave, L. (2017), Simboli nell´arte. Breve guida per scoprire i significati nascoti nelle opere. Modena.Torres, M. (2002), Tartessos (Bibliotheca Archaeologica Hispana, 14), Madrid.— (2017), “El paisaje funerario en las necrópolis tartésicas”, en Arquitecturas funerarias y Memoria: la gestión de las necrópolis en Europa occidental (ss. X-III a. C.), Madrid, pp. 359-398.Townsend, E. (1974), Götterkult (Archaeologia Homerica, 3), Göttingen.Valero, M. A. (2005), “El mosaico del Cerro Gil. Iniesta, Cuenca”, en El Periodo Orientalizante. Actas del III Simposio Internacional de Arqueología de Mérida: Protohistoria del Mediterráneo Occidental (Anejos de AEspA, 35) vol 1. Mérida, pp. 619-634.Vaquero, A. (2012), “Los amuletos de la «Tumba Nº 5» de la necrópolis orientalizante de Les Casetes (Villajoyosa, Alicante)”, Lucentum, 31, pp. 91-114.Vives-Ferrándiz, J. (2007), “La vida social de la vajilla de bronce etrusca en el este de la península ibérica. Notas para un debate”, Revista d´Arqueología de Ponent, 16-17, pp. 318-342.VV.AA. (1979), Mer Égée. Gréce des Îles, Paris.

Environments containing significant concentration of NaCl such as salt lakes harbor extremophiles microorganisms which have a great biotechnology interest. To explore the diversity of Bacteria in Chott Tinsilt (Algeria), an isolation program was performed. Water samples were collected from the saltern during the pre-salt harvesting phase. This Chott is high in salt (22.47% (w/v). Seven halophiles Bacteria were selected for further characterization. The isolated strains were able to grow optimally in media with 10–25% (w/v) total salts. Molecular identification of the isolates was performed by sequencing the 16S rRNA gene. It showed that these cultured isolates included members belonging to the Halomonas, Staphylococcus, Salinivibrio, Planococcus and Halobacillus genera with less than 98% of similarity with their closest phylogenetic relative. The halophilic bacterial isolates were also characterized for the production of biosurfactant and industrially important enzymes. Most isolates produced hydrolases and biosurfactants at high salt concentration. In fact, this is the first report on bacterial strains (A4 and B4) which were a good biosurfactant and coagulase producer at 20% and 25% ((w/v)) NaCl. In addition, the biosurfactant produced by the strain B4 at high salinity (25%) was also stable at high temperature (30-100°C) and high alkalinity (pH 11).Key word: Salt Lake, Bacteria, biosurfactant, Chott, halophiles, hydrolases, 16S rRNAINTRODUCTIONSaline lakes cover approximately 10% of the Earth’s surface area. The microbial populations of many hypersaline environments have already been studied in different geographical regions such as Great Salt Lake (USA), Dead Sea (Israel), Wadi Natrun Lake (Egypt), Lake Magadi (Kenya), Soda Lake (Antarctica) and Big Soda Lake and Mono Lake (California). Hypersaline regions differ from each other in terms of geographical location, salt concentration and chemical composition, which determine the nature of inhabitant microorganisms (Gupta et al., 2015). Then low taxonomic diversity is common to all these saline environments (Oren et al., 1993). Halophiles are found in nearly all major microbial clades, including prokaryotic (Bacteria and Archaea) and eukaryotic forms (DasSarma and Arora, 2001). They are classified as slight halophiles when they grow optimally at 0.2–0.85 M (2–5%) NaCl, as moderate halophiles when they grow at 0.85–3.4 M (5–20%) NaCl, and as extreme halophiles when they grow at 3.4–5.1 M (20–30%) NaCl. Hyper saline environments are inhabited by extremely halophilic and halotolerant microorganisms such as Halobacillus sp, Halobacterium sp., Haloarcula sp., Salinibacter ruber , Haloferax sp and Bacillus spp. (Solomon and Viswalingam, 2013). There is a tremendous demand for halophilic bacteria due to their biotechnological importance as sources of halophilic enzymes. Enzymes derived from halophiles are endowed with unique structural features and catalytic power to sustain the metabolic and physiological processes under high salt conditions. Some of these enzymes have been reported to be active and stable under more than one extreme condition (Karan and Khare, 2010). Applications are being considered in a range of industries such as food processing, washing, biosynthetic processes and environmental bioremediation. Halophilic proteases are widely used in the detergent and food industries (DasSarma and Arora, 2001). However, esterases and lipases have also been useful in laundry detergents for the removal of oil stains and are widely used as biocatalysts because of their ability to produce pure compounds. Likewise, amylases are used industrially in the first step of the production of high fructose corn syrup (hydrolysis of corn starch). They are also used in the textile industry in the de-sizing process and added to laundry detergents. Furthermore, for the environmental applications, the use of halophiles for bioremediation and biodegradation of various materials from industrial effluents to soil contaminants and accidental spills are being widely explored. In addition to enzymes, halophilic / halotolerants microorganisms living in saline environments, offer another potential applications in various fields of biotechnology like the production of biosurfactant. Biosurfactants are amphiphilic compounds synthesized from plants and microorganisms. They reduce surface tension and interfacial tension between individual molecules at the surface and interface respectively (Akbari et al., 2018). Comparing to the chemical surfactant, biosurfactant are promising alternative molecules due to their low toxicity, high biodegradability, environmental capability, mild production conditions, lower critical micelle concentration, higher selectivity, availability of resources and ability to function in wide ranges of pH, temperature and salinity (Rocha et al., 1992). They are used in various industries which include pharmaceuticals, petroleum, food, detergents, cosmetics, paints, paper products and water treatment (Akbari et al., 2018). The search for biosurfactants in extremophiles is particularly promising since these biomolecules can adapt and be stable in the harsh environments in which they are to be applied in biotechnology.OBJECTIVESEastern Algeria features numerous ecosystems including hypersaline environments, which are an important source of salt for food. The microbial diversity in Chott Tinsilt, a shallow Salt Lake with more than 200g/L salt concentration and a superficies of 2.154 Ha, has never yet been studied. The purpose of this research was to chemically analyse water samples collected from the Chott, isolate novel extremely or moderate halophilic Bacteria, and examine their phenotypic and phylogenetic characteristics with a view to screening for biosurfactants and enzymes of industrial interest.MATERIALS AND METHODSStudy area: The area is at 5 km of the Commune of Souk-Naâmane and 17 km in the South of the town of Aïn-Melila. This area skirts the trunk road 3 serving Constantine and Batna and the railway Constantine-Biskra. It is part the administrative jurisdiction of the Wilaya of Oum El Bouaghi. The Chott belongs to the wetlands of the High Plains of Constantine with a depth varying rather regularly without never exceeding 0.5 meter. Its length extends on 4 km with a width of 2.5 km (figure 1).Water samples and physico-chemical analysis: In February 2013, water samples were collected from various places at the Chott Tinsilt using Global Positioning System (GPS) coordinates of 35°53’14” N lat. and 06°28’44”E long. Samples were collected randomly in sterile polythene bags and transported immediately to the laboratory for isolation of halophilic microorganisms. All samples were treated within 24 h after collection. Temperature, pH and salinity were measured in situ using a multi-parameter probe (Hanna Instruments, Smithfield, RI, USA). The analytical methods used in this study to measure ions concentration (Ca2+, Mg2+, Fe2+, Na+, K+, Cl−, HCO3−, SO42−) were based on 4500-S-2 F standard methods described elsewhere (Association et al., 1920).Isolation of halophilic bacteria from water sample: The media (M1) used in the present study contain (g/L): 2.0 g of KCl, 100.0/200.0 g of NaCl, 1.0 g of MgSO4.7HO2, 3.0 g of Sodium Citrate, 0.36 g of MnCl2, 10.0 g of yeast extract and 15.0 g agar. The pH was adjusted to 8.0. Different dilutions of water samples were added to the above medium and incubated at 30°C during 2–7 days or more depending on growth. Appearance and growth of halophilic bacteria were monitored regularly. The growth was diluted 10 times and plated on complete medium agar (g/L): glucose 10.0; peptone 5.0; yeast extract 5.0; KH2PO4 5.0; agar 30.0; and NaCl 100.0/200.0. Resultant colonies were purified by repeated streaking on complete media agar. The pure cultures were preserved in 20% glycerol vials and stored at −80°C for long-term preservation.Biochemical characterisation of halophilic bacterial isolates: Bacterial isolates were studied for Gram’s reaction, cell morphology and pigmentation. Enzymatic assays (catalase, oxidase, nitrate reductase and urease), and assays for fermentation of lactose and mannitol were done as described by Smibert (1994).Optimization of growth conditions: Temperature, pH, and salt concentration were optimized for the growth of halophilic bacterial isolates. These growth parameters were studied quantitatively by growing the bacterial isolates in M1 medium with shaking at 200 rpm and measuring the cell density at 600 nm after 8 days of incubation. To study the effect of NaCl on the growth, bacterial isolates were inoculated on M1 medium supplemented with different concentration of NaCl: 1%-35% (w/v). The effect of pH on the growth of halophilic bacterial strains was studied by inoculating isolates on above described growth media containing NaCl and adjusted to acidic pH of 5 and 6 by using 1N HCl and alkaline pH of 8, 9, 10, 11 and 12 using 5N NaOH. The effect of temperature was studied by culturing the bacterial isolates in M1 medium at different temperatures of incubation (4°C–55°C).Screening of halophilic bacteria for hydrolytic enzymes: Hydrolase producing bacteria among the isolates were screened by plate assay on starch, tributyrin, gelatin and DNA agar plates respectively for amylase, lipase, protease and DNAse activities. Amylolytic activity of the cultures was screened on starch nutrient agar plates containing g/L: starch 10.0; peptone 5.0; yeast extract 3.0; agar 30.0; NaCl 100.0/250.0. The pH was 7.0. After incubation at 30 ºC for 7 days, the zone of clearance was determined by flooding the plates with iodine solution. The potential amylase producers were selected based on ratio of zone of clearance diameter to colony diameter. Lipase activity of the cultures was screened on tributyrin nutrient agar plates containing 1% (v/v) of tributyrin. Isolates that showed clear zones of tributyrin hydrolysis were identified as lipase producing bacteria. Proteolytic activity of the isolates was similarly screened on gelatin nutrient agar plates containing 10.0 g/L of gelatin. The isolates showing zones of gelatin clearance upon treatment with acidic mercuric chloride were selected and designated as protease producing bacteria. The presence of DNAse activity on plates was determined on DNAse test agar (BBL) containing 10%-25% (w/v) total salt. After incubation for 7days, the plates were flooded with 1N HCl solution. Clear halos around the colonies indicated DNAse activity (Jeffries et al., 1957).Milk clotting activity (coagulase activity) of the isolates was also determined following the procedure described (Berridge, 1952). Skim milk powder was reconstituted in 10 mM aqueous CaCl2 (pH 6.5) to a final concentration of 0.12 kg/L. Enzyme extracts were added at a rate of 0.1 mL per mL of milk. The coagulation point was determined by manual rotating of the test tube periodically, at short time intervals, and checking for visible clot formation.Screening of halophilic bacteria for biosurfactant production. Oil spread Assay: The Petridis base was filled with 50 mL of distilled water. On the water surface, 20μL of diesel and 10μl of culture were added respectively. The culture was introduced at different spots on the diesel, which is coated on the water surface. The occurrence of a clear zone was an indicator of positive result (Morikawa et al., 2000). The diameter of the oil expelling circles was measured by slide caliber (with a degree of accuracy of 0.02 mm).Surface tension and emulsification index (E24): Isolates were cultivated at 30 °C for 7 days on the enrichment medium containing 10-25% NaCl and diesel oil as the sole carbon source. The medium was centrifuged (7000 rpm for 20 min) and the surface tension of the cell-free culture broth was measured with a TS90000 surface tensiometer (Nima, Coventry, England) as a qualitative indicator of biosurfactant production. The culture broth was collected with a Pasteur pipette to remove the non-emulsified hydrocarbons. The emulsifying capacity was evaluated by an emulsification index (E24). The E24 of culture samples was determined by adding 2 mL of diesel oil to the same amount of culture, mixed for 2 min with a vortex, and allowed to stand for 24 h. E24 index is defined as the percentage of height of emulsified layer (mm) divided by the total height of the liquid column (mm).Biosurfactant stability studies : After growth on diesel oil as sole source of carbone, cultures supernatant obtained after centrifugation at 6,000 rpm for 15 min were considered as the source of crude biosurfactant. Its stability was determined by subjecting the culture supernatant to various temperature ranges (30, 40, 50, 60, 70, 80 and 100 °C) for 30 min then cooled to room temperature. Similarly, the effect of different pH (2–11) on the activity of the biosurfactant was tested. The activity of the biosurfactant was investigated by measuring the emulsification index (El-Sersy, 2012).Molecular identification of potential strains. DNA extraction and PCR amplification of 16S rDNA: Total cellular DNA was extracted from strains and purified as described by Sambrook et al. (1989). DNA was purified using Geneclean® Turbo (Q-BIO gene, Carlsbad, CA, USA) before use as a template in polymerase chain reaction (PCR) amplification. For the 16S rDNA gene sequence, the purified DNA was amplified using a universal primer set, forward primer (27f; 5′-AGA GTT TGA TCM TGG CTC AG) and a reverse primer (1492r; 5′-TAC GGY TAC CTT GTT ACG ACT T) (Lane, 1991). Agarose gel electrophoresis confirmed the amplification product as a 1400-bp DNA fragment.16S rDNA sequencing and Phylogenic analysis: Amplicons generated using primer pair 27f-1492r was sequenced using an automatic sequencer system at Macrogene Company (Seoul, Korea). The sequences were compared with those of the NCBI BLAST GenBank nucleotide sequence databases. Phylogenetic trees were constructed by the neighbor-joining method using MEGA version 5.05 software (Tamura et al., 2011). Bootstrap resembling analysis for 1,000 replicates was performed to estimate the confidence of tree topologies.Nucleotide sequence accession numbers: The nucleotide sequences reported in this work have been deposited in the EMBL Nucleotide Sequence Database. The accession numbers are represented in table 5.Statistics: All experiments were conducted in triplicates. Results were evaluated for statistical significance using ANOVA.RESULTSPhysico-chemical parameters of the collected water samples: The physicochemical properties of the collected water samples are reported in table 1. At the time of sampling, the temperature was 10.6°C and pH 7.89. The salinity of the sample, as determined in situ, was 224.70 g/L (22,47% (w/v)). Chemical analysis of water sample indicated that Na +and Cl- were the most abundant ions (table 1). SO4-2 and Mg+2 was present in much smaller amounts compared to Na +and Cl- concentration. Low levels of calcium, potassium and bicarbonate were also detected, often at less than 1 g/L.Characterization of isolates. Morphological and biochemical characteristic feature of halophilic bacterial isolates: Among 52 strains isolated from water of Chott Tinsilt, seven distinct bacteria (A1, A2, A3, A4, B1, B4 and B5) were chosen for further characterization (table 2). The colour of the isolates varied from beige, pale yellow, yellowish and orange. The bacterial isolates A1, A2, A4, B1 and B5 were rod shaped and gram negative (except B5), whereas A3 and B4 were cocci and gram positive. All strains were oxidase and catalase positive except for B1. Nitrate reductase and urease activities were observed in all the bacterial isolates, except B4. All the bacterial isolates were negative for H2S formation. B5 was the only strain positive for mannitol fermentation (table 2).We isolated halophilic bacteria on growth medium with NaCl supplementation at pH 7 and temperature of 30°C. We studied the effect of NaCl, temperature and pH on the growth of bacterial isolates. All the isolates exhibited growth only in the presence of NaCl indicating that these strains are halophilic. The optimum growth of isolates A3 and B1 was observed in the presence of 10% NaCl, whereas it was 15% NaCl for A1, A2 and B5. A4 and B4 showed optimum growth in the presence of 20% and 25% NaCl respectively. A4, B4 and B5 strains can tolerate up to 35% NaCl.The isolate B1 showed growth in medium supplemented with 10% NaCl and pH range of 7–10. The optimum pH for the growth B1 was 9 and they did not show any detectable growth at or below pH 6 (table 2), which indicates the alkaliphilic nature of B1 isolate. The bacterial isolates A1, A2 and A4 exhibited growth in the range of pH 6–10, while A3 and B4 did not show any growth at pH greater than 8. The optimum pH for growth of all strains (except B1) was pH 7.0 (table 2). These results indicate that A1, A2, A3, A4, B4 and B5 are neutrophilic in nature. All the bacterial isolates exhibited optimal growth at 30°C and no detectable growth at 55°C. Also, detectable growth of isolates A1, A2 and A4 was observed at 4°C. However, none of the bacterial strains could grow below 4°C and above 50°C (table 2).Screening of the halophilic enzymes: To characterize the diversity of halophiles able to produce hydrolytic enzymes among the population of microorganisms inhabiting the hypersaline habitats of East Algeria (Chott Tinsilt), a screening was performed. As described in Materials and Methods, samples were plated on solid media containing 10%-25% (w/v) of total salts and different substrates for the detection of amylase, protease, lipase and DNAse activities. However, coagulase activity was determined in liquid medium using milk as substrate (figure 3). Distributions of hydrolytic activity among the isolates are summarized in table 4.From the seven bacterial isolates, four strains A1, A2, A4 and B5 showed combined hydrolytic activities. They were positive for gelatinase, lipase and coagulase. A3 strain showed gelatinase and lipase activities. DNAse activities were detected with A1, A4, B1 and B5 isolates. B4 presented lipase and coagulase activity. Surprisingly, no amylase activity was detected among all the isolates.Screening for biosurfactant producing isolates: Oil spread assay: The results showed that all the strains could produce notable (>4 cm diameter) oil expelling circles (ranging from 4.11 cm to 4.67 cm). The average diameter for strain B5 was 4.67 cm, significantly (P < 0.05) higher than for the other strains.Surface tension and emulsification index (E24): The assimilation of hydrocarbons as the sole sources of carbon by the isolate strains led to the production of biosurfactants indicated by the emulsification index and the lowering of the surface tension of cell-free supernatant. Based on rapid growth on media containing diesel oil as sole carbon source, the seven isolates were tested for biosurfactant production and emulsification activity. The obtained values of the surface tension measurements as well as the emulsification index (E24) are shown in table 3. The highest reduction of surface tension was achieved with B5 and A3 isolates with values of 25.3 mN m−1 and 28.1 mN m−1 respectively. The emulsifying capacity evaluated by the E24 emulsification index was highest in the culture of isolate B4 (78%), B5 (77%) and A3 (76%) as shown in table 3 and figure 2. These emulsions were stable even after 4 months. The bacteria with emulsification indices higher than 50 % and/or reduction in the surface tension (under 30 mN/m) have been defined as potential biosurfactant producers. Based on surface tension and the E24 index results, isolates B5, B4, A3 and A4 are the best candidates for biosurfactant production. It is important to note that, strains B4 and A4 produce biosurfactant in medium containing respectively 25% and 20% (w/v) NaCl.Stability of biosurfactant activities: The applicability of biosurfactants in several biotechnological fields depends on their stability at different environmental conditions (temperatures, pH and NaCl). For this study, the strain B4 appear very interesting (It can produce biosurfactant at 25 % NaCl) and was choosen for futher analysis for biosurfactant stability. The effects of temperature and pH on the biosurfactant production by the strain B4 are shown in figure 4.biosurfactant in medium containing respectively 25% and 20% (w/v) NaCl.Stability of biosurfactant activities: The applicability of biosurfactants in several biotechnological fields depends on their stability at different environmental conditions (temperatures, pH and NaCl). For this study, the strain B4 appear very interesting (It can produce biosurfactant at 25 % NaCl) and was chosen for further analysis for biosurfactant stability. The effects of temperature and pH on the biosurfactant production by the strain B4 are shown in figure 4. The biosurfactant produced by this strain was shown to be thermostable giving an E-24 Index value greater than 78% (figure 4A). Heating of the biosurfactant to 100 °C caused no significant effect on the biosurfactant performance. Therefore, the surface activity of the crude biosurfactant supernatant remained relatively stable to pH changes between pH 6 and 11. At pH 11, the value of E24 showed almost 76% activity, whereas below pH 6 the activity was decreased up to 40% (figure 4A). The decreases of the emulsification activity by decreasing the pH value from basic to an acidic region; may be due to partial precipitation of the biosurfactant. This result indicated that biosurfactant produced by strain B4 show higher stability at alkaline than in acidic conditions.Molecular identification and phylogenies of potential isolates: To identify halophilic bacterial isolates, the 16S rDNA gene was amplified using gene-specific primers. A PCR product of ≈ 1.3 kb was detected in all the seven isolates. The 16S rDNA amplicons of each bacterial isolate was sequenced on both strands using 27F and 1492R primers. The complete nucleotide sequence of 1336,1374, 1377,1313, 1305,1308 and 1273 bp sequences were obtained from A1, A2, A3, A4, B1, B4 and B5 isolates respectively, and subjected to BLAST analysis. The 16S rDNA sequence analysis showed that the isolated strains belong to the genera Halomonas, Staphylococcus, Salinivibrio, Planococcus and Halobacillus as shown in table 5. The halophilic isolates A2 and A4 showed 97% similarity with the Halomonas variabilis strain GSP3 (accession no. AY505527) and the Halomonas sp. M59 (accession no. AM229319), respectively. As for A1, it showed 96% similarity with the Halomonas venusta strain GSP24 (accession no. AY553074). B1 and B4 showed for their part 96% similarity with the Salinivibrio costicola subsp. alcaliphilus strain 18AG DSM4743 (accession no. NR_042255) and the Planococcus citreus (accession no. JX122551), respectively. The bacterial isolate B5 showed 98% sequence similarity with the Halobacillus trueperi (accession no. HG931926), As for A3, it showed only 95% similarity with the Staphylococcus arlettae (accession no. KR047785). The 16S rDNA nucleotide sequences of all the seven halophilic bacterial strains have been submitted to the NCBI GenBank database under the accession number presented in table 5. The phylogenetic association of the isolates is shown in figure 5.DICUSSIONThe physicochemical properties of the collected water samples indicated that this water was relatively neutral (pH 7.89) similar to the Dead Sea and the Great Salt Lake (USA) and in contrast to the more basic lakes such as Lake Wadi Natrun (Egypt) (pH 11) and El Golea Salt Lake (Algeria) (pH 9). The salinity of the sample was 224.70 g/L (22,47% (w/v). This range of salinity (20-30%) for Chott Tinsilt is comparable to a number of well characterized hypersaline ecosystems including both natural and man-made habitats, such as the Great Salt Lake (USA) and solar salterns of Puerto Rico. Thus, Chott Tinsilt is a hypersaline environment, i.e. environments with salt concentrations well above that of seawater. Chemical analysis of water sample indicated that Na +and Cl- were the most abundant ions, as in most hypersaline ecosystems (with some exceptions such as the Dead Sea). These chemical water characteristics were consistent with the previously reported data in other hypersaline ecosystems (DasSarma and Arora, 2001; Oren, 2002; Hacěne et al., 2004). Among 52 strains isolated from this Chott, seven distinct bacteria (A1, A2, A3, A4, B1, B4 and B5) were chosen for phenotypique, genotypique and phylogenetique characterization.The 16S rDNA sequence analysis showed that the isolated strains belong to the genera Halomonas, Staphylococcus, Salinivibrio, Planococcus and Halobacillus. Genera obtained in the present study are commonly occurring in various saline habitats across the globe. Staphylococci have the ability to grow in a wide range of salt concentrations (Graham and Wilkinson, 1992; Morikawa et al., 2009; Roohi et al., 2014). For example, in Pakistan, Staphylococcus strains were isolated from various salt samples during the study conducted by Roohi et al. (2014) and these results agreed with previous reports. Halomonas, halophilic and/or halotolerant Gram-negative bacteria are typically found in saline environments (Kim et al., 2013). The presence of Planococcus and Halobacillus has been reported in studies about hypersaline lakes; like La Sal del Rey (USA) (Phillips et al., 2012) and Great Salt Lake (Spring et al., 1996), respectively. The Salinivibrio costicola was a representative model for studies on osmoregulatory and other physiological mechanisms of moderately halophilic bacteria (Oren, 2006).However, it is interesting to note that all strains shared less than 98.7% identity (the usual species cut-off proposed by Yarza et al. (2014) with their closest phylogenetic relative, suggesting that they could be considered as new species. Phenotypic, genetic and phylogenetic analyses have been suggested for the complete identification of these strains. Theses bacterial strains were tested for the production of industrially important enzymes (Amylase, protease, lipase, DNAse and coagulase). These isolates are good candidates as sources of novel enzymes with biotechnological potential as they can be used in different industrial processes at high salt concentration (up to 25% NaCl for B4). Prominent amylase, lipase, protease and DNAase activities have been reported from different hypersaline environments across the globe; e.g., Spain (Sánchez‐Porro et al., 2003), Iran (Rohban et al., 2009), Tunisia (Baati et al., 2010) and India (Gupta et al., 2016). However, to the best of our knowledge, the coagulase activity has never been detected in extreme halophilic bacteria. Isolation and characterization of crude enzymes (especially coagulase) to investigate their properties and stability are in progress.The finding of novel enzymes with optimal activities at various ranges of salt concentrations is of great importance. Besides being intrinsically stable and active at high salt concentrations, halophilic and halotolerant enzymes offer great opportunities in biotechnological applications, such as environmental bioremediation (marine, oilfiel) and food processing. The bacterial isolates were also characterized for production of biosurfactants by oil-spread assay, measurement of surface tension and emulsification index (E24). There are few reports on biosurfactant producers in hypersaline environments and in recent years, there has been a greater increase in interest and importance in halophilic bacteria for biomolecules (Donio et al., 2013; Sarafin et al., 2014). Halophiles, which have a unique lipid composition, may have an important role to play as surface-active agents. The archae bacterial ether-linked phytanyl membrane lipid of the extremely halophilic bacteria has been shown to have surfactant properties (Post and Collins, 1982). Yakimov et al. (1995) reported the production of biosurfactant by a halotolerant Bacillus licheniformis strain BAS 50 which was able to produce a lipopeptide surfactant when cultured at salinities up to 13% NaCl. From solar salt, Halomonas sp. BS4 and Kocuria marina BS-15 were found to be able to produce biosurfactant when cultured at salinities of 8% and 10% NaCl respectively (Donio et al., 2013; Sarafin et al., 2014). In the present work, strains B4 and A4 produce biosurfactant in medium containing respectively 25% and 20% NaCl. To our knowledge, this is the first report on biosurfactant production by bacteria under such salt concentration. Biosurfactants have a wide variety of industrial and environmental applications (Akbari et al., 2018) but their applicability depends on their stability at different environmental conditions. The strain B4 which can produce biosurfactant at 25% NaCl showed good stability in alkaline pH and at a temperature range of 30°C-100°C. Due to the enormous utilization of biosurfactant in detergent manufacture the choice of alkaline biosurfactant is researched (Elazzazy et al., 2015). On the other hand, the interesting finding was the thermostability of the produced biosurfactant even after heat treatment (100°C for 30 min) which suggests the use of this biosurfactant in industries where heating is of a paramount importance (Khopade et al., 2012). To date, more attention has been focused on biosurfactant producing bacteria under extreme conditions for industrial and commercial usefulness. In fact, the biosurfactant produce by strain B4 have promising usefulness in pharmaceutical, cosmetics and food industries and for bioremediation in marine environment and Microbial enhanced oil recovery (MEOR) where the salinity, temperature and pH are high.CONCLUSIONThis is the first study on the culturable halophilic bacteria community inhabiting Chott Tinsilt in Eastern Algeria. Different genera of halotolerant bacteria with different phylogeneticaly characteristics have been isolated from this Chott. Culturing of bacteria and their molecular analysis provides an opportunity to have a wide range of cultured microorganisms from extreme habitats like hypersaline environments. Enzymes produced by halophilic bacteria show interesting properties like their ability to remain functional in extreme conditions, such as high temperatures, wide range of pH, and high salt concentrations. These enzymes have great economical potential in industrial, agricultural, chemical, pharmaceutical, and biotechnological applications. Thus, the halophiles isolated from Chott Tinsilt offer an important potential for application in microbial and enzyme biotechnology. In addition, these halo bacterial biosurfactants producers isolated from this Chott will help to develop more valuable eco-friendly products to the pharmacological and food industries and will be usefulness for bioremediation in marine environment and petroleum industry.ACKNOWLEDGMENTSOur thanks to Professor Abdelhamid Zoubir for proofreading the English composition of the present paper.CONFLICT OF INTERESTThe authors declare that they have no conflict of interest.Akbari, S., N. H. Abdurahman, R. M. Yunus, F. Fayaz and O. R. Alara, 2018. Biosurfactants—a new frontier for social and environmental safety: A mini review. Biotechnology research innovation, 2(1): 81-90.Association, A. P. H., A. W. W. Association, W. P. C. Federation and W. E. Federation, 1920. Standard methods for the examination of water and wastewater. American Public Health Association.Baati, H., R. Amdouni, N. Gharsallah, A. Sghir and E. Ammar, 2010. Isolation and characterization of moderately halophilic bacteria from tunisian solar saltern. Current microbiology, 60(3): 157-161.Berridge, N., 1952. Some observations on the determination of the activity of rennet. Analyst, 77(911): 57b-62.DasSarma, S. and P. Arora, 2001. Halophiles. Encyclopedia of life sciences. Nature publishishing group: 1-9.Donio, M. B. S., F. A. Ronica, V. T. Viji, S. Velmurugan, J. S. C. A. Jenifer, M. Michaelbabu, P. Dhar and T. Citarasu, 2013. Halomonas sp. Bs4, a biosurfactant producing halophilic bacterium isolated from solar salt works in India and their biomedical importance. SpringerPlus, 2(1): 149.El-Sersy, N. A., 2012. Plackett-burman design to optimize biosurfactant production by marine Bacillus subtilis n10. Roman biotechnol lett, 17(2): 7049-7064.Elazzazy, A. M., T. Abdelmoneim and O. Almaghrabi, 2015. Isolation and characterization of biosurfactant production under extreme environmental conditions by alkali-halo-thermophilic bacteria from Saudi Arabia. Saudi journal of biological Sciences, 22(4): 466-475.Graham, J. E. and B. Wilkinson, 1992. Staphylococcus aureus osmoregulation: Roles for choline, glycine betaine, proline, and taurine. Journal of bacteriology, 174(8): 2711-2716.Gupta, S., P. Sharma, K. Dev and A. Sourirajan, 2016. Halophilic bacteria of lunsu produce an array of industrially important enzymes with salt tolerant activity. Biochemistry research international, 1: 1-10.Gupta, S., P. Sharma, K. Dev, M. Srivastava and A. Sourirajan, 2015. A diverse group of halophilic bacteria exist in lunsu, a natural salt water body of Himachal Pradesh, India. SpringerPlus 4(1): 274.Hacěne, H., F. Rafa, N. Chebhouni, S. Boutaiba, T. Bhatnagar, J. C. Baratti and B. Ollivier, 2004. Biodiversity of prokaryotic microflora in el golea salt lake, Algerian Sahara. Journal of arid environments, 58(3): 273-284.Jeffries, C. D., D. F. Holtman and D. G. Guse, 1957. Rapid method for determining the activity of microorgan-isms on nucleic acids. Journal of bacteriology, 73(4): 590.Karan, R. and S. Khare, 2010. Purification and characterization of a solvent‐stable protease from Geomicrobium sp. Emb2. Environmental technology, 31(10): 1061-1072.Khopade, A., R. Biao, X. Liu, K. Mahadik, L. Zhang and C. Kokare, 2012. Production and stability studies of the biosurfactant isolated from marine Nocardiopsis sp. B4. Desalination, 3: 198-204.Kim, K. K., J.-S. Lee and D. A. Stevens, 2013. Microbiology and epidemiology of Halomonas species. Future microbiology, 8(12): 1559-1573.Lane, D., 1991. 16s/23s rRNA sequencing in nucleic acid techniques in bacterial systematics. Stackebrandt e., editor;, and goodfellow m., editor. Chichester, UK: John Wiley & Sons.Morikawa, K., R. L. Ohniwa, T. Ohta, Y. Tanaka, K. Takeyasu and T. Msadek, 2009. Adaptation beyond the stress response: Cell structure dynamics and population heterogeneity in Staphylococcus aureus. Microbes environments, 25: 75-82.Morikawa, M., Y. Hirata and T. J. B. e. B. A.-M. Imanaka, 2000. A study on the structure–function relationship of lipopeptide biosurfactants. Biochimica et biophysica acta, 1488(3): 211-218.Oren, A., 2002. Diversity of halophilic microorganisms: Environments, phylogeny, physiology, and applications. Journal of industrial microbiology biotechnology, 28(1): 56-63.Oren, A., 2006. Halophilic microorganisms and their environments. Springer science & business media.Oren, A., R. Vreeland and L. Hochstein, 1993. Ecology of extremely halophilic microorganisms. The biology of halophilic bacteria, 2(1): 1-8.Phillips, K., F. Zaidan, O. R. Elizondo and K. L. Lowe, 2012. Phenotypic characterization and 16s rDNA identification of culturable non-obligate halophilic bacterial communities from a hypersaline lake, la sal del rey, in extreme south texas (USA). Aquatic biosystems, 8(1): 1-5.Post, F. and N. Collins, 1982. A preliminary investigation of the membrane lipid of Halobacterium halobium as a food additive 1. Journal of food biochemistry, 6(1): 25-38.Rocha, C., F. San-Blas, G. San-Blas and L. Vierma, 1992. Biosurfactant production by two isolates of Pseudomonas aeruginosa. World Journal of microbiology biotechnology, 8(2): 125-128.Rohban, R., M. A. Amoozegar and A. Ventosa, 2009. Screening and isolation of halophilic bacteria producing extracellular hydrolyses from howz soltan lake, Iran. Journal of industrial microbiology biotechnology, 36(3): 333-340.Roohi, A., I. Ahmed, N. Khalid, M. Iqbal and M. Jamil, 2014. Isolation and phylogenetic identification of halotolerant/halophilic bacteria from the salt mines of Karak, Pakistan. International journal of agricultural and biology, 16: 564-570.Sambrook, J., E. F. Fritsch and T. Maniatis, 1989. Molecular cloning: A laboratory manual, 2nd edn. Cold spring harbor laboratory, cold spring harbor, New York.Sánchez‐Porro, C., S. Martin, E. Mellado and A. Ventosa, 2003. Diversity of moderately halophilic bacteria producing extracellular hydrolytic enzymes. Journal of applied microbiology, 94(2): 295-300.Sarafin, Y., M. B. S. Donio, S. Velmurugan, M. Michaelbabu and T. Citarasu, 2014. Kocuria marina bs-15 a biosurfactant producing halophilic bacteria isolated from solar salt works in India. Saudi journal of biological sciences, 21(6): 511-519.Smibert, R., 1994. Phenotypic characterization. In methods for general and molecular bacteriology. American society for microbiology: 611-651.Solomon, E. and K. J. I. Viswalingam, 2013. Isolation, characterization of halotolerant bacteria and its biotechnological potentials. International journal scientific research paper publication sites, 4: 1-7.Spring, S., W. Ludwig, M. Marquez, A. Ventosa and K.-H. Schleifer, 1996. Halobacillus gen. Nov., with descriptions of Halobacillus litoralis sp. Nov. and Halobacillus trueperi sp. Nov., and transfer of Sporosarcina halophila to Halobacillus halophilus comb. Nov. International journal of systematic evolutionary microbiology, 46(2): 492-496.Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei and S. Kumar, 2011. Mega5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology evolution, 28(10): 2731-2739.Yakimov, M. M., K. N. Timmis, V. Wray and H. L. Fredrickson, 1995. Characterization of a new lipopeptide surfactant produced by thermotolerant and halotolerant subsurface Bacillus licheniformis bas50. Applied and environmental microbiology, 61(5): 1706-1713.Yarza, P., P. Yilmaz, E. Pruesse, F. O. Glöckner, W. Ludwig, K.-H. Schleifer, W. B. Whitman, J. Euzéby, R. Amann and R. Rosselló-Móra, 2014. Uniting the classification of cultured and uncultured bacteria and archaea using 16s rRNA gene sequences. Nature reviews microbiology, 12(9): 635-645