To see the other types of publications on this topic, follow the link: GLRA2.
Journal articles on the topic 'GLRA2'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'GLRA2.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Kumar, Priyadarsini, and Stanley Meizel. "Identification and spatial distribution of glycine receptor subunits in human sperm." REPRODUCTION 136, no. 4 (October 2008): 387–90. http://dx.doi.org/10.1530/rep-08-0223.
Full textAbstract:
The human sperm surface glycine receptor (GLR) plays a role in an important fertilization event, the sperm acrosome reaction. Here, by western blot analysis, we report the presence of GLRA1, GLRA2, GLRA3, and GLRB subunits in human sperm. Immunolocalization studies showed that the GLRA1 and GLRA2 subunits are present in the equatorial region, the GLRA3 subunit in the flagellar principal piece, and the GLRB subunit in the acrosomal region of sperm. This first demonstration of isoforms of the sperm GLRA subunit and of a differential spatial distribution of the α and β subunits on the surface of mammalian sperm suggests the possibility that human sperm GLRs have more than one function.
2
Nachman, Michael W. "Patterns of DNA Variability at X-Linked Loci in Mus domesticus." Genetics 147, no. 3 (November 1, 1997): 1303–16. http://dx.doi.org/10.1093/genetics/147.3.1303.
Full textAbstract:
Introns of four X-linked genes (Hprt, Plp, Glra2, and Amg) were sequenced to provide an estimate of nucleotide diversity at nuclear genes within the house mouse and to test the neutral prediction that the ratio of intraspecific polymorphism to interspecific divergence is the same for different loci. Hprt and Plp lie in a region of the X chromosome that experiences relatively low recombination rates, while Glra2 and Amg lie near the telomere of the X chromosome, a region that experiences higher recombination rates. A total of 6022 bases were sequenced in each of 10 Mus domesticus and one M. caroli. Average nucleotide diversity (π) for introns within M. domesticus was quite low (π = 0.078%). However, there was substantial variation in the level of heterozygosity among loci. The two telomeric loci, Glra2 and Amg, had higher ratios of polymorphism to divergence than the two loci experiencing lower recombination rates. These results are consistent with the hypothesis that heterozygosity is reduced in regions with lower rates of recombination, although sampling of additional genes is needed to establish whether there is a general correlation between heterozygosity and recombination rate as in Drosophila melanogaster.
3
Young-Pearse, T. L., L. Ivic, A. R. Kriegstein, and C. L. Cepko. "Characterization of Mice with Targeted Deletion of Glycine Receptor Alpha 2." Molecular and Cellular Biology 26, no. 15 (August 1, 2006): 5728–34. http://dx.doi.org/10.1128/mcb.00237-06.
Full textAbstract:
ABSTRACT Glycine receptors are ligand-gated chloride channels that mediate inhibitory neurotransmission in the adult nervous system. During development, glycine receptor alpha 2 (GlyRα2) is expressed in the retina, in the spinal cord, and throughout the brain. Within the cortex, GlyRα2 is expressed in immature cells and these receptors have been shown to be active and excitatory. In the developing retina, inhibition of glycine receptor activity prevents proper rod photoreceptor development. These data suggest that GlyRα2, the developmentally expressed glycine receptor, may play an important role in neuronal development. We have generated mice with a targeted deletion of glycine receptor alpha 2 (Glra2). Although these mice lack expression of GlyRα2, no gross morphological or molecular alterations were observed in the nervous system. In addition, the cerebral cortex does not appear to require glycine receptor activity for proper development, as Glra2 knockout mice did not show any electrophysiological responses to glycine.
4
MAJUMDAR, SRIPARNA, LIANE HEINZE, SILKE HAVERKAMP, ELENA IVANOVA, and HEINZ WÄSSLE. "Glycine receptors of A-type ganglion cells of the mouse retina." Visual Neuroscience 24, no. 4 (May 29, 2007): 471–87. http://dx.doi.org/10.1017/s0952523807070174.
Full textAbstract:
A-type ganglion cells of the mouse retina represent the visual channel that transfers temporal changes of the outside world very fast and with high fidelity. In this study we combined anatomical and physiological methods in order to study the glycinergic, inhibitory input of A-type ganglion cells. Immunocytochemical studies were performed in a transgenic mouse line whose ganglion cells express green fluorescent protein (GFP). The cells were double labeled for GFP and the four α subunits of the glycine receptor (GlyR). It was found that most of the glycinergic input of A-type cells is through fast, α1-expressing synapses. Whole-cell currents were recorded from A-type ganglion cells in retinal whole mounts. The response to exogenous application of glycine and spontaneous inhibitory postsynaptic currents (sIPSCs) were measured. By comparing glycinergic currents recorded in wildtype mice and in mice with specific deletions of GlyRα subunits (Glra1spd-ot,Glra2−/−,Glra3−/−), the subunit composition of GlyRs of A-type ganglion cells could be further defined. Glycinergic sIPSCs of A-type ganglion cells have fast kinetics (decay time constant τ = 3.9 ± 2.5 ms, mean ± SD). Glycinergic sIPSCs recorded inGlra2−/−andGlra3−/−mice did not differ from those of wildtype mice. However, the number of glycinergic sIPSCs was significantly reduced inGlra1spd-otmice and the remaining sIPSCs had slower kinetics than in wildtype mice. The results show that A-type ganglion cells receive preferentially kinetically fast glycinergic inputs, mediated by GlyRs composed of α1 and β subunits.
5
Schaefermeier, Philipp, and Sarah Heinze. "Hippocampal Characteristics and Invariant Sequence Elements Distribution of GLRA2 and GLRA3 C-to-U Editing." Molecular Syndromology 8, no. 2 (December 16, 2016): 85–92. http://dx.doi.org/10.1159/000453300.
Full text
6
McCracken, Lindsay M., Daniel C. Lowes, Michael C. Salling, Cyndel Carreau-Vollmer, Naomi N. Odean, Yuri A. Blednov, Heinrich Betz, R. Adron Harris, and Neil L. Harrison. "Glycine receptor α3 and α2 subunits mediate tonic and exogenous agonist-induced currents in forebrain." Proceedings of the National Academy of Sciences 114, no. 34 (August 7, 2017): E7179—E7186. http://dx.doi.org/10.1073/pnas.1703839114.
Full textAbstract:
Neuronal inhibition can occur via synaptic mechanisms or through tonic activation of extrasynaptic receptors. In spinal cord, glycine mediates synaptic inhibition through the activation of heteromeric glycine receptors (GlyRs) composed primarily of α1 and β subunits. Inhibitory GlyRs are also found throughout the brain, where GlyR α2 and α3 subunit expression exceeds that of α1, particularly in forebrain structures, and coassembly of these α subunits with the β subunit appears to occur to a lesser extent than in spinal cord. Here, we analyzed GlyR currents in several regions of the adolescent mouse forebrain (striatum, prefrontal cortex, hippocampus, amygdala, and bed nucleus of the stria terminalis). Our results show ubiquitous expression of GlyRs that mediate large-amplitude currents in response to exogenously applied glycine in these forebrain structures. Additionally, tonic inward currents were also detected, but only in the striatum, hippocampus, and prefrontal cortex (PFC). These tonic currents were sensitive to both strychnine and picrotoxin, indicating that they are mediated by extrasynaptic homomeric GlyRs. Recordings from mice deficient in the GlyR α3 subunit (Glra3−/−) revealed a lack of tonic GlyR currents in the striatum and the PFC. In Glra2−/Y animals, GlyR tonic currents were preserved; however, the amplitudes of current responses to exogenous glycine were significantly reduced. We conclude that functional α2 and α3 GlyRs are present in various regions of the forebrain and that α3 GlyRs specifically participate in tonic inhibition in the striatum and PFC. Our findings suggest roles for glycine in regulating neuronal excitability in the forebrain.
7
Alitalo, Tiina, Fiona Francis, Juha Kere, Hans Lehrach, David Schlessinger, and Huntington F. Willard. "A 6-Mb YAC contig in Xp22.1–p22.2 spanning the DXS69E, XE59, GLRA2, PIGA, GRPR, CALB3, and PHKA2 genes." Genomics 25, no. 3 (February 1995): 691–700. http://dx.doi.org/10.1016/0888-7543(95)80012-b.
Full text
8
Feng, Jinong, Nick Craddock, Ian R. Jones, Edwin H. Cook, David Goldman, Leonard L. Heston, Leena Peltonen, Lynn E. DeLisi, and Steve S. Sommer. "Systematic screening for mutations in the glycine receptor α2 subunit gene (GLRA2) in patients with schizophrenia and other psychiatric diseases." Psychiatric Genetics 11, no. 1 (March 2001): 45–48. http://dx.doi.org/10.1097/00041444-200103000-00009.
Full text
9
Yakimov, Alexey M., Elena E. Timechko, Irina G. Areshkina, Anna A. Usoltseva, Kristina D. Yakovleva, Elena A. Kantimirova, Nikita Utyashev, Nikita Ivin, and Diana V. Dmitrenko. "MicroRNAs as Biomarkers of Surgical Outcome in Mesial Temporal Lobe Epilepsy: A Systematic Review." International Journal of Molecular Sciences 24, no. 6 (March 16, 2023): 5694. http://dx.doi.org/10.3390/ijms24065694.
Full textAbstract:
Mesial temporal lobe epilepsy is the most common type of epilepsy. For most patients suffering from TLE, the only treatment option is surgery. However, there is a high possibility of relapse. Invasive EEG as a method for predicting the outcome of surgical treatment is a very complex and invasive manipulation, so the search for outcome biomarkers is an urgent task. MicroRNAs as potential biomarkers of surgical outcome are the subject of this study. For this study, a systematic search for publications in databases such as PubMed, Springer, Web of Science, Scopus, ScienceDirect, and MDPI was carried out. The following keywords were used: temporal lobe epilepsy, microRNA, biomarkers, surgery, and outcome. Three microRNAs were studied as prognostic biomarkers of surgical outcome: miR-27a-3p, miR-328-3p, and miR-654-3p. According to the results of the study, only miR-654-3p showed a good ability to discriminate between patients with poor and good surgical outcomes. MiR-654-3p is involved in the following biological pathways: ATP-binding cassette drug transporters, glutamate transporter SLC7A11, and TP53. A specific target for miR-654-3p is GLRA2, the glycine receptor subunit. MicroRNAs, which are diagnostic biomarkers of TLE, and epileptogenesis, miR-134-5p, MiR-30a, miRs-143, etc., can be considered as potential biomarkers of surgical outcome, as they can be indicators of early and late relapses. These microRNAs are involved in the processes characteristic of epilepsy: oxidative stress and apoptosis. The study of miRNAs as potential predictive biomarkers of surgical outcome is an urgent task and should be continued. However, when studying miRNA expression profiles, it is important to take into account and note a number of factors, such as the type of sample under study, the time of sampling for the study, the type and duration of the disease, and the type of antiepileptic treatment. Without taking into account all these factors, it is impossible to assess the influence and involvement of miRNAs in epileptic processes.
10
Liu, M. H., M. J. Li, H. H. Qi, R. Guo, X. M. Liu, Q. Wang, and Y. Q. Cheng. "Occurrence of Grapevine Leafroll-Associated Viruses in China." Plant Disease 97, no. 10 (October 2013): 1339–45. http://dx.doi.org/10.1094/pdis-01-13-0048-re.
Full textAbstract:
To characterize the prevalence of viruses associated with grapevine leafroll disease in China, 249 grapevine (Vitis spp.) samples (86 popular cultivars and a rootstock) from 19 provinces and regions were collected and tested for Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-2, GLRaV-3, GLRaV-4, and GLRaV-4 strain 5 by SYBR Green real-time reverse-transcription polymerase chain reaction (RT-PCR), and RT-PCR and sequencing. GLRaV-3 was found in 100% of the samples while GLRaV-1, GLRaV-2, and GLRaV-4 were detected in 24.9% (62/249), 15.3% (38/249), and 0.80% (2/249) of the samples, respectively. Single infections with GLRaV-3 were found in 66.3% (165/249) of the samples, and the remaining samples were mixed infections of GLRaV-3 with one or two other GLRaVs, those with GLRaV-1 being the most common (18.5%, 46/249). The genetic variability of Chinese GLRaV-3 isolates was characterized based on the coat protein (CP) gene. In total, 153 full-length CP gene sequences (94 sequences newly generated) of Chinese GLRaV-3 isolates from different grapevine-growing regions showed 89.3 to 100.0% and 92.7 to 100.0% identity at the nucleotide and amino acid levels, respectively. The average nucleotide diversity for the population of Chinese GLRaV-3 isolates was estimated at 0.037 (standard error = 0.0032). GLRaV-3 isolates from China segregated into five distinct phylogenetic groups and two novel recombination events were found in the viral population. This is the first and most extensive report of the prevalent species of GLRaV in China, which also provides an assessment of genetic variability of GLRaV-3 Chinese isolates.
11
Velasco, Leonardo, Josefina Bota, Rafael Montero, and Enrico Cretazzo. "Differences of Three Ampeloviruses' Multiplication in Plant May Explain Their Incidences in Vineyards." Plant Disease 98, no. 3 (March 2014): 395–400. http://dx.doi.org/10.1094/pdis-04-13-0433-re.
Full textAbstract:
Grapevine leafroll ampeloviruses have been recently grouped into two major clades, one for Grapevine leafroll associated virus (GLRaV) 1 and 3 and another one grouping GLRaV-4 and its variants. In order to understand biological factors mediating differential ampelovirus incidences in vineyards, quantitative real-time polymerase chain reactions were performed to assess virus populations in three grapevine varieties in which different infection status were detected: GLRaV-3 + GLRaV-4, GLRaV-3 + GLRaV-4 strain 5, and GLRaV-4 alone. Specific primers based on the RNA-dependent RNA polymerase (RdRp) domains of GLRaV-3, GLRaV-4, and GLRaV-4 strain 5 were used. Absolute and relative quantitations of the three viruses were achieved by normalization of data to the concentration of the endogenous gene actin. In spring, the populations of GLRaV-4 and GLRaV-4 strain 5 were 1.7 × 104 to 5.0 × 105 genomic RNA copies/mg of petiole tissue whereas, for GLRaV-3, values were significantly higher, ranging from 5.6 × 105 and 1.0 × 107 copies mg–1. In autumn, GLRaV-4 and GLRaV-4 strain 5 populations increased significantly, displaying values for genome copies between 4.1 × 105 and 6.3 × 106 copies mg–1, whereas GLRaV-3 populations displayed a less pronounced boost but were still significantly higher, ranging from 4.1 × 106 to 1.6 × 107 copies mg–1. To investigate whether additional viruses may interfere in the quantifications the small RNA populations, vines were analyzed by Ion Torrent high-throughput sequencing. It allowed the identification of additional viruses and viroids, including Grapevine virus A, Hop stunt viroid, Grapevine yellow speckle viroid 1, and Australian grapevine viroid. The significance of these findings is discussed.
12
Kuniyuki, Hugo, Jorge Albeto Marques Rezende, José Osmar Gaspar, and Valdir Atsushi Yuki. "Detecção do Grapevine leafroll-associated virus 5 no Estado de São Paulo." Summa Phytopathologica 34, no. 4 (December 2008): 366–67. http://dx.doi.org/10.1590/s0100-54052008000400014.
Full textAbstract:
O enrolamento da folha da videira ("grapevine leafroll") é uma doença atribuída a pelo menos nove vírus sorologicamente distintos, Grapevine leafroll-associated viruses 1 a 9 e designados GLRaV-1 a GLRaV-9. No Brasil, já é conhecida a existência do GLRaV-1, GLRaV-2, GLRaV-3 e GLRaV-6. Neste trabalho, foi demonstrada a ocorrência do GLRaV-5 em amostras de videiras cultivadas no Estado de São Paulo, mediante teste de Biotina-ELISA. O vírus foi detectado com baixa incidência nas cultivares avaliadas, exceto na 'Cardinal', que apresentou 100% de infecção. Este é o primeiro relato da ocorrência do GLRaV-5 no Brasil.
13
Reynard, Jean-Sébastien, Pierre H. H. Schneeberger, Jürg Ernst Frey, and Santiago Schaerer. "Biological, Serological, and Molecular Characterization of a Highly Divergent Strain of Grapevine leafroll-associated virus 4 Causing Grapevine Leafroll Disease." Phytopathology® 105, no. 9 (September 2015): 1262–69. http://dx.doi.org/10.1094/phyto-12-14-0386-r.
Full textAbstract:
The complete genome sequence of a highly divergent strain of Grapevine leafroll-associated virus 4 (GLRaV-4) was determined using 454 pyrosequencing technology. This virus, designated GLRaV-4 Ob, was detected in Vitis vinifera ‘Otcha bala’ from our grapevine virus collection at Agroscope. The GLRaV-4 Ob genome length and organization share similarities with members of subgroup II in the genus Ampelovirus (family Closteroviridae). Otcha bala was graft-inoculated onto indicator plants of cultivar Gamay to evaluate the biological properties of this new strain, and typical leafroll symptoms were induced. A monoclonal antibody for the rapid detection of GLRaV-4 Ob by enzyme-linked immunosorbent assay is available, thus facilitating large-scale diagnostics of this virus. Based on the relatively small size of the coat protein, the reduced amino acid identity and the distinct serological properties, our study clearly shows that GLRaV-4 Ob is a divergent strain of GLRaV-4. Furthermore, molecular and serological data revealed that the AA42 accession from which GLRaV-7 was originally reported is in fact co-infected with GLRaV-4 Ob and GLRaV-7. This finding challenges the idea that GLRaV-7 is a leafroll-causing agent.
14
Fuchs, M., T. E. Martinson, G. M. Loeb, and H. C. Hoch. "Survey for the Three Major Leafroll Disease-Associated Viruses in Finger Lakes Vineyards in New York." Plant Disease 93, no. 4 (April 2009): 395–401. http://dx.doi.org/10.1094/pdis-93-4-0395.
Full textAbstract:
Vineyards in the Finger Lakes region in New York were surveyed for the three major viruses associated with leafroll disease, i.e., Grapevine leafroll-associated virus 1 (GLRaV-1), Grapevine leafroll-associated virus 2 (GLRaV-2), and Grapevine leafroll-associated virus 3 (GLRaV-3). Target viruses were detected in nearly two-thirds (68%, 65 of 95) of the vineyard blocks surveyed by enzyme-linked immunosorbent assay. Single infections by GLRaV-1, GLRaV-2, and GLRaV-3 occurred in 10% (113 of 1,124), 3% (36 of 1,124), and 15% (173 of 1,124) of the samples tested, respectively, whereas mixed infections affected 3.6% (40 of 1,124) of them, essentially with GLRaV-1 and GLRaV-3 (2.5%, 28 of 1,124). Presence of the target viruses was confirmed in selected samples by reverse transcription–polymerase chain reaction and sequencing. Comparative analysis indicated moderate to high nucleotide sequence identities in the second diverged copy of the GLRaV-1 coat protein gene (81.0 to 86.7%), GLRaV-2 coat protein gene (87.6 to 99.2%), and GLRaV-3 heat shock protein 70 homologue gene (91.5 to 98.3%) of New York isolates with corresponding virus reference strains. The prevalence of the three major leafroll disease-associated viruses in Finger Lakes vineyards results likely from poor sanitary status of planting materials, stressing the need to reinstate a certification program in New York.
15
Rowhani, Adib, Jerry K. Uyemoto, and Deborah A. Golino. "A Comparison Between Serological and Biological Assays in Detecting Grapevine Leafroll Associated Viruses." Plant Disease 81, no. 7 (July 1997): 799–801. http://dx.doi.org/10.1094/pdis.1997.81.7.799.
Full textAbstract:
The efficacy of the serological procedure enzyme-linked immunosorbent assay (ELISA) for detecting grapevine leafroll associated viruses (GLRaV types -1, -2, -3, and -4) was compared with indexing on Vitis vinifera L. cv. Cabernet Franc. Results of the biological assays confirmed the infectious nature of all grapevine sources testing positive by ELISA for GLRaV-1 (9 sources), GLRaV-2 (14 sources), and GLRaV-4 (14 sources), and the noninfectious nature of ELISA-negative grapevines (75 sources). However, among 57 sources testing positive by ELISA for GLRaV-3, or 24 sources with multiple infections, 8 and 1 sources, respectively, were negative by Cabernet Franc assays. Serological assays were repeated on all graft-inoculated indicators and only symptomatic ones reacted positively. Also, the 8 original GLRaV-3 sources that had tested positive by ELISA and negative by bioassay were found positive using immuno-capture/reverse transcription-polymerase chain reaction (IC/RT-PCR). The single multiple-infected source was not available for retesting. The distribution of GLRaV in infected grapevines was tested by assaying 20 to 40 samples per source of 36 plants infected with GLRaV-1, -2, -3, or -4. The incidence of GLRaV-positive canes as determined by ELISA ranged from 0 to 100%, suggesting that GLRaV can be unevenly distributed in chronically infected grapevines.
16
Türkmen, Yağmur, and Filiz Ertunç. "Determination of Grapevine Leafroll Diseases Infection in Turkey." Turkish Journal of Agriculture - Food Science and Technology 7, no. 11 (November 23, 2019): 1947. http://dx.doi.org/10.24925/turjaf.v7i11.1947-1953.2913.
Full textAbstract:
During the growing seasons between 2009 and 2010, totally 213 shoot and leaf samples were collected from the vineyards in Manisa, Denizli, Nevşehir, Elazığ, İzmir, Ankara, Çanakkale, Tekirdağ, Edirne and Kırklareli, which are commercially important viticulture production areas of Turkey. All grapevine samples were serologically investigated for the presence of Grapevine leafroll-associated viruses (GLRaVs) using GLRaV-1, GLRaV-2, GLRaV-3, GLRaV 4-9, GLRaV-6 and GLRaV-7 DAS-ELISA kits. In 143 of total, (67.14%) single or multiple infections were detected. GLRaV4-9, -7, -3, -1, -2 and -6 were detected as 53.52%, 36.15%, 34.74%, 32. 86%, 32.39% and 3.28%, respectively in the surveyed area. Eastern Anatolia Region had the highest infection rate (100%), followed by Marmara, Aegean, and Central Anatolia Region (69.74%, 75%, 62% and 26.47%, respectively). While the highest infection rates were obtained in Marmara Region for GLRaV-1, -2 and -3 as 43.42%, 44.74% and 50% respectively, GLRaV4-9 found as 100% in Eastern Anatolia Region. The highest infection rate was detected in Marmara Region for GLRaV-6 as 3.95%. The most common multiple infection was determined as GLRaV-1, -2, -3, 4-9 and -7 with the rate of 36.17%.
17
Caruso, Andrea Giovanni, Sofia Bertacca, Arianna Ragona, Slavica Matić, Salvatore Davino, and Stefano Panno. "Epidemiological Survey of Grapevine Leafroll-Associated Virus 1 and 3 in Sicily (Italy): Genetic Structure and Molecular Variability." Agriculture 12, no. 5 (April 29, 2022): 647. http://dx.doi.org/10.3390/agriculture12050647.
Full textAbstract:
Background: the most widely distributed and virulent Grapevine leafroll-associated viruses (GLRaV) that affect grapevine are GLRaV-1 and GLRaV-3, transmitted semi-persistently by different mealybugs and soft scales, mainly causing downward rolling of the leaf margins and interveinal reddening. Methods: the main objectives of this study were to investigate the genetic structure and molecular diversity of GLRaV-1 and GLRaV-3 in 617 samples from 11 autochthonous Sicilian grapevine cultivars, ascertaining their presence and spread. The detection was implemented by serological and molecular analyses and subsequently phylogenetic analyses on selected Sicilian isolates were conducted. Results: in total, 33 and 138 samples resulted positive to GLRaV-1 and GLRaV-3, with an incidence of 5.34% and 22.36%, respectively; 9 out of the 11 cultivars resulted positive, while the presence of both viruses was not found in ‘Grillo’ and ‘Moscato’ cultivars. Conclusions: phylogenetic analyses of the coat protein (CP) gene of 12 GLRaV-1 selected sequences showed a close relationship with European isolates; the discrete nucleotide differentiation and positive selection could demonstrate a current increase in population fitness. The phylogenetic analyses of the CP gene of 31 GLRaV-3 Sicilian CP sequences demonstrates a close relationship between Sicilian and different countries isolates; a certain stability of GLRaV-3 in the different cultivars analyzed is suggested by the discrete differentiation nucleotide and negative selection of the Sicilian isolates.
18
Akbaş, B., B. Kunter, and D. Ilhan. "Influence of leafroll on local grapevine cultivars in agroecological conditions of Central Anatolia region." Horticultural Science 36, No. 3 (August 18, 2009): 97–104. http://dx.doi.org/10.17221/27/2008-hortsci.
Full textAbstract:
Leafroll is one of the most important virus diseases of vineyards of Central Anatolia region. Grapevine leafroll associated viruses GLRaV-1 and GLRaV-3 are the most frequently encountered viruses related with leafroll disease of grapes. The effect of leafroll disease on yield and fruit quality was studied. The disease caused in the average 31.22% decrease of berry weights and 28.72% reduction in total soluble solids, while titratable acidity was increased by 24.39%. The reaction of local cultivars to mixed infections of GLRaV-1 and GLRaV-3 was evaluated and Parmak, Kara dirmit, Kara gevrek and Gül üzümü cultivars were considered to be the most sensitive local cultivars to GLRaV-1 and GLRaV-3.
19
Štrukelj, Melita, Jaka RAZINGER, Barbara GRUBAR, Uroš ŽIBRAT, Irena MAVRIČ PLEŠKO, Dominik Vodnik, and Gregor UREK. "Fiziološki odziv žlahtne vinske trte Vitis vinifera L. na okužbo z zvijanjem listov vinske trte povezanih virusov (GLRaV-1 in GLRaV-1 + GLRaV-3)." Acta agriculturae Slovenica 107, no. 2 (October 26, 2016): 519. http://dx.doi.org/10.14720/aas.2016.107.2.22.
Full textAbstract:
Grapevine leafroll disease is one of the most severe viral diseases of grapevine caused by Grapevine leafroll-associated viruses (GLRaVs). Physiological processes were monitored on grapevines with single (GLRaV-1) and mixed (GLRaV-1 and GLRaV -3) viral infection under greenhouse conditions from June to September, in vegetation period 2014. In the mid of the season (July) negative effects of the virus infections on physiological processes were more severe in mixed than in single infection. The net-photosynthesis (Pn) of the leaves infected with GLRaV-1 and GLRaV-3 reached only a half of the Pn in GLRaV-1 infected grapevines. Similar reduction was found for stomatal conductance, transpiration and parameters related to photochemical efficiency (electron transport rate).
20
Good, Xin, and Judit Monis. "Partial Genome Organization, Identification of the Coat Protein Gene, and Detection of Grapevine leafroll-associated virus-5." Phytopathology® 91, no. 3 (March 2001): 274–81. http://dx.doi.org/10.1094/phyto.2001.91.3.274.
Full textAbstract:
The genome of Grapevine leafroll-associated virus-5 (GLRaV-5) was cloned, and the sequence of 4766 nt was determined. Degenerate oligonucleotide primers designed from the conserved closterovirus heat shock 70 protein (HSP 70) homologue were used to obtain viral-specific sequences to anchor the cloning of the viral RNA with a genomic walking approach. The partial nucleotide (nt) sequence of GLRaV-5 showed the presence of four open reading frames (ORF A through D), potentially coding for the HSP 70 homologue (ORF A); a 51-kDa protein of unknown function with similarity to GLRaV-3 p55 (ORF B); the viral capsid protein (ORF C); and a diverged viral duplicate capsid protein (ORF D). The ORF C was identified as GLRaV-5 viral capsid protein based on sequence analyses and the reactivity of the recombinant protein to GLRaV-5 specific antibodies by western blot analyses. The antiserum produced with the in vitro-expressed GLRaV-5 ORF C protein product specifically reacted with a 36-kDa polypeptide from GLRaV-5 infected vines but did not react with protein extracts from vines infected with other GLRaVs or uninfected vines. Furthermore, specific primers were designed for the sensitive detection of GLRaV-1 and GLRaV-5 by polymerase chain reaction.
21
Mahfoudhi, N., N. Habili, S. A. Masri, and M. H. Dhouibi. "First Report on the Occurrence of Grapevine leafroll-associated viruses 5 and 9 in Tunisian Grapevines." Plant Disease 91, no. 10 (October 2007): 1359. http://dx.doi.org/10.1094/pdis-91-10-1359a.
Full textAbstract:
Grapevine leafroll disease is one of the most important diseases that occurs in cultivated grapevines in the world. So far, nine serologically distinct viruses of the family Closteroviridae have been isolated from diseased vines (3). A previous study (4) has shown that Grapevine leafroll-associated viruses (GLRaV) -1, -2, and -3 are present in Tunisian grapevines and GLRaV-3 is the predominant virus associated with leafroll disease. A survey was conducted in table grapes to identify other viruses associated with this disease. Samples of dormant canes were collected and screened by indirect Biotin Steptavidin ELISA with specific antibodies to GLRaV-5 (Bio-Rad, Sanofi, France) according to the manufacturer's instructions. Serological analysis revealed that nearly 47% of the samples were infected with GLRaV-5. To confirm GLRaV-5 identification and identify other leafroll viruses, vines with severe leafroll symptoms were collected and total RNA extracts were obtained from six samples and tested at Waite Diagnostics (University of Adelaide, Australia) by reverse transcription (RT)-PCR using primers for GLRaV-5 (2), LR5-1F 5′-CCCGTGATACAAGGTAGGACA-3′ and LR5-1R 5′-CAGACTTCACCTCCTGTTAC-3′ with a resulting amplicon size of 690 bp and primers for GLRaV-9, LR9F 5′-ACAGTGGTCGGCATAAGAAAAG-3′ and LR9R 5′-ACACAAACATGCAGGCCAAAG-3′ with a resulting amplicon size of 250 bp. Results showed that 1 of 6 and 5 of 6 of the samples were infected with GLRaV-5 and GLRaV-9, respectively, by RT-PCR and comparable results were obtained by ELISA. Amplicons were cloned and sequenced to confirm the identification of GLRaV-5 and GLRaV-9. The obtained sequences showed 99.1% nt identity and 94.8% amino acid similarity with an isolate of GLRaV-5 (GenBank Accession No. AF233934) and 97.6% nt identity and 94.8% amino acid similarity with an isolate of GLRaV-9 (GenBank Accession No. AY297819). The occurrence of GLRaV-9 has previously been reported in California and Australia (1). To our knowledge, this is the first report on the occurrence of GLRaV-5 and -9 in Tunisian grapevines. The widespread occurrence of GLRaV-5 and -9 is probably due either to the presence of their putative vectors, Planococcus ficus (Signoret) and Planococcus citri (Risso), or by propagation using infected local source material. Further studies are in progress to verify the implication of indigenous mealybugs in the spread of these viruses. References: (1) R. Alkowni et al. J. Plant Pathol. 86:123, 2004. (2) X. Good and J. Monis. Phytopathology 91:247, 2001. (3) P. Gugerli. ICVG, Extended Abstracts 14:23, 2003. (4) N. Mahfoudhi et al. EPPO Bulletin 28:197, 1998.
22
Jones, Taylor, and Mizuho Nita. "Gill's mealybug, Ferrisia gilli, can Transmit Grapevine Leafroll-associated Virus-3 after a 24-hour Acquisition Time." International Journal of Phytopathology 9, no. 2 (August 28, 2020): 139–44. http://dx.doi.org/10.33687/phytopath.009.02.3385.
Full textAbstract:
Grapevine leafroll disease (GLD) is a virus disease present in all grapevine-growing regions of the world. Mealybugs and scale insects have been reported as vectors of some grapevine leafroll-associated viruses belongs to the ampeloviruses (family Closteroviridae) in particular with grapevine leafroll-associated virus-1 (GLRaV-1) and GLRaV-3. Both grape (Pseudococcus maritimus) and Gill’s mealybugs are commonly present in Virginia vineyards, but we have limited information on acquisition and transmission of GLRaV-3 by Gill's mealybug (Ferrisia Gilli). We conducted acquisition and transmission assays in the greenhouse to examine the threshold for shorter acquisition time of GLRaV-3 with F. gilli. Approximately 67% and 58% rates of GLRaV-3 acquisition by F. gilli following 24 and 48 hours, respectively, of feeding period were documented. F. gilli first instars fed on a GLRaV-3-positive grapevine for 24 and 48 hours successfully transmitted GLRaV-3 to healthy grapevines after 24 hours of feeding/transmission time. The quick acquisition demonstrated in this study could be one of the factors that promoted the rapid expansion of GLRaV-3-infected vines in vineyards documented in previous studies.
23
Yong, Adeline J. H., Han L. Tan, Qianwen Zhu, Alexei M. Bygrave, Richard C. Johnson, and Richard L. Huganir. "Tyrosine phosphorylation of the AMPA receptor subunit GluA2 gates homeostatic synaptic plasticity." Proceedings of the National Academy of Sciences 117, no. 9 (February 18, 2020): 4948–58. http://dx.doi.org/10.1073/pnas.1918436117.
Full textAbstract:
Hebbian plasticity, comprised of long-term potentiation (LTP) and depression (LTD), allows neurons to encode and respond to specific stimuli; while homeostatic synaptic scaling is a counterbalancing mechanism that enables the maintenance of stable neural circuits. Both types of synaptic plasticity involve the control of postsynaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (AMPAR) abundance, which is modulated by AMPAR phosphorylation. To address the necessity of GluA2 phospho-Y876 in synaptic plasticity, we generated phospho-deficient GluA2 Y876F knock-in mice. We show that, while GluA2 phospho-Y876 is not necessary for Hebbian plasticity, it is essential for both in vivo and in vitro homeostatic upscaling. Bidirectional changes in GluA2 phospho-Y876 were observed during homeostatic scaling, with a decrease during downscaling and an increase during upscaling. GluA2 phospho-Y876 is necessary for synaptic accumulation of glutamate receptor interacting protein 1 (GRIP1), a crucial scaffold protein that delivers AMPARs to synapses, during upscaling. Furthermore, increased phosphorylation at GluA2 Y876 increases GluA2 binding to GRIP1. These results demonstrate that AMPAR trafficking during homeostatic upscaling can be gated by a single phosphorylation site on the GluA2 subunit.
24
Hao, Xinyi, Bolei Jiao, Yunlei Wang, Boxing Shang, and Yan Xu. "Occurrence of Grapevine Leafroll-Associated Virus-3 (GLRaV-3), Complete Nucleotide Sequence and Cultivar Susceptibility to a GLRaV-3 Isolate from Shaanxi Province of China." Horticulturae 8, no. 1 (January 14, 2022): 73. http://dx.doi.org/10.3390/horticulturae8010073.
Full textAbstract:
Grapevine (Vitis spp.) is globally one of the most economically important fruit crops. China is the largest grapevine-growing country of the world and Shaanxi province is one of the major grapevine-growing provinces in the country. A survey of GLRaV-3 found it widespread, with 57–100% infection frequencies, in both wine and table grapevine cultivars of three grapevine-growing regions of Shaanxi province. The virus infection frequencies varied with cultivars and regions. In order to obtain the full genomic length of a new GLRaV-3 isolate, GLRaV-3-Sau (accession number MK988555), was sequenced. This isolate has a genome of 18026 nucleotides, and 14 open reading frames (ORFs). The full-genome of the isolate GLRaV-3-Sau shared 85.88% nucleotide identity to GLRaV-3-LN, another isolate found in China. Coat protein (CP) genes of GLRaV-3 isolates were identical (99%) to the Vitis vinifera isolate (accession number HQ185608.1) from the USA. Immunohistochemistry for virus localization found that distribution patterns were similar in red-berried cultivar ‘Cabernet Sauvignon’ and white-berried cultivar ‘Chardonnay’, and GLRaV-3 is restricted in phloem tissue of vascular bundles. Virus transmission by micrografting found virus transmission efficiency was higher in ‘Chardonnay’ and ‘Thompson Seedless’ than in ‘Hunan-1’, indicating that ‘Hunan-1’ was less sensitive to GLRaV-3. As far as we know, these are the most comprehensive comparisons on the genome and CP genes of GLRaV-3 worldwide and the first to have found that the grapevine ‘Hunan-1’ is less susceptible to GLRaV-3.
25
Fuchs, M., P. Marsella-Herrick, G. M. Loeb, T. E. Martinson, and H. C. Hoch. "Diversity of Ampeloviruses in Mealybug and Soft Scale Vectors and in Grapevine Hosts from Leafroll-Affected Vineyards." Phytopathology® 99, no. 10 (October 2009): 1177–84. http://dx.doi.org/10.1094/phyto-99-10-1177.
Full textAbstract:
The occurrence and diversity of Grapevine leafroll-associated virus 1 (GLRaV-1) and Grapevine leafroll-associated virus 3 (GLRaV-3) in the soft scales Parthenolecanium corni and Pulvinaria innumerabilis and in the mealybug Pseudococcus maritimus was determined in leafroll-affected vineyards in the Finger Lakes region of New York. Groups of 1 to 4 specimens were collected under loose grapevine bark and tested by reverse-transcription polymerase chain reaction (RT-PCR) for segments of the second diverged copy of the GLRaV-1 coat protein gene or GLRaV-3 heat-shock protein 70-homologue gene. Virus-specific RT-PCR products were amplified from immature insect vectors and adult mealybugs. Single viral amplicons were obtained mostly from immature vectors (35%, 30 of 85) and dual viral amplicons from immature (16%, 10 of 61) and adult (100%, 14 of 14) mealybugs, including individuals. These observations suggested a simultaneous uptake of GLRaV-1 and GLRaV-3 by individual mealybugs. Furthermore, a comparative nucleotide sequence analysis of viral amplicons from soft scales, mealybugs, and grapevines from which vectors were collected showed identical or highly similar haplotypes, indicating that uptake of GLRaV-1 and GLRaV-3 likely occurred by direct feeding of vectors on their host plants.
26
Čarija, Mate, Silvija Černi, Darija Stupin-Polančec, Tomislav Radić, Emanuel Gaši, and Katarina Hančević. "Grapevine Leafroll-Associated Virus 3 Replication in Grapevine Hosts Changes through the Dormancy Stage." Plants 11, no. 23 (November 26, 2022): 3250. http://dx.doi.org/10.3390/plants11233250.
Full textAbstract:
Grapevine leafroll-associated virus 3 (GLRaV-3) is a graft-transmissible virus present in every viticultural region of the world and poses a large threat to grapevine production. Frequent coinfections with other viruses, the large number of grapevine varieties, the complexity of processes involved in plant response to virus infection, and the lack of studies on GLRaV-3 replication limit our knowledge of GLRaV-3 damaging effects and their background. In this study, five different inocula, one containing GLRaV-3 and others containing GLRaV-3 in combination with different grapevine viruses were green grafted to 52 different grapevine plants of four varieties to analyze the influence of the phenological stage and virus composition on GLRaV-3 replication. Relative concentration analysis by quantitative PCR conducted over a 16-month period revealed that other viruses as well as plant stage had a significant effect on GLRaV-3 replication and symptoms expression. The replication was most pronounced in the deep dormancy stage at the beginning of the infection, and the least at the exit of the dormancy stage. This study brings new insight into GLRaV-3 replication and discusses about viral interactions in one of the most economically important perennial plants, the grapevine.
27
Han, J., M. A. Ellis, and F. Qu. "First Report of Grapevine leaf roll-associated virus-2 and -3 in Ohio Vineyards." Plant Disease 98, no. 2 (February 2014): 284. http://dx.doi.org/10.1094/pdis-03-13-0276-pdn.
Full textAbstract:
Grapevine leaf roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine leaf roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical leaf roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly rolled leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5′-ACCTGGTTGAACGAGATCGCTT and 1R: 5′-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5′-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5′-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5′-CGGAACGTCGGTTCATTTAGA], Grapevine fan leaf virus (GFLVR1-F: 5′-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5′-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5′-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5′-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5′-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5′-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed leaf roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.
28
Jones, T. J., F. Westover, and M. Nita. "First Report of Grapevine leafroll-associated virus-2 and -3 in Texas Vineyards." Plant Disease 98, no. 11 (November 2014): 1592. http://dx.doi.org/10.1094/pdis-06-14-0619-pdn.
Full textAbstract:
Grapevine leafroll disease (GLD), caused by the grapevine leafroll-associated viruses (GLRaVs, family Closteroviridae) is an important disease in all grapevine-growing regions of the world (2). It negatively affects vine vigor, fruit yield, and grape quality (e.g., sugar accumulation) (3). Typical disease symptoms include downward rolling of grape leaves accompanied by interveinal reddening in red-fruited varieties and interveinal chlorosis in white-fruited varieties (2). The state of Texas currently has over 275 commercial vineyards and acreage under grape production is expanding. Currently, there is limited information on the presence of either GLRaV-2 (genus Closterovirus) or GLRaV-3 (genus Ampelovirus) in this state. During the 2012 season, 19 individual, symptomatic grapevines (13 cv. Lenoir and 6 cv. Blanc du Bois) were sampled (14 petioles per vine) from one vineyard site in Richards, TX. Total nucleic acid was extracted from the samples as described before (5) and tested by RT-PCR using species specific primers to amplify a 334-bp fragment of the HSP70h gene of GLRaV-2 (L2 F: 5′-ATAATTCGGCGTACATCCCCACTT-3′ and U2 R: 5′-GCCCTCCGCGCAACTAATGACAG-3′) (1) and a 541-bp fragment of the HSP70h gene of GLRaV-3 (LC1 F: 5′-CGCTAGGGCTGTGGAAGTATT-3′ and LC2 R: 5′-GTTGTCCCGGGTACCAGATAT-3′) (4). Samples were also subjected to triple (TAS) and double (DAS) antibody sandwich ELISA for GLRaV-2 and GLRaV-3 using commercially available antibody test kits (AC Diagnostics, Fayetteville, AR). Five samples tested positive for GLRaV-2 and one for GLRaV-3, all from the variety Lenoir with no incidences of mixed infection. In addition to the RT-PCR and ELISA, the presence of GLRaV-2 and GLRaV-3 was confirmed by direct sequencing of select RT-PCR products, which was purified using the QIAquick PCR Purification kit (Qiagen Inc., CA). The sequencing took place at the Virginia Bioinformatics Institute, Virginia Polytechnic Institute and State University, Blacksburg, VA. GLRaV-2 isolate TX12 (GenBank Accession No. KF417612) and GLRaV-3 isolate TX9 (KJ545571) shared 85 to 100% and 94 to 100% nucleotide identity and 74 to 100% and 82 to 100% amino acid identity, respectively, with previously reported isolates from around the world. All samples tested negative for GLRaV-1, -4, -4 strain 5, and -4 strain 9 (4), suggesting that some of the symptomatic vines may have a different disease or abiotic disorder, such as a nutrient deficiency. To our knowledge, this is the first report of GLRaV-2 and GLRaV-3 in the state of Texas. References: (1) N. Bertazzon and E. Angelini. J. Plant Pathol. 86:283, 2004. (2) M. Fuchs et al. Plant Dis. 93:395, 2009. (3) L. Kovacs et al. Am. J. Enol. Vitic. 52:254, 2001. (4) F. Osman et al. J. Virol. Methods. 141:22, 2007. (5) A. Rowhani et al. Proc. ICVG (Adelaide). 13:82, 2000.
29
Song, Yashu, Robert H. Hanner, and Baozhong Meng. "Transcriptomic Analyses of Grapevine Leafroll-Associated Virus 3 Infection in Leaves and Berries of ‘Cabernet Franc’." Viruses 14, no. 8 (August 21, 2022): 1831. http://dx.doi.org/10.3390/v14081831.
Full textAbstract:
Grapevine leafroll-associated virus 3 (GLRaV-3) is one of the most important viruses affecting global grape and wine production. GLRaV-3 is the chief agent associated with grapevine leafroll disease (GLRD), the most prevalent and economically destructive grapevine viral disease complex. Response of grapevine to GLRaV-3 infection at the gene expression level is poorly characterized, limiting the understanding of GLRaV-3 pathogenesis and viral-associated symptom development. In this research, we used RNA-Seq to profile the changes in global gene expression of Cabernet franc, a premium red wine grape, analyzing leaf and berry tissues at three key different developmental stages. We have identified 1457 differentially expressed genes (DEGs) in leaves and 1181 DEGs in berries. The expression profiles of a subset of DEGs were validated through RT-qPCR, including those involved in photosynthesis (VvPSBP1), carbohydrate partitioning (VvSUT2, VvHT5, VvGBSS1, and VvSUS), flavonoid biosynthesis (VvUFGT, VvLAR1, and VvFLS), defense response (VvPR-10.3, and VvPR-10.7), and mitochondrial activities (ETFB, TIM13, and NDUFA1). GLRaV-3 infection altered source–sink relationship between leaves and berries. Photosynthesis and photosynthate assimilation were inhibited in mature leaves while increased in young berries. The expression of genes involved in anthocyanin biosynthesis increased in GLRaV-3-infected leaves, correlating with interveinal tissue reddening, a hallmark of GLRD symptoms. Notably, we identified changes in gene expression that suggest a compromised sugar export and increased sugar retrieval in GLRaV-3-infected leaves. Genes associated with mitochondria were down-regulated in both leaves and berries of Cabernet franc infected with GLRaV-3. Results of the present study suggest that GLRaV-3 infection may disrupt mitochondrial function in grapevine leaves, leading to repressed sugar export and accumulation of sugar in mature leaf tissues. The excessive sugar accumulation in GLRaV-3-infected leaves may trigger downstream GLRD symptom development and negatively impact berry quality. We propose a working model to account for the molecular events underlying the pathogenesis of GLRaV-3 and symptom development.
30
Kyrychenko, A. M., K. V. Hrynchuk, I. O. Antipov, and A. I. Konup. "A Survey of Grapevine Leafroll-Associated Virus 1 and 3 in the South of Ukraine and Development of Primers for GLRaV-3 Identification." Mikrobiolohichnyi Zhurnal 84, no. 3 (December 17, 2022): 82–91. http://dx.doi.org/10.15407/microbiolj84.03.082.
Full textAbstract:
Viticulture is one of the most intensive and complex branches of Ukraine agriculture. Grapevine virus diseases are responsible for considerable economic losses to grape productivity and wine industries. One of the most notable and widespread viruses associated with vine leafroll disease is grapevine leafroll-associated viruses (GLRaV), belonging to the genus Ampelovirus, family Closteroviridae. Thus, the aim of this study was to conduct a survey targeting two viruses involved in the grapevine leafroll, namely grapevine leafroll-associated virus 1 (GLRaV-1) and virus 3(GLRaV-3) distributed in commercial wine grapes growing in the vineyards of the Ovidiopol and Bolhrad districts of the Odesa region. For efficient and accurate virus detection, we aimed to design universal primers based on conserved nucleotide sequences. Methods. Virus surveys of vineyards, visual diagnosis, immunoassay (ELISA), polymerase chain reaction with reverse transcription (RT-PCR), and Sanger sequencing of partial genome sequences of GLRaV. Results. The results obtained indicate that grapevine leafroll disease symptoms in field-grown grapevines in the south of Ukraine are caused by GLRaV-3. GLRaV-1 was not detected in any of the samples tested. To confirm the presence of GLRaV-3 in the samples, specific primers were designed targeting the coat protein region (GLRaV3-7f 5’-AGTAGGGGATGCAGCACAAG-3’; GLRaV3-7r 5’-ATCCAAAGCTATTCCCTTGC-3’) of the virus. A new set of primers (GLRaV3-7f / GLRaV3-7r) has been validated for sensitive detection of GLRaV-3 by RT-PCR and may be useful for routine virus detection in the laboratory as well as for large-scale testing. The partial coat protein gene of the isolate, GLRaV-3 ukr, distributed in the south of Ukraine, was sequenced, and the obtained sequence was deposited in GenBank under Acc. No. ON015835. The phylogenetic study demonstrated that GLRaV-3 ukr was closely related to isolates from Russia (MZ065372 and MZ065370).
31
FAJARDO, THOR V. M., GILMAR B. KUHN, MARCELO EIRAS, and OSMAR NICKEL. "Detecção de Closterovirus em videira e caracterização parcial de um isolado do Grapevine leafroll-associated virus 3." Fitopatologia Brasileira 27, no. 1 (February 2002): 58–64. http://dx.doi.org/10.1590/s0100-41582002000100009.
Full textAbstract:
O enrolamento da folha da videira (Vitis spp.) é uma doença causada por até oito vírus, Grapevine leafroll-associated virus (GLRaV) 1 a 8, sorologicamente distintos e associados ao floema de videiras infetadas. Neste trabalho, foram detectados GLRaV-1 e -3 por DAS-ELISA em 6,9 e 14,7% das amostras analisadas, respectivamente, e provenientes de duas importantes regiões vitícolas do Brasil (Serra Gaúcha e Vale do São Francisco). Os GLRaV-2, -5 e -7 não foram detectados. O GLRaV-3 também foi detectado por dot-ELISA e western blot, observando-se a provável proteína capsidial com cerca de 36 kDa. Um fragmento de 340 pb, compreendendo o terminal 3' do gene da polimerase viral de GLRaV-3, foi amplificado por PCR e seqüenciado. As seqüências de nucleotídeos e aminoácidos deduzidos deste isolado apresentaram alta homologia, 95,0 e 97,1%, respectivamente, com outro isolado de GLRaV-3 (NY1).
32
Poojari, S., J. Boulé, N. DeLury, D. T. Lowery, M. Rott, A. M. Schmidt, and J. R. Úrbez-Torres. "Epidemiology and Genetic Diversity of Grapevine Leafroll-Associated Viruses in British Columbia." Plant Disease 101, no. 12 (December 2017): 2088–97. http://dx.doi.org/10.1094/pdis-04-17-0497-re.
Full textAbstract:
Grapevine leafroll disease (GLD) is a complex associated with one or more virus species belonging to the family Closteroviridae. The majority of viruses in this complex are vectored by one or more species of mealybugs (Pseudococcidae) and/or scale insects (Coccidae). Grape-growing regions of British Columbia (BC), including Okanagan, Similkameen, and Fraser valleys and Kamloops (BC central interior), Vancouver, and Gulf islands, were surveyed during the 2014 and 2015 growing seasons for the presence of four major grapevine leafroll-associated viruses, including Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-2, GLRaV-3, and GLRaV-4. In total, 3,056 composite five-vine samples were collected from 153 Vitis vinifera and three interspecific hybrid vineyard blocks. The results showed GLRaV-3 to be the most widespread, occurring in 16.7% of the composite samples, followed by GLRaV-4 (3.9%), GLRaV-1 (3.8%), and GLRaV-2 (3.0%). Mixed infections of two or more GLRaVs were found in 4.1% of the total samples. The relative incidence of GLRaVs differed among regions and vineyard blocks of a different age. Characterization of partial CO1 region from a total of 241 insect specimens revealed the presence of Pseudococcus maritimus, Parthenolecanium corni, and other Pulvinaria sp. in BC vineyards. Spatial patterns of GLRaV-3 infected grapevines in three vineyard blocks from three different regions in the Okanagan Valley showed variable degrees of increase in disease spread ranging from 0 to 19.4% over three growing seasons. Regional differences in the relative incidence and spread of GLD underline the need for region-based management programs for BC vineyards.
33
Soltani, Nourolah, Rongbin Hu, Darrell D. Hensley, David L. Lockwood, Keith L. Perry, and M. R. Hajimorad. "A Survey for Nine Major Viruses of Grapevines in Tennessee Vineyards." Plant Health Progress 21, no. 3 (January 1, 2020): 157–61. http://dx.doi.org/10.1094/php-03-20-0018-rs.
Full textAbstract:
Despite the significance of grape production to the fruit industry in Tennessee (TN), no published information has been available on viruses affecting grapevines in the state. Hence, a survey was conducted during the 2016 and 2017 growing seasons to determine the status of nine major viruses of grapevines in TN vineyards by taking advantage of classical serological assays and confirmatory nucleic acid-based diagnostic approaches. A total of 349 samples from 23 grapevine cultivars mostly displaying viral-like symptoms were collected from 23 commercial vineyards. All samples were assayed by DAS-ELISA for arabis mosaic virus (ArMV), grapevine leafroll-associated virus (GLRaV)-1, GLRaV-2, GLRaV-3, GLRaV-4, grapevine fanleaf virus (GFLV), tobacco ringspot virus (TRSV), and tomato ringspot virus (ToRSV). Selected serologically positive samples were also tested by RT-PCR, followed by Sanger sequencing of the generated amplicons. Additionally, 19 grapevines displaying symptoms characteristic of grapevine red blotch virus (GRBV) were also assayed by PCR followed by confirmatory sequencing-based methods. Collectively, these assays verifiably detected GLRaV-1, GLRaV-2, GLRaV-3, ToRSV, and GRBV in TN vineyards. This is the first record of the presence of these viruses in TN vineyards. ArMV, GLRaV-4, GFLV, and TRSV were not detected. The majority of samples tested positive for a single virus, whereas mixed infections with more than one virus were detected in 37% of samples.
34
Achzet, Lindsay M., Fanny Astruc-Diaz, Phillip H. Beske, Nicholas R. Natale, Travis T. Denton, and Darrell A. Jackson. "Liposomal Encapsulated FSC231, a PICK1 Inhibitor, Prevents the Ischemia/Reperfusion-Induced Degradation of GluA2-Containing AMPA Receptors." Pharmaceutics 13, no. 5 (April 30, 2021): 636. http://dx.doi.org/10.3390/pharmaceutics13050636.
Full textAbstract:
Strokes remain one of the leading causes of disability within the United States. Despite an enormous amount of research effort within the scientific community, very few therapeutics are available for stroke patients. Cytotoxic accumulation of intracellular calcium is a well-studied phenomenon that occurs following ischemic stroke. This intracellular calcium overload results from excessive release of the excitatory neurotransmitter glutamate, a process known as excitotoxicity. Calcium-permeable AMPA receptors (AMPARs), lacking the GluA2 subunit, contribute to calcium cytotoxicity and subsequent neuronal death. The internalization and subsequent degradation of GluA2 AMPAR subunits following oxygen–glucose deprivation/reperfusion (OGD/R) is, at least in part, mediated by protein-interacting with C kinase-1 (PICK1). The purpose of the present study is to evaluate whether treatment with a PICK1 inhibitor, FSC231, prevents the OGD/R-induced degradation of the GluA2 AMPAR subunit. Utilizing an acute rodent hippocampal slice model system, we determined that pretreatment with FSC231 prevented the OGD/R-induced association of PICK1–GluA2. FSC231 treatment during OGD/R rescues total GluA2 AMPAR subunit protein levels. This suggests that the interaction between GluA2 and PICK1 serves as an important step in the ischemic/reperfusion-induced reduction in total GluA2 levels.
35
Krysenko, Sergii, Nicole Okoniewski, Merle Nentwich, Arne Matthews, Moritz Bäuerle, Alina Zinser, Tobias Busche, et al. "A Second Gamma-Glutamylpolyamine Synthetase, GlnA2, Is Involved in Polyamine Catabolism in Streptomyces coelicolor." International Journal of Molecular Sciences 23, no. 7 (March 29, 2022): 3752. http://dx.doi.org/10.3390/ijms23073752.
Full textAbstract:
Streptomyces coelicolor is a soil bacterium living in a habitat with very changeable nutrient availability. This organism possesses a complex nitrogen metabolism and is able to utilize the polyamines putrescine, cadaverine, spermidine, and spermine and the monoamine ethanolamine. We demonstrated that GlnA2 (SCO2241) facilitates S. coelicolor to survive under high toxic polyamine concentrations. GlnA2 is a gamma-glutamylpolyamine synthetase, an enzyme catalyzing the first step in polyamine catabolism. The role of GlnA2 was confirmed in phenotypical studies with a glnA2 deletion mutant as well as in transcriptional and biochemical analyses. Among all GS-like enzymes in S. coelicolor, GlnA2 possesses the highest specificity towards short-chain polyamines (putrescine and cadaverine), while its functional homolog GlnA3 (SCO6962) prefers long-chain polyamines (spermidine and spermine) and GlnA4 (SCO1613) accepts only monoamines. The genome-wide RNAseq analysis in the presence of the polyamines putrescine, cadaverine, spermidine, or spermine revealed indication of the occurrence of different routes for polyamine catabolism in S. coelicolor involving GlnA2 and GlnA3. Furthermore, GlnA2 and GlnA3 are differently regulated. From our results, we can propose a complemented model of polyamine catabolism in S. coelicolor, which involves the gamma-glutamylation pathway as well as other alternative utilization pathways.
36
Pei, G. Q., Y. F. Dong, Z. P. Zhang, and X. D. Fan. "First Report of Grapevine leafroll-associated virus 4 and 5 in Grapevines in China." Plant Disease 94, no. 1 (January 2010): 130. http://dx.doi.org/10.1094/pdis-94-1-0130a.
Full textAbstract:
Grapevine leafroll disease (GLD) is one of the most important diseases of grapevines worldwide. Nine serologically distinct viruses in the Closteroviridae family are associated with GLD. Previous studies reported that Grapevine leafroll-associated virus (GLRaV) -1, -2, -3, and -7 were present in grapevines in China with GLRaV-1 and -3 the predominant viruses associated with GLD (1). To confirm if GLRaV-4 and -5 were also present in China, 36 dormant canes from individual vines of 29 cultivars that showed GLD leaf symptoms during the growing season were collected from the germplasm collection plot of the Research Institute of Pomology, Chinese Academy of Agricultural Sciences. Total RNA extracted by a silica capture protocol (2) from phloem-enriched bark of 36 samples was tested separately for GLRaV-4 and -5 by reverse transcription (RT)-PCR using virus-specific primers. Primers LR4F (5′-ACATTCTCCACCTTGTGCTTTT-3′) and LR4R (5′-CATACAAGCGAGTGCAATTAC-3′) (4) were used to amplify a 321-bp fragment corresponding to a partial region of the HSP70 gene from GLRaV-4. One sample from cv. Autumn Royal was infected by GLRaV-4. The amplicon was cloned and a single clone was sequenced (GenBank Accession No. GQ246624) that showed 99% nucleotide identity with a corresponding region of a GLRaV-4 isolate from the United States (Accession No. AF039553). Since antiserum specific to GLRaV-4 was unavailable, a second pair of primers, LR4CP-F (5′-GGTGTCCAGCGCTTCCAA-3′) and LR4CP-R (5′-GCCAGAGAAGCATCGTAA-3′), was designed on the basis of the sequence of GLRaV-4 from Chile (Accession No. EU746620) that amplified a 300-bp fragment specific to the coat protein gene of GLRaV-4. The amplicon was cloned and a single sequence (Accession No. GQ479041) was compared with a corresponding nucleotide sequence of GLRaV-4 from Chile (Accession No. EU746621) showing 99% identity. A sample from cv. Malaga Rose was positive when tested by ELISA with antibodies specific to GLRaV-5 (Neogen Europe, Ltd. Scotland, UK) and this was confirmed by amplification of a 690-bp fragment corresponding to the GLRaV-5 coat protein gene using virus-specific primers LR5F (5′-CCCGTGATACAAGGTAGGACA-3′) and LR5R (5′-CAGACTTCACCTCCTGTTAC-3′) (3). The amplicon was cloned and a single clone was sequenced (Accession No. GQ246625) that showed 95% nucleotide identity with the CP gene sequence of GLRaV-5 from Argentina (Accession No. EU815935). To our knowledge, this is the first report of GLRaV-4 and -5 in grapevines in China. Confirmation of these viruses in China is very important for producing virus-free plants and this information also will be helpful in developing a multiplex RT-PCR assay to simultaneously detect multiple GLRaVs and helpful with studies on the molecular variability of these viruses. References: (1) Y. Dong et al. China Fruits 6:9, 2005. (2) X. Foissac et al. Acta Hortic. 550, 37, 2001. (3) X. Good and J. Monis. Phytopathology 91:274, 2001. (4) F. Osman et al. J. Virol. Methods 141:22, 2007.
37
Thompson, Brandon D., Jennifer Dahan, Jungmin Lee, Robert R. Martin, and Alexander V. Karasev. "A Novel Genetic Variant of Grapevine leafroll-associated virus-3 (GLRaV-3) from Idaho Grapevines." Plant Disease 103, no. 3 (March 2019): 509–18. http://dx.doi.org/10.1094/pdis-08-18-1303-re.
Full textAbstract:
Grapevine leafroll-associated virus-3 (GLRaV-3) is a major constraint on profitable grapevine cultivation. The virus is transmitted efficiently by mealybugs and soft scale insects, or through vegetative propagation by cuttings, and is present worldwide, wherever grapevines are grown. GLRaV-3 exists as a complex of genetic variants currently classified in several phylogenetic groups that can differ from each other by as much as 30% in nucleotide sequence of the whole genome. In the course of the GLRaV-3 testing of wine grapes in southern Idaho, plants of two grapevine cultivars were found to harbor a novel genetic variant of GLRaV-3, named ID45, which exhibited ≤80% nucleotide sequence identity level to the known GLRaV-3 isolates in its most conserved HSP70h gene. The ID45 variant caused no foliar symptoms in ‘Cabernet Sauvignon’ in the fall, and was demonstrated to have poor reactivity to commercial virus-specific antibodies. The entire 18,478-nt genome sequence of the GLRaV-3-ID45 was determined using a combination of high-throughput and conventional Sanger sequencing, and demonstrated to have typical organization for the genus Ampelovirus (family Closteroviridae), with only 70 to 77% identity level to the GLRaV-3 genomes from other established phylogroups. We concluded that ID45 represented a new phylogenetic group IX of GLRaV-3. Database search using ID45 nucleotide sequence as a query suggested that this novel ID45 variant is present in at least one other grape-growing state in the U.S., California, and in Brazil. An RT-PCR based test was developed to distinguish ID45 from the predominant GLRaV-3 phylogroup I found in Idaho in single and mixed infections.
38
Jackson, Darrell A., Fanny Astruc-Diaz, Nicole M. Byrnes, and Phillip H. Beske. "The Post-Ischemic Increase in GluA2 Ser880 Phosphorylation Involves NADPH Oxidase." Journal of Pharmaceutics and Therapeutics 4, no. 1 (October 11, 2018): 170–81. http://dx.doi.org/10.18314/jpt.v4i1.1300.
Full textAbstract:
Most 2-amino-3-(3-hydroxy-5-methyl-isoxazol-4-yl) propanoic acid receptors (AMPARs) expressed on adult hippocampal pyramidal neurons contain the edited form of GluA2 (Q607R) and are thus impermeable to Ca2+/Zn2+ entry. Following ischemic injury, these receptors undergo a subunit composition change, switching from a GluA2-containing Ca2+/Zn2+-impermeable AMPAR to a GluA2-lacking Ca2+/Zn2+-permeable AMPAR. Recent studies indicate that an oxidative stress signaling pathway is responsible for the I/R-induced changes in AMPAR subunit composition. Studies suggest that nicotinamide adenine dinucleotide phosphate-oxidase (NADPH oxidase), a superoxide generator, is the source that initiates the oxidative stress-signaling cascade during post-ischemic reperfusion. The objective of the present study was to determine if suppression of NADPH oxidase activity prevents the increase in phosphorylation and subsequent internalization of the GluA2 AMPAR subunit during reperfusion of post-ischemic hippocampal slices. In this study, we demonstrated that exposure of adult rat hippocampal slices to oxygen glucose deprivation/reperfusion (OGD/R) results in an increase in Ser880 phosphorylation of the GluA2 subunit. The increase in Ser880 phosphorylation resulted in the dissociation of GluA2 from the scaffolding proteins Glutamate receptor-interacting protein 1 (GRIP1) and AMPAR binding protein (ABP), thus enabling the association of GluA2 with protein interacting with C kinase 1 (PICK1). OGD/R also resulted in an increase in the association of activated protein kinase C ? (PKC?) with PICK1. We have found that pharmacological inhibition of NADPH oxidase with apocynin diminishes the OGD/R-induced increase in activated PKC? association with PICK1 and subsequent Ser880 phosphorylation of GluA2. Suppression of NADPH oxidase activity also blunted OGD/R-induced decreased association of GluA2 with the scaffolding proteins GRIP1 and ABP. Protein phosphatase 2A (PP2A), which regulates PKC? activity by dephosphorylating the kinase, was inactivated by OGD/R-induced increase in tyrosine phosphorylation of the phosphatase (Y307). Inhibition of NADPH oxidase activity ameliorated OGD/R-induced PP2A phosphorylation and inactivation. Our findings are consistent with a model of OGD/R-induced Ser880 phosphorylation of GluA2 that implicates NADPH oxidase mediated inactivation of PP2A and sustained PKC? phosphorylation of GluA2.
39
Porotikova, Elena, Uliana Terehova, Vitalii Volodin, Eugeniya Yurchenko, and Svetlana Vinogradova. "Distribution and Genetic Diversity of Grapevine Viruses in Russia." Plants 10, no. 6 (May 27, 2021): 1080. http://dx.doi.org/10.3390/plants10061080.
Full textAbstract:
Viral diseases can seriously damage the vineyard productivity and the quality of grape and wine products. Therefore, the study of the species composition and range of grapevine viruses is important for the development and implementation of strategies and tactics to limit their spread and increase the economic benefits of viticulture. In 2014–2019, we carried out a large-scale phytosanitary monitoring of Russian commercial vineyards in the Krasnodar region, Stavropol region and Republic of Crimea. A total of 1857 samples were collected and tested for the presence of Grapevine rupestris stem pitting-associated virus (GRSPaV), Grapevine virus A (GVA), Grapevine leafroll-associated virus-1 (GLRaV-1), Grapevine leafroll-associated virus-2 (GLRaV-2), Grapevine leafroll-associated virus-3 (GLRaV-3), Grapevine fanleaf virus (GFLV), and Grapevine fleck virus (GFkV) using RT-PCR. Out of all samples tested, 54.5% were positive for at least one of the viruses (GRSPaV, GVA, GLRaV-1, GLRaV-2, GLRaV-3, GFLV, GFkV) in the Stavropol region, 49.8% in the Krasnodar region and 49.5% in the Republic of Crimea. Some plants were found to be infected with several viruses simultaneously. In the Republic of Crimea, for instance, a number of plants were infected with five viruses. In the Krasnodar region and the Republic of Crimea, 4.7% and 3.3% of the samples were predominantly infected with both GFkV and GRSPaV, whereas in the Stavropol region, 6% of the selected samples had both GLRaV-1 and GVA infections. We carried out a phylogenetic analysis of the coat protein genes of the detected viruses and identified the presence of GVA of groups I and IV, GRSPaV of groups BS and SG1, GLRaV-1 of group III, GLRaV-2 of groups PN and H4, GLRaV-3 of groups I and III. The results obtained make it possible to assess the viral load and the distribution of the main grapevine viruses on plantations in the viticultural zones of Russia, emphasizing the urgent need to develop and implement long-term strategies for the control of viral diseases of grapes.
40
Larsen, Andreas Haahr, Jerzy Dorosz, Thor Seneca Thorsen, Nicolai Tidemand Johansen, Tamim Darwish, Søren Roi Midtgaard, Lise Arleth, and Jette Sandholm Kastrup. "Small-angle neutron scattering studies on the AMPA receptor GluA2 in the resting, AMPA-bound and GYKI-53655-bound states." IUCrJ 5, no. 6 (October 11, 2018): 780–93. http://dx.doi.org/10.1107/s2052252518012186.
Full textAbstract:
The AMPA receptor GluA2 belongs to the family of ionotropic glutamate receptors, which are responsible for most of the fast excitatory neuronal signalling in the central nervous system. These receptors are important for memory and learning, but have also been associated with brain diseases such as Alzheimer's disease and epilepsy. Today, one drug is on the market for the treatment of epilepsy targeting AMPA receptors, i.e. a negative allosteric modulator of these receptors. Recently, crystal structures and cryo-electron microscopy (cryo-EM) structures of full-length GluA2 in the resting (apo), activated and desensitized states have been reported. Here, solution structures of full-length GluA2 are reported using small-angle neutron scattering (SANS) with a novel, fully matched-out detergent. The GluA2 solution structure was investigated in the resting state as well as in the presence of AMPA and of the negative allosteric modulator GYKI-53655. In solution and at neutral pH, the SANS data clearly indicate that GluA2 is in a compact form in the resting state. The solution structure resembles the crystal structure of GluA2 in the resting state, with an estimated maximum distance (D max) of 179 ± 11 Å and a radius of gyration (R g) of 61.9 ± 0.4 Å. An ab initio model of GluA2 in solution generated using DAMMIF clearly showed the individual domains, i.e. the extracellular N-terminal domains and ligand-binding domains as well as the transmembrane domain. Solution structures revealed that GluA2 remained in a compact form in the presence of AMPA or GYKI-53655. At acidic pH only, GluA2 in the presence of AMPA adopted a more open conformation of the extracellular part (estimated D max of 189 ± 5 Å and R g of 65.2 ± 0.5 Å), resembling the most open, desensitized class 3 cryo-EM structure of GluA2 in the presence of quisqualate. In conclusion, this methodological study may serve as an example for future SANS studies on membrane proteins.
41
Achzet, Lindsay M., Clara J. Davison, Moira Shea, Isabella Sturgeon, and Darrell A. Jackson. "Oxidative Stress Underlies the Ischemia/Reperfusion-Induced Internalization and Degradation of AMPA Receptors." International Journal of Molecular Sciences 22, no. 2 (January 13, 2021): 717. http://dx.doi.org/10.3390/ijms22020717.
Full textAbstract:
Stroke is the fifth leading cause of death annually in the United States. Ischemic stroke occurs when a blood vessel supplying the brain is occluded. The hippocampus is particularly susceptible to AMPA receptor-mediated delayed neuronal death as a result of ischemic/reperfusion injury. AMPA receptors composed of a GluA2 subunit are impermeable to calcium due to a post-transcriptional modification in the channel pore of the GluA2 subunit. GluA2 undergoes internalization and is subsequently degraded following ischemia/reperfusion. The subsequent increase in the expression of GluA2-lacking, Ca2+-permeable AMPARs results in excitotoxicity and eventually delayed neuronal death. Following ischemia/reperfusion, there is increased production of superoxide radicals. This study describes how the internalization and degradation of GluA1 and GluA2 AMPAR subunits following ischemia/reperfusion is mediated through an oxidative stress signaling cascade. U251-MG cells were transiently transfected with fluorescently tagged GluA1 and GluA2, and different Rab proteins to observe AMPAR endocytic trafficking following oxygen glucose-deprivation/reperfusion (OGD/R), an in vitro model for ischemia/reperfusion. Pretreatment with Mn(III)tetrakis(1-methyl-4-pyridyl)porphyrin (MnTMPyP), a superoxide dismutase mimetic, ameliorated the OGD/R-induced, but not agonist-induced, internalization and degradation of GluA1 and GluA2 AMPAR subunits. Specifically, MnTMPyP prevented the increased colocalization of GluA1 and GluA2 with Rab5, an early endosomal marker, and with Rab7, a late endosomal marker, but did not affect the colocalization of GluA1 with Rab11, a marker for recycling endosomes. These data indicate that oxidative stress may play a vital role in AMPAR-mediated cell death following ischemic/reperfusion injury.
42
Tsai, C. W., J. Chau, L. Fernandez, D. Bosco, K. M. Daane, and R. P. P. Almeida. "Transmission of Grapevine leafroll-associated virus 3 by the Vine Mealybug (Planococcus ficus)." Phytopathology® 98, no. 10 (October 2008): 1093–98. http://dx.doi.org/10.1094/phyto-98-10-1093.
Full textAbstract:
Grapevine leafroll disease is caused by grapevine leafroll-associated viruses (GLRaVs). Within this virus complex, GLRaV-3 is the predominant species in the world. Several GLRaVs have been shown to be transmitted from vine to vine by mealybugs although a detailed characterization of transmission biology is lacking. The introduction of the vine mealybug (Planococcus ficus) in California and other regions of the world may result in increasing disease incidence of established GLRaVs. We studied the characteristics of GLRaV-3 transmission by the vine mealybug. Our results indicate that the vine mealybug transmits GLRaV-3 in a semipersistent manner. First instars were more efficient vectors than adult mealybugs. GLRaV-3 transmission lacked a latent period in the vector. Virus transmission occurred with a 1-h acquisition access period (AAP) and peaked with a 24-h AAP. Mealybugs inoculated GLRaV-3 with a 1-h inoculation access period (IAP), and transmission efficiency increased with longer plant access period up to 24 h, after which transmission rate remained constant. After an AAP of 24 h, mealybugs lost GLRaV-3 and infectivity 4 days after virus acquisition. In addition, GLRaV-3 was not transovarially transmitted from infected females to their progeny as detected by reverse transcription polymerase chain reaction. In summary, we systematically analyzed transmission parameters of GLRaV-3 by the vine mealybug and showed that transmission of this virus occurs in a semipersistent manner. This research fills in important gaps in knowledge of leafroll virus transmission, which is critical for development of leafroll disease management practices.
43
Tomazic, Irma, Zora Korosec-Koruza, and Natasa Petrovic. "Sanitary status of slovenian indigenous grapevine cultivar Refosk." OENO One 39, no. 1 (March 31, 2005): 19. http://dx.doi.org/10.20870/oeno-one.2005.39.1.908.
Full textAbstract:
<p style="text-align: justify;">Sanitary status of visually selected and nonselected indigenous grapevine cultivar 'Refosk' (Vitis vinifera L. cv. 'Refosk') was evaluated. Nine viruses were tested by ELISA: Nepoviruses Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), Closteroviruses Grapevine leafroll associated viruses 1 (GLRaV-1), 2 (GLRaV-2), 3 (GLRaV-3), and 6 (GLRaV-6), Grapevine fleck virus (GFkV) and Vitiviruses Grapevine virus A (GVA) and Grapevine virus B (GVB). All viruses except ArMV and GVB were detected. The vines of cv. ‘Refosk’ passing the visual selection were 50 % free of tested viruses in comparison to only 24 % virus-free vines of non-visually selected material. Visually selected plants revealed the highest incidence of virus GLRaV- 1 (37 %) and in addition to that a 15 % incidence of rugose wood (RW) disease symptoms.</p>
44
Jarugula, Sridhar, Olufemi J. Alabi, Robert R. Martin, and Rayapati A. Naidu. "Genetic Variability of Natural Populations of Grapevine leafroll-associated virus 2 in Pacific Northwest Vineyards." Phytopathology® 100, no. 7 (July 2010): 698–707. http://dx.doi.org/10.1094/phyto-100-7-0698.
Full textAbstract:
Genetic variability of field populations of Grapevine leafroll-associated virus 2 (GLRaV-2) in Pacific Northwest (PNW) vineyards was characterized by sequencing the entire coat protein (CP) and a portion of the heat-shock protein-70 homolog (HSP70h) genes. Phylogenetic analysis of CP and HSP70h nucleotide sequences obtained in this study and corresponding sequences from GenBank revealed segregation of GLRaV-2 isolates into six lineages with virus isolates from PNW distributed in ‘PN’, ‘H4’, and ‘RG’ lineages. An estimation of the ratio of nonsynonymous substitutions per nonsynonymous site to synonymous substitutions per synonymous site indicated that different selection pressures may be acting on the two genomic regions encoding proteins with distinct functions. Multiple alignments of CP amino acid sequences showed lineage-specific differences. Enzyme-linked immunosorbent assay results indicated that GLRaV-2-specific antibodies from a commercial source are unable to reliably detect GLRaV-2 isolates in the RG lineage, thereby limiting antibody-based diagnosis of all GLRaV-2 isolates currently found in PNW vineyards. A protocol based on reverse-transcription polymerase chain reaction and restriction fragment length polymorphism analysis was developed for differentiating GLRaV-2 isolates belonging to the three lineages present in the region. The taxonomic status of GLRaV-2 is discussed in light of the current knowledge of global genetic diversity of the virus.
45
Engel, E. A., P. Escobar, C. Montt, S. Gómez-Talquenca, and P. D. T. Valenzuela. "First Report on the Occurrence of Grapevine leafroll-associated virus 7 and 9 in Chilean Grapevines." Plant Disease 92, no. 8 (August 2008): 1252. http://dx.doi.org/10.1094/pdis-92-8-1252c.
Full textAbstract:
Grapevine is one of the oldest horticultural crops and represents a highly valuable agricultural commodity. So far, nine distinct Grapevine leafroll-associated viruses (GLRaVs) within the Closteroviridae family have been found to be associated with grapevine leafroll disease (3). Previous studies have demonstrated a high incidence of GLRaV-1, -2, and -3 in Chile (2). To determine if other GLRaVs were present, 21 dormant cane samples were screened with a comprehensive 70-mer oligonucleotide microarray designed to simultaneously detect all grapevine viruses with total or partial genomic sequence available. The array contained 570 unique probes designed against specific regions of more than 40 viral genomes (E. Engel et al., 15th ICVG [Abstr.], 2006). One sample (cv. Black Seedless) showing a microarray hybridization pattern compatible with a mixed infection of GLRaV-7 and GLRaV-1 was analyzed by ELISA using GLRaV-7 specific antibodies (Agritest, Valenzano, Italy) and reverse transcription (RT)-PCR using virus-specific primers LR7-F: 5′- TAT ATC CCA ACG GAG ATG GC -3′ and LR7-R: 5′- ATG TTC CTC CAC CAA AAT CG -3′ (based on GenBank Accession No. Y15987). The serological analysis confirmed the presence of GLRaV-7 with further confirmation by the RT-PCR product of 502 bp corresponding to a fragment of the HSP70h gene that was cloned and sequenced. The Chilean GLRaV-7 sequence (GenBank Accession No. EU334662) showed 94% nucleotide and 95% amino acid identity when compared with a corresponding region of another GLRaV-7 isolate from Albania (GenBank Accession No. Y15987). GLRaV-1 infection was confirmed by ELISA (Bioreba AG, Reinach, Switzerland) and RT-PCR. A second sample (cv. Tintorera) showing microarray hybridization pattern compatible with a mixed infection of GLRaV-9 and Grapevine virus A (GVA) was analyzed by RT-PCR using virus-specific primers LR9-F: 5′- CGG CAT AAG AAA AGA TGG CAC -3′ and LR9-R: 5′- TCA TTC ACC ACT GCT TGA AC -3′ (1). The RT-PCR product of 393 bp corresponding to a fragment of the HSP70h gene was cloned and sequenced (GenBank Accession No. EU334663), showing 94% nucleotide and 95% amino acid identity when compared with a corresponding region of another GLRaV-9 isolate from the United States (GenBank Accession No. AY297819). Since there are no commercial antibodies available for GLRaV-9 detection, a second pair of primers, LR9-F1: 5′- AAA GGT TTC TGC TGG TTA CC -3′ and LR9-R1: 5′- CTT TCA GAA CAG TCC TCC TC -3′ that amplified a fragment of ORF1a was also used. The 301-bp product was cloned and sequenced (GenBank Accession No. EU588989) showing 93.7% nucleotide and 98% amino acid identity when compared with a corresponding region of another GLRaV-9 isolate (GenBank Accession No. AY297819). GVA infection was confirmed by ELISA (Bioreba AG) and RT-PCR. To our knowledge, this is the first report of GLRaV-7 and GLRaV-9 in Chile. Further studies will help determine the effect and incidence of these viruses in Chilean grapevines. References: (1) R. Alkowni et al. J. Plant Pathol. 86:123, 2004. (2) N. Fiore et al. J. Plant Pathol. 90:125, 2008. (3) G. P. Martelli and E. Boudon-Padieu. Options Méditerr. B55, 2006.
46
Adiputra, Jati, Sandya R. Kesoju, and Rayapati A. Naidu. "The Relative Occurrence of Grapevine leafroll-associated virus 3 and Grapevine red blotch virus in Washington State Vineyards." Plant Disease 102, no. 11 (November 2018): 2129–35. http://dx.doi.org/10.1094/pdis-12-17-1962-re.
Full textAbstract:
Vineyard surveys were conducted for three consecutive seasons in eastern Washington State, the major grapevine-growing region in the state, to document the occurrence of Grapevine leafroll-associated virus 3 (GLRaV-3) and Grapevine red blotch virus (GRBV). The majority of samples were collected from red-berried wine grape (Vitis vinifera) cultivars exhibiting symptoms of or suspected for grapevine leafroll (GLD) and red blotch (GRBD) diseases. A limited number of samples from white-berried cultivars were collected randomly due to the lack of visual symptoms. Samples were collected from a total of 2,063 grapevines from 18 red-berried cultivars and seven white-berried cultivars planted in eight American Viticultural Areas and tested for GLRaV-3 and GRBV using RT-PCR and PCR, respectively. The results showed 67.77% and 6.01% of total samples positive for GLRaV-3 and GRBV, respectively, and 9.06% of samples positive for both viruses. About 17% of samples tested negative for the two viruses, but some of these samples were positive for GLRaV-2 and GLRaV-4. Overall results indicated that GLRaV-3 was more common than GRBV, independent of cultivars and the geographic origin of samples. Due to variability in symptoms in red-berried cultivars, virus-specific diagnostic assays were deemed necessary for reliable identification of GLRaV-3 and GRBV and to differentiate GLD and GRBD symptoms from those induced by biotic and abiotic stresses in vineyards. A multiplex PCR protocol was developed for simultaneous detection of GLRaV-3 and GRBV in grapevine samples. A global phylogenetic analysis of GRBV genome sequences revealed segregation of virus isolates from Washington State vineyards into two distinct clades, with the majority of isolates belonging to clade II.
47
Jarugula, S., M. J. Soule, A. Rowhani, and R. A. Naidu. "First Report of Grapevine leafroll-associated virus-9 in Washington State Vineyards." Plant Disease 92, no. 3 (March 2008): 485. http://dx.doi.org/10.1094/pdis-92-3-0485c.
Full textAbstract:
Grapevine leafroll disease (GLD) has been recognized as one of the major constraints to the production of wine grapes in Washington State. At least nine distinct Grapevine leafroll-associated viruses (GLRaV-1 to -9) have been detected in grapevines showing GLD symptoms in grape-growing areas of several countries. Previous studies documented the presence of GLRaV-1, -2, and -3 in Washington State (3). We initiated a program to test grapevine cultivars with GLD symptoms for the occurrence of the other GLRaVs. Leaf samples were collected from individual grapevines of red-berried grapevine cultivars showing typical GLD symptoms and tested by single-tube reverse transcription (RT)-PCR. Of nearly 300 samples from 13 cultivars in 19 vineyards, 14 samples from 5 cultivars (Cabernet Sauvignon, Merlot, Pinot Noir, Mourvedre, and Lagrein) in different vineyards tested positive for GLRaV-9 using primers LR9 F/F (5′-CGG CAT AAG AAA AGA TGG CAC-3′) and LR9 R/R (5′-TCA TTC ACC ACT GCT TGA AC-3′), specific for the HSP-70h gene of GLRaV-9 (1). To confirm the identity of the RT-PCR products, the 393-bp amplicons obtained from each of these five cultivars were cloned individually into the pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced from both orientations. Pairwise comparisons of these sequences (GenBank Accession Nos. EF101737, EF101738, EF101739, EF101740, and EU252530) with corresponding sequences of other GLRaVs in GenBank showed 94 to 100 and 96 to 100% identity at the nucleotide and amino acid level, respectively, with the sequence of HSP-70h gene of GLRaV-9 (GenBank Accession No. AY297819). Antiserum specific to GLRaV-9 was not accessible, therefore, an additional 540-nucleotide fragment specific to the coat protein (CP) gene of GLRaV-9 was amplified from cv. Lagrein using primers LR9-CP-F (5′ TAC CGT CGA CAC TTT CGA AGC ACT 3′) and LR9-CP-R (5′ TGA GGC GTC GTA ACC GAA CAA TCT 3′). PCR amplified fragments were cloned and sequenced. A comparison of this sequence (GenBank Accession No. EU251512) with corresponding nucleotide sequences of other GLRaVs in GenBank showed 96% identity with CP of GLRaV-9 (GenBank Accession No. AY297819), further confirming the presence of GLRaV-9. Previously, GLRaV-9 was reported in grapevines in California (1), Tunisia (2), and Western Australia (4). To our knowledge, our results are the first evidence for the occurrence of GLRaV-9 in Washington State vineyards. Results from our study and previous reports (1,2,4) indicate the wide distribution of GLRaV-9 in several Vitis vinifera cultivars. The economic impact of GLRaV-9 on wine grape cultivars, however, remains to be determined. References: (1) R. Alkowni et al. J. Plant Pathol. 86:123, 2004. (2) N. Mahfoudhi et al. Plant Dis. 91:1359, 2007. (3) R. R. Martin et al. Plant Dis. 89:763, 2005. (4) B. K. Peake et al. Aust. Plant Pathol. 33:445, 2004.
48
Kumar, S., S. D. Sawant, I. S. Sawant, K. Prabha, R. K. Jain, and V. K. Baranwal. "First Report of Grapevine leafroll-associated virus 1 Infecting Grapevines in India." Plant Disease 96, no. 12 (December 2012): 1828. http://dx.doi.org/10.1094/pdis-07-12-0647-pdn.
Full textAbstract:
Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.
49
Mahfoudhi, N., M. Digiaro, and M. H. Dhouibi. "Transmission of Grapevine Leafroll Viruses by Planococcus ficus (Hemiptera: Pseudococcidae) and Ceroplastes rusci (Hemiptera: Coccidae)." Plant Disease 93, no. 10 (October 2009): 999–1002. http://dx.doi.org/10.1094/pdis-93-10-0999.
Full textAbstract:
Grapevine leafroll associated virus-3 (GLRaV-3) and Grapevine leafroll associated virus-5 (GLRaV-5), two members of the genus Ampelovirus associated with grapevine leafroll disease, were transmitted by the mealybug Planococcus ficus and the soft scale insect Ceroplastes rusci from infected to healthy vines under experimental conditions. The efficiencies of transmission of GLRaV-3 and GLRaV-5 by P. ficus were 23.3 and 8.3%, respectively, and by C. rusci were 3.3 and 1.7%, respectively. Juvenile instars of P. ficus were more efficient in transmission of the viruses than adult females. This is the first report of the ability of C. rusci to transmit these viruses to grapevines.
50
Chooi, Kar Mun, Vaughn A. Bell, Arnaud G. Blouin, Daniel Cohen, Dion Mundy, Warwick Henshall, and Robin M. MacDiarmid. "Grapevine Leafroll-Associated Virus 3 Genotype Influences Foliar Symptom Development in New Zealand Vineyards." Viruses 14, no. 7 (June 21, 2022): 1348. http://dx.doi.org/10.3390/v14071348.
Full textAbstract:
Grapevine leafroll disease (GLD) constrains wine production worldwide. In New Zealand, the main causal agent of GLD is grapevine leafroll-associated virus 3 (GLRaV-3). To control GLD, an integrated management program is used and includes removing (roguing) GLRaV-3-infected vines from the vineyard. The classical foliar symptoms from virus-infected red-berry cultivars are leaves with dark red intervein, green veins, and downward rolling of margins. Growers use these phenotypic cues to undertake visual symptom identification (VSI) for GLD. However, the influence of the known large genetic variation among GLRaV-3 isolates on the foliar symptoms from different grapevine cultivars remains undescribed, especially in cool-climate growing environments, such as New Zealand. Over three vintages (2015, 2016, and 2017), VSI for GLD was undertaken at three field sites in New Zealand (Auckland, Hawke’s Bay, and Marlborough), each including four cultivars (Merlot, Pinot noir, Sauvignon blanc, and Pinot gris) infected with three GLRaV-3 genotypes (Groups I, VI, and X) or GLRaV-3-uninfected control plants. Throughout this study, no visual symptoms were observed on white-berry cultivars infected with GLRaV-3. For red-berry cultivars, the greatest variability in observed foliar symptoms among regional study sites, cultivars, and GLRaV-3 genotypes was observed early in the growing season. In particular, Group X had significantly delayed symptom expression across all three sites compared with Groups I and VI. As the newly infected, young vines matured in years 2 and 3, the GLRaV-3 genotype, cultivar, region, and environmental conditions had minimal influence on the accuracy of VSI, with consistently high (>95%) within-vintage identification by the end of each vintage. The results from this study strongly support the use of VSI for the GLD management of red-berry cultivar grapevines, Merlot and Pinot noir, as a reliable and cost-effective tool against GLD.