Relevant bibliographies by topics / Genetic diversity / Journal articles

Journal articles on the topic 'Genetic diversity'

To see the other types of publications on this topic, follow the link: Genetic diversity.
Author: Grafiati
Published: 4 June 2021
Last updated: 22 June 2024

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Genetic diversity.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Sivanandan, Chithra. "Genetic Diversity of Fungal Endophytes." International Journal of Science and Research (IJSR) 13, no. 4 (April 5, 2024): 1639–46. http://dx.doi.org/10.21275/sr24426143007.

Full text
APA, Harvard, Vancouver, ISO, and other styles
2

McHugh, Drake. "Genetic Diversity." Environmental Conservation 15, no. 1 (1988): 76–77. http://dx.doi.org/10.1017/s0376892900028587.

Full text
APA, Harvard, Vancouver, ISO, and other styles
3

Sharma, Mamta, and Dr R. S. Meena Dr. R.S. Meena. "Genetic Diversity in Fennel (Foeniculum Vulgare Mill)." International Journal of Scientific Research 2, no. 8 (June 1, 2012): 3–4. http://dx.doi.org/10.15373/22778179/aug2013/2.

Full text
APA, Harvard, Vancouver, ISO, and other styles
4

S, CHITHRA, and RAJALAKSHMI R. "Genetic diversity study of Tagetes Linn. (Asteraceae)." Journal of Medicinal and Aromatic Plant Sciences 36, no. 2 (July 1, 2014): 49–58. http://dx.doi.org/10.62029/jmaps.v36i2.s.

Full text
Abstract:
Present study was conducted to access genetic diversity among 10 genotypes of two species of Tagetes i.e., Tagetes erecta (6 cultivars) and Tagetes patula (4 cultivars). Though Tagetes possesses great economical value, little attention has been paid for its genetic improvement. Four polymorphic isozyme systems (AAT, MDH, EST and PRX) were selected for cultivar identification. In isozyme analysis, peroxidase was able to differentiate both the species. Esterase showed large number of alleles and polymorphism to differentiate the two species as well as cultivars of the same species. The data would be important in detailing the level of variation and relationship within and between species to plan future domestication trials in Tageties.
APA, Harvard, Vancouver, ISO, and other styles
5

Vankova, O. E., and N. F. Brusnigina. "Cytomegalovirus genetic diversity." Journal Infectology 9, no. 2 (January 1, 2017): 5–12. http://dx.doi.org/10.22625/2072-6732-2017-9-2-5-12.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Schull, W. J. "Genetic Diversity Survey." Science 279, no. 5347 (January 2, 1998): 10h—15. http://dx.doi.org/10.1126/science.279.5347.10h.

Full text
APA, Harvard, Vancouver, ISO, and other styles
7

Sparrow, Robert. "Imposing Genetic Diversity." American Journal of Bioethics 15, no. 6 (June 2015): 2–10. http://dx.doi.org/10.1080/15265161.2015.1028658.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Williams, Scott. "Genetic diversity matters." New Scientist 241, no. 3223 (March 2019): 22–23. http://dx.doi.org/10.1016/s0262-4079(19)30552-4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Kumar, Anand, and Vivudh Pratap Singh. "Maize Genetic Diversity: Utilization of Molecular Markers in Genetic Diversity." International Journal of Current Microbiology and Applied Sciences 9, no. 2 (February 10, 2020): 1948–59. http://dx.doi.org/10.20546/ijcmas.2020.902.222.

Full text
APA, Harvard, Vancouver, ISO, and other styles
10

Alvarez-Mejia, Cesar, Gustavo Hernandez-Guzman, Varinia Lopez-Ramirez, Jose-Humberto Valenzuela-Soto, and Rodolfo Marsch. "Genetic Diversity in Pseudomonas syringae pv. maculicola Strains." Journal of Pure and Applied Microbiology 12, no. 3 (September 30, 2018): 1233–38. http://dx.doi.org/10.22207/jpam.12.3.24.

Full text
APA, Harvard, Vancouver, ISO, and other styles
11

Vellend, Mark, and Monica A. Geber. "Connections between species diversity and genetic diversity." Ecology Letters 8, no. 7 (June 15, 2005): 767–81. http://dx.doi.org/10.1111/j.1461-0248.2005.00775.x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
12

Magurran, Anne E. "Ecology: Linking Species Diversity and Genetic Diversity." Current Biology 15, no. 15 (August 2005): R597—R599. http://dx.doi.org/10.1016/j.cub.2005.07.041.

Full text
APA, Harvard, Vancouver, ISO, and other styles
13

Exposito-Alonso, Moises, Tom R. Booker, Lucas Czech, Lauren Gillespie, Shannon Hateley, Christopher C. Kyriazis, Patricia L. M. Lang, et al. "Genetic diversity loss in the Anthropocene." Science 377, no. 6613 (September 23, 2022): 1431–35. http://dx.doi.org/10.1126/science.abn5642.

Full text
Abstract:
Anthropogenic habitat loss and climate change are reducing species’ geographic ranges, increasing extinction risk and losses of species’ genetic diversity. Although preserving genetic diversity is key to maintaining species’ adaptability, we lack predictive tools and global estimates of genetic diversity loss across ecosystems. We introduce a mathematical framework that bridges biodiversity theory and population genetics to understand the loss of naturally occurring DNA mutations with decreasing habitat. By analyzing genomic variation of 10,095 georeferenced individuals from 20 plant and animal species, we show that genome-wide diversity follows a mutations-area relationship power law with geographic area, which can predict genetic diversity loss from local population extinctions. We estimate that more than 10% of genetic diversity may already be lost for many threatened and nonthreatened species, surpassing the United Nations’ post-2020 targets for genetic preservation.
APA, Harvard, Vancouver, ISO, and other styles
14

Žáková, M., and M. Benková. "Genetic Diversity of Genetic Resources of Winter Barley Maintained in the Genebank in Slovakia." Czech Journal of Genetics and Plant Breeding 40, No. 4 (November 23, 2011): 118–26. http://dx.doi.org/10.17221/3709-cjgpb.

Full text
Abstract:
A set of 140 winter barley genetic resources of foreign and domestic origins was tested on experimental basis of RIPP in 1997–1999 to characterise the variability of the accessions based on agronomic data using multivariate methods. In the set tested, variability was studied of selected traits and characteristics such as: plant height (PH), weight of 1000 grains (W), grain number per a spike (SNG), grain uniformity – ratio of front seeds over 2.5  m sieve (GU), vegetation period – sowing/full maturity (VM) and seed yield (Y). Agronomic characters show great variability between cultivars. The study of matrix interrelationships between different variables showed that the yield is greatly correlated with traits:  vegetation period – sowing/full maturity, grain uniformity and grain number per a spike. High positive correlation was obtained between the grain uniformity and the weight of 1000 grains. Negative correlation was found between the grain number per a spike and weight of 1000 grains in six-row barley. Correlations between agronomic traits differed between two- and six-row barley sets. The study revealed the existence of genetic differences among accessions as well as differences between two- and six-row winter barley and between the genotypes of domestic and foreign country origin, respectively. Results of this study provided information about diversity which should be of particular interest for the further collecting of genetic resources.  
APA, Harvard, Vancouver, ISO, and other styles
15

BERT, T. M., S. SEYOUM, M. D. TRINGALI, and A. McMILLEN-JACKSON. "Methodologies for conservation assessments of the genetic biodiversity of aquatic macro-organisms." Brazilian Journal of Biology 62, no. 3 (August 2002): 387–408. http://dx.doi.org/10.1590/s1519-69842002000300002.

Full text
Abstract:
International organizations and biodiversity scientists recognize three levels of biodiversity: genetic, species, and ecosystem. However, most studies with the goal of assessing biodiversity collect data at only a single level -- that of the species. Even when multiple levels of biodiversity are considered, usually only ecosystem diversity is also evaluated. Genetic diversity is virtually never considered. Yet, genetic diversity is essential for the maintenance of populations and species over ecological and evolutionary time periods. Moreover, because components of genetic diversity are independent of either species or ecosystem diversity, genetic diversity can provide a unique measure by which to assess the value of regions for conservation. Regions can be valuable for conservation of their genetic resources regardless of their levels of species or ecosystem uniqueness or diversity. In general, the same methods and statistical programs that are used to answer questions about population genetics and phylogenetics are applicable to conservation genetics. Thus, numerous genetic techniques, laboratory methods, and statistical programs are available for assessing regional levels of genetic diversity for conservation considerations. Here, we provide the rationale, techniques available, field and laboratory protocols, and statistical programs that can be used to estimate the magnitude and type of genetic diversity in regions. We also provide information on how to obtain commonly utilized statistical programs and the type of analyses that they include. The guide that we present here can be used to conduct investigations of the genetic diversity of regions under consideration for conservation of their natural resources.
APA, Harvard, Vancouver, ISO, and other styles
16

Teixeira, João C., and Christian D. Huber. "The inflated significance of neutral genetic diversity in conservation genetics." Proceedings of the National Academy of Sciences 118, no. 10 (February 19, 2021): e2015096118. http://dx.doi.org/10.1073/pnas.2015096118.

Full text
Abstract:
The current rate of species extinction is rapidly approaching unprecedented highs, and life on Earth presently faces a sixth mass extinction event driven by anthropogenic activity, climate change, and ecological collapse. The field of conservation genetics aims at preserving species by using their levels of genetic diversity, usually measured as neutral genome-wide diversity, as a barometer for evaluating population health and extinction risk. A fundamental assumption is that higher levels of genetic diversity lead to an increase in fitness and long-term survival of a species. Here, we argue against the perceived importance of neutral genetic diversity for the conservation of wild populations and species. We demonstrate that no simple general relationship exists between neutral genetic diversity and the risk of species extinction. Instead, a better understanding of the properties of functional genetic diversity, demographic history, and ecological relationships is necessary for developing and implementing effective conservation genetic strategies.
APA, Harvard, Vancouver, ISO, and other styles
17

Debouck, Daniel G. "Managing Plant Genetic Diversity." Crop Science 43, no. 2 (March 2003): 749–50. http://dx.doi.org/10.2135/cropsci2003.749a.

Full text
APA, Harvard, Vancouver, ISO, and other styles
18

Mengistu, Lemma W., and Calvin G. Messersmith. "Genetic diversity of kochia." Weed Science 50, no. 4 (July 2002): 498–503. http://dx.doi.org/10.1614/0043-1745(2002)050[0498:gdok]2.0.co;2.

Full text
APA, Harvard, Vancouver, ISO, and other styles
19

LI, Juan, and Ke-Qin ZHANG. "Genetic diversity of microorganisms." Hereditas (Beijing) 34, no. 11 (November 20, 2012): 1399–408. http://dx.doi.org/10.3724/sp.j.1005.2012.01399.

Full text
APA, Harvard, Vancouver, ISO, and other styles
20

Williams, Scott M., Giorgio Sirugo, and Sarah A. Tishkoff. "Embracing African Genetic Diversity." Med 2, no. 1 (January 2021): 19–20. http://dx.doi.org/10.1016/j.medj.2020.12.019.

Full text
APA, Harvard, Vancouver, ISO, and other styles
21

Aradhva, K. M., F. Zee, and R. M. Manshardt. "Genetic Diversity in Nephelium." HortScience 30, no. 4 (July 1995): 795F—795. http://dx.doi.org/10.21273/hortsci.30.4.795f.

Full text
Abstract:
Fifty-six accessions involving five taxa of Nephelium (N. Iappaceum varieties lappaceum and pallens, N. hypoleucum, N. ramboutan-ake, and N. cuspidatum) were fingerprinted and evaluated for genetic diversity using isozyme polymorphism. All five taxa were polymorphic for most of the enzymes encoded by 10 putative loci. Number of alleles per locus ranged from three for Pgi-1 to nine for Pgi-2 with a total of 57 alleles. Thirty-eight accessions out of 56 possessed unique isozyme genotypes, indicating a high level of diversity in the collection. On average, 80% of the loci were polymorphic and the expected and observed heterozygosities were 0.374 and 0.373, respectively. The cluster analysis of the isozyme data revealed five distinct clusters representing the five taxa included in the study. Genetic differentiation within N. Iappaceum var. Iappaceum was evident from the cluster analysis. Isozyme data indicated that N. ramboutan-ake is the closest relative of N. Iappaceum var. Iappaceum, followed by N. hypoleucum, N. Iappaceum var. pallens, and N. cuspidatum. Interestingly, the varieties of N. Iappaceum exhibited genetic divergence far beyond that of the congenerics, N. hypoleucum and N. ramboutan-ake and may require a taxonomic revision.
APA, Harvard, Vancouver, ISO, and other styles
22

Coutinho, Thamara Carvalho, Telles Timóteo Da Silva, and Gustavo Leal Toledo. "Recombination and Genetic Diversity." TEMA (São Carlos) 13, no. 3 (December 22, 2012): 265–75. http://dx.doi.org/10.5540/tema.2013.013.03.0265.

Full text
Abstract:
In this paper we present a spatial stochastic model for genetic recombination, that answers if diversity is preserved in an infinite population of recombinating individuals distributed spatially. We show that, for finite times, recombination may maintain all the various potential different types, but when time grows infinitely, the diversity of individuals extinguishes off. So under the model premisses, recombination and spatial localization alone are not enough to explain diversity in a population. Further we discuss an application of the model to a controversy regarding the diversity of "Major Histocompatibility Complex" (MHC).
APA, Harvard, Vancouver, ISO, and other styles
23

Seabrook, Jeremy. "Biotechnology and genetic diversity." Race & Class 34, no. 3 (January 1993): 15–30. http://dx.doi.org/10.1177/030639689303400302.

Full text
APA, Harvard, Vancouver, ISO, and other styles
24

Howlett, Rory. "Plants lose genetic diversity." Nature Climate Change 2, no. 2 (January 27, 2012): 74. http://dx.doi.org/10.1038/nclimate1403.

Full text
APA, Harvard, Vancouver, ISO, and other styles
25

Bates, D. M. "Managing Plant Genetic Diversity." Heredity 89, no. 3 (September 2002): 235. http://dx.doi.org/10.1038/sj.hdy.6800105.

Full text
APA, Harvard, Vancouver, ISO, and other styles
26

Meltzer, Paul S. "Genetic Diversity in Melanoma." New England Journal of Medicine 353, no. 20 (November 17, 2005): 2104–7. http://dx.doi.org/10.1056/nejmp058173.

Full text
APA, Harvard, Vancouver, ISO, and other styles
27

Meade, John C., and Jane M. Carlton. "Genetic diversity inTrichomonas vaginalis." Sexually Transmitted Infections 89, no. 6 (May 23, 2013): 444–48. http://dx.doi.org/10.1136/sextrans-2013-051098.

Full text
APA, Harvard, Vancouver, ISO, and other styles
28

Ellegren, Hans, and Nicolas Galtier. "Determinants of genetic diversity." Nature Reviews Genetics 17, no. 7 (June 6, 2016): 422–33. http://dx.doi.org/10.1038/nrg.2016.58.

Full text
APA, Harvard, Vancouver, ISO, and other styles
29

Burgess, Darren J. "Determinants of genetic diversity." Nature Reviews Genetics 15, no. 10 (September 9, 2014): 642. http://dx.doi.org/10.1038/nrg3825.

Full text
APA, Harvard, Vancouver, ISO, and other styles
30

Lanham, P. G., and R. M. Brennan. "GENETIC DIVERSITY IN RIBES." Acta Horticulturae, no. 546 (February 2001): 135–37. http://dx.doi.org/10.17660/actahortic.2001.546.11.

Full text
APA, Harvard, Vancouver, ISO, and other styles
31

Clark, C. Graham, Mehreen Zaki, and Ibne Karim Md Ali. "Genetic diversity inEntamoeba histolytica." Journal of Biosciences 27, no. 6 (November 2002): 603–7. http://dx.doi.org/10.1007/bf02704854.

Full text
APA, Harvard, Vancouver, ISO, and other styles
32

Dhar, M. K., A. K. Koul, and A. Langer. "Genetic diversity among Plantagos." Theoretical and Applied Genetics 79, no. 2 (February 1990): 216–18. http://dx.doi.org/10.1007/bf00225954.

Full text
APA, Harvard, Vancouver, ISO, and other styles
33

Pearce, David. "Economics and genetic diversity." Futures 19, no. 6 (December 1987): 710–12. http://dx.doi.org/10.1016/0016-3287(87)90088-7.

Full text
APA, Harvard, Vancouver, ISO, and other styles
34

Aradhva, K. M., F. Zee, and R. M. Manshardt. "Genetic Diversity in Nephelium." HortScience 30, no. 4 (July 1995): 795F—795. http://dx.doi.org/10.21273/hortsci.30.4.795.

Full text
Abstract:
Fifty-six accessions involving five taxa of Nephelium (N. Iappaceum varieties lappaceum and pallens, N. hypoleucum, N. ramboutan-ake, and N. cuspidatum) were fingerprinted and evaluated for genetic diversity using isozyme polymorphism. All five taxa were polymorphic for most of the enzymes encoded by 10 putative loci. Number of alleles per locus ranged from three for Pgi-1 to nine for Pgi-2 with a total of 57 alleles. Thirty-eight accessions out of 56 possessed unique isozyme genotypes, indicating a high level of diversity in the collection. On average, 80% of the loci were polymorphic and the expected and observed heterozygosities were 0.374 and 0.373, respectively. The cluster analysis of the isozyme data revealed five distinct clusters representing the five taxa included in the study. Genetic differentiation within N. Iappaceum var. Iappaceum was evident from the cluster analysis. Isozyme data indicated that N. ramboutan-ake is the closest relative of N. Iappaceum var. Iappaceum, followed by N. hypoleucum, N. Iappaceum var. pallens, and N. cuspidatum. Interestingly, the varieties of N. Iappaceum exhibited genetic divergence far beyond that of the congenerics, N. hypoleucum and N. ramboutan-ake and may require a taxonomic revision.
APA, Harvard, Vancouver, ISO, and other styles
35

Elfituri Muftah Eltariki, Fuzia, Kartikeya Tiwari, Indang Ariati Ariffin, and Mohammed Abdelfatah Alhoot. "Genetic Diversity of Fungi Producing Mycotoxins in Stored Crops." Journal of Pure and Applied Microbiology 12, no. 4 (December 30, 2018): 1815–23. http://dx.doi.org/10.22207/jpam.12.4.15.

Full text
APA, Harvard, Vancouver, ISO, and other styles
36

Komatsudaa, T., Y. Manoa, Y. Turuspekovb, I. Hondab, N. Kawadab, and Y. Watanabe. "Inheritance and genetic diversity of flowering types in barley." Czech Journal of Genetics and Plant Breeding 41, Special Issue (July 31, 2012): 194. http://dx.doi.org/10.17221/6167-cjgpb.

Full text
APA, Harvard, Vancouver, ISO, and other styles
37

Blackburn, HD. "Genetic Selection and Conservation of Genetic Diversity*." Reproduction in Domestic Animals 47 (July 25, 2012): 249–54. http://dx.doi.org/10.1111/j.1439-0531.2012.02083.x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
38

Harpending, Henry, and Gregory Cochran. "Genetic diversity and genetic burden in humans." Infection, Genetics and Evolution 6, no. 2 (March 2006): 154–62. http://dx.doi.org/10.1016/j.meegid.2005.04.002.

Full text
APA, Harvard, Vancouver, ISO, and other styles
39

Neelima, S., K. Ashok Kumar, K. Venkataramanamma, and Y. Padmalatha. "Genetic variability and genetic diversity in sunflower." Electronic Journal of Plant Breeding 7, no. 3 (2016): 703. http://dx.doi.org/10.5958/0975-928x.2016.00090.9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
40

Vajda, I., and J. Zvárová. "On Genetic Information, Diversity and Distance." Methods of Information in Medicine 45, no. 02 (2006): 173–79. http://dx.doi.org/10.1055/s-0038-1634063.

Full text
Abstract:
Summary Objectives: General information-theoretic concepts such as f-divergence, f-information and f-entropy are applied to the genetic models where genes are characterized by randomly distributed alleles. The paper thus presents an information-theoretic background for measuring genetic distances between populations, genetic information in various observations on individuals about their alleles and, finally, genetic diversities in various populations. Methods: Genetic distances were derived as divergences between frequencies of alleles representing a gene in two different populations. Genetic information was derived as a measure of statistical association between the observations taken on individuals and the alleles of these individuals. Genetic diversities were derived from divergences and information. Results: The concept of genetic f-information introduced in the paper seems to be new. We show that the measures of genetic distance and diversity used in the previous literature are special cases of the genetic f-divergence and f-diversity introduced in the paper and illustrated by examples. We also display intimate connections between the genetic f-information and the genetic f-divergence on one side and genetic f-diversity on the other side. The examples at the same time also illustrate practical computations and applications of the important concepts of quantitative genetics introduced in the paper. Conclusions: We discussed a general class of f-divergence measures that are suitable measures of genetic distance between populations characterized by concrete frequencies of alleles. We have shown that a wide class of genetic information, called f-information, can be obtained from f-divergences and that a wide class of measures of genetic diversity, called f-diversities, can be obtained from the f-divergences and f-information.
APA, Harvard, Vancouver, ISO, and other styles
41

Pfeiffer, Vera Wilder, Brett Michael Ford, Johann Housset, Audrey McCombs, José Luis Blanco‐Pastor, Nicolas Gouin, Stéphanie Manel, and Angéline Bertin. "Partitioning genetic and species diversity refines our understanding of species–genetic diversity relationships." Ecology and Evolution 8, no. 24 (December 2018): 12351–64. http://dx.doi.org/10.1002/ece3.4530.

Full text
APA, Harvard, Vancouver, ISO, and other styles
42

Bonneuil, Noël, and Raouf Boucekkine. "Genetic diversity and its value: conservation genetics meets economics." Conservation Genetics Resources 12, no. 1 (October 25, 2019): 141–51. http://dx.doi.org/10.1007/s12686-019-01113-y.

Full text
APA, Harvard, Vancouver, ISO, and other styles
43

Watanabe, K. N., and J. A. Watanabe. "Genetic Diversity and Molecular Genetics of Ornamental Plant Species." Biotechnology & Biotechnological Equipment 14, no. 2 (January 2000): 19–21. http://dx.doi.org/10.1080/13102818.2000.10819081.

Full text
APA, Harvard, Vancouver, ISO, and other styles
44

Holderegger, Rolf, Urs Kamm, and Felix Gugerli. "Adaptive vs. neutral genetic diversity: implications for landscape genetics." Landscape Ecology 21, no. 6 (August 2006): 797–807. http://dx.doi.org/10.1007/s10980-005-5245-9.

Full text
APA, Harvard, Vancouver, ISO, and other styles
45

Peter, Benjamin M., Desislava Petkova, and John Novembre. "Genetic Landscapes Reveal How Human Genetic Diversity Aligns with Geography." Molecular Biology and Evolution 37, no. 4 (November 28, 2019): 943–51. http://dx.doi.org/10.1093/molbev/msz280.

Full text
Abstract:
Abstract Geographic patterns in human genetic diversity carry footprints of population history and provide insights for genetic medicine and its application across human populations. Summarizing and visually representing these patterns of diversity has been a persistent goal for human geneticists, and has revealed that genetic differentiation is frequently correlated with geographic distance. However, most analytical methods to represent population structure do not incorporate geography directly, and it must be considered post hoc alongside a visual summary of the genetic structure. Here, we estimate “effective migration” surfaces to visualize how human genetic diversity is geographically structured. The results reveal local patterns of differentiation in detail and emphasize that while genetic similarity generally decays with geographic distance, the relationship is often subtly distorted. Overall, the visualizations provide a new perspective on genetics and geography in humans and insight to the geographic distribution of human genetic variation.
APA, Harvard, Vancouver, ISO, and other styles
46

TASMA, I. MADE, and SEKAR ARUMSARI. "ANALISIS DIVERSITAS GENETIK AKSESI KELAPA SAWIT KAMERUN BERDASARKAN MARKA SSR." Jurnal Penelitian Tanaman Industri 19, no. 4 (June 19, 2020): 194. http://dx.doi.org/10.21082/jlittri.v19n4.2013.194-202.

Full text
Abstract:
<p>ABSTRAK<br />Diversitas genetik aksesi kelapa sawit Indonesia saat ini sangat<br />rendah. Dalam usaha meningkatkan keragaman genetik telah dilakukan<br />eksplorasi plasma nutfah di pusat keragaman genetik kelapa sawit di<br />Kamerun. Tujuan dari penelitian ini untuk mengetahui diversitas genetik<br />dan tingkat polimorfisme berdasarkan marka SSR aksesi-aksesi kelapa<br />sawit Kamerun. Bahan tanaman yang digunakan 49 aksesi kelapa sawit<br />Kamerun, Afrika yang ditanam di Kebun Sumber Daya Genetik (SDG)<br />Sawit Sijunjung, Sumatera Barat. DNA genomik diisolasi dari tiap<br />individu aksesi menggunakan protokol isolasi DNA untuk tanaman<br />bergetah. DNA dianalisis menggunakan 20 marka SSR. Dendrogram<br />kekerabatan dikonstruksi menggunakan metode Unweighted Pair Group<br />Method Arithmetic (UPGMA) melalui software NTSYS-pc (Numerical<br />Taxonomy and Multivariate Analysis System) versi 2.1-pc. Hasil penelitian<br />menunjukkan nilai polimorfisme information content (PIC) marka SSR<br />tinggi sebesar 0,80 (berkisar 0,63-0,91). Jumlah alel yang terdeteksi per<br />marka SSR berkisar antara 4-15 alel per lokus SSR (rata-rata 8,75).<br />Analisis filogenetik 49 aksesi menghasilkan diversitas genetik 12,5-<br />54,72% (kemiripan genetik 55,28-87,50%). Pada diversitas genetik<br />54,72%, aksesi Kamerun terbagi menjadi tujuh kelompok masing-masing<br />terdiri dari 9, 28, 4, 2, 1, 2, dan 3 aksesi. Aksesi dengan diversitas genetik<br />tinggi dan berada pada klaster berbeda, potensial digunakan sebagai calon<br />tetua dalam program pemuliaan kelapa sawit.<br />Kata kunci: Elaeis guineensis Jacq., diversitas genetik, plasma nutfah,<br />marka SSR</p><p>ABSTRACT<br />Genetic diversity of the Indonesian oil palm collection is very low.<br />To improve their genetic variability, exploration from the oil palm center<br />of origins has been done in Kamerun. The objectives of this study were to<br />determine genetic and polymorphism level of the SSR markers Cameroon-<br />originated oil palm accessions. Genetic materials used were 49 Cameroon-<br />originated oil palm accessions collected at Sijunjung Oil Palm Germplam<br />Collection Station, West Sumatera. Genomic DNA was isolated using a<br />protocol for isolating DNA from leaves rich with latex. DNA was analyzed<br />using 20 SSR markers. A dendogram was constructed using the<br />Unweighted Pair Group Method Arithmetic (UPGMA) method through the<br />Numerical Taxonomy and Multivariate Analysis System software<br />(NTSYS-pc) version 2.1-pc. Results showed that the polimorfisme<br />information content (PIC) values of the SSR markers used was high, 0.80<br />(range from 0.63-0.91). The average number of the SSR alleles detected<br />was also high, 8.75 alleles (range from 4-15 alleles per SSR locus).<br />Phylogenetic analysis of the 49 oil palm accessions resulted genetic<br />diversity of 12.5-54.72% (genetic similarity of 55.28-87.50%). At genetic<br />diversity 54.72%, the 49 accessions were divided into seven clusters, each<br />consisted of 9, 28, 4, 2, 1, 2, and 3 accesions, respectively. Accessions<br />with high genetic diversity and located at different clusters may be useful<br />as parent candidates in the future oil palm breeding programs.<br />Key words: Elaeis guineensis Jacq., genetic diversity, germplasm, SSR<br />markers</p>
APA, Harvard, Vancouver, ISO, and other styles
47

Xuan, Zhou, Zheng Hong Li, Cheng Zhang, Hong Dao Zhang, Ji Lin Li, and Yan Ming Zhang. "An Application of Molecular Tools in Plant Genetic Diversity Conservation." Advanced Materials Research 955-959 (June 2014): 830–33. http://dx.doi.org/10.4028/www.scientific.net/amr.955-959.830.

Full text
Abstract:
The conservation and use of plant genetic diversity are essential to the continued maintenance and improvement of agricultural and forestry production and thus, to sustainable development and poverty alleviation. The dramatic advances in molecular genetics over the last decade years have provided workers involved in the conservation of plant genetic diversity with a range of new techniques. Molecular tools, such as molecular markers and other genomic applications, have been highly successful in characterizing existing genetic variation within species, which generates new genetic diversity that often extends beyond species boundaries. The objectives of this article are to review the molecular basis on plant genetic diversity conservation and summarize the continuously rising and application of molecular tool. Then, we look forward and consider the significant of application of molecular tools in plant genetic diversity conservation.
APA, Harvard, Vancouver, ISO, and other styles
48

CROW, J. F. "Human Genetic Diversity: Genetic Variation and Its Maintenance." Science 236, no. 4807 (June 12, 1987): 1475–76. http://dx.doi.org/10.1126/science.236.4807.1475-a.

Full text
APA, Harvard, Vancouver, ISO, and other styles
49

Neri, Jordana, Tânia Wendt, and Clarisse Palma-Silva. "Comparative phylogeography of bromeliad species: effects of historical processes and mating system on genetic diversity and structure." Botanical Journal of the Linnean Society 197, no. 2 (March 27, 2021): 263–76. http://dx.doi.org/10.1093/botlinnean/boab019.

Full text
Abstract:
Abstract A fundamental challenge in population genetics is to understand the role of ecological and historical processes in shaping genetic diversity patterns within and among species. Based on a set of nuclear microsatellite loci, we conducted a comparative study of the genetic diversity and structure of two epiphytic plant species: Vriesea simplex and V. scalaris (Bromeliaceae), endemic to the Brazilian Atlantic Rainforest. The results showed contrasting genetic diversity and structure patterns according to variation in reproductive systems of these species. High genetic diversity, high effective population sizes and low genetic differentiation were observed in the mainly outcrossing V. simplex populations. In contrast, low genetic diversity, low effective population sizes and high genetic differentiation were detected in the mainly selfing V. scalaris populations. Accordingly, the isolation-by-distance indicated stronger population structures in V. scalaris than in V. simplex. Both species showed a similar phylogeographic north-south split across the Atlantic Rainforest, suggesting possible multiple refugia in this biome. Historical climatic changes during the Pleistocene were possible determinants of the genetic diversity and structure of these species in the Atlantic Rainforest. Divergent mating systems (selfing vs. outcrossing), genetic drift and colonization history influenced the genetic diversity and structure of these Neotropical plant species.
APA, Harvard, Vancouver, ISO, and other styles
50

Nooratiny, I and Kumara Thevan Krishnan. "A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia." Journal of Tropical Resources and Sustainable Science (JTRSS) 10, no. 1 (June 30, 2022): 39–42. http://dx.doi.org/10.47253/jtrss.v10i1.897.

Full text
Abstract:
A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.
APA, Harvard, Vancouver, ISO, and other styles
You might also be interested in the bibliographies on the topic 'Genetic diversity' for other source types:
Dissertations / Theses Books
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography