Journal articles on the topic 'Fusarium pseudograminearum'
To see the other types of publications on this topic, follow the link: Fusarium pseudograminearum.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Fusarium pseudograminearum.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Saad, Ahmed, Bethany Macdonald, Anke Martin, Noel L. Knight, and Cassandra Percy. "Winter Cereal Reactions to Common Root Rot and Crown Rot Pathogens in the Field." Agronomy 12, no. 10 (October 19, 2022): 2571. http://dx.doi.org/10.3390/agronomy12102571.
Full textAbstract:
In Australia, Fusarium pseudograminearum and F. culmorum are the two main fungi causing crown rot, while Bipolaris sorokiniana is the causal agent of common root rot. Fusarium graminearum is typically linked with Fusarium head blight; however, it has been associated with crown rot in Australia and other parts of the world. This study investigated the reactions of single cultivars of barley, bread wheat, durum wheat, oat, and triticale to inoculation with strains of F. pseudograminearum, F. culmorum, F. graminearum and B. sorokiniana in field trials across two seasons. Fusarium pseudograminearum and F. culmorum caused greater visual discolouration than F. graminearum and B. sorokiniana on both stems and sub crown internodes of all hosts. Fusarum pseudograminearum caused the greatest reduction in plant dry weight across hosts in both years. Durum wheat (cv. Hyperno) barley (cv. Grimmett), bread wheat (cv. Livingston) and triticale (cv. Endeavour) observed significantly high levels of visual discolouration on stems when inoculated with F. pseudograminearum, while oat (cv. Genie) exhibited the least visual discolouration. Despite variation in the visual discolouration, the DNA of all pathogens were detected in all cultivars. This research further highlights the complicated nature of the pathogen × strain × cultivar × environment interaction, which remains a challenge in breeding for genetic resistance. The specific infection of each fungus and the host responses in these field trials improves our understanding of disease development and its importance in cropping systems.
2
Ocamb, Cynthia M., and Stephen C. Alderman. "Fusarium Species Associated with Tall Fescue Seed Production in Oregon." Plant Health Progress 5, no. 1 (January 2004): 7. http://dx.doi.org/10.1094/php-2004-0319-01-rs.
Full textAbstract:
Seed samples were collected from 15 commercial tall fescue seed production fields and examined for Fusarium spp. The percentage of seeds from which Fusarium spp. were recovered ranged from 0 to 32%, while disinfesting seeds with 3% hydrogen peroxide reduced the recovery of Fusarium to 7% or less. The predominant Fusarium spp. isolated from the tall fescue seeds included F. avenaceum, F. culmorum, F. pseudograminearum, and F. sambucinum. Greenhouse inoculations of tall fescue panicles with F. avenaceum, F. culmorum, and F. pseudograminearum resulted in higher seedborne rates of each respective Fusarium sp. than that recovered from noninoculated plants. Seeds recovered from panicles treated with F. avenaceum or F. pseudograminearum had significantly lower germination rates relative to panicles sprayed with water or a suspension of F. culmorum. Our work confirms that Fusarium spp. decrease seed germination and expands the pathogen list to include F. avenaceum and F. pseudograminearum. Accepted for publication 17 February 2004. Published 19 March 2004.
3
Wu, Tianci, Feilong Guo, Gangbiao Xu, Jinfeng Yu, Li Zhang, Xuening Wei, Xiuliang Zhu, and Zengyan Zhang. "The Receptor-like Kinase TaCRK-7A Inhibits Fusarium pseudograminearum Growth and Mediates Resistance to Fusarium Crown Rot in Wheat." Biology 10, no. 11 (November 1, 2021): 1122. http://dx.doi.org/10.3390/biology10111122.
Full textAbstract:
The fungus F. pseudograminearum can cause the destructive disease Fusarium crown rot (FCR) of wheat, an important staple crop. Functional roles of FCR resistance genes in wheat are largely unknown. In the current research, we characterized the antifungal activity and positive-regulatory function of the cysteine-rich repeat receptor-like kinase TaCRK-7A in the defense against F. pseudograminearum in wheat. Antifungal assays showed that the purified TaCRK-7A protein inhibited the growth of F. pseudograminearum. TaCRK-7A transcript abundance was elevated after F. pseudograminearum attack and was positively related to FCR-resistance levels of wheat cultivars. Intriguingly, knocking down of TaCRK-7A transcript increased susceptibility of wheat to FCR and decreased transcript levels of defense-marker genes in wheat. Furthermore, the transcript abundances of TaCRK-7A and its modulated-defense genes were responsive to exogenous jasmonate treatment. Taken together, these results suggest that TaCRK-7A can directly inhibit F. pseudograminearum growth and mediates FCR-resistance by promoting the expression of wheat defense genes in the jasmonate pathway. Thus, TaCRK-7A is a potential gene resource in FCR-resistant wheat breeding program.
4
Chen, Linlin, Yuming Ma, Jingya Zhao, Xuejing Geng, Wenbo Chen, Shengli Ding, Haiyang Li, and Honglian Li. "The bZIP transcription factor FpAda1 is essential for fungal growth and conidiation in Fusarium pseudograminearum." Current Genetics 66, no. 3 (November 6, 2019): 507–15. http://dx.doi.org/10.1007/s00294-019-01042-1.
Full textAbstract:
Abstract Fusarium pseudograminearum is an important pathogen of Fusarium crown rot and Fusarium head blight, which is able to infect wheat and barley worldwide, causing great economic losses. Transcription factors (TFs) of the basic leucine zipper (bZIP) protein family control important processes in all eukaryotes. In this study, we identified a gene, designated FpAda1, encoding a bZIP TF in F. pseudograminearum. The homolog of FpAda1 is also known to affect hyphal growth in Neurospora crassa. Deletion of FpAda1 in F. pseudograminearum resulted in defects in hyphal growth, mycelial branching and conidia formation. Pathogenicity assays showed that virulence of the Δfpada1 mutant was dramatically decreased on wheat coleoptiles and barley leaves. However, wheat coleoptile inoculation assay showed that Δfpada1 could penetrate and proliferate in wheat cells. Moreover, the FpAda1 was required for abnormal nuclear morphology in conidia and transcription of FpCdc2 and FpCdc42. Taken together, these results indicate that FpAda1 is an important transcription factor involved in growth and development in F. pseudograminearum.
5
Ji, Lijing, Qiusheng Li, Yajiao Wang, Lester W. Burgess, Mengwei Sun, Keqiang Cao, and Lingxiao Kong. "Monitoring of Fusarium Species and Trichothecene Genotypes Associated with Fusarium Head Blight on Wheat in Hebei Province, China." Toxins 11, no. 5 (April 28, 2019): 243. http://dx.doi.org/10.3390/toxins11050243.
Full textAbstract:
To clarify the changes in field populations of Fusarium head blight (FHB) pathogens over a decade, Fusarium species and trichothecene genotypes associated with FHB on wheat were monitored in Hebei province during the periods 2005–2006 and 2013–2016. Fusarium species determination was carried out by morphological identification, species-specific amplification and partial translation elongation factor (TEF-1α) gene sequencing. Trichothecene genotype prediction was carried out by primers 3CON/3NA/3D15A/3D3 or Tri13F/Tri13R, Tri303F/Tri303R and Tri315F/Tri315R. A total of 778 purified Fusarium isolates were recovered from 42 sampling sites in 17 counties during the period 2005–2006 and 1002 Fusarium isolates were recovered from 122 sampling sites in 65 counties during the period 2013–2016. F. graminearum was the predominant pathogen recovered during the periods 2005–2006 and 2013–2016. However, the pathogen composition differed slightly between the two periods. In 2005–2006, 752 out of 778 (96.7%) of the isolates belonged to F. graminearum. Two were identified as F. culmorum. Five other Fusarium species were also recovered, F. equiseti, F. verticillioides, F. proliferatum, F. subglutinans and F. chlamydosporum, with lower recoveries of 0.4%, 0.8%, 0.8%, 0.1% and 1.0%, respectively. Trichothecene genotype prediction showed that all the 752 F. graminearum isolates were of the 15-ADON genotype. Five Fusarium species were recovered from samples collected over the period 2013–2016. F. graminearum was again the predominant pathogen with an isolation frequency of 97.6%. F. pseudograminearum, F. asiaticum, F. culmorum and F. negundis were also isolated at a recovery of 1.4%, 0.7%, 0.2% and 0.1%, respectively. For the 2013–2016 isolates, 971 of the 978 F. graminearum strains were 15-ADON whereas seven isolates were of the 3-ADON type. All seven F. asiaticum isolates were of the NIV type and fourteen F. pseudograminearum isolates were classified as 3-ADON. F. pseudograminearum was first isolated from FHB in Hebei in 2013. Although the recovery of F. pseudograminearum is still low, it represents a small shift in the pathogen composition and trichothecene genotypes associated with FHB in Hebei province. As Fusarium crown rot of wheat caused by F. pseudograminearum is an increasing problem in Hebei province, it is appropriate to monitor the role of F. pseudograminearum in FHB in the future.
6
Yörük, Emre, Aylin Gazdağli, and Gülruh Albayrak. "Class B trichothecene chemotyping in Fusarium species by PCR assay." Genetika 46, no. 3 (2014): 661–69. http://dx.doi.org/10.2298/gensr1403661y.
Full textAbstract:
Fusarium isolates are divided into three chemotypes according to produce of class B trichothecenes; 3-acetyldeoxynivalenol (3ADON) 15-acetyldeoxynivalenol (15ADON) and nivalenol (NIV) and 4- acetyldeoxynivalenol (NIV) chemotypes. In this study, chemotyping of seventeen isolates from Turkey and Iran belonging to F. graminearum, F. culmorum, F. poae and F. pseudograminearum species were carried out by polymerase chain reaction (PCR) analysis. While all F. culmorum and F. poae isolates determined as 3ADON, remaining F. graminearum and F. pseudograminearum isolates were either 3ADON or 15ADON chemotypes. A common band of 583 bp long DNA fragment was amplified in all of F. culmorum and F. poae, one F. pseudograminearum (21F) and four F. graminearum (14F, sh14, sh15, sh7) isolates with 3ADON chemotype. However, remaining two F. pseudograminearum and four F. graminearum isolates with 15ADON chemotype, yielded amplicons that of 863 bp. It was shown that 3ADON was more predominant chemotype from other class B trichothecenes. This is the first report on chemotyping of F. poae and F. pseudograminearum isolates and also to show presence of 3ADON chemotype in F. graminearum isolate from Turkey.
7
Blum, Ailisa, Aurélie H. Benfield, Jens L. Sørensen, Mikkel R. Nielsen, Simone Bachleitner, Lena Studt, Giovanni Beccari, Lorenzo Covarelli, Jacqueline Batley, and Donald M. Gardiner. "Regulation of a novel Fusarium cytokinin in Fusarium pseudograminearum." Fungal Biology 123, no. 3 (March 2019): 255–66. http://dx.doi.org/10.1016/j.funbio.2018.12.009.
Full text
8
Li, Ke, Dongmei Liu, Xin Pan, Shuwei Yan, Jiaqing Song, Dongwei Liu, Zhifang Wang, et al. "Deoxynivalenol Biosynthesis in Fusarium pseudograminearum Significantly Repressed by a Megabirnavirus." Toxins 14, no. 7 (July 19, 2022): 503. http://dx.doi.org/10.3390/toxins14070503.
Full textAbstract:
Deoxynivalenol (DON) is a mycotoxin widely detected in cereal products contaminated by Fusarium. Fusarium pseudograminearum megabirnavirus 1 (FpgMBV1) is a double-stranded RNA virus infecting Fusarium pseudograminearum. In this study, it was revealed that the amount of DON in F. pseudograminearum was significantly suppressed by FpgMBV1 through a high-performance liquid chromatography–tandem mass spectrometry (HPLC-MS/MS) assay. A total of 2564 differentially expressed genes were identified by comparative transcriptomic analysis between the FpgMBV1-containing F. pseudograminearum strain FC136-2A and the virus-free strain FC136-2A-V-. Among them, 1585 genes were up-regulated and 979 genes were down-regulated. Particularly, the expression of 12 genes (FpTRI1, FpTRI3, FpTRI4, FpTRI5, FpTRI6, FpTRI8, FpTRI10, FpTRI11, FpTRI12, FpTRI14, FpTRI15, and FpTRI101) in the trichothecene biosynthetic (TRI) gene cluster was significantly down-regulated. Specific metabolic and transport processes and pathways including amino acid and lipid metabolism, ergosterol metabolic and biosynthetic processes, carbohydrate metabolism, and biosynthesis were regulated. These results suggest an unrevealing mechanism underlying the repression of DON and TRI gene expression by the mycovirus FpgMBV1, which would provide new methods in the detoxification of DON and reducing the yield loss in wheat.
9
Moya-Elizondo, Ernesto A., Barry J. Jacobsen, Andrew C. Hogg, and Alan T. Dyer. "Population Dynamics Between Fusarium pseudograminearum and Bipolaris sorokiniana in Wheat Stems Using Real-Time qPCR." Plant Disease 95, no. 9 (September 2011): 1089–98. http://dx.doi.org/10.1094/pdis-11-10-0794.
Full textAbstract:
Fusarium pseudograminearum and Bipolaris sorokiniana are causal agents of Fusarium crown rot and common root rot, respectively, of wheat and cause significant losses worldwide. Understanding the population dynamics between these two pathogens at late stages of wheat development is needed. The effect of F. pseudograminearum and B. sorokiniana inocula applied singly or in mixtures at seeding to spring wheat ‘Hank’ was measured using seedling stand, grain yield, and pathogen populations in the first internode at heading, milk, and harvest stage of wheat development using real-time quantitative polymerase chain reaction. High and low rates of F. pseudograminearum inoculum reduced B. sorokiniana populations in field trials but B. sorokiniana inoculations did not affect F. pseudograminearum populations. Populations of both pathogens increased from heading until harvest, with F. pseudograminearum colonizing lower internodes earlier than B. sorokiniana. Neither pathogen prevented infection by the other in the first internode of wheat stems. Inoculations increased incidence of infection and co-infection relative to natural settings observed for both pathogens. At the seedling stage, both fungi, individually or combined, reduced the seedling stands when compared with a noninoculated control for the three location–years. Grain yield and F. pseudograminearum populations were inversely correlated, while B. sorokiniana populations were not correlated with yield.
10
Hogg, A. C., R. H. Johnston, J. A. Johnston, L. Klouser, K. D. Kephart, and A. T. Dyer. "Monitoring Fusarium Crown Rot Populations in Spring Wheat Residues Using Quantitative Real-Time Polymerase Chain Reaction." Phytopathology® 100, no. 1 (January 2010): 49–57. http://dx.doi.org/10.1094/phyto-100-1-0049.
Full textAbstract:
Caused by a complex of Fusarium species including F. culmorum, F. graminearum, and F. pseudograminearum, Fusarium crown rot (FCR) is an important cereal disease worldwide. For this study, Fusarium population dynamics were examined in spring wheat residues sampled from dryland field locations near Bozeman and Huntley, MT, using a quantitative real-time polymerase chain reaction (qPCR) Taqman assay that detects F. culmorum, F. graminearum, and F. pseudograminearum. Between August 2005 and June 2007, Fusarium populations and residue decomposition were measured eight times for standing stubble (0 to 20 cm above the soil surface), lower stem (20 to 38 cm), middle stem (38 to 66 cm), and chaff residues. Large Fusarium populations were found in stubble collected in August 2005 from F. pseudograminearum-inoculated plots. These populations declined rapidly over the next 8 months. Remnant Fusarium populations in inoculated stubble were stable relative to residue biomass from April 2006 until June 2007. These two phases of population dynamics were observed at both locations. Relative to inoculated stubble populations, Fusarium populations in other residue fractions and from noninoculated plots were small. In no case were FCR species observed aggressively colonizing noninfested residues based on qPCR data. These results suggest that Fusarium populations are unstable in the first few months after harvest and do not expand into noninfested wheat residues. Fusarium populations remaining after 8 months were stable for at least another 14 months in standing stubble providing significant inoculums for newly sown crops.
11
Troth, Erin E. Gunnink, Jeffrey A. Johnston, and Alan T. Dyer. "Competition Between Fusarium pseudograminearum and Cochliobolus sativus Observed in Field and Greenhouse Studies." Phytopathology® 108, no. 2 (February 2018): 215–22. http://dx.doi.org/10.1094/phyto-03-17-0110-r.
Full textAbstract:
Among root pathogens, one of the most documented antagonisms is the suppression of Cochliobolus sativus by Fusarium (roseum) species. Unfortunately, previous studies involved single isolates of each pathogen and thus, provided no indication of the spectrum of responses that occur across the respective species. To investigate the variability in interactions between Cochliobolus sativus and Fusarium pseudograminearum, field and greenhouse trials were conducted that included monitoring of spring wheat plant health and monitoring of pathogen populations via quantitative real-time polymerase chain reaction. The interactions between two isolates of C. sativus and four isolates of F. pseudograminearum were explored in three geographically distinct wheat fields. To complement field trials and to limit potentially confounding environmental variables that are often associated with field studies, greenhouse trials were performed that investigated the interactions among and between three isolates of C. sativus and four isolates of F. pseudograminearum. Across field locations, C. sativus isolate Cs2344 consistently and significantly reduced Fusarium populations by an average of 20.1%. Similarly, F. pseudograminearum isolate Fp2228 consistently and significantly reduced C. sativus field populations by an average of 30.9%. No interaction was detected in the field between pathogen species with regards to disease or crop losses. Greenhouse results confirmed a powerful (>99%), broadly effective suppression of Fusarium populations by isolate Cs2344. Among greenhouse trials, additional isolate–isolate interactions were observed affecting Fusarium populations. Due to lower C. sativus population sizes in greenhouse trials, significant Fusarium suppression of C. sativus was only detected in one isolate–isolate interaction. This study is the first to demonstrate suppression of Fusarium spp. by C. sativus in field and greenhouse settings. These findings also reveal a complex competitive interaction between these two pathogen species that was previously unknown.
12
Hagerty, Christina H., Tessa Irvine, Hannah M. Rivedal, Chuntao Yin, and Duncan R. Kroese. "Diagnostic Guide: Fusarium Crown Rot of Winter Wheat." Plant Health Progress 22, no. 2 (January 1, 2021): 176–81. http://dx.doi.org/10.1094/php-10-20-0091-dg.
Full textAbstract:
Fusarium crown rot of winter wheat is an economically important disease in most regions where winter wheat is grown. Fusarium crown rot is caused by Fusarium culmorum and F. pseudograminearum. This diagnostic guide details information to aid in field, molecular, and morphological diagnosis of Fusarium crown rot.
13
Wang, Mingyu, Hao Xu, Chunjie Liu, Yilin Tao, Xiaofeng Wang, Yuancun Liang, Li Zhang, and Jinfeng Yu. "Peroxisome Proliferator FpPEX11 Is Involved in the Development and Pathogenicity in Fusarium pseudograminearum." International Journal of Molecular Sciences 23, no. 20 (October 12, 2022): 12184. http://dx.doi.org/10.3390/ijms232012184.
Full textAbstract:
Fusarium crown rot (FCR) of wheat, an important soil-borne disease, presents a worsening trend year by year, posing a significant threat to wheat production. Fusarium pseudograminearum cv. b was reported to be the dominant pathogen of FCR in China. Peroxisomes are single-membrane organelles in eukaryotes that are involved in many important biochemical metabolic processes, including fatty acid β-oxidation. PEX11 is important proteins in peroxisome proliferation, while less is known in the fungus F. pseudograminearum. The functions of FpPEX11a, FpPEX11b, and FpPEX11c in F. pseudograminearum were studied using reverse genetics, and the results showed that FpPEX11a and FpPEX11b are involved in the regulation of vegetative growth and asexual reproduction. After deleting FpPEX11a and FpPEX11b, cell wall integrity was impaired, cellular metabolism processes including active oxygen metabolism and fatty acid β-oxidation were significantly blocked, and the production ability of deoxynivalenol (DON) decreased. In addition, the deletion of genes of FpPEX11a and FpPEX11b revealed a strongly decreased expression level of peroxisome-proliferation-associated genes and DON-synthesis-related genes. However, deletion of FpPEX11c did not significantly affect these metabolic processes. Deletion of the three protein-coding genes resulted in reduced pathogenicity of F. pseudograminearum. In summary, FpPEX11a and FpPEX11b play crucial roles in the growth and development, asexual reproduction, pathogenicity, active oxygen accumulation, and fatty acid utilization in F. pseudograminearum.
14
Nur Ain Izzati, M. Z., A. R. Azmi, M. S. Siti Nordahliawate, and J. Norazlina. "Contribution to the knowledge of diversity of Fusarium associated with maize in Malaysia." Plant Protection Science 47, No. 1 (March 1, 2011): 20–24. http://dx.doi.org/10.17221/52/2008-pps.
Full textAbstract:
The Fusarium species associated with maize are widely distributed in Malaysia. Eight Fusarium species were obtained in this country. A series of field samplings was conducted from 2006 to 2008, when 167 Fusarium isolates were obtained from maize plants in seven locations throughout Malaysia. The determination was based on micro- and macromorphological features (growth rates, colony features, mode of production of microconidia, macroconidia, conidiophores, and chlamydospores). F. proliferatum (29.9% isolates), F. semitectum (22.2% isolates), F. verticillioides (13.7% isolates), and F. subglutinans (12.6% isolates) were found out most frequently. F. equiseti, F. pseudograminearum, F. oxysporum, and F. solani were also isolated. This is the first report on the occurrence of F. equiseti, F. pseudograminearum, and F. subglutinans associated with maize plants in Malaysia.
15
Bentley, Alison R., Brett A. Summerell, and Lester W. Burgess. "Sexual compatibility in Fusarium pseudograminearum (Gibberella coronicola)." Mycological Research 112, no. 9 (September 2008): 1101–6. http://dx.doi.org/10.1016/j.mycres.2008.04.016.
Full text
16
Xu, F., Y. L. Song, G. Q. Yang, J. M. Wang, L. L. Liu, and Y. H. Li. "First Report of Fusarium pseudograminearum from Wheat Heads with Fusarium Head Blight in North China Plain." Plant Disease 99, no. 1 (January 2015): 156. http://dx.doi.org/10.1094/pdis-05-14-0543-pdn.
Full textAbstract:
Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 μm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 104 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009.
17
Carlson, René, Fidele Tugizimana, Paul A. Steenkamp, Ian A. Dubery, and Nico Labuschagne. "Differential Metabolic Reprogramming in Paenibacillus alvei-Primed Sorghum bicolor Seedlings in Response to Fusarium pseudograminearum Infection." Metabolites 9, no. 7 (July 23, 2019): 150. http://dx.doi.org/10.3390/metabo9070150.
Full textAbstract:
Metabolic changes in sorghum seedlings in response to Paenibacillus alvei (NAS-6G6)-induced systemic resistance against Fusarium pseudograminearum crown rot were investigated by means of untargeted ultra-high performance liquid chromatography-high definition mass spectrometry (UHPLC-HDMS). Treatment of seedlings with the plant growth-promoting rhizobacterium P. alvei at a concentration of 1 × 108 colony forming units mL−1 prior to inoculation with F. pseudograminearum lowered crown rot disease severity significantly at the highest inoculum dose of 1 × 106 spores mL−1. Intracellular metabolites were subsequently methanol-extracted from treated and untreated sorghum roots, stems and leaves at 1, 4 and 7 days post inoculation (d.p.i.) with F. pseudograminearum. The extracts were analysed on an UHPLC-HDMS platform, and the data chemometrically processed to determine metabolic profiles and signatures related to priming and induced resistance. Significant treatment-related differences in primary and secondary metabolism post inoculation with F. pseudograminearum were observed between P. alvei-primed versus naïve S. bicolor seedlings. The differential metabolic reprogramming in primed plants comprised of a quicker and/or enhanced upregulation of amino acid-, phytohormone-, phenylpropanoid-, flavonoid- and lipid metabolites in response to inoculation with F. pseudograminearum.
18
Saad, Ahmed, Bethany Macdonald, Anke Martin, Noel L. Knight, and Cassandra Percy. "Comparison of disease severity caused by four soil-borne pathogens in winter cereal seedlings." Crop and Pasture Science 72, no. 5 (2021): 325. http://dx.doi.org/10.1071/cp20245.
Full textAbstract:
In Australia, crown rot of cereals is predominantly caused by Fusarium pseudograminearum and Fusarium culmorum, and common root rot by Bipolaris sorokiniana. Fusarium graminearum is an important pathogen causing Fusarium head blight worldwide and has also been reported to cause crown rot of wheat. The comparative ability of F. pseudograminearum, F. culmorum, F. graminearum and B. sorokiniana to cause crown rot and common root rot across a range of winter cereal species requires investigation. In glasshouse trials, we inoculated one cultivar each of barley, bread wheat, durum wheat, oat and triticale with two strains of each of the four pathogens. At 21 days after inoculation, the sub-crown internode and leaf sheaths of each plant were visually rated for brown discoloration. Shoot length and dry weight of inoculated plants were compared with those of non-inoculated controls. Barley and bread wheat had the highest disease severity ratings on leaf sheaths and sub-crown internode (64.7–99.6%), whereas oat had the lowest disease severity ratings across all pathogens (<5%). The shoot length of all cultivars was significantly reduced (by 12.2–55%, P < 0.05) when exposed to F. pseudograminearum. This study provides a comparison of pathogenicity of crown rot and common root rot pathogens and demonstrates significant variation in visual discoloration and host response across a range of winter cereals.
19
Bentley, Alison R., John F. Leslie, Edward C. Y. Liew, Lester W. Burgess, and Brett A. Summerell. "Genetic Structure of Fusarium pseudograminearum Populations from the Australian Grain Belt." Phytopathology® 98, no. 2 (February 2008): 250–55. http://dx.doi.org/10.1094/phyto-98-2-0250.
Full textAbstract:
Crown rot, caused by the fungus Fusarium pseudograminearum (teleomorph Gibberella coronicola) is a major disease of wheat in the Australian grain belt. However, there is little information available on the population structure of this pathogen. We measured genetic diversity as assessed with amplified fragment length polymorphism (AFLP) analysis within and between populations of F. pseudograminearum from northeastern, south central, and southwestern regions of the Australian grain belt. Amongst the 217 isolates, 176 haplotypes were identified and grouped into two main clusters. One cluster contained isolates from populations in northeastern Australia, and the other cluster contained isolates from populations in south central and southwestern Australia. The southern populations were distinguished from the northeastern populations by higher levels of population differentiation (Gst) between them and genetic identity amongst the regional populations. We hypothesize that the F. pseudograminearum populations from northeastern and southern Australia are independent, which could result from different founding events or from geographic isolation and the accumulation of genetic differences due to genetic drift and/or selection.
20
Knight, Noel L., and Mark W. Sutherland. "Assessment of Fusarium pseudograminearum and F. culmorum Biomass in Seedlings of Potential Host Cereal Species." Plant Disease 101, no. 12 (December 2017): 2116–22. http://dx.doi.org/10.1094/pdis-12-16-1739-re.
Full textAbstract:
Fusarium crown rot is a major disease of wheat and barley worldwide, with the most frequently isolated causal agents being Fusarium pseudograminearum and F. culmorum. This study has successfully designed a quantitative polymerase chain reaction assay that is specific for F. culmorum, which has been used in conjunction with a previously established F. pseudograminearum-specific assay to compare the location and extent of infection by each fungus across a range of potential hosts, including six winter and three summer cereal species. All common winter cereals, excluding oat, demonstrated a similar range of visual and fungal biomass results when inoculated with either F. pseudograminearum or F. culmorum. Oat exhibited the lowest visual disease ratings and fungal biomass values of the winter cereals, while the sorghum, maize, and rice cultivars returned the lowest values overall. The ranking of host species according to visual discoloration was strongly correlated for both pathogens. Visual reactions to F. pseudograminearum were greater than those caused by F. culmorum in all potential hosts trialed; however, fungal biomass results only indicated this trend for barley. These results demonstrate significant variation in the ability of these pathogens to colonize the range of cereal species examined and also suggest differences between the pathogens in their patterns of host colonization.
21
Zhang, Jie, Wenqian Zhu, Paul H. Goodwin, Qitong Lin, Mingcong Xia, Wen Xu, Runhong Sun, et al. "Response of Fusarium pseudograminearum to Biocontrol Agent Bacillus velezensis YB-185 by Phenotypic and Transcriptome Analysis." Journal of Fungi 8, no. 8 (July 22, 2022): 763. http://dx.doi.org/10.3390/jof8080763.
Full textAbstract:
The use of biological control agents (BCAs) is a promising alternative control measure for Fusarium crown rot (FCR) of wheat caused by Fusarium pseudograminearum. A bacterial strain, YB-185, was isolated from the soil of wheat plants with FCR and identified as Bacillus velezensis. YB-185 exhibited strong inhibition of F. pseudograminearum mycelial growth and conidial germination in culture. Seed treatment with YB-185 in greenhouse and field resulted in reductions in disease by 66.1% and 57.6%, respectively, along with increased grain yield. Microscopy of infected root tissues confirmed that YB-185 reduced root invasion by F. pseudograminearum. RNA-seq of F. pseudograminearum during co-cultivation with B. velezensis YB-185 revealed 5086 differentially expressed genes (DEGs) compared to the control. Down-regulated DEGs included genes for glucan synthesis, fatty acid synthesis, mechanosensitive ion channels, superoxide dismutase, peroxiredoxin, thioredoxin, and plant-cell-wall-degrading enzymes, whereas up-regulated DEGs included genes for chitin synthesis, ergosterol synthesis, glutathione S-transferase, catalase, and ABC transporters. In addition, fungal cell apoptosis increased significantly, as indicated by TUNEL staining, and the scavenging rate of 2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt radical cation (ABTS·+) in the fungus significantly decreased. Thus, F. pseudograminearum may be trying to maintain normal cell functions by increasing cell wall and membrane synthesis, antioxidant and anti-stress responses, detoxification of bacterial antimicrobial compounds, and transportation of damaging compounds from its cells. However, cell death and free radical accumulation still occurred, indicating that the responses were insufficient to prevent cell damage. Bacillus velezensis YB-185 is a promising BCA against FCR that acts by directly damaging F. pseudograminearum, thus reducing its ability to colonize roots and produce symptoms.
22
Smiley, Richard W., Jennifer A. Gourlie, Sandra A. Easley, and Lisa-Marie Patterson. "Pathogenicity of Fungi Associated with the Wheat Crown Rot Complex in Oregon and Washington." Plant Disease 89, no. 9 (September 2005): 949–57. http://dx.doi.org/10.1094/pd-89-0949.
Full textAbstract:
Crown rot of wheat in the Pacific Northwest is caused by a complex including Bipolaris sorokiniana, Fusarium avenaceum, F. culmorum, F. pseudograminearum, and Microdochium nivale. Relative pathogenicity was examined under greenhouse conditions for 178 isolates of the five species, and under field conditions for 24 isolates of B. sorokiniana, F. culmorum, and F. pseudograminearum. In the greenhouse, all five species reduced (P < 0.05) plant height relative to noninoculated controls. Disease severity was inversely correlated with plant height for the three Fusarium spp. In one or more of four experiments with spring wheat in the field, all three species reduced stand establishment and density of mature heads and increased the incidence and severity of crown rot. F. culmorum and F. pseudograminearum caused the greatest disease severity and plant damage and were the only pathogens that reduced grain yield. Virulence ratings were variable among isolates for each species in all greenhouse and field experiments. Isolate variability was especially high for the location and year variables in field experiments. Mixtures of multiple isolates are required for future research.
23
Castañares, E., L. Wehrhahne, and S. A. Stenglein. "Fusarium pseudograminearum Associated with Barley Kernels in Argentina." Plant Disease 96, no. 5 (May 2012): 763. http://dx.doi.org/10.1094/pdis-01-12-0050-pdn.
Full textAbstract:
Barley (Hordeum vulgare L.), one of the most widely grown winter cereal crops in Argentina, is primarily grown for use as malted barley for the beer industry. In December 2010, a survey of fungi was conducted in a barley (cv. Shakira) seed lot in a field located in Tres Arroyos, Buenos Aires, Argentina. A sample of 400 seeds was surface sterilized (70% EtOH for 2 min and 5% NaClO for 2 min), rinsed twice in sterilized distilled water, plated on potato dextrose agar (PDA), and incubated at 24 ± 2°C in a 12-h dark/light cycle. One isolate that was morphologically similar to Fusarium graminearum was observed after 6 days of incubation. The isolate was transferred onto PDA and carnation leaf agar (CLA) substrates and grown with the same conditions as described above. On PDA, the isolate produced abundant, white-to-yellow-to-red, aerial mycelium and formed red pigments in the medium. On CLA, macroconidia were abundant, relatively slender and almost straight to moderately curved, and commonly five to six septate. Microconidia were not observed. Chlamydospores were observed after 3 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (1). Pathogenicity was conducted using a hand sprayer to inoculate five barley (cv. Shakira) heads in potted plants with a 5-ml asexual spore suspension (1 × 104 conidia per ml). Two heads were sprayed with sterile distilled water as a control. Plants were covered with polyethylene bags and incubated for 3 days in a growth chamber under a 12-h day/dark cycle at 22 ± 2°C. Plants were unbagged and moved into a greenhouse. Noninoculated spikelets were asymptomatic and inoculated spikelets showed discoloration or a tan-to-dark brown necrosis. The fungus was reisolated from symptomatic kernels. DNA of the isolate was extracted (3) and the isolate was identified to species by sequencing the reductase (RED), trichothecene 3-O-acetyltransferase (tri101), and translation elongation factor (TEF) regions (4). The sequences were compared with those in GenBank. The RED sequence (Accession No. JQ350697) showed 100% similarity, the tri101 (Accession No. JQ350698) showed 99% similarity, and the TEF (Accession No. JQ350699) showed 100% similarity with several F. pseudograminearum sequences. Additionally, the isolate was tested for the potential to produce deoxinyvalenol (DON) using a PCR approach that allows identification of two acetylated forms of DON: 15-acetyl-DON (15-ADON) and 3-ADON (2). A PCR product indicative of a 3-ADON genotype was obtained. To our knowledge, this is the first report of F. pseudograminerum associated with barley kernels in Argentina. Considering its potential to cause head blight and product mycotoxins, a large-scale survey of F. pseudograminearum on barley crops in Argentina is underway. A voucher culture (No. 1154) has been deposited in the Culture Collection of the La Plata Spegazzini Institute. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK. 2006. (2) A. Quarta et al. Food Addit. Contam. 22:309, 2005. (3) S. A. Stenglein and P. A. Balatti. Physiol. Mol. Plant Pathol. 68:158, 2006. (4) T. J. Ward et al. Fungal Genet. Biol. 45:473, 2008.
24
Hogg, A. C., R. H. Johnston, and A. T. Dyer. "Applying Real-Time Quantitative PCR to Fusarium Crown Rot of Wheat." Plant Disease 91, no. 8 (August 2007): 1021–28. http://dx.doi.org/10.1094/pdis-91-8-1021.
Full textAbstract:
Fusarium crown rot (FCR) of wheat is a persistent problem that causes significant losses worldwide. In Montana, FCR is caused primarily by Fusarium culmorum and F. pseudograminearum. Recently, a real-time quantitative PCR (QPCR) assay was developed for FCR using primers and probes specific for a segment of the trichodiene synthase (tri5) gene. The purpose of this study was to determine the utility of QPCR for accessing FCR severity on wheat in field experiments. In 2004 and 2005, plots of spring and durum wheat were inoculated with varying levels of F. pseudograminearum oat inoculum and grown under rain-fed conditions. Two weeks prior to harvest, plants were collected from the plots and assessed for FCR severity and analyzed by QPCR for Fusarium DNA quantities. Disease severity scores (DSS) and Fusarium DNA quantities were positively correlated with each other for all three cultivars in 2004 but for only the durum cultivar in 2005 (P < 0.05). In 2004, grain yields for both spring wheat cultivars were negatively correlated with Fusarium DNA quantities (P > 0.05). When DSS and Fusarium DNA quantities negatively correlated with yield, both measurements were comparable in predicting yield reduction (R = –0.64 and –0.77, respectively). Results indicate that this QPCR assay is effective in measuring FCR severity in wheat.
25
Sui, Lina, Jishun Li, Jindong Hu, and Yan Wang. "Establishment of a rapid detection method for wheat crown rot." E3S Web of Conferences 251 (2021): 02027. http://dx.doi.org/10.1051/e3sconf/202125102027.
Full textAbstract:
We have established a real-time fluorescent quantitative PCR system that can detect wheat crown rot rapidly and accurately quantify fungi, Fusarium species and Fusarium pseudograminearum in the rhizosphere soil of infected wheat through the standard curve produced, with a view to the early stage of wheat Provide help in predicting the occurrence of wheat crown rot.
26
Smiley, Richard W. "Mechanized Method to Inoculate Field Soil to Evaluate Fusarium Crown Rot of Wheat." Plant Disease 103, no. 11 (November 2019): 2857–64. http://dx.doi.org/10.1094/pdis-01-19-0215-re.
Full textAbstract:
Assessments of Fusarium crown rot are often made in field trials inoculated with Fusarium pseudograminearum or F. culmorum. Factors affecting the efficiency of two inoculation procedures were evaluated. Pulverized Fusarium-colonized wheat plus oat grain inoculum mixed with the wheat seed caused more seedling damping-off compared with equal rates of colonized whole millet seeds placed 2 cm above the wheat seed. Both inoculation systems increased the incidence and severity of crown rot. The efficiency of F. pseudograminearum-colonized millet seed inoculum was not reduced when wheat seed was treated with difenoconazole. Crown rot in inoculated plots became greater when starter fertilizer was applied with or below the wheat seed and when soil below the wheat seed was disrupted by a seed drill with an opener that creates a groove or trench directly below the seed. No biologically important associations were detected between whiteheads and other measures of crown rot, grain yield, or grain test weight. The millet seed inoculation system was the most efficient for wheat production systems in the semiarid U.S. Pacific Northwest.
27
Van Coller, Gerhardus J., Lindy J. Rose, Anne-Laure Boutigny, Todd J. Ward, Sandra C. Lamprecht, and Altus Viljoen. "The distribution and type B trichothecene chemotype of Fusarium species associated with head blight of wheat in South Africa during 2008 and 2009." PLOS ONE 17, no. 9 (September 26, 2022): e0275084. http://dx.doi.org/10.1371/journal.pone.0275084.
Full textAbstract:
Fusarium head blight (FHB) of wheat occurs commonly in irrigation regions of South Africa and less frequently in dryland regions. Previous surveys of Fusarium species causing FHB identified isolates using morphological characters only. This study reports on a comprehensive characterisation of FHB pathogens conducted in 2008 and 2009. Symptomatic wheat heads were collected from the Northern Cape, KwaZulu-Natal (KZN), Bushveld and eastern Free State (irrigation regions), and from one field in the Western Cape (dryland region). Fusarium isolates were identified with species-specific primers or analysis of partial EF-1α sequences. A representative subset of isolates was characterized morphologically. In total, 1047 Fusarium isolates were collected, comprising 24 species from seven broad species complexes. The F. sambucinum (FSAMSC) and F. incarnatum-equiseti species complexes (FIESC) were most common (83.5% and 13.3% of isolates, respectively). The F. chlamydosporum (FCSC), F. fujikuroi (FFSC), F. oxysporum (FOSC), F. solani (FSSC), and F. tricinctum species complexes (FTSC) were also observed. Within the FSAMSC, 90.7% of isolates belonged to the F. graminearum species complex (FGSC), accounting for 75.7% of isolates. The FGSC was the dominant Fusaria in all four irrigation regions. F. pseudograminearum dominated at the dryland field in the Western Cape. The Northern Cape had the highest species diversity (16 Fusarium species from all seven species complexes). The type B trichothecene chemotype of FGSC and related species was inferred with PCR. Chemotype diversity was limited (15-ADON = 90.1%) and highly structured in relation to species differences. These results expand the known species diversity associated with FHB in South Africa and include first reports of F. acuminatum, F. armeniacum, F. avenaceum, F. temperatum, and F. pseudograminearum from wheat heads in South Africa, and of F. brachygibbosum, F. lunulosporum and F. transvaalense from wheat globally. Potentially novel species were identified within the FCSC, FFSC, FOSC, FSAMSC, FIESC and FTSC.
28
Knight, Noel L., and Mark W. Sutherland. "Histopathological Assessment of Fusarium pseudograminearum Colonization of Cereal Culms During Crown Rot Infections." Plant Disease 100, no. 2 (February 2016): 252–59. http://dx.doi.org/10.1094/pdis-04-15-0476-re.
Full textAbstract:
Histopathological assessment of the crown rot pathogen Fusarium pseudograminearum was performed using fluorescence microscopy of culm tissues of six cereal genotypes grown in inoculated field conditions. Tissue samples were collected at 10, 16, and 22 weeks after planting (WAP). Colonization of culm tissues was initiated through epidermal penetration, most distinctly through stomatal apertures, and progressed into the parenchymatous hypoderm, which exhibited the discoloration used as the basis for visual assessment of disease. Hyphae spread from the culm base vertically through the tissues, initially via the hypoderm and pith cavity. Colonization of sclerified cells occurred later in the disease process. Both xylem and phloem tissues became colonized by 16 WAP in all host genotypes, with colonization being less extensive in the more resistant genotypes. Culms displaying dead head symptoms revealed dense colonization in at least the first three internodes, with frequent xylem vessel and phloem cell occlusions. Paired living culms from the same plants exhibited less extensive colonization. These observations have revealed the ability of F. pseudograminearum to colonize all cell types of nodal and internodal sections, including vascular tissues, across all host genotypes. This study is the first detailed examination of the pattern of F. pseudograminearum colonization in adult hosts and indicates a potential vascular mechanism by which the effects of crown rot are produced.
29
Al-Fahdawi, Mohsin S., Jason A. Able, Margaret Evans, and Amanda J. Able. "Response of durum wheat to different levels of zinc and Fusarium pseudograminearum." Crop and Pasture Science 65, no. 1 (2014): 61. http://dx.doi.org/10.1071/cp13306.
Full textAbstract:
Durum wheat (Triticum turgidum ssp. durum) is susceptible to Fusarium pseudograminearum and sensitive to zinc (Zn) deficiency in Australian soils. However, little is known about the interaction between these two potentially yield-limiting factors, especially for Australian durum varieties. The critical Zn concentration (concentration of Zn in the plant when there is a 10% reduction in yield) and degree of susceptibility to F. pseudograminearum was therefore determined for five Australian durum varieties (Yawa, Hyperno, Tjilkuri, WID802, UAD1153303). Critical Zn concentration averaged 24.6 mg kg–1 for all durum varieties but differed for the individual varieties (mg kg–1: Yawa, 21.7; Hyperno, 22.7; Tjilkuri, 24.1; WID802, 24.8; UAD1153303, 28.7). Zinc efficiency also varied amongst genotypes (39–52%). However, Zn utilisation was similar amongst genotypes under Zn-deficient or Zn-sufficient conditions (0.51–0.59 and 0.017–0.022 g DM μg–1 Zn, respectively). All varieties were susceptible to F. pseudograminearum but the development of symptoms and detrimental effect on shoot biomass and grain yield were significantly greater in Tjilkuri. Even though crown rot symptoms may still be present, the supply of adequate Zn in the soil helped to maintain biomass and grain yield in all durum varieties. However, the extent to which durum varieties were protected from plant growth penalties due to crown rot by Zn treatment was genotype-dependent.
30
Zhang, Xueya, Shuang Liang, Qingnan Wu, Trevor C. Charles, Rui He, Jiakai Wu, Yuhui Zhao, Zhiyi Zhao, and Hezhong Wang. "Mode of action of nanochitin whisker against Fusarium pseudograminearum." International Journal of Biological Macromolecules 217 (September 2022): 356–66. http://dx.doi.org/10.1016/j.ijbiomac.2022.07.056.
Full text
31
Akinsanmi, O. A., D. Backhouse, S. Simpfendorfer, and S. Chakraborty. "Genetic diversity of Australian Fusarium graminearum and F. pseudograminearum." Plant Pathology 55, no. 4 (August 2006): 494–504. http://dx.doi.org/10.1111/j.1365-3059.2006.01398.x.
Full text
32
Knight, Noel L., and Mark W. Sutherland. "Culm discolouration as an indicator of Fusarium pseudograminearum biomass." Australasian Plant Pathology 44, no. 3 (April 17, 2015): 319–26. http://dx.doi.org/10.1007/s13313-015-0351-x.
Full text
33
Xu, F., Y. L. Song, J. M. Wang, L. L. Liu, and K. Zhao. "Occurrence of Fusarium Crown Rot Caused by Fusarium pseudograminearum on Barley in China." Plant Disease 101, no. 5 (May 2017): 837. http://dx.doi.org/10.1094/pdis-10-16-1436-pdn.
Full text
34
Akinsanmi, Olufemi A., Sukumar Chakraborty, David Backhouse, and Steven Simpfendorfer. "Passage through alternative hosts changes the fitness of Fusarium graminearum and Fusarium pseudograminearum." Environmental Microbiology 9, no. 2 (February 2007): 512–20. http://dx.doi.org/10.1111/j.1462-2920.2006.01168.x.
Full text
35
Li, Shen, Jianqiang Xu, Liming Fu, Guohui Xu, Xiaomin Lin, Junqing Qiao, and Yanfei Xia. "Biocontrol of Wheat Crown Rot Using Bacillus halotolerans QTH8." Pathogens 11, no. 5 (May 18, 2022): 595. http://dx.doi.org/10.3390/pathogens11050595.
Full textAbstract:
Fusarium pseudograminearum causes crown rot in wheat. This study aimed to assess the effects of the bacterial strain QTH8 isolated from Cotinus coggygria rhizosphere soil against F. pseudograminearum. Bacterial strain QTH8 was identified as Bacillus halotolerans in accordance with the phenotypic traits and the phylogenetic analysis of 16S rDNA and gyrB gene sequence. Culture filtrates of bacterial strain QTH8 inhibited the mycelial growth of F. pseudograminearum and resulted in mycelial malformation such as tumor formation, protoplast condensation, and mycelial fracture. In addition, bacterial strain QTH8 also inhibited the mycelial growth of Hainesia lythri, Pestalotiopsis sp., Botrytis cinerea, Curvularia lunata, Phyllosticta theaefolia, Fusarium graminearum, Phytophthora nicotianae, and Sclerotinia sclerotiorum. The active compounds produced by bacterial strain QTH8 were resistant to pH, ultraviolet irradiation, and low temperature, and were relatively sensitive to high temperature. After 4 h exposure, culture filtrates of bacterial strain QTH8—when applied at 5%, 10%, 15%, 20%, 25%, and 30%—significantly reduced conidial germination of F. pseudograminearum. The coleoptile infection assay proved that bacterial strain QTH8 reduced the disease index of wheat crown rot. In vivo application of QTH8 to wheat seedlings decreased the disease index of wheat crown rot and increased root length, plant height, and fresh weight. Iturin, surfactin, and fengycin were detected in the culture extract of bacterial strain QTH8 by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Bacterial strain QTH8 was identified for the presence of the ituC, bacA, bmyB, spaS, srfAB, fend, and srfAA genes using the specific polymerase chain reaction primers. B. halotolerans QTH8 has a vital potential for the sustainable biocontrol of wheat crown rot.
36
Li, H. L., H. X. Yuan, B. Fu, X. P. Xing, B. J. Sun, and W. H. Tang. "First Report of Fusarium pseudograminearum Causing Crown Rot of Wheat in Henan, China." Plant Disease 96, no. 7 (July 2012): 1065. http://dx.doi.org/10.1094/pdis-01-12-0007-pdn.
Full textAbstract:
Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 μm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.
37
Bozoğlu, Tuğba, Sibel Derviş, Mustafa Imren, Mohammed Amer, Fatih Özdemir, Timothy C. Paulitz, Alexey Morgounov, Abdelfattah A. Dababat, and Göksel Özer. "Fungal Pathogens Associated with Crown and Root Rot of Wheat in Central, Eastern, and Southeastern Kazakhstan." Journal of Fungi 8, no. 5 (April 19, 2022): 417. http://dx.doi.org/10.3390/jof8050417.
Full textAbstract:
Kazakhstan is the fourteenth largest wheat producer in the world. Despite this fact, there has not been a comprehensive survey of wheat root and crown rot. A quantitative survey was conducted for the purpose of establishing the distribution of fungi associated with root and crown rot on wheat (Triticum spp.). During the 2019 growing season, samples were taken from the affected plants’ roots and stem bases. A total of 1221 fungal isolates were acquired from 65 sites across the central (Karagandy region), eastern (East Kazakhstan region), and southeastern (Almaty region) parts of the country and identified using morphological and molecular tools. The internal transcribed spacer (ITS), translation elongation factor 1-alpha (EF1-α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) sequences were successfully used to identify the species of fungal isolates. It was found that Bipolaris sorokiniana (44.80%) and Fusarium acuminatum (20.39%) were the most predominant fungal species isolated, which were present in 86.15 and 66.15% of the fields surveyed, respectively, followed by F. equiseti (10.16%), Curvularia spicifera (7.62%), F. culmorum (4.75%), F. oxysporum (4.10%), F. redolens (2.38%), Rhizoctonia solani AG2-1 (1.06%), Nigrospora oryzae (0.98%), C. inaequalis (0.90%), F. pseudograminearum (0.74%), F. flocciferum (0.74%), Macrophomina phaseolina (0.66%), F. cf. incarnatum (0.33%), Fusarium sp. (0.25%), and F. torulosum (0.16%). A total of 74 isolates representing 16 species were tested via inoculation tests on the susceptible Triticum aestivum cv. Seri 82 and the results revealed that F. culmorum and F. pseudograminearum, B. sorokiniana, Fusarium sp., R. solani, F. redolens, C. spicifera, C. inaequalis, and N. oryzae were virulent, whereas others were non-pathogenic. The findings of this investigation demonstrate the presence of a diverse spectrum of pathogenic fungal species relevant to wheat crown and root rot in Kazakhstan. To the best of our knowledge, this is the first report of F. pseudograminearum, Fusarium sp., C. spicifera, and C. inaequalis as pathogens on wheat in Kazakhstan.
38
Ivić, Dario, Ana-Marija Domijan, Maja Peraica, Tihomir Miličević, and Bogdan Cvjetković. "Fusarium spp. Contamination of Wheat, Maize, Soybean, and Pea Grain in Croatia." Archives of Industrial Hygiene and Toxicology 60, no. 4 (December 1, 2009): 435–42. http://dx.doi.org/10.2478/10004-1254-60-2009-1963.
Full textAbstract:
Fusariumspp. Contamination of Wheat, Maize, Soybean, and Pea Grain in CroatiaFrom 2002 to 2008, 203 samples of wheat, maize, soybean, and pea were analysed for the presence ofFusariumspecies. Contamination withFusariumspp., expressed as the percentage of seeds withFusariumcolonies, ranged from 5 % to 69 % for wheat, from 25 % to 100 % for maize, from 4 % to 17 % for soybean, and from 3 % to 17 % for pea. 187 isolates were collected and the following 19 species determined:F. graminearum, F. poae, F. avenaceum, F. verticillioides, F. sporotrichioides, F. heterosporum, F. crookwellense, F. tricinctum, F. semitectum, F. oxysporum, F. proliferatum, F. solani, F. equiseti, F. pseudograminearum, F. chlamydosporum, F. sambucinum, F. compactum, F. scirpi, and F. culmorum.Dominant species wereF. graminearumon wheat (27 % of isolates),F. verticillioideson maize (83 % of isolates),F. sporotrichioideson soybean (34 % of isolates), andF. proliferatumon pea (29 % of isolates). Among species identified,F. heterosporum, F. crookwellense, F. pseudograminearum, F. sambucinum, andF. compactumhave been reported for the first time in Croatia.
39
Hollaway, G. J., M. L. Evans, H. Wallwork, C. B. Dyson, and A. C. McKay. "Yield Loss in Cereals, Caused by Fusarium culmorum and F. pseudograminearum, Is Related to Fungal DNA in Soil Prior to Planting, Rainfall, and Cereal Type." Plant Disease 97, no. 7 (July 2013): 977–82. http://dx.doi.org/10.1094/pdis-09-12-0867-re.
Full textAbstract:
In southeastern Australia, Fusarium crown rot, caused by Fusarium culmorum or F. pseudograminearum, is an increasingly important disease of cereals. Because in-crop control options are limited, it is important for growers to know prior to planting which fields are at risk of yield loss from crown rot. Understanding the relationships between crown rot inoculum and yield loss would assist in assessing the risk of yield loss from crown rot in fields prior to planting. Thirty-five data sets from crown rot management experiments conducted in the states of South Australia and Victoria during the years 2005 to 2010 were examined. Relationships between Fusarium spp. DNA concentrations (inoculum) in soil samples taken prior to planting and disease development and grain yield were evaluated in seasons with contrasting seasonal rainfall. F. culmorum and F. pseudograminearum DNA concentrations in soil prior to planting were found to be positively related to crown rot expression (stem browning and whiteheads) and negatively related to grain yield of durum wheat, bread wheat, and barley. Losses from crown rot were greatest when rainfall during September and October (crop maturation) was below the long-term average. Losses from crown rot were greater in durum wheat than bread wheat and least in barley. Yield losses from F. pseudograminearum were similar to yield losses from F. culmorum. Yield loss patterns were consistent across experiments and between states; therefore, it is reasonable to expect that similar relationships will occur over broad geographic areas. This suggests that quantitative polymerase chain reaction technology and soil sampling could be powerful tools for assessing crown rot inoculum concentrations prior to planting and predicting the risk of yield loss from crown rot wherever this disease is an issue.
40
Xu, Wen, Qian Yang, Xia Xie, Paul H. Goodwin, Xiaoxu Deng, Jie Zhang, Runhong Sun, et al. "Genomic and Phenotypic Insights into the Potential of Bacillus subtilis YB-15 Isolated from Rhizosphere to Biocontrol against Crown Rot and Promote Growth of Wheat." Biology 11, no. 5 (May 20, 2022): 778. http://dx.doi.org/10.3390/biology11050778.
Full textAbstract:
Fusarium crown rot caused by Fusarium pseudograminearum is one of the most devastating diseases of wheat worldwide causing major yield and economic losses. In this study, strain YB-15 was isolated from soil of wheat rhizosphere and classified as Bacillus subtilis by average nucleotide identity analysis. It significantly reduced Fusarium crown rot with a control efficacy of 81.50% and significantly improved the growth of wheat seedlings by increasing root and shoot fresh weight by 11.4% and 4.2%, respectively. Reduced Fusarium crown rot may have been due to direct antagonism by the production of β-1, 3-glucanase, amylase, protease and cellulase, or by the ability of B. subtilis YB-15 to induce defense-related enzyme activities of wheat seedlings, both alone and in seedlings infected with F. pseudograminearum. Improved plant growth may be related to the ability of B. subtilis YB-15 to secrete indole acetic acid and siderophores, as well as to solubilize phosphorus. In addition, the genome of strain YB-15 was determined, resulting in a complete assembled circular genome of 4,233,040 bp with GC content of 43.52% consisting of 4207 protein-encoding genes. Sequencing the B. subtilis YB-15 genome further revealed genes for encoding carbohydrate-active enzymes, biosynthesis of various secondary metabolites, nutrient acquisition, phytohormone production, chemotaxis and motility, which could explain the potential of strain YB-15 to be plant growth-promoting bacteria and biological control agent. B. subtilis YB-15 appears to be a promising biocontrol agent against Fusarium crown rot as well as for wheat growth promotion.
41
Gargouri, Samia, Imène Mtat, Lobna Gargouri Kammoun, Mouldi Zid, and Mohamed Rabeh Hajlaoui. "Molecular Genetic Diversity in Populations of Fusarium pseudograminearum from Tunisia." Journal of Phytopathology 159, no. 4 (November 29, 2010): 306–13. http://dx.doi.org/10.1111/j.1439-0434.2010.01769.x.
Full text
42
Özer, Göksel, İsmail Erper, Şenol Yıldız, Tuğba Bozoğlu, Sezim Zholdoshbekova, Mehtap Alkan, Fatih Tekin, et al. "Fungal Pathogens Associated with Crown and Root Rot in Wheat-Growing Areas of Northern Kyrgyzstan." Journal of Fungi 9, no. 1 (January 16, 2023): 124. http://dx.doi.org/10.3390/jof9010124.
Full textAbstract:
Fungal species associated with crown and root rot diseases in wheat have been extensively studied in many parts of the world. However, no reports on the relative importance and distribution of pathogens associated with wheat crown and root rot in Kyrgyzstan have been published. Hence, fungal species associated with wheat crown/root rot were surveyed in three main wheat production regions in northern Kyrgyzstan. Fungal species were isolated on 1/5 strength potato-dextrose agar amended with streptomycin (0.1 g/L) and chloramphenicol (0.05 g/L). A total of 598 fungal isolates from symptomatic tissues were identified using morphological features of the cultures and conidia, as well as sequence analysis of the nuclear ribosomal internal transcribed spacer (ITS) region, the translation elongation factor 1α (TEF1), and the RNA polymerase II beta subunit (RPB2) genes. The percentage of fields from which each fungus was isolated and their relative percentage isolation levels were determined. Bipolaris sorokiniana, the causal agent of common root rot, was the most prevalent pathogenic species isolated, being isolated from 86.67% of the fields surveyed at a frequency of isolation of 40.64%. Fusarium spp. accounted for 53.01% of all isolates and consisted of 12 different species. The most common Fusarium species identified was Fusarium acuminatum, which was isolated from 70% of the sites surveyed with an isolation frequency of 21.57%, followed by Fusarium culmorum, Fusarium nygamai, Fusarium oxysporum, and Fusarium equiseti, all of which had a field incidence of more than 23%. Inoculation tests with 44 isolates representing 17 species on the susceptible Triticum aestivum cv. Seri 82 revealed that Fusarium pseudograminearum and F. culmorum isolates were equally the most virulent pathogens. The widespread distribution of moderately virulent B. sorokiniana appears to be a serious threat to wheat culture, limiting yield and quality. With the exception of F. culmorum, the remaining Fusarium species did not pose a significant threat to wheat production in the surveyed areas because common species, such as F. acuminatum, F. nygamai, F. oxysporum, and F. equiseti, were non-pathogenic but infrequent species, such as Fusarium redolens, Fusarium algeriense, and F. pseudograminearum, were highly or moderately virulent. Curvularia inaequalis, which was found in three different fields, was mildly virulent. The remaining Fusarium species, Fusarium solani, Fusarium proliferatum, Fusarium burgessii, and Fusarium tricinctum, as well as Microdochium bolleyi, Microdochium nivale, and Macrophomina phaseolina, were non-pathogenic and considered to be secondary colonizers. The implications of these findings are discussed.
43
Smiley, Richard W., and Hui Yan. "Variability of Fusarium Crown Rot Tolerances Among Cultivars of Spring and Winter Wheat." Plant Disease 93, no. 9 (September 2009): 954–61. http://dx.doi.org/10.1094/pdis-93-9-0954.
Full textAbstract:
Crown rot caused by Fusarium pseudograminearum reduces the yield of wheat (Triticum aestivum) in Oregon. Observations of crown rot symptoms in traditional breeding and yield testing nurseries have not been useful for describing tolerance ratings of wheat cultivars. Yield data from inoculated experiments were therefore evaluated to determine if differences in cultivar response could be identified. A comparison of yields in inoculated and noninoculated plots was made for one group of spring wheat entries and four groups of winter wheat entries. Significant differences among spring wheat entries were identified and were validated against standards for tolerance and intolerance to F. pseudograminearum in Australia. Locally adapted and Australian standards exhibited a comparable range of yield reduction due to inoculation. Spring wheat tolerance reactions can be accurately described using as few as 24 yield comparisons. However, this screening method will not be practical for winter wheat due to stronger effects of year and location on the phenotypic tolerance response, requiring about 95 yield comparisons to accurately define the crown rot phenotype of a winter wheat cultivar.
44
Ji, L. J., L. X. Kong, Q. S. Li, L. S. Wang, D. Chen, and P. Ma. "First Report of Fusarium pseudograminearum Causing Fusarium Head Blight of Wheat in Hebei Province, China." Plant Disease 100, no. 1 (January 2016): 220. http://dx.doi.org/10.1094/pdis-06-15-0643-pdn.
Full text
45
Knight, Noel L., Bethany Macdonald, and Mark W. Sutherland. "Colonization of Durum Wheat (Triticum turgidum L. var. durum) Culms Exhibiting Premature Senescence (Dead Heads) Associated with Fusarium pseudograminearum Crown Rot." Plant Disease 101, no. 10 (October 2017): 1788–94. http://dx.doi.org/10.1094/pdis-03-17-0415-re.
Full textAbstract:
Fusarium crown rot is a significant disease of durum wheat (Triticum turgidum L. var. durum), which exhibits high levels of disease susceptibility. The most extreme symptom of crown rot is a prematurely senescing culm that typically fails to set grain. Individual crown rot-affected durum wheat plants displaying both nonsenescent and prematurely senescent culms were harvested to compare visual discoloration, Fusarium pseudograminearum biomass, and vascular colonization in culm sections sampled at three different heights above the crown. Field samples of EGA Bellaroi were collected at Wellcamp, QLD, in 2011, 2012, 2013, and 2014, and of Hyperno at Narrabri, NSW, in 2014. Prematurely senescent culms exhibited greater visual discoloration, F. pseudograminearum biomass, and vascular colonization than nonsenescent culms in each year they were examined. The extent of these differences varied between environments and timing of collection in each year. Vascular colonization initially occurred in xylem vessels and spread into phloem tissues as disease severity increased. The increased presence of hyphae in vascular bundles of prematurely senescing culms provides strong evidence for the hypothesis that restriction of water and nutrient movement in a diseased culm is a key factor in crown rot severity.
46
Özdemir, Fatih. "Host Susceptibility of CIMMYT’s International Spring Wheat Lines to Crown and Root Rot Caused by Fusarium culmorum and F. pseudograminearum." Agronomy 12, no. 12 (December 1, 2022): 3038. http://dx.doi.org/10.3390/agronomy12123038.
Full textAbstract:
The destructive soilborne Fusarium species is one of the most serious challenges facing agriculture. Mycotoxins produced by Fusarium spp. can induce both acute and chronic toxic effects on humans and animals. Massive investments have been made in the last few decades to develop an appropriate management strategy to control Fusarium species in cereals, particularly in wheat, using genetic resistance and other practices, with varied outcomes. The purpose of this research was to find new sources of resistance to both Fusarium culmorum and F. pseudograminearum, which are wheat’s most destructive pathogens in seedlings and adult plants stages. In this study, 26 lines were selected and promoted from a total of 200 spring wheat germplasm received from CIMMYT Mexico plus 6 local check lines. The 32 lines were screened for their resistance reactions to both Fusarium species under different environmental conditions. The discriminant factorial analysis indicated that 7, 12, and 5 were resistant lines against F. culmorum under field, greenhouse, and growth room conditions, respectively. Four lines, L12, L19, L21, and L26, were found to be jointly resistant at the adult and seedling stages in the field and greenhouse. On the other hand, only moderately resistant lines were found for F. pseudograminearum but not completely resistant, which was limited to growth room conditions. Interestingly, five lines (L10, L13, L17, L25, and L28) have shown resistant properties to both Fusarium species. To further evaluate the yield performance of the best-selected 26 lines plus 6 check lines, field trials were conducted under ± F. culmorum inoculum. The highest yield values were obtained from three check lines, as well as the L26, which showed consistency in its reaction to F. culmorum under both field and greenhouse conditions, and produced a high yield (5342 kg/ha). Based on the result obtained, L26 showed a high potential to improve wheat yield and resistance to F. culmorum-caused root and crown rot; therefore, it should be used in wheat crossing programs. Having Fusarium-resistant varieties will ultimately reduce crown rot symptoms and increase grain quality by reducing mycotoxin levels.
47
Chakraborty, Sukumar, Friday Obanor, Rhyannyn Westecott, and Krishanthi Abeywickrama. "Wheat Crown Rot Pathogens Fusarium graminearum and F. pseudograminearum Lack Specialization." Phytopathology® 100, no. 10 (October 2010): 1057–65. http://dx.doi.org/10.1094/phyto-01-10-0007.
Full textAbstract:
This article reports a lack of pathogenic specialization among Australian Fusarium graminearum and F. pseudograminearum causing crown rot (CR) of wheat using analysis of variance (ANOVA), principal component and biplot analysis, Kendall's coefficient of concordance (W), and κ statistics. Overall, F. pseudograminearum was more aggressive than F. graminearum, supporting earlier delineation of the crown-infecting group as a new species. Although significant wheat line–pathogen isolate interaction in ANOVA suggested putative specialization when seedlings of 60 wheat lines were inoculated with 4 pathogen isolates or 26 wheat lines were inoculated with 10 isolates, significant W and κ showed agreement in rank order of wheat lines, indicating a lack of specialization. The first principal component representing nondifferential aggressiveness explained a large part (up to 65%) of the variation in CR severity. The differential components were small and more pronounced in seedlings than in adult plants. By maximizing variance on the first two principal components, biplots were useful for highlighting the association between isolates and wheat lines. A key finding of this work is that a range of analytical tools are needed to explore pathogenic specialization, and a statistically significant interaction in an ANOVA cannot be taken as conclusive evidence of specialization. With no highly resistant wheat cultivars, Fusarium isolates mostly differ in aggressiveness; however, specialization may appear as more resistant cultivars become widespread.
48
Sabburg, R., F. Obanor, and E. Aitken. "Effect on Increasing Temperature on the Pathogenic Fitness of Fusarium Pseudograminearum." Procedia Environmental Sciences 29 (2015): 182–83. http://dx.doi.org/10.1016/j.proenv.2015.07.250.
Full text
49
Scott, Jason B., and Sukumar Chakraborty. "Multilocus sequence analysis of Fusarium pseudograminearum reveals a single phylogenetic species." Mycological Research 110, no. 12 (December 2006): 1413–25. http://dx.doi.org/10.1016/j.mycres.2006.09.008.
Full text
50
Petronaitis, Toni, Clayton Forknall, and Steven Simpfendorfer. "Microwave radiation reduces survival of Fusarium pseudograminearum in durum wheat stubble." Australasian Plant Pathology 47, no. 4 (June 9, 2018): 375–78. http://dx.doi.org/10.1007/s13313-018-0568-6.
Full text