Log in

Relevant bibliographies by topics / Farey tree / Journal articles

Journal articles on the topic 'Farey tree'

To see the other types of publications on this topic, follow the link: Farey tree.

Author: Grafiati

Published: 4 June 2021

Last updated: 28 January 2023

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Farey tree.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Goldberg, Lisa, and Charles Tresser. "Rotation orbits and the Farey tree." Ergodic Theory and Dynamical Systems 16, no. 5 (October 1996): 1011–29. http://dx.doi.org/10.1017/s0143385700010154.

Full text

Abstract:

AbstractAn α-rotation orbit for a self-map of the circle is an orbit whose cyclic order on the circle is the same as for any orbit of rotation by a. In this paper, we classify sets which are minimal sets comprised of a-rotation orbits for degree d αself-coverings of the circle.

APA, Harvard, Vancouver, ISO, and other styles

2

Mosko, Marc, and J. J. Garcia-Luna-Aceves. "Fraction interpolation walking a Farey tree." Information Processing Letters 98, no. 1 (April 2006): 19–23. http://dx.doi.org/10.1016/j.ipl.2005.11.014.

Full text

APA, Harvard, Vancouver, ISO, and other styles

3

Golubeva, E. P. "Random variables associated with the Farey tree." Journal of Mathematical Sciences 193, no. 1 (July 24, 2013): 32–39. http://dx.doi.org/10.1007/s10958-013-1430-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

4

Kim, Dong Han, Seonhee Lim, Hitoshi Nakada, and Rie Natsui. "Farey maps, Diophantine approximation and Bruhat–Tits tree." Finite Fields and Their Applications 30 (November 2014): 14–32. http://dx.doi.org/10.1016/j.ffa.2014.05.007.

Full text

APA, Harvard, Vancouver, ISO, and other styles

5

PIACQUADIO, M., and E. CESARATTO. "MULTIFRACTAL SPECTRUM AND THERMODYNAMICAL FORMALISM OF THE FAREY TREE." International Journal of Bifurcation and Chaos 11, no. 05 (May 2001): 1331–58. http://dx.doi.org/10.1142/s0218127401002754.

Full text

Abstract:

Let (Ω, μ) be a set of real numbers to which we associate a measure μ. Let α≥0, let Ωα={x∈Ω/α(x)=α}, where α is the concentration index defined by Halsey et al. [1986]. Let fH(α) be the Hausdorff dimension of Ωα. Let fL(α) be the Legendre spectrum of Ω, as defined in [Riedi & Mandelbrot, 1998]; and fC(α) the classical computational spectrum of Ω, defined in [Halsey et al., 1986]. The task of comparing fH, fC and fL for different measures μ was tackled by several authors [Cawley & Mauldin, 1992; Mandelbrot & Riedi, 1997; Riedi & Mandelbrot, 1998] working, mainly, on self-similar measures μ. The Farey tree partition in the unit segment induces a probability measure μ on an universal class of fractal sets Ω that occur in physics and other disciplines. This measure μ is the Hyperbolic measure μℍ, fundamentally different from any self-similar one. In this paper we compare fH, fC and fL for μℍ.

APA, Harvard, Vancouver, ISO, and other styles

6

Piacquadio, M., and M. Rosen. "Multifractal Spectrum of an Experimental (Video Feedback) Farey Tree." Journal of Statistical Physics 127, no. 4 (March 7, 2007): 783–804. http://dx.doi.org/10.1007/s10955-006-9217-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

7

Devaney, Robert L. "The Mandelbrot Set, the Farey Tree, and the Fibonacci Sequence." American Mathematical Monthly 106, no. 4 (April 1999): 289. http://dx.doi.org/10.2307/2589552.

Full text

APA, Harvard, Vancouver, ISO, and other styles

8

Lagarias, J. C., and C. P. Tresser. "A walk along the branches of the extended Farey Tree." IBM Journal of Research and Development 39, no. 3 (May 1995): 283–94. http://dx.doi.org/10.1147/rd.393.0283.

Full text

APA, Harvard, Vancouver, ISO, and other styles

9

Devaney, Robert L. "The Mandelbrot Set, the Farey Tree, and the Fibonacci Sequence." American Mathematical Monthly 106, no. 4 (April 1999): 289–302. http://dx.doi.org/10.1080/00029890.1999.12005046.

Full text

APA, Harvard, Vancouver, ISO, and other styles

10

Ringland, John, and Mark Schell. "The Farey tree embodied — In bimodal maps of the interval." Physics Letters A 136, no. 7-8 (April 1989): 379–86. http://dx.doi.org/10.1016/0375-9601(89)90419-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

11

KENNY, BRIAN G., and TONY W. DIXON. "AMBIGUITY IN THE DETERMINATION OF THE FREE ENERGY ASSOCIATED WITH THE CRITICAL CIRCLE MAP." ANZIAM Journal 50, no. 2 (October 2008): 177–84. http://dx.doi.org/10.1017/s1446181108000291.

Full text

Abstract:

AbstractWe consider a simple model to describe the widths of the mode-locked intervals for the critical circle map. By using two different partitions of the rational numbers based on Farey series and Farey tree levels, respectively, we calculate the free energy analytically at selected points for each partition. It emerges that the result of the calculation depends on the method of partition. An implication of this finding is that the generalized dimensions Dq are different for the two types of partition except when q=0; that is, only the Hausdorff dimension is the same in both cases.

APA, Harvard, Vancouver, ISO, and other styles

12

Brucks, K. M., and C. Tresser. "A Farey tree organization of locking regions for simple circle maps." Proceedings of the American Mathematical Society 124, no. 2 (1996): 637–47. http://dx.doi.org/10.1090/s0002-9939-96-03025-0.

Full text

APA, Harvard, Vancouver, ISO, and other styles

13

Calero-Sanz, Jorge. "On the Degree Distribution of Haros Graphs." Mathematics 11, no. 1 (December 26, 2022): 92. http://dx.doi.org/10.3390/math11010092.

Full text

Abstract:

Haros graphs are a graph-theoretical representation of real numbers in the unit interval. The degree distribution of the Haros graphs provides information regarding the topological structure and the associated real number. This article provides a comprehensive demonstration of a conjecture concerning the analytical formulation of the degree distribution. Specifically, a theorem outlines the relationship between Haros graphs, the corresponding continued fraction of its associated real number, and the subsequent symbolic paths in the Farey binary tree. Moreover, an expression that is continuous and piecewise linear in subintervals defined by Farey fractions can be derived from an additional conclusion for the degree distribution of Haros graphs.

APA, Harvard, Vancouver, ISO, and other styles

14

Baums, Dieter, Wolfgang Elsässer, and Ernst O. Göbel. "Farey tree and devil’s staircase of a modulated external-cavity semiconductor laser." Physical Review Letters 63, no. 2 (July 10, 1989): 155–58. http://dx.doi.org/10.1103/physrevlett.63.155.

Full text

APA, Harvard, Vancouver, ISO, and other styles

15

Li, Yong, Jinqing Fang, and Qiang Liu. "From unweighted to weighted generalized Farey organized tree and the pyramid networks." Journal of Systems Science and Complexity 23, no. 4 (August 2010): 681–700. http://dx.doi.org/10.1007/s11424-010-9166-6.

Full text

APA, Harvard, Vancouver, ISO, and other styles

16

Moshchevitin, Nikolai, and Anatoly Zhigljavsky. "Entropies of the partitions of the unit interval generated by the Farey tree." Acta Arithmetica 115, no. 1 (2004): 47–58. http://dx.doi.org/10.4064/aa115-1-4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

17

SHEN, YUNZHU, and YONGXIANG ZHANG. "STRANGE NONCHAOTIC ATTRACTORS IN A QUASIPERIODICALLY-FORCED PIECEWISE SMOOTH SYSTEM WITH FAREY TREE." Fractals 27, no. 07 (November 2019): 1950118. http://dx.doi.org/10.1142/s0218348x19501184.

Full text

Abstract:

The existence of strange nonchaotic attractors (SNAs) is verified in a simple quasiperiodically-forced piecewise smooth system with Farey tree. It can be seen that more and more jumping discontinuities appear on the smooth torus and the torus becomes extremely fragmented with the change of control parameter. Finally, the torus becomes an SNA with fractal property. In order to confirm the existence of SNAs in this system, we preliminarily use the estimation of the phase sensitivity exponent, estimation of the largest Lyapunov exponent and rational approximation. SNAs are further characterized by power spectra, recurrence plots, the largest Lyapunov exponents and their variance, the distribution of the finite-time Lyapunov exponents, the spectral distribution function and scaling laws.

APA, Harvard, Vancouver, ISO, and other styles

18

Gruber, C., D. Ueltschi, and J. Jędrzejewski. "Molecule formation and the Farey tree in the one-dimensional Falicov-Kimball model." Journal of Statistical Physics 76, no. 1-2 (July 1994): 125–57. http://dx.doi.org/10.1007/bf02188658.

Full text

APA, Harvard, Vancouver, ISO, and other styles

19

Rao, Xiao-Bo, Yan-Dong Chu, Ying-Xiang Chang, and Jian-Gang Zhang. "Broken Farey tree and fractal in a hexagonal centrifugal governor with a spring." Chaos, Solitons & Fractals 107 (February 2018): 251–55. http://dx.doi.org/10.1016/j.chaos.2018.01.015.

Full text

APA, Harvard, Vancouver, ISO, and other styles

20

ALKAUSKAS, GIEDRIUS. "THE MOMENTS OF MINKOWSKI QUESTION MARK FUNCTION: THE DYADIC PERIOD FUNCTION." Glasgow Mathematical Journal 52, no. 1 (July 30, 2009): 41–64. http://dx.doi.org/10.1017/s0017089509990152.

Full text

Abstract:

AbstractThe Minkowski question mark function ?(x) arises as a real distribution of rationals in the Farey tree. We examine the generating function of moments of ?(x). It appears that the generating function is a direct dyadic analogue of period functions for Maass wave forms and it is defined in the cut plane \ (1, ∞). The exponential generating function satisfies an integral equation with kernel being the Bessel function. The solution of this integral equation leads to the definition of dyadic eigenfunctions, arising from a certain Hilbert–Schmidt operator. Finally, we describe p-adic distribution of rationals in the Stern–Brocot tree. Surprisingly, the Eisenstein series G2(z) does manifest in both real and p-adic cases.

APA, Harvard, Vancouver, ISO, and other styles

21

Du, Zhengdong. "Period-adding and the Farey tree structure in a class of one-dimensional discontinuous nonlinear maps." Nonlinear Dynamics 84, no. 4 (February 1, 2016): 2211–26. http://dx.doi.org/10.1007/s11071-016-2640-5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

22

Siemens, Ansgar, and Peter Schmelcher. "Formation and crossover of multiple helical dipole chains." Journal of Physics A: Mathematical and Theoretical 55, no. 37 (August 19, 2022): 375205. http://dx.doi.org/10.1088/1751-8121/ac86af.

Full text

Abstract:

Abstract We investigate the classical equilibrium properties and metamorphosis of the ground state of interacting dipoles with fixed locations on a helix. The dipoles are shown to align themselves along separate intertwined dipole chains forming single, double, and higher-order helical chains. The number of dipole chains, and their properties such as chirality and length scale on which the chains wind around each other, can be tuned by the geometrical parameters. We demonstrate that all possible configurations form a self-similar bifurcation diagram which can be linked to the Stern–Brocot tree and the underlying Farey sequence. We describe the mechanism responsible for this behavior and subsequently discuss corresponding implications and possible applications.

APA, Harvard, Vancouver, ISO, and other styles

23

Mitani, Hisashi. "The Continued Fraction and Concatenation Series on the Farey Tree on Two Dimensional Atomic Arrays on Periodic Substrate Potentials." Journal of the Physical Society of Japan 69, no. 10 (October 15, 2000): 3276–86. http://dx.doi.org/10.1143/jpsj.69.3276.

Full text

APA, Harvard, Vancouver, ISO, and other styles

24

GROHS, J., F. ZHOU, H. IßLER, and C. KLINGSHIRN. "SELF-OSCILLATIONS OF AN OPTICALLY BISTABLE ELEMENT WITH VERY BROAD HYSTERESIS IN A HYBRID RING CAVITY." International Journal of Bifurcation and Chaos 02, no. 04 (December 1992): 861–72. http://dx.doi.org/10.1142/s0218127492000483.

Full text

Abstract:

We investigate thermally induced optical nonlinearity of a glass doped with semiconductor quantum dots. With the feedback of a Fabry-Perot resonator this glass shows dispersive optical bistability. The reflected light signal is coupled to a hybrid ring cavity with a round trip time much longer than that of the Fabry-Perot resonator and even longer than the thermal relaxation time of the glass. The self-oscillations occurring for certain input parameters are regular and the appearance of different modes as a function of the light intensity coupled to the resonator is observed. Due to the broad hysteresis and the high inclination of both branches of the bistable loop we observe large numbers of ascending and descending steps in the output intensity, i.e., long oscillation periods. A simple model of adiabatic simulations by an iterated map shows that the mode structure follows a Farey-tree construction.

APA, Harvard, Vancouver, ISO, and other styles

25

Kawczyński, Andrzej L., and Peter E. Strizhak. "Period adding and broken Farey tree sequence of bifurcations for mixed-mode oscillations and chaos in the simplest three-variable nonlinear system." Journal of Chemical Physics 112, no. 14 (April 8, 2000): 6122–30. http://dx.doi.org/10.1063/1.481222.

Full text

APA, Harvard, Vancouver, ISO, and other styles

26

Gebber, Gerard L., Sheng Zhong, Shi-Yi Zhou, and Susan M. Barman. "Nonlinear dynamics of the frequency locking of baroreceptor and sympathetic rhythms." American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 273, no. 6 (December 1, 1997): R1932—R1945. http://dx.doi.org/10.1152/ajpregu.1997.273.6.r1932.

Full text

Abstract:

We used phase plane analysis to identify modes of frequency locking of the 10-Hz rhythm in sympathetic nerve discharge (SND) to the cardiac cycle in urethan-anesthetized, baroreceptor-innervated cats. Frequency locking occurred in rational ratios predicted by a generic mathematical construct called the Farey tree. Both simple harmonic ratios (e.g., 1:3) and complex ratios (e.g., 2:5) comprised of relatively prime integers (no common divisor) were identified under natural conditions. Frequency locking in such ratios is attributed to forcing of the 10-Hz oscillator by pulse-synchronous baroreceptor afferent nerve activity (BNA). Ventricular pacing changed the frequency of the 10-Hz rhythm as well as heart rate so as to maintain or change the ratio of frequency locking in a predictable way. Intriguingly, frequency locking of the 10-Hz rhythm to medullary raphe sympathoinhibitory stimuli in simple harmonic ratios was accompanied by increased power in the 10-Hz band of SND, whereas locking in complex ratios led to decreased 10-Hz power. These findings raise the possibility that pulse-synchronous BNA also exerts divergent actions on the 10-Hz rhythm depending on the ratio of frequency locking. Augmented 10-Hz power can be attributed to the resonant properties of oscillators that are periodically forced at the same phase in their cycle.

APA, Harvard, Vancouver, ISO, and other styles

27

Dotov, Dobromir, and Laurel J. Trainor. "Cross-frequency coupling explains the preference for simple ratios in rhythmic behaviour and the relative stability across non-synchronous patterns." Philosophical Transactions of the Royal Society B: Biological Sciences 376, no. 1835 (August 23, 2021): 20200333. http://dx.doi.org/10.1098/rstb.2020.0333.

Full text

Abstract:

Rhythms are important for understanding coordinated behaviours in ecological systems. The repetitive nature of rhythms affords prediction, planning of movements and coordination of processes within and between individuals. A major challenge is to understand complex forms of coordination when they differ from complete synchronization. By expressing phase as ratio of a cycle, we adapted levels of the Farey tree as a metric of complexity mapped to the range between in-phase and anti-phase synchronization. In a bimanual tapping task, this revealed an increase of variability with ratio complexity, a range of hidden and unstable yet measurable modes, and a rank-frequency scaling law across these modes. We use the phase-attractive circle map to propose an interpretation of these findings in terms of hierarchical cross-frequency coupling (CFC). We also consider the tendency for small-integer attractors in the single-hand repeated tapping of three-interval rhythms reported in the literature. The phase-attractive circle map has wider basins of attractions for such ratios. This work motivates the question whether CFC intrinsic to neural dynamics implements low-level priors for timing and coordination and thus becomes involved in phenomena as diverse as attractor states in bimanual coordination and the cross-cultural tendency for musical rhythms to have simple interval ratios. This article is part of the theme issue ‘Synchrony and rhythm interaction: from the brain to behavioural ecology’.

APA, Harvard, Vancouver, ISO, and other styles

28

Choi, Sang-Kyu, and Sherif T. Noah. "Mode-Locking and Chaos in a Jeffcott Rotor With Bearing Clearances." Journal of Applied Mechanics 61, no. 1 (March 1, 1994): 131–38. http://dx.doi.org/10.1115/1.2901387.

Full text

Abstract:

A complex mode-locking (or entrainment) structure underlying the nonlinear whirling phenomenon of a horizontal Jeffcott rotor with a discontinuous nonlinearity (bearing clearance) was identified. A winding number is introduced as a measure of the ratio between two frequencies involved in the aperiodic whirling motions of the rotor system considered. Utilizing the winding number map, it was revealed that the alternating periodic and quasi-periodic responses take place according to the Farey number tree. The winding number varies in the form of the so-called “Devil’s staircase” as a certain system parameter varies. From the mode-locking pattern in the parameter space of the forcing amplitude and frequency, it was observed that as the forcing amplitude increases, the size of each locking interval increases so that its growth takes place in the form of “Arnol’d tongues,” where the winding number remains a rational number. Moreover, inside each locking zone, i.e., each “Arnol’d tongue,” there exist many smaller tongues similar to the main tongue, in which a sequence of period-doubling bifurcations leading to chaos occurred. The boundaries of each locking zone was obtained using a fixed-point algorithm along with the Floquet theory for checking the stability of the periodic solutions. The winding numbers were estimated utilizing a fixed-point algorithm modified to obtain quasi-periodic responses. A jump phenomenon was also observed by tracking multiple periodic solutions for several parameters of the rotor system.

APA, Harvard, Vancouver, ISO, and other styles

29

Wood, Bruce W., Jerry A. Payne, and Owen Jones. "Transplanting Bearing Pecan Trees." HortScience 25, no. 8 (August 1990): 916–18. http://dx.doi.org/10.21273/hortsci.25.8.916.

Full text

Abstract:

Overcrowding in young high-density pecan [Carya illinoensis (Wangenh.) C. Koch] orchards has prompted a study of tree transplanting and evaluation of survival and tree performance. Shoot growth and nut production characteristics of 13-year-old `Stuart' and `Farley' pecan trees subjected to different stubbing and pruning treatments and then transplanted with a large tree spade indicated that transplants can survive with little or no pruning if moved when dormant. Shoot regrowth was proportional to the degree of pruning, and nut production was inversely proportional to the degree of pruning.

APA, Harvard, Vancouver, ISO, and other styles

30

Bush, Elizabeth. "Secret Tree Fort by Brianne Farley." Bulletin of the Center for Children's Books 69, no. 9 (2016): 465. http://dx.doi.org/10.1353/bcc.2016.0400.

Full text

APA, Harvard, Vancouver, ISO, and other styles

31

Tetsumura, Takuya, Hisajiro Yukinaga, and Ryutaro Tao. "Early Field Performance of Micropropagated Japanese Persimmon Trees." HortScience 33, no. 4 (July 1998): 751–53. http://dx.doi.org/10.21273/hortsci.33.4.751.

Full text

Abstract:

Growth of micropropagated Japanese persimmon trees (Diospyros kaki L. cv. Nishimurawase) during the initial 3 years after field establishment was compared with that of grafted trees on seedling stocks. Judging from the mean length of annual shoots per tree and the yearly increases in height, trunk diameter, and top and root dry mass, the grafted trees on seedling stocks grew poorly during the first and second growing seasons, while micropropagated trees, raised in an outdoor nursery, developed poorly only during the first growing season. In contrast, micropropagated trees raised in pots fared well soon after field establishment. These trees had more fine than middle and large roots; in contrast, grafted trees on seedling stocks had one large taproot, which died back to some extent after field establishment, with few fine roots.

APA, Harvard, Vancouver, ISO, and other styles

32

Degli Esposti, Mirko, Stefano Isola, and Andreas Knauf. "Generalized Farey Trees, Transfer Operators and Phase Transitions." Communications in Mathematical Physics 275, no. 2 (August 2, 2007): 297–329. http://dx.doi.org/10.1007/s00220-007-0294-3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

33

Zhang, Zhongzhi, Bin Wu, and Yuan Lin. "Counting spanning trees in a small-world Farey graph." Physica A: Statistical Mechanics and its Applications 391, no. 11 (June 2012): 3342–49. http://dx.doi.org/10.1016/j.physa.2012.01.039.

Full text

APA, Harvard, Vancouver, ISO, and other styles

34

Zhang, Jingyuan, and Weigen Yan. "Counting spanning trees of a type of generalized Farey graphs." Physica A: Statistical Mechanics and its Applications 555 (October 2020): 124749. http://dx.doi.org/10.1016/j.physa.2020.124749.

Full text

APA, Harvard, Vancouver, ISO, and other styles

35

Conejero, J. Alberto, Cristina Jordán, and Esther Sanabria-Codesal. "A Tree-Based Model for Setting Optimal Train Fare Zones." Mathematical Problems in Engineering 2014 (2014): 1–11. http://dx.doi.org/10.1155/2014/384321.

Full text

Abstract:

Given a railway line withnstops and the number of travelers between each pair of stops, we show how to split these stops intokdifferent fare zones in order to maximize the benefit obtained from the sale of tickets to the travelers. We present a method to obtain this solution that is based on finding the longest path in a weighted root tree. This method improves in terms of efficiency the combinatorial method, where all the possible distributions have to be considered for deciding which is the optimal one.

APA, Harvard, Vancouver, ISO, and other styles

36

LEWIS, CHERRY. "GEOLOGISTS JOHN FAREY AND WILLIAM SMITH AWARDED SILVER MEDALS FOR AGRICULTURE." Earth Sciences History 37, no. 2 (January 1, 2018): 293–308. http://dx.doi.org/10.17704/1944-6178-37.2.293.

Full text

Abstract:

In 1805 John Farey and William Smith, received silver medals for agriculture from the Society for the Encouragement of Arts, Manufactures and Commerce, in recognition of work they had carried out on the Duke of Bedford's estate at Woburn. Today we recognise these men as leading geologists of their time, but Farey's medal was awarded for experiments which recorded the growth of timber trees in Brown's Wood over a sixteen-year period and William Smith's for turning Prisley Bog into a water meadow. While today these agricultural endeavours may appear unrelated to geology, this paper demonstrates how an increasing understanding of the substratum became an important aspect of agriculture, and how the offer of premiums for agriculture indirectly contributed to advancing the young science of geology.

APA, Harvard, Vancouver, ISO, and other styles

37

Worley, Ray E. "Effects of Hedging and Selective Limb Pruning of Elliott, Desirable, and Farley Pecan Trees under Three Irrigation Regimes." Journal of the American Society for Horticultural Science 110, no. 1 (January 1985): 12–16. http://dx.doi.org/10.21273/jashs.110.1.12.

Full text

Abstract:

Abstract Twenty-year-old ‘Elliott’, ‘Desirable’, and ‘Farley’ trees were pruned over, an 8-year period using: 1) pruning on only low and broken limbs, 2) removal of competing wood from alternating temporary trees, 3) top and side hedging, and 4) selective limb pruning. Wood removal from temporary trees was low, except for the last two years of the study, and little difference in yield and quality from the control was obtained. Top and side hedging reduced overall yield of ‘Desirable’ and ‘Farley’ and it changed the alternate bearing phase of ‘Elliott’ so that yields were increased and decreased in alternating years. Selective limb pruning increased yield of ‘Desirable’ in one year but, overall, gave no significant yield changes from the control. Selective limb pruning increased ‘Elliott’ yield in some years and reduced it in others to give an overall reduction in yield. Selective limb pruning did not reduce yield of ‘Farley’ significantly. Selective limb pruning usually increased nut size, and pruning effects on quality were erratic. Both hedging and selective limb pruning usually increased terminal growth. Most parameters measured showed significant cultivar × year × irrigation × pruning interactions.

APA, Harvard, Vancouver, ISO, and other styles

38

Kotivuori, Eetu, Matti Maltamo, Lauri Korhonen, Jacob L. Strunk, and Petteri Packalen. "Prediction error aggregation behaviour for remote sensing augmented forest inventory approaches." Forestry: An International Journal of Forest Research 94, no. 4 (March 24, 2021): 576–87. http://dx.doi.org/10.1093/forestry/cpab007.

Full text

Abstract:

Abstract In this study we investigated the behaviour of aggregate prediction errors in a forest inventory augmented with multispectral Airborne Laser Scanning and airborne imagery. We compared an Area-Based Approach (ABA), Edge-tree corrected ABA (EABA) and Individual Tree Detection (ITD). The study used 109 large 30 × 30 m sample plots, which were divided into four 15 × 15 m subplots. Four different levels of aggregation were examined: all four subplots (quartet), two diagonal subplots (diagonal), two edge-adjacent subplots (adjacent) and subplots without aggregation. We noted that the errors at aggregated levels depend on the selected predictor variables, and therefore, this effect was studied by repeating the variable selection 200 times. At the subplot level, EABA provided the lowest mean of root mean square error ($\overline{\mathrm{RMSE}}$) values of 200 repetitions for total stem volume (EABA 21.1 percent, ABA 23.5 percent, ITD 26.2 percent). EABA also fared the best for diagonal and adjacent aggregation ($\overline{\mathrm{RMSE}}$: 17.6 percent, 17.4 percent), followed by ABA ($\overline{\mathrm{RMSE}}$: 19.3 percent, 18.2 percent) and ITD ($\overline{\mathrm{RMSE}}$: 21.8, 21.9 percent). Adjacent subplot errors of ABA were less correlated than errors of diagonal subplots, which resulted also in clearly lower RMSEs for adjacent subplots. This appears to result from edge tree effects, where omission and commission errors cancel for trees leaning from one subplot into the other. The best aggregate performance was achieved at the quartet level, as expected from fundamental properties of variance. ABA and EABA had similar RMSEs at the quartet level ($\overline{\mathrm{RMSE}}$ 15.5 and 15.3 percent), with poorer ITD performance ($\overline{\mathrm{RMSE}}$ 19.4 percent).

APA, Harvard, Vancouver, ISO, and other styles

39

Zambounis, Antonios, Aliki Xanthopoulou, Filippos A. Aravanopoulos, Athanasios Tsaftaris, and Evaggelos Barbas. "First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece." International Journal of Phytopathology 5, no. 1 (June 13, 2016): 53. http://dx.doi.org/10.33687/phytopath.005.01.1601.

Full text

Abstract:

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

APA, Harvard, Vancouver, ISO, and other styles

40

Garrett, Phoebe. "ANCESTRY AND FAMILY IDENTITY IN SUETONIUS’ CAESARS." Classical Quarterly 71, no. 2 (November 12, 2021): 777–90. http://dx.doi.org/10.1017/s0009838821000823.

Full text

Abstract:

AbstractSuetonius’ Lives of the Caesars usually begin with a family tree. These family trees are often rhetorical, foreshadowing in the ancestors character traits that will be themes of the rest of the Life. This particular rhetorical strategy relies upon an older phenomenon of ‘family identity’—namely, the literary application of similar characteristics to people in the same family—such as the one that tells us that the Claudii are proud and the Domitii Ahenobarbi are ferocious. Gary Farney studied ‘family identity’ as a phenomenon of the Republic. There, it was the association of a family with a certain characteristic, a kind of ‘branding’. It would be perfectly obvious for Suetonius to use the family identities already in use for well-known families, but, as I show here, Suetonius’ selection of ancestors creates different family identities rather than simply using the traditional ones he would have found in other sources. In this study I concentrate on Nero and Tiberius. I focus on these two emperors because they are individuals where there is a known family identity in other sources and they also have the most detailed and elaborate ancestry sections in Suetonius’ Caesars. Family identity seems to be most interesting to Suetonius when it goes against expectations, and that is when Suetonius’ family trees are most elaborate.

APA, Harvard, Vancouver, ISO, and other styles

41

Reichhardt, C., and Franco Nori. "Phase Locking, Devil's Staircases, Farey Trees, and Arnold Tongues in Driven Vortex Lattices with Periodic Pinning." Physical Review Letters 82, no. 2 (January 11, 1999): 414–17. http://dx.doi.org/10.1103/physrevlett.82.414.

Full text

APA, Harvard, Vancouver, ISO, and other styles

42

Sekikawa, Munehisa, Takuji Kousaka, Tadashi Tsubone, Naohiko Inaba, and Hideaki Okazaki. "Bifurcation analysis of mixed-mode oscillations and Farey trees in an extended Bonhoeffer–van der Pol oscillator." Physica D: Nonlinear Phenomena 433 (May 2022): 133178. http://dx.doi.org/10.1016/j.physd.2022.133178.

Full text

APA, Harvard, Vancouver, ISO, and other styles

43

Rose, G. A. "Reconciling overfishing and climate change with stock dynamics of Atlantic cod (Gadus morhua) over 500 years." Canadian Journal of Fisheries and Aquatic Sciences 61, no. 9 (September 1, 2004): 1553–57. http://dx.doi.org/10.1139/f04-173.

Full text

Abstract:

To examine overfishing and climate effects on depleted cod (Gadus morhua) stocks, a surplus production model based on reconstructions of cod catch in Newfoundland was used to describe biomass dynamics from 1505 to 2004. Productivity parameters r (population growth rate) and K (carrying capacity) were assigned by fitting model to survey biomass. Assumptions of fishery-only influences inferring constant, random, or depensatory parameters fared poorly (did not mimic history), as did climate influences indexed by tree ring growth. However, a model using both climate and depensation fared well, mimicking much documented history of Newfoundland cod, including declines during the Little Ice Age (mid- to late 19th century) and the stock collapses of the late 20th century, with a good fit to recent scientific surveys (r2 = 0.80). This model suggests temporal differentiation between fishing and climate effects, including (i) declines during the Little Ice Age (18001880) caused by lower productivity, (ii) collapses in the 1960s caused by overfishing, (iii) collapses in the late 1980s caused by both, and (iv) rebuilding now hindered by depensatory effects of low numbers.

APA, Harvard, Vancouver, ISO, and other styles

44

Albano, Mariangela, and Emine Alkaya. "A aprendizaxe do italiano L4 a partir do francés L2 para estudantes adultos de fala turca: o caso das colocacións «fare + substantivo» e «fare + determinante + substantivo»." Cadernos de Fraseoloxía Galega, no. 23 (December 26, 2022): 23–38. http://dx.doi.org/10.52740/cfg.22.23.01.00027.

Full text

Abstract:

Este estudo describe a influencia que exerce o francés L2 na aprendizaxe de italiano L4 por parte de estudantes adultos de fala turca nun contexto universitario. O noso estudo céntrase, concretamente, na interpretación e tradución de trece colocacións italianas do tipo «fare + substantivo» e «fare + determinante + substantivo». Describimos e analizamos as decisións tradutolóxicas destas colocacións baseándonos na lingüística analóxica (Hofstadter 1995; Gentner et al., 2001; Monneret, 2011 e 2018) e na semántica cognitiva (Lakoff e Johnson, 1980 e 1999). O noso propósito é destacar a importancia de empregar unha lingua franca, coma o francés, para fomentar a aprendizaxe das construcións fraseolóxicas italianas ante un público de fala turca.

APA, Harvard, Vancouver, ISO, and other styles

45

Ahluwalia, Madhu V., Aryya Gangopadhyay, and Zhiyuan Chen. "Preserving Privacy in Mining Quantitative Associations Rules." International Journal of Information Security and Privacy 3, no. 4 (October 2009): 1–17. http://dx.doi.org/10.4018/jisp.2009100101.

Full text

Abstract:

Association rule mining is an important data mining method that has been studied extensively by the academic community and has been applied in practice. In the context of association rule mining, the state-of-the-art in privacy preserving data mining provides solutions for categorical and Boolean association rules but not for quantitative association rules. This article fills this gap by describing a method based on discrete wavelet transform (DWT) to protect input data privacy while preserving data mining patterns for association rules. A comparison with an existing kd-tree based transform shows that the DWT-based method fares better in terms of efficiency, preserving patterns, and privacy.

APA, Harvard, Vancouver, ISO, and other styles

46

McLaughlin, J. A. "Impact of Armillaria root disease on succession in red pine plantations in southern Ontario." Forestry Chronicle 77, no. 3 (June 1, 2001): 519–24. http://dx.doi.org/10.5558/tfc77519-3.

Full text

Abstract:

Armillaria root disease created openings in southern Ontario red pine plantations that are gradually succeeding to hardwood-dominated mixedwoods through natural regeneration. A study of 13 root disease centres found several tree and shrub species colonizing the openings. Black cherry was the most important hardwood and white pine the most important conifer colonizer. Mortality of black cherry and white pine regeneration was greater than for other species. Long-term survival of conifers in the centres is doubtful, and high mortality of black cherry is expected. Other hardwood species may fare better but with growth and yield losses due to Armillaria infection. Key words: Armillaria root disease, red pine plantations, succession, disturbance ecology, Armillaria ostoyae

APA, Harvard, Vancouver, ISO, and other styles

47

Menkhorst, Peter, David Ramsey, Tim O'Brien, Emily Hynes, and Desley Whisson. "Survival and movements of koalas translocated from an over-abundant population." Wildlife Research 46, no. 7 (2019): 557. http://dx.doi.org/10.1071/wr19090.

Full text

Abstract:

Abstract Context At some sites in southern Victoria, browsing pressure caused by high-density koala populations can result in defoliation of preferred browse trees. In extreme cases, this over-browsing can lead to widespread tree death and starvation of koalas. To reduce the potential for mortality of trees and koalas, a management strategy that includes fertility control of females and translocation of healthy individuals (male and female) has been adopted. AimsTo compare the short- to medium-term survival and body condition of koalas translocated from over-browsed habitat and released into unoccupied (or nearly so) habitat with that of koalas left in situ in compromised habitat. Methods We monitored survival and body condition of 36 translocated koalas for 4–5 months after translocation relative to that of a control group (24 animals) left in situ. Koalas were recaptured and body condition measured (as a scaled body-mass index) ~40 and 137 days after translocation. Additionally, GPS loggers were used to investigate patterns of koala movement. Key resultsSurvival rates of translocated koalas were not different from those of controls and females in both groups showed slightly higher survival rates than did males. After 137 days, control animals had lower scaled body mass, whereas translocated animals, after an initial reduction, had mostly regained, or increased their scaled body mass. Translocated females regained their original scaled body mass faster than did translocated males. Male koalas in both control and translocated groups had higher rates of movement than did females, and translocated koalas had slightly higher rates of movement than did control koalas. Translocated koalas moved farther from their release location than control koalas. ConclusionsOn the basis of the scaled body-mass index, translocated koalas fared better than those left in situ in compromised habitat, even though the density of koalas in the over-browsed habitat had been reduced by a wider salvage translocation program. The process used to identify potential release sites, including a spatial koala-habitat index, accurately predicted suitable koala habitat. ImplicationsThe current management strategy of translocating koalas out of over-browsed habitat is supported and could be more widely applied.

APA, Harvard, Vancouver, ISO, and other styles

48

Hegedűs, Ferenc. "Topological analysis of the periodic structures in a harmonically driven bubble oscillator near Blake's critical threshold: Infinite sequence of two-sided Farey ordering trees." Physics Letters A 380, no. 9-10 (March 2016): 1012–22. http://dx.doi.org/10.1016/j.physleta.2016.01.022.

Full text

APA, Harvard, Vancouver, ISO, and other styles

49

Condit, Richard, Stephen P. Hubbell, and Robin B. Foster. "Changes in tree species abundance in a Neotropical forest: impact of climate change." Journal of Tropical Ecology 12, no. 2 (March 1996): 231–56. http://dx.doi.org/10.1017/s0266467400009433.

Full text

Abstract:

ABSTRACTThe abundance of all tree and shrub species has been monitored for eight years in a 50 ha census plot in tropical moist forest in central Panama. Here we examine population trends of the 219 most numerous species in the plot, assessing the impact of a long-term drying trend. Population change was calculated as the mean rate of increase (or decrease) over eight years, considering either all stems ≥10 mm diameter at breast height (dbh) or just stems ≥100 mm dbh. For stems ≥10 mm, 40% of the species had mean growth rates <1% per year (either increasing or decreasing) and 12% had changes ≥5% per year. For stems ≥100 mm, the figures were 38% and 8%.Species that specialize on the slopes of the plot, a moist microhabitat relative to the plateau, suffered significantly more declines in abundance than species that did not prefer slopes (stems ≥10 mm dbh). This pattern was due entirely to species of small stature: 91% of treelets and shrubs that were slope-specialists declined in abundance, but just 19% of non-slope treelets and shrubs declined. Among larger trees, slope and non-slope species fared equally. For stems ≥100 mm dbh, the slope effect vanished because there were few shrubs and treelets with stems ≥100 mm dbh. Another edaphic guild of species, those occurring preferentially in a small swamp in the centre of the plot, were no more likely to decline in abundance than non-swamp species, regardless of growth form. Species that preferentially colonize canopy gaps in the plot were slightly more likely to decrease in abundance than non-colonizing species (only for stems ≥10 mm dbh, not ≥100 mm). Despite this overall trend, however, several colonizing species had the most rapidly increasing populations in the plot.The impact of a 25-year drying trend and an associated increase in the severity of the 4-month dry season is having an obvious impact on the BCI forest. At least 16 species of shrubs and treelets with affinities for moist microhabitats are headed for extinction in the plot. Presumably, these species invaded the forest during a wetter period prior to 1966. A severe drought of 1983 that caused unusually high tree mortality contributed to this trend, and may also have been responsible for sharp increases in abundance of a few gap-colonizers because it temporarily opened the forest canopy. The BCI forest is remarkably sensitive to a subtle climatic shift, yet we do not know whether this is typical for tropical forests because no other large-scale censuses exist for comparison.

APA, Harvard, Vancouver, ISO, and other styles

50

Edwards, Scott V., Sally Potter, C. Jonathan Schmitt, Jason G. Bragg, and Craig Moritz. "Reticulation, divergence, and the phylogeography–phylogenetics continuum." Proceedings of the National Academy of Sciences 113, no. 29 (July 18, 2016): 8025–32. http://dx.doi.org/10.1073/pnas.1601066113.

Full text

Abstract:

Phylogeography, and its extensions into comparative phylogeography, have their roots in the layering of gene trees across geography, a paradigm that was greatly facilitated by the nonrecombining, fast evolution provided by animal mtDNA. As phylogeography moves into the era of next-generation sequencing, the specter of reticulation at several levels—within loci and genomes in the form of recombination and across populations and species in the form of introgression—has raised its head with a prominence even greater than glimpsed during the nuclear gene PCR era. Here we explore the theme of reticulation in comparative phylogeography, speciation analysis, and phylogenomics, and ask how the centrality of gene trees has fared in the next-generation era. To frame these issues, we first provide a snapshot of multilocus phylogeographic studies across the Carpentarian Barrier, a prominent biogeographic barrier dividing faunas spanning the monsoon tropics in northern Australia. We find that divergence across this barrier is evident in most species, but is heterogeneous in time and demographic history, often reflecting the taxonomic distinctness of lineages spanning it. We then discuss a variety of forces generating reticulate patterns in phylogeography, including introgression, contact zones, and the potential selection-driven outliers on next-generation molecular markers. We emphasize the continued need for demographic models incorporating reticulation at the level of genomes and populations, and conclude that gene trees, whether explicit or implicit, should continue to play a role in the future of phylogeography.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!