Journal articles on the topic 'Etching, German South Australia'

The German presence in nineteenth-century South Australia is associated primarily with the immigration of Prussian Lutherans escaping religious persecution in their homeland. Their settlement in the fledgling British colony aided its early, stuttering development; in the longer term it also fitted neatly South Australia's perception of itself as a “paradise of dissent.” These Germans took their religion seriously, none more so than the Lutheran missionaries who committed themselves to bringing the Gospel to the indigenous people of the Adelaide plains and, eventually, much further afield as well. In reality, however, the story of the German contribution to the history of this British colony extended far beyond these pious Lutherans. Among those who followed in their wake, whether as settlers or travellers, were Germans of many different backgrounds, who made their way to the Antipodes for a multitude of reasons. In South Australia as much as anywhere, globalising Germany was a multi-facetted project.The intellectual gamut of Germans in South Australia is nowhere more evident than in the realm of anthropology. The missionaries were not alone in displaying a keen interest in the Australian Aborigines. Anthropologists steeped in the empirical tradition that came to dominate the nascent discipline at the end of the nineteenth century also turned their attention to Australia. Indeed, in Germany and elsewhere, Australia occupied a special position in international discourse. The American anthropologist Lewis Henry Morgan had observed in 1880 that Australian aboriginal societies “now represent the condition of mankind in savagery better than it is elsewhere represented on the earth—a condition now rapidly passing away.”

Erhard Eylmann (1860–1926) was a German scientist who devoted much of his working life to researching Australia, where he travelled extensively during the period 1896 to 1913. His primary field of expertise was anthropology, about which he wrote at great length in his major work Die Eingeborenen der Kolonie Südaustralien (The Aborigines of the Colony of South Australia). This paper places Eylmann and his work in a tradition of German scientific endeavour which can be traced back to William Blandowski and Alexander von Humboldt. Eylmann’s insistence on the primacy of empirical methodology and his belief in the essential unity of all the scientific disciplines characterise his work. At the same time the paper argues that Eylmann’s approach to anthropological study was also indebted to practitioners outside Germany, in particular Francis Gillen and Baldwin Spencer. Similarly, there were other anthropologists in Eylmann’s own time – foremost among them Carl Strehlow – who adopted a very different paradigm in their efforts to understand indigenous Australians.

Much early discussion on the glaciations now dated as late Neoproterozoic (Cryogenian) emanated from the small geological community working in South Australia in the early twentieth century, when their age was regarded as Lower Cambrian. An initial glacial interpretation of long known ‘conglomerates’ by H. P. Woodward was made as early as 1884. Papers by Adelaide-based W. Howchin, were published in British, US and German Journals in 1908, 1911 and 1912 respectively, advocating floating sea ice as a major depositional mechanism. Sydney-based T. W. E. David was also significantly involved via the longstanding Glacial Research Committee of the Australasian Association for Advancement of Science. David publicised recognition of the glaciation at the International Geological Congress in Mexico (1906) where he also suggested that the entire earth might have been glaciated, hence foreshadowing the modern ‘snowball earth’ hypothesis. Objections to the hypothesis of a ‘Lower Cambrian’ glaciation were also raised at an early stage by Howchin's Adelaide-based colleagues. Howchin and his adversaries defended their opposing views in voluminous and fiery articles in the South Australian press in the period 1905-1912 during which both sides endeavoured to undermine their opponent's credibility. By 1907, David had also appreciated the importance of carbonate beds that succeed glacial deposition. R. Lockhart Jack recognised two major glacial episodes within the modern late Neoproterozoic as early as 1913.

Emigration from the German states was a mass phenomenon in the “long” nineteenth century. Much of this migration was of course labour migration, and German workers were very much on the move during the nineteenth century: in addition to the traditional Wanderschaft (travels) of journeymen, the century saw increasing internal migration within and between German-speaking lands, migration from rural areas to cities, and the participation of working people in emigration to destinations outside Europe. Over five million Germans left the German states from 1820 to 1914, with a large majority choosing the United States as their destination, especially in the earliest waves of migration. By comparison with the mass migration to North America, the flow of German migrants to the British colonies in Australia (which federated to form a single Commonwealth in 1901) was a relative trickle, but the numbers were still significant in the Australian context, with Germans counted as the second-largest national group among European settlers after the “British-born” (which included the Irish) in the nineteenth century, albeit a long way behind the British. After the influx of Old Lutheran religious dissidents from Prussia to South Australia in the late 1830s, there was a wave of German emigrants in the 1840s and 1850s, driven by the “push” factor of agrarian and economic crisis in the German states in the 1840s followed by the attraction of the Australian gold rushes and other opportunities, such as land-ownership incentives. While the majority of German settlers were economic migrants, this latter period also saw the arrival in the Australian colonies of a few “Forty-Eighters,” radicals and liberals who had been active in the political upheavals of 1848–9, some of whom became active in politics and the press in Australia. The 1891 census counted over 45,000 German-born residents in the Australian colonies.

This article examines the demographic and occupational selectivity of German immigration to South America (primarily Argentina and Brazil) and Australia, compared to Germans bound for the United States, and the geographic and occupational niches they occupied at various destinations. It draws upon both individual-level and aggregate data from censuses and migration records on three continents to examine occupational profiles, urbanization rates, sex ratios, age structure, and age heaping as a rough measure of “quality,” among German immigrants to these destinations, concluding that immigration to the United States tended to be the least selective.

The social wasp Vespula germanica (F.) occurs throughout Europe south of latitude 62-degrees-N. Its native distribution extends into northern Africa, the Middle East, northern India, China and Korea. It has been accidentally introduced into several regions, including North and South America, and South Africa. It has also been introduced to Australasia, where it became established in Tasmania in 1959 and at several Australian mainland localities during 1977-78. It is now widespread throughout Victoria, in much of southern and coastal New South Wales, and in some suburbs of Adelaide and Per-th. One nest has been recorded in Maryborough, Queensland. The observed global distribution is used here to determine the potential distribution and relative abundance of V. germanica in Australia using the climate-matching computer program CLIMEX. The results indicate that this pestiferous wasp could potentially colonise most of the eastern seaboard of Australia north to Rockhampton, Queensland. V. germanica is likely to adversely affect human activities, with accompanying environmental damage as it inevitably spreads and consolidates, and prospects for containment and control appear minimal.

The term Open Educational Resources (OER) is buzzword in education systems around the world and their potential has even been highlighted with the pandemic crisis as an aid in education systems. However, it is still far from reaching the promises that were envisaged for them. This is especially true for Germany, where challenges have been identified in terms of OER infrastructure and adoption at a macro, meso and micro level. In this study, factors such as OER infrastructure, policy, quality and change are considered in German higher education from an international perspective (Australia, Canada, China, Japan, South Africa, South Korea, Spain, Turkey and the United States). As part of a broader research project, this comparative case study between higher education (HE) systems internationally provides insights into OER that could be useful for other HE systems, institutions and faculty members moving towards OER in these times.

In 1852, the naturalist and writer Louisa Meredith observed in her book My Home in Tasmania: “I know of no place where greater order and decorum is observed by the motley crowds assembled on any public occasion than in this most shamefully slandered country: not even in an English country village can a lady walk alone with less fear of harm or insult than in this capital of Van Diemen's Land, commonly believed at home to be a pest-house, where every crime that can disgrace and degrade humanity stalks abroad with unblushing front.”Meredith's paean to life in the notorious Australian penal colony of Hobart was in stark contrast to her earlier, highly unfavourable account of colonial Sydney. It papered over the years of personal hardship she had endured in Australia, as well as avoiding mention of the racial warfare against Tasmania's Aborigines that had afforded her such a genteel European existence.Such intra-Australian complexities, however, were lost when Meredith's account was superimposed onto German debates about the desirability of penal colonies for Germany. Instead, Meredith's portrait of a cultivated city emerging from the most notorious penal colony in Australia was presented as proof that the deportation of criminals was an important dimension of the civilising mission of Europe in the extra-European world. It was also presented as a vindication of those in Germany who wished to rid Germany of its lumpen criminal class through deportation. The exact paragraph of Meredith's account cited above was quoted in German debates on deportation for almost half a century; first in 1859 by the jurist Franz von Holtzendorff, and thereafter by Friedrich Freund when advocating the establishment of a penal colony in the Preußische Jahrbücher in September 1895.

Although best known as a descriptive botanist, Ferdinand Mueller published an early account of the South Australian Mallee in the style of his scientific hero, Alexander von Humboldt. This vegetation type is found across southern arid Australia and includes several distinctive botanical features that Mueller sought to highlight. While his article was republished twice, each issue was in German and consequently this work has tended to be overlooked in scholarship on the history of Australian botany. Mueller's article is introduced here along with a translation into English for the first time.

Before 1890, German emigrants were one of the largest European groups to emigrate overseas in the middle of the nineteenth century. Most of them settled in North America, but a handful of Germans landed in countries south of the equator. This article examines those who chose uncommon paths and settled in the Southern Hemisphere, focusing on Hessians who went to either Australia or South America. Those who emigrated to the Southern Hemisphere were quite different from the Hessians who moved to the United States. More striking, however, are the contrasting backgrounds of the Australian-bound versus the South American–bound groups: These two groups were comparable in size, but in terms of any identifying socioeconomic characteristic they were poles apart from each other. Those bound for Australia were poorer, less skilled, and more likely to use a multiyear migration strategy to get their family members across the ocean, typical of the ways of those bound for the United States. In contrast, those who went to South America were wealthier, more skilled, and mostly emigrated as intact families without the use of such migration networks. This work shows that the choice of destination mattered for individuals and that certain destinations attracted particular types of individuals and groups, reemphasizing the role of self-selection in the migration experience.

This paper shows that bilingual education has a long tradition in Australia. In the 19th century, primary and secondary schools operating German-English, French-English or Gaelic-English programs, or ones with a Hebrew component, existed in different parts of Australia. The most common bilingual schools were Lutheran rural day schools but there were also many private schools. They believed in the universal value of bilingualism, and some attracted children from English-speaking backgrounds. Bilingual education was for language maintenance, ethno-religious continuity or second language acquisition. The languages were usually divided according to subject and time of day or teacher. The programs were strongest in Melbourne, Adelaide and rural South Australia and Victoria. In Queensland, attitudes and settlement patterns led to the earlier demise of bilingual education. The education acts led to a decline in bilingual education except in elitist girls or rural primary schools and an increase in part-time language programs. Bilingual education was stopped by wartime legislation. It is intended that bilingualism can flourish unless monolingualism is given special preference.

AbstractAlluvial rubies and sapphires are found in palaeodrainage deposits along the Cudgegong-Macquarie River system, central eastern New South Wales, Australia. A pink to red suite contains Cr (up to 0.6 wt.% Cr2O3) as the main chromophore, exceeding Fe (up to 0.5 wt.%Fe2O3). Corrosive etching suggests a prior xenocrystic Mesozoic-Cenozoic basaltic transport, while Cr2O3/Ga2O3to Fe2O3/TiO2ratios indicate an original metamorphic source. Syngenetic mineral inclusions include Al-rich diopside, meionite and anatase. The Al-rich diopside (‘fassaite’) contains extremely high Al2O3(20–21 wt.%). A blue-green suite contains Fe (up to 0.8 wt.% Fe2O3) as a dominant chromophore, while a rare nepheline-anorthoclase composite inclusion supports a magmatic phonolitic origin. The Cudgegong- Macquarie ruby formation is compared with a garnet granulite origin proposed for Thailand rubies and a xenolith of corundum-bearing garnet granulite from Ruby Hill, Bingara, Australia. Clinopyroxenecorundum thermometry suggests the Cudgegong-Macquarie rubies formed atT>1000–1300ºC, a high equilibrationTfor proposed lithospheric granulites. These rubies form a distinctive suite compared to other rubies from Australian and SE Asian basalt fields, but have some similarities with eastern Thailand rubies.

Kaurna, the language indigenous to the Adelaide Plains in South Australia, is being reclaimed from nineteenth-century written historical sources. There are no sound recordings of the language as it was spoken in the nineteenth century, and little has been handed down orally to the present generation. Fortunately, the nineteenth-century records of the language are reasonably good for the time, having been recorded by Christian Teichelmann and Clamor Schürmann, German missionaries who were trained in philology and a range of languages including Hebrew, Greek, Latin and Chinese. The language was also recorded, in part, by a number of other English, German and French observers. The Kaurna language is now being revived: rebuilt, re-learnt and reintroduced on the basis of this nineteenth-century documentation. In this process, numerous problems of interpretation are being encountered. However, the tools that linguistics provides are being used to interpret the historical corpus. A range of concrete examples are analysed and discussed to illustrate the kinds of problems faced and the solutions adopted.

Dipluridae represent a small Mygalomorphae family of South American origin, the family includes two subfamilies Diplurinae and Masteriinae although the placement of the latter in Dipluridae is still under debate. The family has a predominantly South American distribution although the genus Masteria L. Koch, 1873 presents an interesting distribution with representatives found in Fiji, Micronesia, New Caledonia, New Guinea and Australia. This genus is diverse at the species level in tropical South America and the Caribbean but no species have been described from Ecuador to date. Ongoing field work as part of the BIO-GEEC Project—a consortium established by several Ecuadorian and German institutions—has resulted in the discovery of several new species from both lowlands and highland habitats in Ecuador. Herein we described seven new species of Masteria from Ecuador: M. jatunsacha n. sp. (male); M. machay n. sp. (female); M. chalupas n. sp. (male); M. papallacta n. sp. (male and female); M. pasochoa n. sp. (male and female); M. lasdamas n. sp. (male); and M. otongachi n. sp. (male). The type species of the genus, Masteria hirsuta L. Koch, 1873 from Fiji, is redescribed and re-illustrated, from the original type specimen.

Purpose – The purpose of this paper is to assess the competitiveness of the Uruguayan rural tourism sector against its main competitors from Argentina and Brazil, as perceived by Uruguayan stakeholders on the supply side. The paper will also evaluate the potential of Uruguay as a rural tourism destination in attracting German tourists. Design/methodology/approach – Two different questionnaires were administered, one to Uruguayan rural tourism stakeholders and another one to potential German tourists in Germany. Findings – The findings indicate that the main strengths of Uruguayan rural tourism offer, compared to Argentina and Brazil, are the hospitality and friendliness of local people, the natural and cultural attractions and the country’s security and safety. Main weaknesses identified were the poor management of several destination components that are key to create a successful tourism destination and poor management of the “demand conditions” component of Dwyer and Kim’s (2003) integrated model. Originality/value – There is very limited research done on the competitiveness of Uruguay as a rural tourist destination in attracting foreign tourists (Mackinnon et al., 2009). The objective of this study is to partially fill this gap by assessing how competitive Uruguayan rural tourism is and evaluating whether Uruguay represents an attractive market for German tourists looking for agro tourism and farm holiday destinations. The German market was chosen because it is one of the top tourist-generating countries and one of the biggest spenders in international tourism (The World Tourism organization, 2010). Moreover, most tourists – from outside South America – selecting Uruguay as a tourist destination come from Germany, USA and Australia (Peralta, 2012).

In 1980 the state of South Australia contracted with the German supplier of a new busway technology called O-Bahn. The project produced an 11.8-km busway alignment that was built in two phases with public operation in 1986 and 1989. Although the technology has functioned without fault and the safety record is excellent, the project has not experienced robust patronage growth or political success. During the 1990s public transit has been privatized and overall system ridership has declined by 30%. The long-term relationship between the foreign contractor and the local managers and staff failed to create a positive atmosphere for ongoing work, whether locally, nationally, or abroad. Although local and state officials provide positive public comment about their happiness with the technology, their management and policy actions suggest tepid belief in the concept.

This paper reports on the first stage of an international comparative study for the project “Digital educational architectures: Open learning resources in distributed learning infrastructures–EduArc”, funded by the German Federal Ministry of Education and Research. This study reviews the situation of digital educational resources (or (O)ER) framed within the digital transformation of ten different Higher Education (HE) systems (Australia, Canada, China, Germany, Japan, South Africa, South Korea, Spain, Turkey and the United States). Following a comparative case study approach, we investigated issues related to the existence of policies, quality assurance mechanisms and measures for the promotion of change in supporting infrastructure development for (O)ER at the national level in HE in the different countries. The results of this mainly documentary research highlight differences and similarities, which are largely due to variations in these countries’ political structure organisation. The discussion and conclusion point at the importance of understanding each country’s context and culture, in order to understand the differences between them, as well as the challenges they face.

The present paper reads David Malouf’s 1996 novel The Conversations at Curlow Creek as portraying a vivid and realistic picture of events relating to crime and punishment in colonial Australia in the early nineteenth century. The depiction of death penalty accorded to the bushranger Daniel Carney under the supervision of the Irish sheriff Michael Adair in New South Wales thus resonates with numerous historical accounts of incidents that actually happened. The novel, however, does more than only provide accurate historical representation as it also presents Adair as having undergone a rather dramatic transformation in the process of conversing with Carney before the latter’s execution. The paper, drawing on the views of the German philosopher Martin Heidegger, argues that a realization of inevitable mortality, of facing certain death characterizes this change in Adair’s nature and worldview. It concludes by suggesting that Adair’s acceptance of his finitude intimates of a way of being in the world that not only subverts procedures of administering punishment to convicts in colonial Australia but also indicates the limits of polarized identity politics that shapes the country in the present times.

When in the 1880s and 1890s German Lutheran missionaries were sent to Australia from their colleges in Hermannsburg in Lower Saxony and Neuendettelsau in Bavaria to work among the Australian indigenous peoples of the Northern Territory, they had no ethnological education to speak of. This was particularly true for Carl Strehlow who, born in 1871 and educated from 1888 to 1891 at the Lutheran Missionary College in Neuendettelsau, arrived in Adelaide in 1892 and went straight to work with Pastor Reuther among the Diari in Killalpaninna, south of Lake Eyre. From there, in 1894, he was sent to Hermannsburg to resurrect the abandoned Lutheran Mission Station of the Finke River Mission, owned by the South Australian Immanuel Synod. The records of the curriculum in Neuendettelsau show no subjects teaching the theory and practice of ethnology. However, his ethnographic work among the local tribes of the Arrernte and Loritja is today still considered a classic in the field. As a contribution to the history of research methodology in the field of ethnology, I intend to give a brief outline of 1) the early development of scientific research instructions in general, and 2) as a special case, Carl Strehlow’s learning process in form of letters with questions and answers between himself in Hermannsburg and his editors in Frankfurt.

Purpose This paper aims to represent a unique and original piece of research on full professors in global hospitality and tourism academia. Aimed at revisiting academic leadership, this study identifies its components and gains insight into the so far understudied dimensions of diversity in academic contexts worldwide. Design/methodology/approach This study examines the careers of senior researchers (R3 and R4, according to European Commission) in hospitality and tourism, with special attention given to diversity. Based on quantitative methodology and a standardised online search, it uses individual-level data to give insights into dimensions of academic leadership. Full professors from the UK, the USA, German-speaking countries (Germany, Austria and Switzerland) and the Asia-Pacific region (Australia, New Zealand, China, Malaysia, Singapore and South Korea) build the sample. Findings Academic leadership in hospitality and tourism academia is not yet fully tied to cooperation with industry, as predicted by the “Triple Helix” model. Currently, the majority of the intellectual component constitutes academic leadership, outweighing administrative and innovative angles. Gender, age and ethnic diversity are underrepresented. While some regions can be considered sealed to ethnic diversity, others are more open and attract international scholars. Originality/value Rooted in interdisciplinary explanations, this study is the first of its kind to consider various diversity dimensions of academic leadership from a global perspective. It not only enriches the notion of academic leadership but also provides several practical implications and suggestions for further research.

Musical theatre can take root anywhere. The future of the musical may very well lie beyond Broadway and the West End. In recent years, successful musicals have been developed in Canada, Australia and the German speaking countries. Some, like Elisabeth, have travelled internationally without ever playing in English. Companies in Korea, Japan and China are investing in new works, both domestically and internationally. These different countries can learn from each other. In South Africa, people do literally burst into song on the streets. During the apartheid era, some of the freedom fighters were known to have gone to the gallows singing. Both there and in Argentina, musical theatre played an active role in the struggle against oppression. Shows like Sarafina weren’t just about the struggle against apartheid, they were part of it. This is nothing new – the cabarets of Weimar Berlin were also struggling against oppression. In fact, the birth of the musical coincided with the birth of democracy. On the other hand, during World War II, the all-female Takarazuka Revue was co-opted by the Japanese government for propaganda purposes. The real point of my book A Million Miles from Broadway is not just to tell a history of the musical. It’s what you do with that history after you’ve learned it that is important. Firstly to learn about our own musical theatre heritage, but also to learn about each other’s. We may find that people in other countries have found solutions to problems that we are struggling with.

Purpose In recent decades, New World winemakers have increased their wine export to European markets and became considerable market players in the EU. Therefore, this paper aims to explore whether the major New World wine producers are able to exploit its market power at European destination markets. Design/methodology/approach The paper applies the pricing-to-market (PTM) model of trade in respect of asymmetric effect of exchange rate changes by using monthly bilateral wine data between January 2000 and December 2016. Findings First, there is evidence of PTM in three New World wine exporters, namely, Chile, South Africa and the USA. Chile was able to apply price discrimination across Danish, German, Dutch and the British wine markets. Second, South Africa set their prices in Belgian, Dutch and Swedish markets, while the USA discriminated their wine prices in Denmark and Sweden. In contrast, this advantage was not observable in the case of Argentina and Australia. Third, the local-currency price stability was explored in Chilean wine import prices (exported to Belgium, the Czech Republic), South African wine prices (exported to France, Denmark, Germany), in US wine prices (sold in Germany and the UK). Furthermore, the analysis of the asymmetric effects of exchange rate changes suggests that depreciation of the exporter’s currency relative to the Euro had not a significant impact on EU wine import prices. On the whole, the estimated pricing to market model indicates that a non-competitive pricing behaviour of New World exporters was limited and was rather due to the market-specific characteristics. Research limitations/implications The research provides multiple advice for New World wine producers. First, in general, European consumers do not pay an extra price for the New World bottled wines. Second, only Chilean, South African and North American wine exporters can expect higher prices for its wines from European buyers only. Moreover, European wine markets are fairly competitive where New World wine exporters do not have significant market dominance. Therefore, New World wine exporters should strengthen its wine marketing and branding strategy to gain higher market share in Europe and to attract attention to its wines. Finally, exchange rates relative to Euro should be continuously monitored by the New World wine exporters because it might deviate the wine export prices significantly. Originality/value The study applies the pricing-to-market model to major New World wine exporters on the European Union’s destination market. The paper also makes valuable contributions to the wine literature by testing the asymmetric effects of exchange rate changes on wine import prices. It analyses the nature of price discrimination, whether it is market-specific or exchange rate influenced, or both.

The 2016 Warwick Agreement on femoroacetabular impingement (FAI) syndrome was convened to build an international, multidisciplinary consensus on the diagnosis and management of patients with FAI syndrome. 22 panel members and 1 patient from 9 countries and 5 different specialties participated in a 1-day consensus meeting on 29 June 2016. Prior to the meeting, 6 questions were agreed on, and recent relevant systematic reviews and seminal literature were circulated. Panel members gave presentations on the topics of the agreed questions atSports Hip 2016, an open meeting held in the UK on 27–29 June. Presentations were followed by open discussion. At the 1-day consensus meeting, panel members developed statements in response to each question through open discussion; members then scored their level of agreement with each response on a scale of 0–10. Substantial agreement (range 9.5–10) was reached for each of the 6 consensus questions, and the associated terminology was agreed on. The term ‘femoroacetabular impingement syndrome’ was introduced to reflect the central role of patients' symptoms in the disorder. To reach a diagnosis, patients should have appropriate symptoms, positive clinical signs and imaging findings. Suitable treatments are conservative care, rehabilitation, and arthroscopic or open surgery. Current understanding of prognosis and topics for future research were discussed. The 2016 Warwick Agreement on FAI syndrome is an international multidisciplinary agreement on the diagnosis, treatment principles and key terminology relating to FAI syndrome.The Warwick Agreement on femoroacetabular impingement syndrome has been endorsed by the following 25 clinical societies: American Medical Society for Sports Medicine (AMSSM), Association of Chartered Physiotherapists in Sports and Exercise Medicine (ACPSEM), Australasian College of Sports and Exercise Physicians (ACSEP), Austian Sports Physiotherapists, British Association of Sports and Exercise Medicine (BASEM), British Association of Sport Rehabilitators and Trainers (BASRaT), Canadian Academy of Sport and Exercise Medicine (CASEM), Danish Society of Sports Physical Therapy (DSSF), European College of Sports and Exercise Physicians (ECOSEP), European Society of Sports Traumatology, Knee Surgery and Arthroscopy (ESSKA), Finnish Sports Physiotherapist Association (SUFT), German-Austrian-Swiss Society for Orthopaedic Traumatologic Sports Medicine (GOTS), International Federation of Sports Physical Therapy (IFSPT), International Society for Hip Arthroscopy (ISHA), Groupo di Interesse Specialistico dell’A.I.F.I., Norwegian Association of Sports Medicine and Physical Activity (NIMF), Norwegian Sports Physiotherapy Association (FFI), Society of Sports Therapists (SST), South African Sports Medicine Association (SASMA), Sports Medicine Australia (SMA), Sports Doctors Australia (SDrA), Sports Physiotherapy New Zealand (SPNZ), Swedish Society of Exercise and Sports Medicine (SFAIM), Swiss Society of Sports Medicine (SGMS/SGSM), Swiss Sports Physiotherapy Association (SSPA).

Abstract. During the SCOUT-O3/ACTIVE field phase in November–December 2005, airborne in situ measurements were performed inside and in the vicinity of thunderstorms over northern Australia with several research aircraft (German Falcon, Russian M55 Geophysica, and British Dornier-228. Here a case study from 19 November is presented in detail on the basis of airborne trace gas measurements (NO, NOy, CO, O3) and stroke measurements from the German LIghtning Location NETwork (LINET), set up in the vicinity of Darwin during the field campaign. The anvil outflow from three different types of thunderstorms was probed by the Falcon aircraft: (1) a continental thunderstorm developing in a tropical airmass near Darwin, (2) a mesoscale convective system (MCS), known as Hector, developing within the tropical maritime continent (Tiwi Islands), and (3) a continental thunderstorm developing in a subtropical airmass ~200 km south of Darwin. For the first time detailed measurements of NO were performed in the Hector outflow. The highest NO mixing ratios were observed in Hector with peaks up to 7 nmol mol−1 in the main anvil outflow at ~11.5–12.5 km altitude. The mean NOx (=NO+NO2) mixing ratios during these penetrations (~100 km width) varied between 2.2 and 2.5 nmol mol−1. The NOx contribution from the boundary layer (BL), transported upward with the convection, to total anvil-NOx was found to be minor (<10%). On the basis of Falcon measurements, the mass flux of lightning-produced NOx (LNOx) in the well-developed Hector system was estimated to 0.6–0.7 kg(N) s−1. The highest average stroke rate of the probed thunderstorms was observed in the Hector system with 0.2 strokes s−1 (here only strokes with peak currents ≥10 kA contributing to LNOx were considered). The LNOx mass flux and the stroke rate were combined to estimate the LNOx production rate in the different thunderstorm types. For a better comparison with other studies, LINET strokes were scaled with Lightning Imaging Sensor (LIS) flashes. The LNOx production rate per LIS flash was estimated to 4.1–4.8 kg(N) for the well-developed Hector system, and to 5.4 and 1.7 kg(N) for the continental thunderstorms developing in subtropical and tropical airmasses, respectively. If we assume, that these different types of thunderstorms are typical thunderstorms globally (LIS flash rate ~44 s−1), the annual global LNOx production rate based on Hector would be ~5.7–6.6 Tg(N) a−1 and based on the continental thunderstorms developing in subtropical and tropical airmasses ~7.6 and ~2.4 Tg(N) a−1, respectively. The latter thunderstorm type produced much less LNOx per flash compared to the subtropical and Hector thunderstorms, which may be caused by the shorter mean flash component length observed in this storm. It is suggested that the vertical wind shear influences the horizontal extension of the charged layers, which seems to play an important role for the flash lengths that may originate. In addition, the horizontal dimension of the anvil outflow and the cell organisation within the thunderstorm system are probably important parameters influencing flash length and hence LNOx production per flash.

Abstract. During the SCOUT-O3/ACTIVE field phase in November–December 2005 airborne in situ measurements were performed inside and in the vicinity of thunderstorms over northern Australia with several research aircraft (German Falcon, Russian M55 Geophysica, and British Dornier-228). Here a case study from 19 November is presented in large detail on the basis of airborne trace gas measurements (NO, NOy, CO, O3) and stroke measurements from the German LIghtning Location NETwork (LINET), set up in the vicinity of Darwin during the field campaign. The anvil outflow from three different types of thunderstorms was probed by the Falcon aircraft: 1) a continental thunderstorm developing in a tropical airmass near Darwin, 2) a mesoscale convective system (MCS) developing within the tropical maritime continent (Tiwi Islands) known as Hector, and 3) a continental thunderstorm developing in a subtropical airmass ~200 km south of Darwin. For the first time detailed measurements of NO were performed in the Hector outflow. The highest NO mixing ratios were observed in Hector with peaks up to 7 nmol mol−1 in the main anvil outflow at ~11.5–12.5 km altitude. The mean NOx (=NO+NO2) mixing ratios during these penetrations (~100 km width) varied between 2.2 and 2.5 nmol mol−1. The NOx contribution from the boundary layer (BL), transported upward with the convection, to total anvil-NOx was found to be minor (<10%). On the basis of Falcon measurements, the mass flux of lightning-produced NOx (LNOx) in the well-developed Hector system was estimated to 0.6–0.7 kg(N) s−1. The highest average stroke rate of the probed thunderstorms was observed in the Hector system with 0.2 strokes s−1 (here only strokes with peak currents ≥10 kA contributing to LNOx were considered). The LNOx mass flux and the stroke rate were combined to estimate the LNOx production rate in the different thunderstorm types. For a better comparison with other studies, LINET strokes were scaled with Lightning Imaging Sensor (LIS) flashes. The LNOx production rate per LIS flash was estimated to 4.1–4.8 kg(N) for the well-developed Hector system, and to 5.4 and 1.7 kg(N) for the continental thunderstorms developing in subtropical and tropical airmasses, respectively. If we assume, that these different types of thunderstorms are typical thunderstorms globally (LIS flash rate ~44 s−1), the annual global LNOx production rate based on Hector would be ~5.7–6.6 Tg(N) a−1 and based on the continental thunderstorms developing in subtropical and tropical airmasses ~7.6 and ~2.4 Tg(N) a−1, respectively. The latter thunderstorm type produced much less LNOx per flash compared to the subtropical and Hector thunderstorms, which may be caused by the shorter mean flash component length observed in this storm. It is suggested that the vertical wind shear influences the horizontal extension of the charged layers, which seems to play an important role for the flash lengths that may originate. In addition, the horizontal dimension of the anvil outflow and the cell organisation within the thunderstorm system are probably important parameters influencing flash length and hence LNOx production per flash.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis ‘P1’, which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

Abstract Objective – To investigate and compare the nature of e-mail reference services in academic and public libraries outside the United States. Design – Longitudinal comparative study. Setting – A total of 23 academic and public libraries in ten countries: Australia, Belgium, France, Germany, Mexico, the Netherlands, Slovenia, South Africa, Sweden, and the United Kingdom. Subjects – The authors collected reference questions that were e-mailed to the 23 libraries for the weeks of April 3, 2006 and April 7, 2008. Questions were sent from the libraries’ websites to QuestionPoint, a collaborative, online reference service that was used to answer the questions received. Methods – The authors randomly selected 25 questions for each library for the weeks under investigation. If a library did not receive 25 email reference questions that week, then they collected transactions from subsequent weeks until the quota was met or until the end of the month. The authors examined transactions from a total of 919 questions – 515 questions in 2006 and 476 in 2008. All identifying information about the user was stripped from each transaction collected. Each transaction was labeled according to the following categories: • Type of institution, i.e., whether the question was sent to an academic or public library • Language of the question • Question type, i.e., whether the question was about library policy or access to electronic resources (labeled “access” questions), about library holdings (labeled “bibliographic” questions), or about finding specific information on a topic (labeled “subject” questions) • Answer type, i.e., whether the response consisted of: a confirmation, clarification, fact, instructions, referral to a pathfinder/bibliography, referral to another library/person/place, or no answer. • User status, i.e., whether the person asking the question was an undergrad, a graduate student, or a staff/faculty member • Subject classification of the questions using the Dewey Decimal Classification system • Response time Main Results – The e-mail transactions that were examined revealed a wide range of end-user and librarian behaviors. English, followed by Dutch, German, and French, were the languages most frequently used by library users. Countries also varied in terms of the types of questions received. For example, more than 75% of the email queries in Belgium (which only had academic libraries participate in this study) were “access” questions, while Mexico (which also consisted of all academic libraries) only received 6% “access” questions, France (all public libraries) had relatively few access questions, and Sweden (also all public libraries) had none. Public libraries received the most “subject” questions (75%) compared to academic libraries (28%). Public libraries answered “subject” questions with facts over a third of the time, while academic libraries responded with instructions close to half of the time. Among the academic libraries, graduate students asked slightly more “access” questions than undergraduates (62% versus 56%), and undergraduates asked more “subject” questions than graduate students (26% versus 13%). The “subject” questions submitted to academic libraries were divided almost equally among topics in the humanities (36%), the sciences (32%), and the social sciences (32%). This differed from public libraries; the latter received mostly questions about humanities topics (65%). The time taken to respond to users’ reference questions ranged from a few minutes to a few weeks between libraries. Some libraries set the response times on their websites. Those libraries that indicated longer response times on their sites met the users’ expectations more often, up to a maximum of 100 percent of the time. Most of the characteristics of email reference services that are listed above remained consistent from 2006 to 2008. The two areas that changed over two years were the libraries’ response time and the types of questions asked by university students. “Access questions increased (by 14 percent among graduates and by 4 percent among undergraduates), and bibliographic and subject questions decreased in both groups” (p. 364). Response time improved overall from 2006 to 2008. Conclusion – The authors’ analysis of the 919 transactions of e-mail reference questions revealed unique patterns about end-user information seeking behavior and librarians’ responses in academic and public libraries outside the United States and Canada. One of these patterns is that the public libraries participating in the study received the highest percentage of “subject” questions. The authors state that “the pattern of a much higher percentage of subject-related questions in public libraries contrasts with the general virtual reference trend in academic libraries, which shows a much higher percentage of access questions. Since many of the access questions concerned connection problems or logging on to databases, the relatively fewer number may indicate that the arts and humanities disciplines require less database searching and that the users need specific answers instead” (p. 367). The data also revealed significant differences between the types of questions asked by undergraduates versus graduate students. Undergraduates asked two thirds of the subject questions submitted to academic libraries and graduate students asked just over a fourth. The authors assume that this finding indicates that graduate students do more of their own research than undergraduates. The authors were concerned by the increase in the number of access questions posed by undergrads and graduate students from 2006 to 2008. They suggested that websites, databases, and other resources might have become more difficult to use over the years. They also noted that questions in technology almost doubled from 2006 to 2008. One of the patterns that were revealed contradicted the authors’ assumption that libraries with slow response times in 2006 would improve in 2008 as they became more proficient in providing virtual reference services. The majority of libraries in the study improved their turnaround time from 2006 to 2008, but the two slowest libraries took even longer to respond to their users.

From its beginning, mankind suffered injuries through falling, fire, drowning and human aggression [1]. Although the frequency and the kinetics modifiy over millennia, trauma continues to represent an important cause of morbidity and mortality even in the modern society [1]. Significant progresses in the trauma surgery were due to military conflicts, which next to social sufferance came with important steps in injuries’ management, further applied in civilian hospitals. The foundation of modern trauma systems was started by Dominique Jean Larrey (1766-1842) during the Napoleonic Rin military campaign from 1792. The wounded who remained on the battlefield till the end of the battle to receive medical care, usually more than 24 hours, from that moment were transported during the conflict with flying ambulances to mobile hospitals. Starting with the First World War, through the usage of antiseptics, blood transfusions, and fracture management, the mortality decreased from 39% in the Crimean War (1853–1856) to 10%. One of the most preeminent figures of the Second World War was Michael DeBakey, who created the Mobile Army Surgical Hospitals (MASH), concept very similar to the Larrey’s unit. In 1941, in England, Birmingham Accident Hospital was opened, specially designed for injured people, this being the first trauma center worldwide. During the Golf War (1990–1991) the MASH were used for the last time, being replaced by Forward Surgical Teams, very mobile units satisfying the necessities of the nowadays infantry [1]. Nowadays, trauma meets the pandemic criteria, everyday 16,000 people worldwide are dying, injuries representing one of the first five causes of mortality for all the age groups below 60 [2]. A recent 12-month analysis of trauma pattern in the Emergency Hospital of Bucharest revealed 141 patients, 72.3% males, with a mean age of 43.52 ± 19 years, and a mean New Injury Severity Score (NISS) of 27.58 ± 11.32 [3]. The etiology was traffic related in 101 (71.6%), falls in 28 (19.9%) and crushing in 7 (5%) cases. The overall mortality was as high as 30%, for patients with a mean NISS of 37.63 [3]. At the scene, early recognition of severe injuries and a high index of suspicion according to trauma kinetics may allow a correct triage of patients [4]. A functional trauma system should continuously evaluate the rate of over- and under-triage [5]. The over-triage represents the transfer to a very severe patient to a center without necessary resources, while under-triage means a low injured patient referred to a highly specialized center. If under-triage generates preventable deaths, the over-triage comes with a high financial and personal burden for the already overloaded tertiary centers [5]. To maximize the chance for survival, the major trauma patients should be transported as rapid as possible to a trauma center [6]. The initial resuscitation of trauma patients was divided into two time intervals: ten platinum minutes and golden hour [6]. During the ten platinum minutes the airways should be managed, the exsanguinating bleeding should be stopped, and the critical patients should be transported from the scene. During the golden hour all the life-threatening lesions should be addressed, but unfortunately many patients spend this time in the prehospital setting [6]. These time intervals came from Trunkey’s concept of trimodal distribution of mortality secondary to trauma, proposed in 1983 [7]. This trimodal distribution of mortality remains a milestone in the trauma education and research, and is still actual for development but inconsistent for efficient trauma systems [8]. The concept of patients’ management in the prehospital setting covered a continuous interval, with two extremities: stay and play/treat then transfer or scoop and run/ load and go. Stay and play, usually used in Europe, implies airways securing and endotracheal intubation, pleurostomy tube insertion, and intravenous lines with volemic replacement therapy. During scoop and run, used in the Unites States, the patient is immediately transported to a trauma center, addressing the immediate life-threating injuries during transportation. In the emergency department of the corresponding trauma center, the resuscitation of the injured patients should be done by a trauma team, after an orchestrated protocol based on Advanced Trauma Life Support (ATLS). The modern trauma teams include five to ten specialists: general surgeons trained in trauma care, emergency medicine physicians, intensive care physicians, orthopedic surgeons, neurosurgeons, radiologists, interventional radiologists, and nurses. In the specially designed trauma centers, the leader of the trauma team should be the general surgeon, while in the lower level centers this role may be taken over by the emergency physicians. The implementation of a trauma system is a very difficult task, and should be tailored to the needs of the local population. For example, in Europe the majority of injuries are by blunt trauma, while in the United States or South Africa they are secondary to penetrating injuries. In an effort to analyse at a national level the performance of trauma care, we have proposed a national registry of major trauma patients [9]. For this registry we have defined major trauma as a New Injury Severity Score higher than 15. The maintenance of such registry requires significant human and financial resources, while only a permanent audit may decrease the rate of preventable deaths in the Romanian trauma care (Figure 1) [10]. Figure 1 - The website of Romanian Major Trauma Registry (http://www.registrutraume.ro). USA - In the United States of America there are 203 level I centers, 265 level II centers, 205 level III or II centers and only 32 level I or II pediatric centers, according to the 2014 report of National Trauma Databank [11]. USA were the first which recognized trauma as a public health problem, and proceeded to a national strategy for injury prevention, emergency medical care and trauma research. In 1966, the US National Academy of Sciences and the National Research Council noted that ‘’public apathy to the mounting toll from accidents must be transformed into an action program under strong leadership’’ [12]. Considerable national efforts were made in 1970s, when standards of trauma care were released and in 1990s when ‘’The model trauma care system plan’’[13] was generated. The American College of Surgeons introduced the concept of a national trauma registry in 1989. The National Trauma Databank became functional seven years later, in 2006 being registered over 1 million patients from 600 trauma centers [14]. Mortality from unintentional injury in the United States decreased from 55 to 37.7 per 100,000 population, in 1965 and 2004, respectively [15]. Due to this national efforts, 84.1% of all Americans have access within one hour from injury to a dedicated trauma care [16]. Canada - A survey from 2010 revealed that 32 trauma centers across Canada, 16 Level I and 16 Level II, provide definitive trauma care [18]. All these centers have provincial designation, and funding to serve as definitive or referral hospital. Only 18 (56%) centers were accredited by an external agency, such as the Trauma Association of Canada. The three busiest centers in Canada had between 798–1103 admissions with an Injury Severity Score over 12 in 2008 [18]. Australia - Australia is an island continent, the fifth largest country in the world, with over 23 million people distributed on this large area, a little less than the United States. With the majority of these citizens concentrated in large urban areas, access to the medical care for the minority of inhabitants distributed through the territory is quite difficult. The widespread citizens cannot be reached by helicopter, restricted to near-urban regions, but with the fixed wing aircraft of the Royal Flying Doctor Service, within two hours [13]. In urban centers, the trauma care is similar to the most developed countries, while for people sparse on large territories the trauma care is far from being managed in the ‘’golden hour’’, often extending to the ‘’Golden day’’ [19]. Germany - One of the most efficient European trauma system is in Germany. Created in 1975 on the basis of the Austrian trauma care, this system allowed an over 50% decreasing of mortality, despite the increased number of injuries. According to the 2014 annual report of the Trauma Register of German Trauma Society (DGU), there are 614 hospitals submitting data, with 34.878 patients registered in 2013 [20]. The total number of cases documented in the Trauma Register DGU is now 159.449, of which 93% were collected since 2002. In the 2014 report, from 26.444 patients with a mean age of 49.5% and a mean ISS of 16.9, the observed mortality was 10% [20]. The United Kingdom - In 1988, a report of the Royal College of Surgeons of England, analyzing major injuries concluded that one third of deaths were preventable [21]. In 2000, a joint report from the Royal College of Surgeons of England and of the British Orthopedic Association was very suggestive entitled "Better Care for the Severely Injured" [22]. Nowadays the Trauma Audit Research network (TARN) is an independent monitor of trauma care in England and Wales [23]. TARN collects data from hospitals for all major trauma patients, defined as those with a hospital stay longer than 72 hours, those who require intensive care, or in-hospital death. A recent analysis of TARN data, looking at the cost of major trauma patients revealed that the total cost of initial hospital inpatient care was £19.770 per patient, of which 62% was attributable to ventilation, intensive care and wards stays, 16% to surgery, and 12% to blood transfusions [24]. Global health care models Countries where is applied Functioning concept Total healthcare costs from GDP Bismarck model Germany Privatized insurance companies (approx. 180 nonprofit sickness funds). Half of the national trauma beds are publicly funded trauma centers; the remaining are non-profit and for-profit private centers. 11.1% Beveridge model United Kingdom Insurance companies are non-existent. All hospitals are nationalized. 9.3% National health insurance Canada, Australia, Taiwan Fusion of Bismarck and Beveridge models. Hospitals are privatized, but the insurance program is single and government-run. 11.2% for Canada The out-of-pocket model India, Pakistan, Cambodia The poorest countries, with undeveloped health care payment systems. Patients are paying for more than 75% of medical costs. 3.9% for India GDP – gross domestic product Table 1 - Global health care models with major consequences on trauma care [17]. Traumas continue to be a major healthcare problem, and no less important than cancer and cardiovascular diseases, and access to dedicated and timely intervention maximizes the patients’ chance for survival and minimizes the long-term morbidities. We should remember that one size does not fit in all trauma care. The Romanian National Trauma Program should tailor its resources to the matched demands of the specific Romanian urban and rural areas.

Education in Oceania continues to reflect the embedded implicit and explicit colonial practices and processes from the past. This paper conceptualises a cultural approach to education and leadership appropriate and relevant to the Republic of the Marshall Islands. As elementary school leaders, we highlight Kanne Lobal, a traditional Marshallese navigation practice based on indigenous language, values and practices. We conceptualise and develop Kanne Lobal in this paper as a framework for understanding the usefulness of our indigenous knowledge in leadership and educational practices within formal education. Through bwebwenato, a method of talk story, our key learnings and reflexivities were captured. We argue that realising the value of Marshallese indigenous knowledge and practices for school leaders requires purposeful training of the ways in which our knowledge can be made useful in our professional educational responsibilities. Drawing from our Marshallese knowledge is an intentional effort to inspire, empower and express what education and leadership partnership means for Marshallese people, as articulated by Marshallese themselves. Introduction As noted in the call for papers within the Waikato Journal of Education (WJE) for this special issue, bodies of knowledge and histories in Oceania have long sustained generations across geographic boundaries to ensure cultural survival. For Marshallese people, we cannot really know ourselves “until we know how we came to be where we are today” (Walsh, Heine, Bigler & Stege, 2012). Jitdam Kapeel is a popular Marshallese concept and ideal associated with inquiring into relationships within the family and community. In a similar way, the practice of relating is about connecting the present and future to the past. Education and leadership partnerships are linked and we look back to the past, our history, to make sense and feel inspired to transform practices that will benefit our people. In this paper and in light of our next generation, we reconnect with our navigation stories to inspire and empower education and leadership. Kanne lobal is part of our navigation stories, a conceptual framework centred on cultural practices, values, and concepts that embrace collective partnerships. Our link to this talanoa vā with others in the special issue is to attempt to make sense of connections given the global COVID-19 context by providing a Marshallese approach to address the physical and relational “distance” between education and leadership partnerships in Oceania. Like the majority of developing small island nations in Oceania, the Republic of the Marshall Islands (RMI) has had its share of educational challenges through colonial legacies of the past which continues to drive education systems in the region (Heine, 2002). The historical administration and education in the RMI is one of colonisation. Successive administrations by the Spanish, German, Japanese, and now the US, has resulted in education and learning that privileges western knowledge and forms of learning. This paper foregrounds understandings of education and learning as told by the voices of elementary school leaders from the RMI. The move to re-think education and leadership from Marshallese perspectives is an act of shifting the focus of bwebwenato or conversations that centres on Marshallese language and worldviews. The concept of jelalokjen was conceptualised as traditional education framed mainly within the community context. In the past, jelalokjen was practiced and transmitted to the younger generation for cultural continuity. During the arrival of colonial administrations into the RMI, jelalokjen was likened to the western notions of education and schooling (Kupferman, 2004). Today, the primary function of jelalokjen, as traditional and formal education, it is for “survival in a hostile [and challenging] environment” (Kupferman, 2004, p. 43). Because western approaches to learning in the RMI have not always resulted in positive outcomes for those engaged within the education system, as school leaders who value our cultural knowledge and practices, and aspire to maintain our language with the next generation, we turn to Kanne Lobal, a practice embedded in our navigation stories, collective aspirations, and leadership. The significance in the development of Kanne Lobal, as an appropriate framework for education and leadership, resulted in us coming together and working together. Not only were we able to share our leadership concerns, however, the engagement strengthened our connections with each other as school leaders, our communities, and the Public Schooling System (PSS). Prior to that, many of us were in competition for resources. Educational Leadership: IQBE and GCSL Leadership is a valued practice in the RMI. Before the IQBE programme started in 2018, the majority of the school leaders on the main island of Majuro had not engaged in collaborative partnerships with each other before. Our main educational purpose was to achieve accreditation from the Western Association of Schools and Colleges (WASC), an accreditation commission for schools in the United States. The WASC accreditation dictated our work and relationships and many school leaders on Majuro felt the pressure of competition against each other. We, the authors in this paper, share our collective bwebwenato, highlighting our school leadership experiences and how we gained strength from our own ancestral knowledge to empower “us”, to collaborate with each other, our teachers, communities, as well as with PSS; a collaborative partnership we had not realised in the past. The paucity of literature that captures Kajin Majol (Marshallese language) and education in general in the RMI is what we intend to fill by sharing our reflections and experiences. To move our educational practices forward we highlight Kanne Lobal, a cultural approach that focuses on our strengths, collective social responsibilities and wellbeing. For a long time, there was no formal training in place for elementary school leaders. School principals and vice principals were appointed primarily on their academic merit through having an undergraduate qualification. As part of the first cohort of fifteen school leaders, we engaged in the professional training programme, the Graduate Certificate in School Leadership (GCSL), refitted to our context after its initial development in the Solomon Islands. GCSL was coordinated by the Institute of Education (IOE) at the University of the South Pacific (USP). GCSL was seen as a relevant and appropriate training programme for school leaders in the RMI as part of an Asia Development Bank (ADB) funded programme which aimed at “Improving Quality Basic Education” (IQBE) in parts of the northern Pacific. GCSL was managed on Majuro, RMI’s main island, by the director at the time Dr Irene Taafaki, coordinator Yolanda McKay, and administrators at the University of the South Pacific’s (USP) RMI campus. Through the provision of GCSL, as school leaders we were encouraged to re-think and draw-from our own cultural repository and connect to our ancestral knowledge that have always provided strength for us. This kind of thinking and practice was encouraged by our educational leaders (Heine, 2002). We argue that a culturally-affirming and culturally-contextual framework that reflects the lived experiences of Marshallese people is much needed and enables the disruption of inherent colonial processes left behind by Western and Eastern administrations which have influenced our education system in the RMI (Heine, 2002). Kanne Lobal, an approach utilising a traditional navigation has warranted its need to provide solutions for today’s educational challenges for us in the RMI. Education in the Pacific Education in the Pacific cannot be understood without contextualising it in its history and culture. It is the same for us in the RMI (Heine, 2002; Walsh et al., 2012). The RMI is located in the Pacific Ocean and is part of Micronesia. It was named after a British captain, John Marshall in the 1700s. The atolls in the RMI were explored by the Spanish in the 16th century. Germany unsuccessfully attempted to colonize the islands in 1885. Japan took control in 1914, but after several battles during World War II, the US seized the RMI from them. In 1947, the United Nations made the island group, along with the Mariana and Caroline archipelagos, a U.S. trust territory (Walsh et al, 2012). Education in the RMI reflects the colonial administrations of Germany, Japan, and now the US. Before the turn of the century, formal education in the Pacific reflected western values, practices, and standards. Prior to that, education was informal and not binded to formal learning institutions (Thaman, 1997) and oral traditions was used as the medium for transmitting learning about customs and practices living with parents, grandparents, great grandparents. As alluded to by Jiba B. Kabua (2004), any “discussion about education is necessarily a discussion of culture, and any policy on education is also a policy of culture” (p. 181). It is impossible to promote one without the other, and it is not logical to understand one without the other. Re-thinking how education should look like, the pedagogical strategies that are relevant in our classrooms, the ways to engage with our parents and communities - such re-thinking sits within our cultural approaches and frameworks. Our collective attempts to provide a cultural framework that is relevant and appropriate for education in our context, sits within the political endeavour to decolonize. This means that what we are providing will not only be useful, but it can be used as a tool to question and identify whether things in place restrict and prevent our culture or whether they promote and foreground cultural ideas and concepts, a significant discussion of culture linked to education (Kabua, 2004). Donor funded development aid programmes were provided to support the challenges within education systems. Concerned with the persistent low educational outcomes of Pacific students, despite the prevalence of aid programmes in the region, in 2000 Pacific educators and leaders with support from New Zealand Aid (NZ Aid) decided to intervene (Heine, 2002; Taufe’ulungaki, 2014). In April 2001, a group of Pacific educators and leaders across the region were invited to a colloquium funded by the New Zealand Overseas Development Agency held in Suva Fiji at the University of the South Pacific. The main purpose of the colloquium was to enable “Pacific educators to re-think the values, assumptions and beliefs underlying [formal] schooling in Oceania” (Benson, 2002). Leadership, in general, is a valued practice in the RMI (Heine, 2002). Despite education leadership being identified as a significant factor in school improvement (Sanga & Chu, 2009), the limited formal training opportunities of school principals in the region was a persistent concern. As part of an Asia Development Bank (ADB) funded project, the Improve Quality Basic Education (IQBE) intervention was developed and implemented in the RMI in 2017. Mentoring is a process associated with the continuity and sustainability of leadership knowledge and practices (Sanga & Chu, 2009). It is a key aspect of building capacity and capabilities within human resources in education (ibid). Indigenous knowledges and education research According to Hilda Heine, the relationship between education and leadership is about understanding Marshallese history and culture (cited in Walsh et al., 2012). It is about sharing indigenous knowledge and histories that “details for future generations a story of survival and resilience and the pride we possess as a people” (Heine, cited in Walsh et al., 2012, p. v). This paper is fuelled by postcolonial aspirations yet is grounded in Pacific indigenous research. This means that our intentions are driven by postcolonial pursuits and discourses linked to challenging the colonial systems and schooling in the Pacific region that privileges western knowledge and learning and marginalises the education practices and processes of local people (Thiong’o, 1986). A point of difference and orientation from postcolonialism is a desire to foreground indigenous Pacific language, specifically Majin Majol, through Marshallese concepts. Our collective bwebwenato and conversation honours and values kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness) (Taafaki & Fowler, 2019). Pacific leaders developed the Rethinking Pacific Education Initiative for and by Pacific People (RPEIPP) in 2002 to take control of the ways in which education research was conducted by donor funded organisations (Taufe’ulungaki, 2014). Our former president, Dr Hilda Heine was part of the group of leaders who sought to counter the ways in which our educational and leadership stories were controlled and told by non-Marshallese (Heine, 2002). As a former minister of education in the RMI, Hilda Heine continues to inspire and encourage the next generation of educators, school leaders, and researchers to re-think and de-construct the way learning and education is conceptualised for Marshallese people. The conceptualisation of Kanne Lobal acknowledges its origin, grounded in Marshallese navigation knowledge and practice. Our decision to unpack and deconstruct Kanne Lobal within the context of formal education and leadership responds to the need to not only draw from indigenous Marshallese ideas and practice but to consider that the next generation will continue to be educated using western processes and initiatives particularly from the US where we get a lot of our funding from. According to indigenous researchers Dawn Bessarab and Bridget Ng’andu (2010), doing research that considers “culturally appropriate processes to engage with indigenous groups and individuals is particularly pertinent in today’s research environment” (p. 37). Pacific indigenous educators and researchers have turned to their own ancestral knowledge and practices for inspiration and empowerment. Within western research contexts, the often stringent ideals and processes are not always encouraging of indigenous methods and practices. However, many were able to ground and articulate their use of indigenous methods as being relevant and appropriate to capturing the realities of their communities (Nabobo-Baba, 2008; Sualii-Sauni & Fulu-Aiolupotea, 2014; Thaman, 1997). At the same time, utilising Pacific indigenous methods and approaches enabled research engagement with their communities that honoured and respected them and their communities. For example, Tongan, Samoan, and Fijian researchers used the talanoa method as a way to capture the stories, lived realities, and worldviews of their communities within education in the diaspora (Fa’avae, Jones, & Manu’atu, 2016; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014; Vaioleti, 2005). Tok stori was used by Solomon Islander educators and school leaders to highlight the unique circles of conversational practice and storytelling that leads to more positive engagement with their community members, capturing rich and meaningful narratives as a result (Sanga & Houma, 2004). The Indigenous Aborigine in Australia utilise yarning as a “relaxed discussion through which both the researcher and participant journey together visiting places and topics of interest relevant” (Bessarab & Ng’andu, 2010, p. 38). Despite the diverse forms of discussions and storytelling by indigenous peoples, of significance are the cultural protocols, ethics, and language for conducting and guiding the engagement (Bessarab & Ng’andu, 2010; Nabobo-Baba, 2008; Sualii-Sauni & Aiolupotea, 2014). Through the ethics, values, protocols, and language, these are what makes indigenous methods or frameworks unique compared to western methods like in-depth interviews or semi-structured interviews. This is why it is important for us as Marshallese educators to frame, ground, and articulate how our own methods and frameworks of learning could be realised in western education (Heine, 2002; Jetnil-Kijiner, 2014). In this paper, we utilise bwebwenato as an appropriate method linked to “talk story”, capturing our collective stories and experiences during GCSL and how we sought to build partnerships and collaboration with each other, our communities, and the PSS. Bwebwenato and drawing from Kajin Majel Legends and stories that reflect Marshallese society and its cultural values have survived through our oral traditions. The practice of weaving also holds knowledge about our “valuable and earliest sources of knowledge” (Taafaki & Fowler, 2019, p. 2). The skilful navigation of Marshallese wayfarers on the walap (large canoes) in the ocean is testament of their leadership and the value they place on ensuring the survival and continuity of Marshallese people (Taafaki & Fowler, 2019; Walsh et al., 2012). During her graduate study in 2014, Kathy Jetnil-Kijiner conceptualised bwebwenato as being the most “well-known form of Marshallese orality” (p. 38). The Marshallese-English dictionary defined bwebwenato as talk, conversation, story, history, article, episode, lore, myth, or tale (cited in Jetnil Kijiner, 2014). Three years later in 2017, bwebwenato was utilised in a doctoral project by Natalie Nimmer as a research method to gather “talk stories” about the experiences of 10 Marshallese experts in knowledge and skills ranging from sewing to linguistics, canoe-making and business. Our collective bwebwenato in this paper centres on Marshallese ideas and language. The philosophy of Marshallese knowledge is rooted in our “Kajin Majel”, or Marshallese language and is shared and transmitted through our oral traditions. For instance, through our historical stories and myths. Marshallese philosophy, that is, the knowledge systems inherent in our beliefs, values, customs, and practices are shared. They are inherently relational, meaning that knowledge systems and philosophies within our world are connected, in mind, body, and spirit (Jetnil-Kijiner, 2014; Nimmer, 2017). Although some Marshallese believe that our knowledge is disappearing as more and more elders pass away, it is therefore important work together, and learn from each other about the knowledges shared not only by the living but through their lamentations and stories of those who are no longer with us (Jetnil-Kijiner, 2014). As a Marshallese practice, weaving has been passed-down from generation to generation. Although the art of weaving is no longer as common as it used to be, the artefacts such as the “jaki-ed” (clothing mats) continue to embody significant Marshallese values and traditions. For our weavers, the jouj (check spelling) is the centre of the mat and it is where the weaving starts. When the jouj is correct and weaved well, the remainder and every other part of the mat will be right. The jouj is symbolic of the “heart” and if the heart is prepared well, trained well, then life or all other parts of the body will be well (Taafaki & Fowler, 2019). In that light, we have applied the same to this paper. Conceptualising and drawing from cultural practices that are close and dear to our hearts embodies a significant ontological attempt to prioritize our own knowledge and language, a sense of endearment to who we are and what we believe education to be like for us and the next generation. The application of the phrase “Majolizing '' was used by the Ministry of Education when Hilda Heine was minister, to weave cultural ideas and language into the way that teachers understand the curriculum, develop lesson plans and execute them in the classroom. Despite this, there were still concerns with the embedded colonized practices where teachers defaulted to eurocentric methods of doing things, like the strategies provided in the textbooks given to us. In some ways, our education was slow to adjust to the “Majolizing '' intention by our former minister. In this paper, we provide Kanne Lobal as a way to contribute to the “Majolizing intention” and perhaps speed up yet still be collectively responsible to all involved in education. Kajin Wa and Kanne Lobal “Wa” is the Marshallese concept for canoe. Kajin wa, as in canoe language, has a lot of symbolic meaning linked to deeply-held Marshallese values and practices. The canoe was the foundational practice that supported the livelihood of harsh atoll island living which reflects the Marshallese social world. The experts of Kajin wa often refer to “wa” as being the vessel of life, a means and source of sustaining life (Kelen, 2009, cited in Miller, 2010). “Jouj” means kindness and is the lower part of the main hull of the canoe. It is often referred to by some canoe builders in the RMI as the heart of the canoe and is linked to love. The jouj is one of the first parts of the canoe that is built and is “used to do all other measurements, and then the rest of the canoe is built on top of it” (Miller, 2010, p. 67). The significance of the jouj is that when the canoe is in the water, the jouj is the part of the hull that is underwater and ensures that all the cargo and passengers are safe. For Marshallese, jouj or kindness is what living is about and is associated with selflessly carrying the responsibility of keeping the family and community safe. The parts of the canoe reflect Marshallese culture, legend, family, lineage, and kinship. They embody social responsibilities that guide, direct, and sustain Marshallese families’ wellbeing, from atoll to atoll. For example, the rojak (boom), rojak maan (upper boom), rojak kōrā (lower boom), and they support the edges of the ujelā/ujele (sail) (see figure 1). The literal meaning of rojak maan is male boom and rojak kōrā means female boom which together strengthens the sail and ensures the canoe propels forward in a strong yet safe way. Figuratively, the rojak maan and rojak kōrā symbolise the mother and father relationship which when strong, through the jouj (kindness and love), it can strengthen families and sustain them into the future. Figure 1. Parts of the canoe Source: https://www.canoesmarshallislands.com/2014/09/names-of-canoe-parts/ From a socio-cultural, communal, and leadership view, the canoe (wa) provides understanding of the relationships required to inspire and sustain Marshallese peoples’ education and learning. We draw from Kajin wa because they provide cultural ideas and practices that enable understanding of education and leadership necessary for sustaining Marshallese people and realities in Oceania. When building a canoe, the women are tasked with the weaving of the ujelā/ujele (sail) and to ensure that it is strong enough to withstand long journeys and the fierce winds and waters of the ocean. The Kanne Lobal relates to the front part of the ujelā/ujele (sail) where the rojak maan and rojak kōrā meet and connect (see the red lines in figure 1). Kanne Lobal is linked to the strategic use of the ujelā/ujele by navigators, when there is no wind north wind to propel them forward, to find ways to capture the winds so that their journey can continue. As a proverbial saying, Kanne Lobal is used to ignite thinking and inspire and transform practice particularly when the journey is rough and tough. In this paper we draw from Kanne Lobal to ignite, inspire, and transform our educational and leadership practices, a move to explore what has always been meaningful to Marshallese people when we are faced with challenges. The Kanne Lobal utilises our language, and cultural practices and values by sourcing from the concepts of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). A key Marshallese proverb, “Enra bwe jen lale rara”, is the cultural practice where families enact compassion through the sharing of food in all occurrences. The term “enra” is a small basket weaved from the coconut leaves, and often used by Marshallese as a plate to share and distribute food amongst each other. Bwe-jen-lale-rara is about noticing and providing for the needs of others, and “enra” the basket will help support and provide for all that are in need. “Enra-bwe-jen-lale-rara” is symbolic of cultural exchange and reciprocity and the cultural values associated with building and maintaining relationships, and constantly honouring each other. As a Marshallese practice, in this article we share our understanding and knowledge about the challenges as well as possible solutions for education concerns in our nation. In addition, we highlight another proverb, “wa kuk wa jimor”, which relates to having one canoe, and despite its capacity to feed and provide for the individual, but within the canoe all people can benefit from what it can provide. In the same way, we provide in this paper a cultural framework that will enable all educators to benefit from. It is a framework that is far-reaching and relevant to the lived realities of Marshallese people today. Kumit relates to people united to build strength, all co-operating and working together, living in peace, harmony, and good health. Kanne Lobal: conceptual framework for education and leadership An education framework is a conceptual structure that can be used to capture ideas and thinking related to aspects of learning. Kanne Lobal is conceptualised and framed in this paper as an educational framework. Kanne Lobal highlights the significance of education as a collective partnership whereby leadership is an important aspect. Kanne Lobal draws-from indigenous Marshallese concepts like kautiej (respect), jouj eo mour eo (reciprocity), and jouj (kindness, heart). The role of a leader, including an education leader, is to prioritise collective learning and partnerships that benefits Marshallese people and the continuity and survival of the next generation (Heine, 2002; Thaman, 1995). As described by Ejnar Aerōk, an expert canoe builder in the RMI, he stated: “jerbal ippān doon bwe en maron maan wa e” (cited in Miller, 2010, p. 69). His description emphasises the significance of partnerships and working together when navigating and journeying together in order to move the canoe forward. The kubaak, the outrigger of the wa (canoe) is about “partnerships”. For us as elementary school leaders on Majuro, kubaak encourages us to value collaborative partnerships with each other as well as our communities, PSS, and other stakeholders. Partnerships is an important part of the Kanne Lobal education and leadership framework. It requires ongoing bwebwenato – the inspiring as well as confronting and challenging conversations that should be mediated and negotiated if we and our education stakeholders are to journey together to ensure that the educational services we provide benefits our next generation of young people in the RMI. Navigating ahead the partnerships, mediation, and negotiation are the core values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity). As an organic conceptual framework grounded in indigenous values, inspired through our lived experiences, Kanne Lobal provides ideas and concepts for re-thinking education and leadership practices that are conducive to learning and teaching in the schooling context in the RMI. By no means does it provide the solution to the education ills in our nation. However, we argue that Kanne Lobal is a more relevant approach which is much needed for the negatively stigmatised system as a consequence of the various colonial administrations that have and continue to shape and reframe our ideas about what education should be like for us in the RMI. Moreover, Kannel Lobal is our attempt to decolonize the framing of education and leadership, moving our bwebwenato to re-framing conversations of teaching and learning so that our cultural knowledge and values are foregrounded, appreciated, and realised within our education system. Bwebwenato: sharing our stories In this section, we use bwebwenato as a method of gathering and capturing our stories as data. Below we capture our stories and ongoing conversations about the richness in Marshallese cultural knowledge in the outer islands and on Majuro and the potentialities in Kanne Lobal. Danny Jim When I was in third grade (9-10 years of age), during my grandfather’s speech in Arno, an atoll near Majuro, during a time when a wa (canoe) was being blessed and ready to put the canoe into the ocean. My grandfather told me the canoe was a blessing for the family. “Without a canoe, a family cannot provide for them”, he said. The canoe allows for travelling between places to gather food and other sources to provide for the family. My grandfather’s stories about people’s roles within the canoe reminded me that everyone within the family has a responsibility to each other. Our women, mothers and daughters too have a significant responsibility in the journey, in fact, they hold us, care for us, and given strength to their husbands, brothers, and sons. The wise man or elder sits in the middle of the canoe, directing the young man who help to steer. The young man, he does all the work, directed by the older man. They take advice and seek the wisdom of the elder. In front of the canoe, a young boy is placed there and because of his strong and youthful vision, he is able to help the elder as well as the young man on the canoe. The story can be linked to the roles that school leaders, teachers, and students have in schooling. Without each person knowing intricately their role and responsibility, the sight and vision ahead for the collective aspirations of the school and the community is difficult to comprehend. For me, the canoe is symbolic of our educational journey within our education system. As the school leader, a central, trusted, and respected figure in the school, they provide support for teachers who are at the helm, pedagogically striving to provide for their students. For without strong direction from the school leaders and teachers at the helm, the students, like the young boy, cannot foresee their futures, or envisage how education can benefit them. This is why Kanne Lobal is a significant framework for us in the Marshall Islands because within the practice we are able to take heed and empower each other so that all benefit from the process. Kanne Lobal is linked to our culture, an essential part of who we are. We must rely on our own local approaches, rather than relying on others that are not relevant to what we know and how we live in today’s society. One of the things I can tell is that in Majuro, compared to the outer islands, it’s different. In the outer islands, parents bring children together and tell them legends and stories. The elders tell them about the legends and stories – the bwebwenato. Children from outer islands know a lot more about Marshallese legends compared to children from the Majuro atoll. They usually stay close to their parents, observe how to prepare food and all types of Marshallese skills. Loretta Joseph Case There is little Western influence in the outer islands. They grow up learning their own culture with their parents, not having tv. They are closely knit, making their own food, learning to weave. They use fire for cooking food. They are more connected because there are few of them, doing their own culture. For example, if they’re building a house, the ladies will come together and make food to take to the males that are building the house, encouraging them to keep on working - “jemjem maal” (sharpening tools i.e. axe, like encouraging workers to empower them). It’s when they bring food and entertainment. Rubon Rubon Togetherness, work together, sharing of food, these are important practices as a school leader. Jemjem maal – the whole village works together, men working and the women encourage them with food and entertainment. All the young children are involved in all of the cultural practices, cultural transmission is consistently part of their everyday life. These are stronger in the outer islands. Kanne Lobal has the potential to provide solutions using our own knowledge and practices. Connie Joel When new teachers become a teacher, they learn more about their culture in teaching. Teaching raises the question, who are we? A popular saying amongst our people, “Aelon kein ad ej aelon in manit”, means that “Our islands are cultural islands”. Therefore, when we are teaching, and managing the school, we must do this culturally. When we live and breathe, we must do this culturally. There is more socialising with family and extended family. Respect the elderly. When they’re doing things the ladies all get together, in groups and do it. Cut the breadfruit, and preserve the breadfruit and pandanus. They come together and do it. Same as fishing, building houses, building canoes. They use and speak the language often spoken by the older people. There are words that people in the outer islands use and understand language regularly applied by the elderly. Respect elderly and leaders more i.e., chiefs (iroj), commoners (alap), and the workers on the land (ri-jerbal) (social layer under the commoners). All the kids, they gather with their families, and go and visit the chiefs and alap, and take gifts from their land, first produce/food from the plantation (eojōk). Tommy Almet The people are more connected to the culture in the outer islands because they help one another. They don’t have to always buy things by themselves, everyone contributes to the occasion. For instance, for birthdays, boys go fishing, others contribute and all share with everyone. Kanne Lobal is a practice that can bring people together – leaders, teachers, stakeholders. We want our colleagues to keep strong and work together to fix problems like students and teachers’ absenteeism which is a big problem for us in schools. Demetria Malachi The culture in the outer islands are more accessible and exposed to children. In Majuro, there is a mixedness of cultures and knowledges, influenced by Western thinking and practices. Kanne Lobal is an idea that can enhance quality educational purposes for the RMI. We, the school leaders who did GCSL, we want to merge and use this idea because it will help benefit students’ learning and teachers’ teaching. Kanne Lobal will help students to learn and teachers to teach though traditional skills and knowledge. We want to revitalize our ways of life through teaching because it is slowly fading away. Also, we want to have our own Marshallese learning process because it is in our own language making it easier to use and understand. Essentially, we want to proudly use our own ways of teaching from our ancestors showing the appreciation and blessings given to us. Way Forward To think of ways forward is about reflecting on the past and current learnings. Instead of a traditional discussion within a research publication, we have opted to continue our bwebwenato by sharing what we have learnt through the Graduate Certificate in School Leadership (GCSL) programme. Our bwebwenato does not end in this article and this opportunity to collaborate and partner together in this piece of writing has been a meaningful experience to conceptualise and unpack the Kanne Lobal framework. Our collaborative bwebwenato has enabled us to dig deep into our own wise knowledges for guidance through mediating and negotiating the challenges in education and leadership (Sanga & Houma, 2004). For example, bwe-jen-lale-rara reminds us to inquire, pay attention, and focus on supporting the needs of others. Through enra-bwe-jen-lale-rara, it reminds us to value cultural exchange and reciprocity which will strengthen the development and maintaining of relationships based on ways we continue to honour each other (Nimmer, 2017). We not only continue to support each other, but also help mentor the next generation of school leaders within our education system (Heine, 2002). Education and leadership are all about collaborative partnerships (Sanga & Chu, 2009; Thaman, 1997). Developing partnerships through the GCSL was useful learning for us. It encouraged us to work together, share knowledge, respect each other, and be kind. The values of jouj (kindness, love), kautiej (respect), and jouj eo mour eo (reciprocity) are meaningful in being and becoming and educational leader in the RMI (Jetnil-Kijiner, 2014; Miller, 2010; Nimmer, 2017). These values are meaningful for us practice particularly given the drive by PSS for schools to become accredited. The workshops and meetings delivered during the GCSL in the RMI from 2018 to 2019 about Kanne Lobal has given us strength to share our stories and experiences from the meeting with the stakeholders. But before we met with the stakeholders, we were encouraged to share and speak in our language within our courses: EDP05 (Professional Development and Learning), EDP06 (School Leadership), EDP07 (School Management), EDP08 (Teaching and Learning), and EDP09 (Community Partnerships). In groups, we shared our presentations with our peers, the 15 school leaders in the GCSL programme. We also invited USP RMI staff. They liked the way we presented Kannel Lobal. They provided us with feedback, for example: how the use of the sail on the canoe, the parts and their functions can be conceptualised in education and how they are related to the way that we teach our own young people. Engaging stakeholders in the conceptualisation and design stages of Kanne Lobal strengthened our understanding of leadership and collaborative partnerships. Based on various meetings with the RMI Pacific Resources for Education and Learning (PREL) team, PSS general assembly, teachers from the outer islands, and the PSS executive committee, we were able to share and receive feedback on the Kanne Lobal framework. The coordinators of the PREL programme in the RMI were excited by the possibilities around using Kanne Lobal, as a way to teach culture in an inspirational way to Marshallese students. Our Marshallese knowledge, particularly through the proverbial meaning of Kanne Lobal provided so much inspiration and insight for the groups during the presentation which gave us hope and confidence to develop the framework. Kanne Lobal is an organic and indigenous approach, grounded in Marshallese ways of doing things (Heine, 2002; Taafaki & Fowler, 2019). Given the persistent presence of colonial processes within the education system and the constant reference to practices and initiatives from the US, Kanne Lobal for us provides a refreshing yet fulfilling experience and makes us feel warm inside because it is something that belongs to all Marshallese people. Conclusion Marshallese indigenous knowledge and practices provide meaningful educational and leadership understanding and learnings. They ignite, inspire, and transform thinking and practice. The Kanne Lobal conceptual framework emphasises key concepts and values necessary for collaborative partnerships within education and leadership practices in the RMI. The bwebwenato or talk stories have been insightful and have highlighted the strengths and benefits that our Marshallese ideas and practices possess when looking for appropriate and relevant ways to understand education and leadership. Acknowledgements We want to acknowledge our GCSL cohort of school leaders who have supported us in the development of Kanne Lobal as a conceptual framework. A huge kommol tata to our friends: Joana, Rosana, Loretta, Jellan, Alvin, Ellice, Rolando, Stephen, and Alan. References Benson, C. (2002). Preface. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (p. iv). Suva, Fiji: University of the South Pacific, Institute of Education. Bessarab, D., Ng’andu, B. (2010). Yarning about yarning as a legitimate method in indigenous research. International Journal of Critical Indigenous Studies, 3(1), 37-50. Fa’avae, D., Jones, A., & Manu’atu, L. (2016). Talanoa’i ‘a e talanoa - talking about talanoa: Some dilemmas of a novice researcher. AlterNative: An Indigenous Journal of Indigenous Peoples,12(2),138-150. Heine, H. C. (2002). A Marshall Islands perspective. In F. Pene, A. M. Taufe’ulungaki, & C. Benson (Eds.), Tree of Opportunity: re-thinking Pacific Education (pp. 84 – 90). Suva, Fiji: University of the South Pacific, Institute of Education. Infoplease Staff (2017, February 28). Marshall Islands, retrieved from https://www.infoplease.com/world/countries/marshall-islands Jetnil-Kijiner, K. (2014). Iep Jaltok: A history of Marshallese literature. (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Kabua, J. B. (2004). We are the land, the land is us: The moral responsibility of our education and sustainability. In A.L. Loeak, V.C. Kiluwe and L. Crowl (Eds.), Life in the Republic of the Marshall Islands, pp. 180 – 191. Suva, Fiji: University of the South Pacific. Kupferman, D. (2004). Jelalokjen in flux: Pitfalls and prospects of contextualising teacher training programmes in the Marshall Islands. Directions: Journal of Educational Studies, 26(1), 42 – 54. http://directions.usp.ac.fj/collect/direct/index/assoc/D1175062.dir/doc.pdf Miller, R. L. (2010). Wa kuk wa jimor: Outrigger canoes, social change, and modern life in the Marshall Islands (Unpublished masters’ thesis). Honolulu, HW: University of Hawaii. Nabobo-Baba, U. (2008). Decolonising framings in Pacific research: Indigenous Fijian vanua research framework as an organic response. AlterNative: An Indigenous Journal of Indigenous Peoples, 4(2), 141-154. Nimmer, N. E. (2017). Documenting a Marshallese indigenous learning framework (Unpublished doctoral thesis). Honolulu, HW: University of Hawaii. Sanga, K., & Houma, S. (2004). Solomon Islands principalship: Roles perceived, performed, preferred, and expected. Directions: Journal of Educational Studies, 26(1), 55-69. Sanga, K., & Chu, C. (2009). Introduction. In K. Sanga & C. Chu (Eds.), Living and Leaving a Legacy of Hope: Stories by New Generation Pacific Leaders (pp. 10-12). NZ: He Parekereke & Victoria University of Wellington. Suaalii-Sauni, T., & Fulu-Aiolupotea, S. M. (2014). Decolonising Pacific research, building Pacific research communities, and developing Pacific research tools: The case of the talanoa and the faafaletui in Samoa. Asia Pacific Viewpoint, 55(3), 331-344. Taafaki, I., & Fowler, M. K. (2019). Clothing mats of the Marshall Islands: The history, the culture, and the weavers. US: Kindle Direct. Taufe’ulungaki, A. M. (2014). Look back to look forward: A reflective Pacific journey. In M. ‘Otunuku, U. Nabobo-Baba, S. Johansson Fua (Eds.), Of Waves, Winds, and Wonderful Things: A Decade of Rethinking Pacific Education (pp. 1-15). Fiji: USP Press. Thaman, K. H. (1995). Concepts of learning, knowledge and wisdom in Tonga, and their relevance to modern education. Prospects, 25(4), 723-733. Thaman, K. H. (1997). Reclaiming a place: Towards a Pacific concept of education for cultural development. The Journal of the Polynesian Society, 106(2), 119-130. Thiong’o, N. W. (1986). Decolonising the mind: The politics of language in African literature. Kenya: East African Educational Publishers. Vaioleti, T. (2006). Talanoa research methodology: A developing position on Pacific research. Waikato Journal of Education, 12, 21-34. Walsh, J. M., Heine, H. C., Bigler, C. M., & Stege, M. (2012). Etto nan raan kein: A Marshall Islands history (First Edition). China: Bess Press.

Abstract A new distribution map is provided for Gloeotinia granigena (Quélet) Schumacher. Hosts: Lolium spp. and other Gramineae. Information is given on the geographical distribution in Australasia, Australia, New South Wales, South Australia, Tasmania, Victoria, New Zealand, Europe, Denmark, France, German Federal Republic, Irish Republic, Netherlands, Sweden, UK, USSR, North America, Canada, Quebec, USA, Oregon.

Abstract A new distribution map is provided for Aphanomyces raphani Kendr. Hosts: Radish (Raphanus sativus). Information is given on the geographical distribution in Africa, South Africa, Australasia & Oceania, Australia, New South Wales, Queensland, New Zealand, Europe, German Federal Republic, Romania, North America, Canada, British Columbia, Quebec, Ontario, Nova Scotia, USA, South America, Venezuela, Asia, Japan.

Abstract A new distribution map is provided for Aphanomyces cochlioides Drechsler. Hosts: sugar beet (Beta vulgaris), spinach (Spinacia oleracea). Information is given on the geographical distribution in ASIA, Japan, AUSTRALASIA & OCEANIA, Australia, Queensland, EUROPE, Austria, Denmark, France, German, Democratic Republic, German, Federal Republic, Hungary, Poland, Republic of Ireland, Sweden, UK, England, USSR, NORTH AMERICA, Canada, Alberta, Ontario, Nova Scotia: Quebec USA: California, IA, Maine, Montana, North Dakota, Ohio, South Dakota, Washington State, Michigan, Colorado, Wisconsin, Texas, SOUTH AMERICA, Chile.

Abstract A new distribution map is provided for Sphacelotheca reiliana (Kuhn) Clint. Hosts: Maize (Zea mays) and Sorghum. Information is given on the geographical distribution in Africa, Burkina Faso, Burundi, Cameroon, Chad, Egypt, Ethiopia (Eritrea), Ghana, Kenya, Malawi, Mali, Mauritania, Mauritius, Morocco, Mozambique, Niger, Nigeria, Rodriguez Island, Rwanda, Senegal, Somalia, South Africa, Sudan, Tanzania, Togo, Uganda, Zaire, Zambia, Zimbabwe, Asia, Bhutan, Burma, China, India, Indonesia, Iran, Iraq, Israel, Japan, Korea Republic, Malaysia, Sarawak, Nepal, Pakistan, Philippines, Taiwan, Central Asia, Siberia, Russian Far East, Kazakhstan, Yemen Arab Republic, Yemen Democratic Republic, Australasia & Oceania, Australia, New South Wales, Queensland, Victoria, Hawaii, New Britain, New Zealand, Papua New Guinea, Europe, Austria, Azores, Bulgaria, Cyprus, Czechoslovakia, France, German Democratic Republic, German Federal Republic, Greece, Hungary, Italy, Romania, Spain, USSR, Estonia, Ukraine, Yugoslavia, North America, Canada, Ontario, Mexico, USA, Central America & West Indies, Barbados, Guatemala, Honduras, Jamaica, Panama, Salvador, South America, Argentina, Bolivia, Brazil, Rio Grande do Sul, Chile, Colombia, Uruguay.

Abstract A new distribution map is provided for Sorosporium saponariae Rudolphi. Hosts: Saponaria officinalis, Dianthus spp. and other Caryophyllaceae. Information is given on the geographical distribution in AFRICA, Algeria, Morocco, ASIA, Pakistan, USSR, AUSTRALASIA, Australia, EUROPE, Austria, Bulgaria, Czechoslovakia, Denmark, Finland, France, German, Democratic, Republic, Germany, Hungary, Italy, Norway, Poland, Romania, Spain, Sweden, Switzerland, USSR, Yugoslavia, NORTH AMERICA, USA, New York, Colorado, Utah, Nevada, Connecticut, Nevada. SOUTH AMERICA, Argentina, Chile.

Abstract A new distribution map is provided for Scirrhia pini[Mycosphaerella pini] Funk & Parker. Hosts: Pine (Pinus spp.). Information is given on the geographical distribution in AFRICA, Kenya, Malawi, South Africa (Cape Province, Swaziland), Tanzania(Tanganyika), Uganda (Gibson, loc, cit.),? Zambia, Zimbabwe, ASIA, Brunei, India (Madras), Korea, USSR (Republic of Georgia), AUSTRALASIA, Australia, New Zealand, EUROPE, Austria, Britain (England), Bulgaria, France, German Federal Republic, Greece, Portugal (Azores), Romania, Spain, Yugoslavia, NORTH AMERICA, Canada (Manitoba, Saskatchewan), (British Columbia), (Newfld), USA (Illinois, Iowa, Maryland, Ohio, Okla), (Peterson, loc, cit.), (California), Minnisota; Florida, CENTRAL AMERICA & WEST INDIES, Costa Rica, Guatemala, Honduras, Jamaica, SOUTH AMERICA, Argentina, Brazil, Chile, Ecuador, Uruguay.

An international boundary across navigable rivers can naturally create a great potential for international conflict. In New Guinea, the officials of Anglo-German colonial authorities seemed to have overlooked this problem when they first decided to lay down their common boundary in 1885 across Gira, Eia, Wuwu and Waria Rivers at eight parallel on the south latitude. This paper attempts to discuss how the colonial officials of the two very powerful countries at the time (1885-1909) tried to make decisions in such a way to prevent or avoid an international conflict with the navigation of rivers across their common boundaries. It involved the parliamentarians of newly federated Commonwealth of Australia. Wherever the colonial officials laid claims to protect land and people, they also created a lasting problem relating to definition of boundaries that crossed navigable rivers. A good example is the “Anglo-German boundary” which crosses the Gira, Eia, Wuwu, and Waria rivers. When the British colonial officials were pressured by their colonies in Australia, they never considered likely problems in the future if international boundary crossed navigable rivers.

AbstractThis article theorizes on the relation between individual and societal language loss. In this context, the notion of relic variety will be introduced, describing a setting where a language is spoken by a very small number of speakers who live isolated from the main speech community and have not acquired literacy in their L1. The article focuses on attrition phenomena in a specific relic variety, i.e. Barossa German, a German-speaking enclave in South Australia. It analyses phenomena caused by lack of usage (hesitation phenomena, code-switching, semantic restructuring) as well as reduction processes, namely of the German case system. The results of the analysis demonstrate that in contrast to canonical attrition settings, in a relic variety morphological markers are only retained in constructions that had been either entrenched early in the acquisition processes or are very frequently used. It will be argued that the main factors influencing the reduction process are the variety of input, a decrease of normativity and the absence of a written variety.

Abstract A new distribution map is provided for Phytophthora nicotianae var. nicotianae van Breda de Haan. Hosts: tobacco (Nicotiana tabacum), etc. Information is given on the geographical distribution in AFRICA, Egypt, Ghana, Libya, Madagascar, Malawi, Mauritius, Nigeria, Senegal, South Africa, Tanzania, ASIA, Brunei, China, India, Andhra Pradesh, Karnataka, Kerela, Tamil Nadu, Indonesia, Java, Sumatra, Iran, Iraq, Israel, Japan, Jordan, Korea, Lebanon, Malaysia, Sabah, Sararak, Pakistan, Sri Lanka, Taiwan, Thailand, AUSTRALASIA & OCEANIA, Australia: Queensland, WA, Caroline Islands, Fiji, French, Polynesia, Hawaii, New Zealand, Papua New Guinea, EUROPE, Bulgaria, Cyprus, France, German, Democratic Republic, Greece, Italy, Netherlands, UK, England, Yugoslavia, NORTH AMERICA, Canada, Mexico, USA, Alabama, Florida, Georgia, Kentucky, North carolina, Tennessee, California, Connecticut, Maryland, Pennsylvania, Texas, Virginia, Arizona, CENTRAL AMERICA & WEST INDIES, Puerto Rico, West Indies, Trinidad, Jamaica, SOUTH AMERICA, Brazil, Chile, Colombia, Guyana, Venezuela.

04–403 Ammon, Ulrich. Sprachenpolitik in Europa- unter dem vorrangigen Aspekt von Deutsch als Fremdsprache (2). [Policy towards languages in Europe with special reference to German as a foreign language (2)]. Deutsch als Fremdsprache (Leipzig, Germany), 41 (2004), 3–10.04–404 Bray, Gayle Babbitt (U. of Iowa, USA; Email: gayle-bray@uiowa.edu), Pascarella, Ernest T. and Pierson, Christopher T. Postsecondary education and some dimensions of literacy development: An exploration of longitudinal evidence. Reading Research Quarterly (Newark, USA), 39, 3 (2004), 306–330.04–405 Dufon, Margaret A. (California State U., USA). Producing a video for teaching pragmatics in the second or foreign language. Prospect (Sydney, Australia), 19, 1 (2004), 65–83.04–406 Intachakra, S. (Thammasat U., Thailand; Email: songthama@tu.ac.th). Contrastive pragmatics and language teaching: apologies and thanks in English and Thai. RELC Journal (Singapore), 35, 1 (2004), 37–62.04–407 Kerkes, Julie (California State U., Los Angeles, USA). Preparing ESL learners for self-presentation in institutional settings outside the classroom. Prospect (Sydney, Australia), 19, 1 (2004), 22–46.04–408 Kozlova, Iryna (Georgia State U., USA). Can you complain? Cross-cultural comparison of indirect complaints in Russian and American English. Prospect (Sydney, Australia), 19, 1 (2004), 84–105.04–409 McLean, Terence (Grant MacEwan College, Edmonton, Canada; Email: mcleanky@telusplanet.net). Giving students a fighting chance: pragmatics in the language classroom. TESL Canada Journal/Revue TESL du Canada (Barnaby, Canada), 21, 2 (2004), 72–92.04–410 Newton, Jonathan (Victoria U. of Wellington, New Zealand). Face-threatening talk on the factory floor: using authentic workplace interactions in language teaching. Prospect (Sydney, Australia), 19, 1 (2004), 47–64.04–411 Nichols, Susan (U. of South Australia). Literacy learning and children's social agendas in the school entry classroom. Australian Journal of Language and Literacy (Norwood, Australia), 27, 2 (2004), 101–113.04–412 Yates, Lynda (La Trobe U., Australia). The ‘secret rules of language‘: tackling pragmatics in the classroom. Prospect (Sydney, Australia), 19, 1 (2004), 3–20.

Caodaism was established in the South in 1926. It has been considered as one of indigenous religions in Vietnam in the first half of 20th century. In the first days, trend of Caodaism was to develop in foreign countries through missionary campaigns. Cao Dai’s dignitaries carried out missionary task in Cambodia, France, German, China… That was why followers of Cao Dai (Cao Dai followers) lived in these countries in the early 1930s. After 1975 many people in the South emigrated to America, Australia. Many of them were Cao Dai followers. After their lives have been stabilized, they have gathered to build temples so Caodaism in foreign countries has developed strongly. The number of believers in foreign countries is about 50,000 believers. They have created connection with Cao Dai sects through many forms. In this article we mention three main contents: 1) Cao Dai followers in foreign countries: the process of establishment and development after 1975; 2) The administrative relation between Cao Dai followers in foreign countries and Cao Dai church in Vietnam; 3) Some remarks on the administrative relation. The information in this article has been completed with two research methods: in-depth interview and participate observation.

04–117Al-Jarf, Reima S. (King Saud U., Saudi Arabia). The effects of web-based learning on struggling EFL college writers. Foreign Language Annals (New York, USA), 37, 1 (2004), 49–57.04–118Basturkmen, Helen (University of Auckland, New Zealand; Email: h.basturkmen@auckland.ac.nz). Specificity and ESP course design. RELC Journal (Singapore), 34, 1 (2003), 48–63.04–119Basturkmen, H., Loewen, S. and Ellis, R. (U. of Auckland, New Zealand Email: h.basturkmen@auckland.ac.nz). Teachers' stated beliefs about incidental focus on form and their classroom practices. Applied Linguistics (Oxford, UK), 25, 2 (2004), 243–72.04–120Benson, Barbara E. (Piedmont College, Georgia, USA). Framing culture within classroom practice: culturally relevant teaching. Action in Teacher Education (Alexandria, Virginia, USA), 25, 2 (2003), 16–22.04–121Blanche, Patrick (U. of California, Davis, USA; Email: blanche@kumagaku.ac.jp). Using dictations to teach pronunciation. Modern English Teacher (London, UK), 13, 1 (2004), 30–36.04–122Budimlic, Melisa (Ludwig-Maximilians Universität München, Germany). Zur Konzeption und Entwicklung interdisziplinärer Lernprogramme am Beispiel eines Lernmodules zur Psycholinguistik. [The concept and development of an interdisciplinary learning programme. An example of a module in psycholinguistics] Zeitschrift für Interkulturellen Fremdsprachenunterricht (Edmonton, Alberta, Canada), Online Journal, 9, 1 (2004), 12 pp.04–123Cajkler, Wasyl (U. of Leicester, UK; Email: wc4@le.ac.uk). How a dead butler was killed: the way English national strategies maim grammatical parts. Language and Education (Clevedon, UK), 18, 1 (2004), 1–16.04–124Calvin, Lisa M. & Rider, N. Ann (Indiana State U., USA). Not your parents' language class: curriculum revision to support university language requirements. Foreign Language Annals (New York, USA), 37, 1 (2004), 11–25.04–125Carrier, Karen A. (Northern Illinois University, USA). Improving high school English language learners' second language listening through strategy instruction. Bilingual Research Journal (Arizona, USA), 27, 3 (2003), 383–408.04–126Christie, Frances (Universities of Melbourne and Sydney, Australia; Email: fhchri@unimelb.edu.au). English in Australia. RELC Journal (Singapore) 34, 1 (2003), 100–19.04–127Drobná, Martina (Ludwig-Maximilians Universität München, Germany). Konzeption von Online-Lerneinheiten für den Unterricht Deutsch als Fremdsprache am Beispiel des Themas ‘Auslandsstudium in Deutschland’. [The concept of an online learning unit ‘Studying in Germany’ for German as a foreign language]. Zeitschrift für Iinterkulturellen Fremdsprachenunterricht (Edmonton, Canada) Online Journal, 9, 1 (2004), 17 pp.04–128Ellis, Rod (University of Auckland, New Zealand; Email: r.ellis@auckland.ac.nz). Designing a task-based syllabus. RELC Journal (Singapore) 34, 1 (2003), 64–81.04–129Giambo, D. & McKinney, J. (University of Miami, USA) The effects of a phonological awareness intervention on the oral English proficiency of Spanish-speaking kindergarten children. TESOL Quarterly (Alexandria, Virginia, USA), 38, 1 (2004), 95–117.04–130Goodwyn, Andrew (Reading University, UK). The professional identity of English teachers. English in Australia (Norwood, Australia), 139 (2004), 122–30.04–131Hu, Guangwei (Nanyang Technological U., Singapore; Email: gwhu@nie.edu.sg). English language teaching in China: regional differences and contributing factors. Journal of Multilingual and Multicultural Development (Clevedon, UK), 24, 4 (2003), 290–318.04–132Jacobs, George M. (JF New Paradigm Education, Singapore; Email: gmjacobs@pacific.net.sg) and Farrell, Thomas S. C. Understanding and implementing the communicative language teaching paradigm. RELC Journal (Singapore) 34, 1 (2003), 5–30.04–133Janks, Hilary (University of the Witwatersrand, South Africa). The access paradox. English in Australia (Norwood, Australia), 139 (2004), 33–42.04–134Kim, Jeong-ryeol (Korea National U. of Education, South Korea; Email: jrkim@knue.ac.kr). Using mail talk to improve English speaking skills. English Teaching (Anseonggun, South Korea), 58, 4 (2003), 349–69.04–135Kim, Nahk-Bohk (Chungnam National University, South Korea). An investigation into the collocational competence of Korean high school EFL learners. English Teaching (Anseonggun, South Korea), 58, 4 (2003), 225–48.04–136Kormos, Judit & Dénes, Mariann (Eötvös Loránd U., Hungary; Email: kormos.j@chello.hu). Exploring measures and perceptions of fluency in the speech of second language learners. System (Oxford, UK), 32, 2 (2004), 145–64.04–137Lee, Jin Kyong (Seoul National U., South Korea). The acquisition process of yes/no questions by ESL learners and its pedagogical implications. English Teaching (Anseonggun, South Korea), 58, 4 (2003), 205–24.04–138Levine, Glenn S. (U. of California, Irvine, USA). Global simulation: a student-centered, task-based format for intermediate foreign language courses. Foreign Language Annals (New York, USA), 37, 1 (2004), 26–36.04–139Littlemore, Jeannette (U. of Birmingham, UK; Email: j.m.littlemore@bham.ac.uk). Using clipart and concordancing to teach idiomatic expressions. Modern English Teacher (London, UK), 13, 1 (2004), 17–44.04–140Llurda, Enric (Email: ellurda@dal.udl.es) and Huguet, Ángel (Universitat de Lleida, Spain). Self-awareness in NNS EFL Primary and Secondary school teachers. Language Awareness (Clevedon, UK), 12, 3&4 (2003), 220–33.04–141Lochtman, Katja (Vrije U., Belgium; Email: katja.lochtman@vub.ac.be). Oral corrective feedback in the foreign language classroom: how it affects interaction in analytic foreign language teaching. International Journal of Educational Research (Abingdon, UK), 37 (2002), 271–83.04–142Mackey, Alison (Georgetown U., USA; Email: mackeya@georgetown.edu). Beyond production: learners' perceptions about interactional processes. International Journal of Educational Research (Abingdon, UK), 37 (2002), 379–94.04–143Maiwald, Cordula (Passau, Germany). Zeitverstehen und Tempusformen im Deutschen – eine Herausforderung im Fremdsprachenunterricht. [The concept of time and German tenses – a challenge for a foreign language classroom] Jahrbuch Deutsch als Fremdsprache (Munich, Germany), 29 (2003), 287–302.04–144McKay, Sandra Lee (San Francisco State U., USA; Email: 2slmckay@attbi.com). EIL curriculum development. RELC Journal (Singapore), 34, 1 (2003), 31–47.04–145Na, Yoon-Hee and Kim, Sun-Joo (U. of Texas at Austin, USA; Email: yhena@mail.utexas.edu). Critical literacy in the EFL classroom. English Teaching (Anseonggun, Korea), 58, 3 (2003), 143–63.04–146Nettelbeck, David (Whitefriars College, Australia). ICT and the re-shaping of literacy. A secondary classroom perspective. English in Australia (Norwood, Australia), 139 (2004), 68–77.04–147Park, Mae-Ran (Pukyong National U., South Korea; Email: mrpark@pknu.ac.kr) and Suh, Kang-Oak. An analysis of Korean high school English textbooks under the 7th curriculum. English Teaching (Anseonggun, South Korea), 58, 4 (2003), 319–47.04–148Peters, George F. (Michigan State U., USA). Kulturexkurse: a model for teaching deeper German culture in a proficiency-based curriculum. Die Unterrichtspraxis (Cherry Hill, New Jersey, USA) 36, 2 (2003), 121–34.04–149Plewnia, Albrecht (Mannheim, Germany). Vom Nutzen kontrastiven grammatischen Wissens am Beispiel von Deutsch und Französisch. [The benefits of contrastive grammar knowledge; an example of German and French] Jahrbuch Deutsch als Fremdsprache (Munich, Germany), 29 (2003), 251–86.04–150Prodromou, Luke (Email: luke@spark.net.gr). In search of the successful user of English: how a corpus of non-native speaker language could impact on EFL teaching. Modern English Teacher (London, UK), 12, 2 (2003), 5–14.04–151Rieger, Caroline L. (U. of British Columbia, Canada). Some conversational strategies and suggestions for teaching them. Die Unterrichtspraxis (Cherry Hill, New Jersey, USA), 36, 2 (2003), 164–75.04–152Sakui, K. (U. of Auckland, New Zealand). Wearing two pairs of shoes: language teaching in Japan. ELT Journal (Oxford, UK), 58, 2 (2004), 155–63.04–153Schleppegrell, M., Achugar, M., & Oteíza, T. (University of California, USA). The grammar of history: enhancing content-based instruction through a functional focus on language. TESOL Quarterly (Alexandria, Virginia, USA), 38, 1 (2004), 67–93.04–154Sercu, Lies (Katholieke Universiteit Leuven, Belgium; Email: lies.sercu@arts.kuleuven.ac.be). Implementing intercultural foreign language education: Belgian, Danish and British teachers' professional self-concepts and teaching practices compared. Evaluation and Research in Education (Clevedon, UK), 16, 3 (2002), 150–65.04–155Shinwoong, Lee (Hanyang U., South Korea). Korean ESL learners' experiences in computer assisted classroom discussions. English Teaching (Anseonggun, Korea), 58, 4 (2003), 371–95.04–156Sifakis, Nicos C. (Hellenic Open U., Greece; Email: nicossif@hol.gr). TeachingEIL– TeachingInternationalorInterculturalEnglish? What Teachers Should Know. System (Oxford, UK), 32, 2 (2004), 237–50.04–157Simard, Daphnée (Université du Québec à Montréal, Canada; Email: simard.daphnee@uqam.ca). Using diaries to promote metalinguistic reflection among elementary school students. Language Awareness (Clevedon, UK), 13, 1 (2004), 34–48.04–158Song, Jeong-Weon (Hanyang U., South Korea). Effects of task-processing conditions on the oral output of post beginners in a narrative task. English Teaching (Anseonggun, Korea), 58, 4 (2003), 249–71.04–159Storch, Neomy (U. of Melbourne, Australia; Email: neomys@unimelb.edu.au). Relationships formed in dyadic interaction and opportunity for learning. International Journal of Educational Research (Abingdon, UK), 37 (2002), 305–22.04–160Tomlinson, Brian and Masuhara, Hitomi (Leeds Metropolitan U., UK; Email: B.Tomlinson@lmu.ac.uk). Developing cultural awareness. Modern English Teacher (London, UK), 13, 1 (2004), 5–12.04–161Towndrow, P. (Nangyang Technological U., Singapore). Reflections of an on-line tutor. ELT Journal (Oxford, UK), 58, 2 (2004), 174–82.04–162Vilches, Ma. Luz C. (Ateneo do Manila U., Philippines; Email: mvilches@ateneo.edu). Task-based language teaching: the case of EN 10. RELC Journal (Singapore), 34, 1 (2003), 82–99.04–163Willkop, Eva-Maria (Mainz, Germany). Texte im Mitteilungsprozess – Wege durch ein vereinigtes Babylon [Texts in the mediation process – ways through united Babylon] Jahrbuch Deutsch als Fremdsprache (Munich, Germany), 29 (2003), 221–50.