Academic literature on the topic 'Enzyme reagent matrix'

Enzymes serving as biocatalysts and play an important roles in many industrial field. However, the limitation of enzyme usage due to its high cost and unstable conditions of soluble enzyme to harsh conditions lead to findings an alternative to enhance the enzyme efficiency by immobilisation (insoluble enzyme). The present work reported a combination of immobilisation technique of xylanase by entrapment and covalent binding on alginate hydrogel beads. Xylanase enzyme was effectively immobilised within the support matrix, alginate hydrogel beads by entrapment and covalent binding on the surface of beads using glutaraldehyde as a cross-linked agent. The effects of support matrix comprised of sodium alginate concentration (% w/v) and calcium chloride, CaCl2 (M) were studied in order to obtain a better immobilisation yield. The suitable concentration of sodium alginate and CaCl2 to ensure a robust and stable hydrogel beads with higher immobilisation yield were formed as a support matrix for xylanase immobilisation. The analysis of xylanase activity was determined using dinitrosalicyclic (DNS) acid reagent method. Maximal enzyme immobilisation yield (>80 %) was achieved at 3.0 % w/v of sodium alginate concentration and 0.3 M of CaCl2. The study shows the support matrix of hydrogel beads gave a significant impact towards the immobilisation yield of xylanase.

In micro-arrayed compound screening (μARCS), an agarose gel is used as a reaction vessel that maintains humidity and compound location as well as being a handling system for reagent addition. Two or more agarose gels may be used to bring test compounds, targets, and reagents together, relying on the pore size of the gel matrix to regulate diffusion of reactants. It is in the microenvironment of the agarose matrix that all the components of an enzymatic reaction interact and result in inhibitable catalytic activity. In an effort to increase the throughput of μARCS-based screens, reduce the effort involved in manipulating agarose gels, and reduce costs, blotter paper was used rather than a second agarose gel to introduce a substrate to a gel containing a target enzyme. In this assay, the matrix of the blotter paper did not prevent the substrate from diffusing into the enzyme gel. The compound density of the μARCS format, the ease of manipulating sheets of paper for reagent addition, and a scheduled protocol for running multiple gels allowed for a throughput capacity of more than 200,000 tests per hour. A protease assay was developed and run in the μARCS format at a rate of 200,000 tests per hour using blotter paper to introduce the substrate. Picks in the primary screen were retested in the μARCS format at a density of 384 compounds per sheet. IC50 values were confirmed in a 96-well plate format. The screen identified several small molecule inhibitors of the enzyme. The details of the screening format and the analysis of the hits from the screen are presented.

The cell surface enzyme beta 1–4 galactosyl transferase (galtase) has been implicated in a number of cellular events involving adhesion and recognition, among them migration of neural crest and mesenchymal cells as well as initiation and elongation of neurites from PC12 cells. Results presented here demonstrate that reagents that specifically alter galtase activity modulate the rate of neurite outgrowth from chick dorsal root ganglia on substrata coated with the large extracellular matrix glycoprotein, laminin (LN), a known substrate for galtase activity. Not all neurites responded equally to reagent addition, and in every experiment a subset of neurites was ostensibly unaffected by reagent, even at the highest concentration tested. Those neurites that were affected demonstrated an ability to adapt to the continued presence of reagent and resume normal elongation. These results support the hypothesis that cell surface galtase activity plays an important role in mediating neurite elongation and suggest further that differential expression of galtase at the nerve growth cone might contribute to axonal guidance through glycoconjugate-rich environments in vivo.

<p>Xylanase is an enzyme that catalyzes the reaction of xylan hydrolysis into xylose. The free enzyme can be used only once, therefore it needs to be made in the form of immobilization. This study aims to determine the optimum conditions for immobilization of xylanase using an acid-activated zeolite. The xylanase immobilization was performed on variations of shaking time (1-5) hours, variation of xylanase concentration (2 - 4 mg / mL) using 0.1 g zeolite at room temperature and a shaking rate of 100 rpm. The amount of xylanase adsorbed on the zeolite was determined by spectrophotometry using the Biuret reagent and the immobilized xylanase activity formed was determined spectrophotometrically using a DNS reagent The results showed that the optimum condition of xylanase immobilization at zeolite was achieved at 3 hrs shaking time and xylanase concentration 3.5 mg / mL with xylanase adsorbed of 156.5 mg/g zeolite and activity 26.67 units.</p>

Abstract A new format for solid-phase immunoassays has been developed in which a monoclonal antibody-coated membrane, incorporated into a cylindrical, disposable device, regulates sample and reagent delivery. We illustrate the method with a two-site, immunoenzymometric assay that can detect human choriogonadotropin at less than 50 int. units/L (4 micrograms/L) in urine and less than 25 int. units/L (2 micrograms/L) in serum and takes less than 5 min to perform. The solid-phase antibody is located in a circular area in the center of the membrane so that in the presence of the hormone, after addition of substrate, a blue enzyme product is generated in this circular area. The high ratio of surface area to volume within the microporous matrix of the membrane assures short diffusion distances and therefore rapid binding of liquid-phase reagents to the solid phase. Pseudo-first-order reaction kinetics describe the binding of antigen to immobilized antibody and the binding of enzyme-labeled antibody to immobilized antigen. The speed and simplicity of this format may facilitate testing for many analytes, both soluble and particulate, as well as serological testing.

Commonly used methods for isolated enzyme inhibitor screening typically rely on fluorescent or chemiluminescent detection techniques that are often indirect and/or coupled assays. Mass spectrometry (MS) has been widely reported for measuring the conversion of substrates to products for enzyme assays and has more recently been demonstrated as an alternative readout system for inhibitor screening. In this report, a high-throughput mass spectrometry (HTMS) readout platform, based on the direct measurement of substrate conversion to product, is presented. The rapid ionization and desorption features of a new generation matrix-assisted laser desorption ionization-triple quadrupole (MALDI-QqQ) mass spectrometer are shown to improve the speed of analysis to greater than 1 sample per second while maintaining excellent Z′ values. Furthermore, the readout was validated by demonstrating the ability to measure IC50 values for several known kinase inhibitors against cyclic AMP—dependent protein kinase (PKA). Finally, when the assay performance was compared with a common ADPaccumulation readout system, this HTMS approach produced better signal-to-background ratios, higher Z′ values, and a reagent cost of about $0.03 per well compared with about $0.60 per well for the fluorescence assay. Collectively, these data demonstrate that a MALDI-QqQ-MS—based readout platform offers significant advantages over the commonly used assays in terms of speed, sensitivity, reproducibility, and reagent cost. ( Journal of Biomolecular Screening 2008:1007-1013)

In order to facilitate the large-scale preparation of active class II polyhydroxyalkanoate (PHA) synthase, we constructed a vector pT7-7 derivative that contains a modified phaC1 gene encoding a PHA synthase from Pseudomonas aeruginosa possessing six N-terminally fused histidine residues. Overexpression of this phaC1 gene under control of the strong Ø10 promoter was achieved in Escherichia coli BL21(DE3). The fusion protein was deposited as inactive inclusion bodies in recombinant E. coli, and contributed approx. 30% of total protein. The inclusion bodies were purified by selective solubilization, resulting in approx. 70–80% pure PHA synthase, then dissolved and denatured by 6M guanidine hydrochloride. The denatured PHA synthase was reversibly immobilized on a Ni2+-nitrilotriacetate–agarose matrix. The matrix-bound fusion protein was refolded by gradual removal of the chaotropic reagent. This procedure avoided the aggregation of folding intermediates which often decreases the efficiency of refolding experiments. Finally, the refolded fusion protein was eluted with imidazole. The purified and refolded PHA synthase protein showed a specific enzyme activity of 10.8m-units/mg employing (R/S)-3-hydroxydecanoyl-CoA as substrate, which corresponds to 27% of the maximum specific activity of the native enzyme. The refolding of the enzyme was confirmed by CD spectroscopy. Deconvolution of the spectrum resulted in the following secondary structure prediction: 10% α-helix, 50% β-sheet and 40% random coil. Gel filtration chromatography indicated an apparent molecular mass of 69kDa for the refolded PHA synthase. However, light-scattering analysis of a 10-fold concentrated sample indicated a molecular mass of 128kDa. These data suggest that the class II PHA synthase is present in an equilibrium of monomer and dimer.

The acetabular labrum is a fibrocartilaginous ring surrounding the acetabulum and is important for hip stability and contact pressure dissipation through a sealing function. Injury of the labrum may contribute to hip-joint degeneration and development of secondary osteoarthritis. Understanding how extracellular matrix (ECM) production and remodelling is regulated is of key importance for successful tissue restoration. The present study hypothesised that physiological stretching enhanced the metabolic activity and altered the ECM gene expression in labrum cells. Primary bovine labrum cells were physiologically stretched for up to 5 d. 24 h after the last stretch cycle, changes in metabolic activity were measured using the PrestoBlue™ HS Cell Viability Reagent and ECM gene expression was examined using the quantitative polymerase chain reaction method. Targets of interest were further investigated using immunofluorescence and enzyme-linked immunosorbent assay. Metabolic activity was not affected by the stretching (0.9746 ± 0.0614, p > 0.05). Physiological stretching upregulated decorin (DCN) (1.8548 ± 0.4883, p = 0.002) as well as proteoglycan 4 (PRG4) (1.7714 ± 0.6600, p = 0.029) and downregulated biglycan (BGN) (0.7018 + 0.1567, p = 0.008), cartilage oligomeric matrix protein (COMP) (0.5747 ± 0.2650, p = 0.029), fibronectin (FN1) (0.5832 ± 0.0996, p < 0.001) and spondin 1 (SPON1) (0.6282 ± 0.3624, p = 0.044) gene expression. No difference in PRG4 and DCN abundance or release could be measured. The here identified mechanosensitive targets are known to play relevant roles in tissue organisation. Therefore, physiological stretching might play a role in labrum tissue homeostasis and regeneration.

Oxidation is believed to play a role in atherosclerosis. Oxidized lipids, sterols and proteins have been detected in early, intermediate and advanced human lesions at elevated levels. The spectrum of oxidized side-chain products detected on proteins from homogenates of advanced human lesions has been interpreted in terms of the occurrence of two oxidative mechanisms, one involving oxygen-derived radicals catalysed by trace transition metal ions, and a second involving chlorinating species (HOCl or Cl2), generated by the haem enzyme myeloperoxidase (MPO). As MPO is released extracellularly by activated monocytes (and possibly macrophages) and is a highly basic protein, it would be expected to associate with polyanions such as the glycosaminoglycans of the extracellular matrix, and might result in damage being localized at such sites. In this study proteins extracted from extracellular matrix material obtained from advanced human atherosclerotic lesions are shown to contain elevated levels of oxidized amino acids [3,4-dihydroxyphenylalanine (DOPA), di-tyrosine, 2-hydroxyphenylalanine (o-Tyr)] when compared with healthy (human and pig) arterial tissue. These matrix-derived materials account for 83—96% of the total oxidized protein side-chain products detected in these plaques. Oxidation of matrix components extracted from healthy artery tissue, and model proteins, with reagent HOCl is shown to give rise to a similar pattern of products to those detected in advanced human lesions. The detection of elevated levels of DOPA and o-Tyr, which have been previously attributed to the occurrence of oxygen-radical-mediated reactions, by HOCl treatment, suggests an alternative route to the formation of these materials in plaques. This is believed to involve the formation and subsequent decomposition of protein chloramines.

In vitro diagnostic (IVD) tests are critical for making informed clinical decisions. These tests are performed outside the body using specimens such as blood, sputum, saliva, and urine. IVD tests are usually performed at centralized labs with complex and expensive instrumentation, and associated protocols. There are only a few commercially available point-of-care (POC) devices for performing IVD Tests. This thesis presents platform technologies for POC testing of three categories of IVDs: Clinical Biochemistry, Immunodiagnostics, and Molecular diagnostics. Additionally, a Biosafety Level 2+ (BSL- 2+) Mobile Laboratory was designed & developed for testing of infectious diseases at the point-of-need. Clinical biochemistry tests are quantitative tests that measure the concentration of biochemicals in body fluids. Most clinical biochemistry tests involve the testing of serum. A POC serum separation device from micro-volumes of blood using an air-displacement pipette and a chemical-preloaded disposable pipette-tip cartridge is introduced in Chapter- 2. To address the issue of reagent stabilization and room-temperature storage, trehalosebased enzyme reagent matrix (TERM) cartridge with dried reagents was developed. The cartridge was tested for triglycerides measurement in blood and found to offer good shelflife. In addition, the development of reagent kits for conducting sickle-cell disease confirmatory test at point-of-need was reported. Finally, as an alternative to conventional biochemical analyzers, a portable multi-spectral absorbance reader capable of detecting the results at POC of a wide range of clinical biochemical assays was developed and validated. Immunodiagnostics includes tests that can detect and quantify antigens and antibodies in a sample. Chapter-3 of the thesis proposes the development of platform technologies in this category based on introducing innovative (i) protocols and (ii) processes: (i) Counting target CD4+ T-Cells in blood was demonstrated using anti-CD4 antibodies conjugated to superparamagnetic iron oxide nanoparticles (SPIONs) and a commercially available haematology analyser. (ii) A bare fibre Bragg grating (bFBG) sensor-based technique is developed for pathogen detection, and demonstrated its ability in detecting E. coli in water by coating anti-E. Coli antibodies onto the bFBG sensor. Molecular diagnostics comprises of techniques that can detect the presence or modification of nucleic acid (DNA/RNA). These tests usually require sophisticated and iv expensive instruments. To address this issue, Chapter-4 reports the development of Portable PCR System: i) Isothermal Amplification Device (LAMP assays), ii) Handheld Thermal Cycler (tested for HCV & Dengue), and iii) Fluorescence Reader (tested for CoViD-19). In Chapter-5, a mobile laboratory for infectious diseases testing and reporting (MITR Lab) was conceptualized, designed, fabricated, and found to offer 100% match with static lab results in testing CoViD-19. The MITR lab is the first ICMR approved Mobile BSL2+ lab for COVID-19 testing and aided in conducting few lakh tests during the past one year. All the technologies developed as part of the thesis are validated with clinical samples and showed sensitivity and specificity above 90%. These innovative, affordable platform technologies are expected to create huge social impact by providing timely diagnoses at the point-of-need.

Introdução: O câncer de mama (CM) é o segundo tipo de câncer mais frequente entre as mulheres, sendo responsável por 66.280 novos casos no ano passado. Biomarcadores são parâmetros biológicos que refletem desequilíbrios moleculares provenientes de patologias, colaborando com exames laboratoriais. A metaloproteinase de matriz 2 (MMP-2) é uma enzima que digere a matriz extracelular e responde à alterações moleculares, sendo que em células cancerígenas sua expressão é aumentada. Sua presença no soro e tecido de pacientes com câncer mamário pode indicar invasão tumoral. Objetivos: Confeccionar primers para detecção da expressão de MMP-2 em linhagem de células tumorais de mama. Materiais e métodos: A partir de levantamento bibliográfico no GenBank do gene da MMP-2 humana foram confeccionados primers para a realização da metodologia de PCR em tempo real. Os softwares IDT e Primer 3 foram os escolhidos para confecção dos primers forward e reverse. Após a confecção, os primers foram avaliados quanto aos parâmetros de reação e afinidade pelo gene alvo utilizando as plataformas Clustal Omega, IDT Tools e BLAST, para obtenção do melhor par de primers. Resultados: Foram confeccionados 5 pares de primers para MMP-2 e, após avaliação, foi selecionado o par de primers a seguir: GCAGCTCCTTACCAACCAGT e GGGGAGAGAGGGAAGGATGT. Conclusão: A etapa de confecção de primers é importante, pois a simulação em computador muitas vezes acaba se demonstrando diferente da reação in vitro. Portanto, quanto mais rigor na avaliação dos parâmetros de reação, maior chance de se obter um par de primers que apresente bom desempenho nas reações, poupando perda de tempo e de reagentes. A partir da confecção dos primers realizada neste trabalho, espera-se que os mesmo apresentem sensibilidade e especificidade suficientes para garantir que o produto formado durante a amplificação seja realmente a sequência esperada, confirmando que a etapa de confecção foi conduzida adequadamente.