To see the other types of publications on this topic, follow the link: Energy metabolism; Hypoxia; Erythropoietin.
Journal articles on the topic 'Energy metabolism; Hypoxia; Erythropoietin'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Energy metabolism; Hypoxia; Erythropoietin.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
EBERT, Benjamin L., Jonathan M. GLEADLE, John F. O'ROURKE, Sylvia M. BARTLETT, Jo POULTON, and Peter J. RATCLIFFE. "Isoenzyme-specific regulation of genes involved in energy metabolism by hypoxia: similarities with the regulation of erythropoietin." Biochemical Journal 313, no. 3 (February 1, 1996): 809–14. http://dx.doi.org/10.1042/bj3130809.
Full textAbstract:
Recent studies have indicated that regulatory mechanisms underlying the oxygen-dependent expression of the haematopoietic growth factor erythropoietin are widely operative in non-erythropoietin-producing cells and are involved in the regulation of other genes. An important characteristic of this system is that the inducible response to hypoxia is mimicked by exposure to particular transition metals such as cobaltous ions, and by iron chelation. We have investigated the extent of operation of this system in the regulation of a range of genes concerned with energy metabolism. The effects of hypoxia (1% oxygen), cobaltous ions and desferrioxamine on gene expression in tissue-culture cells was studied using RNase protection assays. Hypoxia induced the expression of glucose transporters in an isoform-specific manner; GLUT-1 and GLUT-3 were induced by hypoxia, whereas expression of GLUT-2 was decreased. Isoenzyme-specific regulation by hypoxia was also observed for genes encoding phosphofructokinase, aldolase and lactate dehydrogenase. For all of these genes, responses to cobaltous ions and desferrioxamine correlated in both direction and magnitude with the response to hypoxia. In contrast, a reduction in mitochondrial transcripts was observed in hypoxia, but these changes were not mimicked by either cobaltous ions or desferrioxamine. These findings indicate that similarities with erythropoietin regulation extend to the oxygen-dependent regulation of genes encoding glucose transporters and glycolytic enzymes but not to the regulation of mitochondrial transcripts, and they show that in glucose metabolism regulation by this system is isoenzyme- or isoform-specific.
2
Ratcliffe, P. J., J. F. O'Rourke, P. H. Maxwell, and C. W. Pugh. "Oxygen sensing, hypoxia-inducible factor-1 and the regulation of mammalian gene expression." Journal of Experimental Biology 201, no. 8 (April 1, 1998): 1153–62. http://dx.doi.org/10.1242/jeb.201.8.1153.
Full textAbstract:
A great many aspects of the anatomy and physiology of large animals are constrained by the need to match oxygen supply to cellular metabolism and appear likely to involve the regulation of gene expression by oxygen. Some insight into possible underlying mechanisms has been provided by studies of erythropoietin, a haemopoietic growth factor which stimulates red cell production in response to hypoxia. Studies of hypoxia-inducible cis-acting sequences from the erythropoietin gene have led to the recognition of a widespread transcriptional response to hypoxia based on the activation of a DNA-binding complex termed hypoxia-inducible factor-1 (HIF-1). Perturbation of the transcriptional response by particular transition metal ions, iron chelators and certain redox-active agents have suggested a specific oxygen sensing mechanism, perhaps involving a haem protein in a flavoprotein/cytochrome system. In addition to erythropoietin, HIF-1-responsive genes include examples with functions in cellular energy metabolism, iron metabolism, catecholamine metabolism, vasomotor control and angiogenesis, suggesting an important role in the coordination of oxygen supply and cellular metabolism. In support of this, we have demonstrated an important role for HIF-1 in tumour angiogenesis. HIF-1 itself consists of a heterodimer of two basic-helix-loop-helix proteins of the PAS family, termed HIF-1alpha and HIF-1beta, although other closely related members of this family may also contribute to the response to hypoxia. We have fused domains of HIF-1 genes to heterologous transcription factors to assay for regulatory function. These experiments have defined several domains in HIF-1alpha which can independently confer the hypoxia-inducible property, and they suggest a mechanism of HIF-1 activation in which post-translational activation/derepression of HIF-1alpha is amplified by changes in HIF-1alpha abundance most probably arising from suppression of proteolytic breakdown. Pursuit of the mechanism(s) underlying these processes should ultimately lead to better definition of the oxygen-sensing process.
3
Hubbi, Maimon E., and Gregg L. Semenza. "Regulation of cell proliferation by hypoxia-inducible factors." American Journal of Physiology-Cell Physiology 309, no. 12 (December 15, 2015): C775—C782. http://dx.doi.org/10.1152/ajpcell.00279.2015.
Full textAbstract:
Hypoxia is a physiological cue that impacts diverse physiological processes, including energy metabolism, autophagy, cell motility, angiogenesis, and erythropoiesis. One of the key cell-autonomous effects of hypoxia is as a modulator of cell proliferation. For most cell types, hypoxia induces decreased cell proliferation, since an increased number of cells, with a consequent increase in O2 demand, would only exacerbate hypoxic stress. However, certain cell populations maintain cell proliferation in the face of hypoxia. This is a common pathological hallmark of cancers, but can also serve a physiological function, as in the maintenance of stem cell populations that reside in a hypoxic niche. This review will discuss major molecular mechanisms by which hypoxia regulates cell proliferation in different cell populations, with a particular focus on the role of hypoxia-inducible factors.
4
Rankin, Erinn B., Jennifer Rha, Mary A. Selak, Travis L. Unger, Brian Keith, Qingdu Liu, and Volker H. Haase. "Hypoxia-Inducible Factor 2 Regulates Hepatic Lipid Metabolism." Molecular and Cellular Biology 29, no. 16 (June 15, 2009): 4527–38. http://dx.doi.org/10.1128/mcb.00200-09.
Full textAbstract:
ABSTRACT In mammals, the liver integrates nutrient uptake and delivery of carbohydrates and lipids to peripheral tissues to control overall energy balance. Hepatocytes maintain metabolic homeostasis by coordinating gene expression programs in response to dietary and systemic signals. Hepatic tissue oxygenation is an important systemic signal that contributes to normal hepatocyte function as well as disease. Hypoxia-inducible factors 1 and 2 (HIF-1 and HIF-2, respectively) are oxygen-sensitive heterodimeric transcription factors, which act as key mediators of cellular adaptation to low oxygen. Previously, we have shown that HIF-2 plays an important role in both physiologic and pathophysiologic processes in the liver. HIF-2 is essential for normal fetal EPO production and erythropoiesis, while constitutive HIF-2 activity in the adult results in polycythemia and vascular tumorigenesis. Here we report a novel role for HIF-2 in regulating hepatic lipid metabolism. We found that constitutive activation of HIF-2 in the adult results in the development of severe hepatic steatosis associated with impaired fatty acid β-oxidation, decreased lipogenic gene expression, and increased lipid storage capacity. These findings demonstrate that HIF-2 functions as an important regulator of hepatic lipid metabolism and identify HIF-2 as a potential target for the treatment of fatty liver disease.
5
Haase, Volker H. "Hypoxia-inducible factors in the kidney." American Journal of Physiology-Renal Physiology 291, no. 2 (August 2006): F271—F281. http://dx.doi.org/10.1152/ajprenal.00071.2006.
Full textAbstract:
Tissue hypoxia not only occurs under pathological conditions but is also an important microenvironmental factor that is critical for normal embryonic development. Hypoxia-inducible factors HIF-1 and HIF-2 are oxygen-sensitive basic helix-loop-helix transcription factors, which regulate biological processes that facilitate both oxygen delivery and cellular adaptation to oxygen deprivation. HIFs consist of an oxygen-sensitive α-subunit, HIF-α, and a constitutively expressed β-subunit, HIF-β, and regulate the expression of genes that are involved in energy metabolism, angiogenesis, erythropoiesis and iron metabolism, cell proliferation, apoptosis, and other biological processes. Under conditions of normal Po2, HIF-α is hydroxylated and targeted for rapid proteasomal degradation by the von Hippel-Lindau (VHL) E3-ubiquitin ligase. When cells experience hypoxia, HIF-α is stabilized and either dimerizes with HIF-β in the nucleus to form transcriptionally active HIF, executing the canonical hypoxia response, or it physically interacts with unrelated proteins, thereby enabling convergence of HIF oxygen sensing with other signaling pathways. In the normal, fully developed kidney, HIF-1α is expressed in most cell types, whereas HIF-2α is mainly found in renal interstitial fibroblast-like cells and endothelial cells. This review summarizes some of the most recent advances in the HIF field and discusses their relevance to renal development, normal kidney function and disease.
6
CHUN, Yang-Sook, Eunjoo CHOI, Tae-You KIM, Myung-Suk KIM, and Jong-Wan PARK. "A dominant-negative isoform lacking exons 11 and 12 of the human hypoxia-inducible factor-1α gene." Biochemical Journal 362, no. 1 (February 8, 2002): 71–79. http://dx.doi.org/10.1042/bj3620071.
Full textAbstract:
Hypoxia-inducible factor-1α (HIF-1α), a member of the transcription family characterized by a basic helix-loop-helix (bHLH) domain and a PAS domain, regulates the transcription of hypoxia-inducible genes involved in erythropoiesis, vascular remodelling and glucose/energy metabolism. It contains bHLH/PAS domains in the N-terminal half, and a nuclear localization signal (NLS) and two transactivation domains (TADs) in the C-terminal half. It also has an oxygen-dependent degradation (ODD) domain, which is required to degrade HIF-1α protein by the ubiquitin—proteasome pathway. In this study, we identified a new alternatively spliced variant of human HIF-1α mRNA, which lacked both exons 11 and 12, producing a frame shift and giving a shorter form of HIF-1α. In the corresponding protein, a part of the ODD domain, both TADs and the C-terminal NLS motif were missing. Expression of endogenous HIF-1α variant protein was identified using immunoprecipitation and immunoblotting methods. The expressed HIF-1α variant exhibited neither the activity of transactivation nor hypoxia-induced nuclear translocation. In contrast with HIF-1α, the variant was strikingly stable in normoxic conditions and not up-regulated to such an extent by hypoxia, cobalt ions or desferrioxamine. It was also demonstrated that the HIF-1α variant competed with endogenous HIF-1α and suppressed HIF-1 activity, resulting in the down-regulation of mRNA expression of hypoxia-inducible genes. The association of the variant and arylhydrocarbon receptor nuclear translocator in the cytoplasm may be related to the inhibition of HIF-1 activity. It is assumed that this isoform preserves the balance between aerobic and anaerobic metabolism by counteracting the overaction of HIF-1α.
7
Liu, Hong, Rongrong Liu, Travis Nemkov, Jacob Couturier, Long Liang, Anren Song, Shushan Zhao, et al. "Adenosine A2B Receptor Controls Erythroid Lineage Commitment in Stress Erythropoiesis By Promoting Metabolic Reprogramming." Blood 132, Supplement 1 (November 29, 2018): 845. http://dx.doi.org/10.1182/blood-2018-99-114075.
Full textAbstract:
Abstract Insufficient oxygen availability under stress conditions including hypoxia and anemia is a major stimulus for stress erythropoiesis. Adenosine is known to be induced under hypoxia and energy depletion. Increased adenosine signaling via its specific receptors regulates multiple cellular functions including anti-inflamation, anti-vascular leakage and vasodilation. However, its function in stress erythropoiesis and underlying mechanisms are enigmatic. Among four adenosine receptors, we report that adenosine A2B receptor (ADORA2B) is expressed at a significant higher level in megakaryocyte-erythroid progenitor (MEP) compared to common pluoripotent progenitors (CMP) or granulocyte-erythroid progenitor (GMP) in undifferentiated human CD34+. To determine the function role of ADORA2B in stress erythropoiesis, we generated erythroid Adora2b specific knockouts by crossing Adora2bf/fmice with EpoR-Cre+mice. First, we demonstrated that EpoR specifically ablated ADORA2B gene only in MEP but not in CMP or GMP lineages. Next, we challenged EpoR-Cre+mice (control) and Adora2bf/fEpoR-Cre+ mice (erythroid specific ablation of Adora2b genes) with hypoxia. We discovered that genetic deletion of ADORA2B at MEP stage blocked erythroid vs myeloid commitment under hypoxia-induced stress erythropoiesis. Further metabolic profiling revealed that ADORA2B activation regulated erythroid lineage commitment by promoting glucose uptake and erythroid metabolic reprogramming channelling glucose metabolism toward the pentose phosphate pathway (PPP) rather than glycolysis to generate more ribose phosphate as well as facilitate glutamine uptake to serve as a nitrogen donor for de novo nucleotide biosynthesis. Meanwhile, ADORA2B-stimulated glutaminolysis increased TCA cycle intermediates and thus increased energy production under stress erythropoiesis. We further demonstrated that ADORA2B on MEP is also important for erythroid commitment in response to PHZ-induced mouse model. Followup studies revealed that HIF-1a is induced in erythroid progenitors in a ADORA2B-dependent manner and ablation of HIF-1a only in MEP but not in CMP or GMP attenuated erythroid lineage commitment in both hypoxia-induced and anemia-induced stress erythropoiesis mouse models. Moreover, we showed that ADORA2B-triggered metabolic reprogramming depended on HIF-1a-preferentially upregulated gene expression of transporters for glucose and glutamine and key enyzmes of PPP and glutaminolysis over glycolytic enzymes. Similar to mouse studies, in cultured Epo-stimulated human CD34+ hematopoietic stem progenitor cells, enhancing ADORA2B signaling induced gene expression of the transporters for glucose and glutamine, key enzymes of PPP and glutaminolysis over glycolysis and thus controlled the commitment to erythrioid versus myeloid lineage and in turn promoted erythroid colony formation including BFU-E, CFU-E versus CFU-GM. Further studies showed that inhibition of HIF-1a by Chrysin significantly attenuated ADORA2B activation-induced upregulation of gene expression of the transporters of glucose and glutamine, metabolic enzymes and thus reduces erythroic commitment and BFU-E and CFU-E in Epo-stimualted CD34+ HPSCs. Overall, using multidisciplinary approaches including mouse genetics, metabolomics, isotopically labelled glucose and glutamine flux analysis, human CD34+ HPSCs and pharmacological studies, we provide both mouse and human evidence that ADORA2B is a missing cofactor controlling erythroid lineage commitment in stress erythropoiesis via HIF-1a-dependent upregulation of key genes to promote metabolic reprogramming. These findings add significant new insights to erythroid commitment and immediately provide new strategies for regulating stress erythropoiesis. Disclosures Nemkov: Omix Technologies inc: Equity Ownership.
8
Baek, Jin H., Ye V. Liu, Karin R. McDonald, Jacob B. Wesley, Huafeng Zhang, and Gregg L. Semenza. "Spermidine/Spermine N1-Acetyltransferase-1 Binds to Hypoxia-inducible Factor-1α (HIF-1α) and RACK1 and Promotes Ubiquitination and Degradation of HIF-1α." Journal of Biological Chemistry 282, no. 46 (September 17, 2007): 33358–66. http://dx.doi.org/10.1074/jbc.m705627200.
Full textAbstract:
Hypoxia-inducible factor-1 (HIF-1) is a master regulator of oxygen homeostasis that controls the expression of genes encoding proteins that play key roles in angiogenesis, erythropoiesis, and glucose/energy metabolism. The stability of the HIF-1α subunit is regulated by ubiquitination and proteasomal degradation. In aerobic cells, O2-dependent prolyl hydroxylation of HIF-1α is required for binding of the von Hippel-Lindau tumor suppressor protein VHL, which then recruits the Elongin C ubiquitin-ligase complex. SSAT2 (spermidine/spermine N-acetyltransferase-2) binds to HIF-1α and promotes its ubiquitination/degradation by stabilizing the interaction of VHL and Elongin C. Treatment of cells with heat shock protein HSP90 inhibitors induces the degradation of HIF-1α even under hypoxic conditions. HSP90 competes with RACK1 for binding to HIF-1α, and HSP90 inhibition leads to increased binding of RACK1, which recruits the Elongin C ubiquitin-ligase complex to HIF-1α in an O2-independent manner. In this work, we demonstrate that SSAT1, which shares 46% amino acid identity with SSAT2, also binds to HIF-1α and promotes its ubiquitination/degradation. However, in contrast to SSAT2, SSAT1 acts by stabilizing the interaction of HIF-1α with RACK1. Thus, the paralogs SSAT1 and SSAT2 play complementary roles in promoting O2-independent and O2-dependent degradation of HIF-1α.
9
Zhang, Xu, Jihyun Song, Binal N. Shah, Galina Miasnikova, Adelina Sergeyeva, Victor R. Gordeuk, and Josef T. Prchal. "Altered Blood Gene Transcription in Chuvash Polycythemia and Its Cell Lineage Specificity." Blood 128, no. 22 (December 2, 2016): 1244. http://dx.doi.org/10.1182/blood.v128.22.1244.1244.
Full textAbstract:
Abstract Chuvash polycythemia (CP) is a monogenic disorder characterized by an upregulated hypoxic response at normoxia. Homozygosity for the VHLR200W mutation leads to decreased degradation of the a subunits of hypoxia inducible factor (HIF)-1 and HIF-2 by the hypomorphic variant of VHL, the principal negative regulator of HIFs. An array of HIF-regulated genes, including the principal regulators of erythropoiesis and iron metabolism, have altered expression. Previous studies in CP using peripheral blood mononuclear cells (PBMCs), a heterogeneous mixture of cells, identified significant gene expression differences from wild type controls, but the cell linage specificity of these hypoxia-regulated genes remains unknown. In this study, we systematically analyzed gene expression by unbiased deep RNA sequencing in purified reticulocytes, granulocytes and platelets of CP and control individuals living at the same altitude of ~200 meters. Thirty-one samples passed quality control: reticulocytes from 10 individuals (5 VHLR200W homozygotes and 5 wild type controls), platelets from 7 individuals (3 VHL homozygotes and 4 controls) and granulocytes from 14 individuals (5 VHL homozygotes, 1 heterozygote and 8 controls). The samples were analyzed for expression differences (VHL homozygote/heterozygote versus wild type) in each cell type. We found abundant gene expression differences in these three cell types. The differential genes detected in the three cell types showed no more overlap than expected by random (Binomial test P=1 for all pairings of the three cell types), suggesting cell lineage specificity of hypoxic gene expression in CP. At 5% false discovery rate (FDR, i.e., <5 false positives in 100 detected genes), 737 of 7238 analyzed genes (10%) were altered in the reticulocytes of VHLR200W homozygotes, 271 up-regulated and 466 down-regulated. The up-regulated genes were enriched in pathways of "Telomere maintenance", "Oxidative phosphorylation", "Parkinson's disease", "Ribosome", "Systemic lupus erythematosis", "Apoptosis", "Influenza Infection", "Metabolism of proteins", "Huntington's disease", and "Integration of energy metabolism". The down-regulated genes were enriched in pathways of "Cell cycle" and "Ubiquitin mediated proteolysis". At 5% FDR, 3646 of 12,334 analyzed genes (30%) were differentially expressed in the platelets of VHLR200W homozygotes, 1830 up-regulated and 1816 down-regulated. The up-regulated genes were enriched in pathways of "Lysosome" and "Signaling in immune system". The down-regulated genes were enriched in pathways of "Hemostasis" and "Opioid signaling". At 5% FDR, 3423 of 11,274 analyzed genes (30%) were differentially expressed in the granulocytes of VHLR200W homozygotes, 1490 up-regulated and 1933 down-regulated. The up-regulated genes were enriched in pathways of "Gene Expression", "Metabolism of nucleotides", "Metabolism of proteins", and "Aminoacyl-tRNA biosynthesis". The down-regulated genes were highly enriched in immune pathways including "Chemokine signaling pathway", "Fc gamma R-mediated phagocytosis", "Endocytosis", "Neurotrophin signaling pathway", "B cell receptor signaling pathway", "Fc epsilon RI signaling pathway", as well as several cancer-related pathways. The relative abundance of alternative transcript isoforms differed in VHLR200W homozygotes relative to wild type controls for many genes in these three blood lineages indicating a role for HIFs in regulation of mRNA processing. At 1% FDR, 3121 of 12,514 analyzed genes (25%) in platelets, 233 of 7342 analyzed genes (3%) in reticulocytes, and 224 of 11,306 analyzed genes (2%) in granulocytes contained alternative exon(s) in VHLR200W homozygotes compared to wild type controls. In conclusion, we report marked gene expression variation in three blood cell lineages from individuals with CP, the first described disorder of congenital augmentation of hypoxia sensing. Dysregulated expression of genes not known to be transcriptionally regulated by HIFs may be due to the well-known but poorly defined effects of HIFs on epigenetic regulation of transcription. Our results demonstrate extensive cell lineage specificity in blood gene expression variations induced by augmented signaling of HIFs caused by the VHLR200W mutation. This provides novel insights to our understanding of clinical complications in CP and more broadly of hypoxic gene regulation. Disclosures No relevant conflicts of interest to declare.
10
Fan, Lihong, Jia Li, Zefeng Yu, Xiaoqian Dang, and Kunzheng Wang. "The Hypoxia-Inducible Factor Pathway, Prolyl Hydroxylase Domain Protein Inhibitors, and Their Roles in Bone Repair and Regeneration." BioMed Research International 2014 (2014): 1–11. http://dx.doi.org/10.1155/2014/239356.
Full textAbstract:
Hypoxia-inducible factors (HIFs) are oxygen-dependent transcriptional activators that play crucial roles in angiogenesis, erythropoiesis, energy metabolism, and cell fate decisions. The group of enzymes that can catalyse the hydroxylation reaction of HIF-1 is prolyl hydroxylase domain proteins (PHDs). PHD inhibitors (PHIs) activate the HIF pathway by preventing degradation of HIF-αvia inhibiting PHDs. Osteogenesis and angiogenesis are tightly coupled during bone repair and regeneration. Numerous studies suggest that HIFs and their target gene, vascular endothelial growth factor (VEGF), are critical regulators of angiogenic-osteogenic coupling. In this brief perspective, we review current studies about the HIF pathway and its role in bone repair and regeneration, as well as the cellular and molecular mechanisms involved. Additionally, we briefly discuss the therapeutic manipulation of HIFs and VEGF in bone repair and bone tumours. This review will expand our knowledge of biology of HIFs, PHDs, PHD inhibitors, and bone regeneration, and it may also aid the design of novel therapies for accelerating bone repair and regeneration or inhibiting bone tumours.
11
Baron, Margaret H., Joan Isern, Stuart T. Fraser, Zhiyong He, Avi Ma'ayan, Vincent P. Schulz, David Tuck, and Patrick G. Gallagher. "Primitive Erythroid Progenitors Are Regulated by Hypoxia and Display An Aerobic Glycolytic Metabolic Profile,." Blood 118, no. 21 (November 18, 2011): 3159. http://dx.doi.org/10.1182/blood.v118.21.3159.3159.
Full textAbstract:
Abstract Abstract 3159 Primitive erythroblasts (EryP) are the first cell type specified from mesodermal progenitors in the mammalian embryo. They are found in the mouse yolk sac from embryonic day (E) ∼E7.5–8.5 and, as circulation initiates, they begin to differentiate to erythroblasts that enter the bloodstream and continue to mature in a stepwise, synchronous fashion until their enucleation several days later. We have purified these first hematopoietic-committed progenitors from staged embryos based on the expression of a nuclear GFP transgene that is expressed specifically within the EryP lineage as early as E7.5. Genome-wide expression profiling allowed us to define the transcriptome from each stage of development and revealed highly dynamic changes during the progression from progenitor to maturing erythroblast. We focused on the emergence of EryP progenitors in the yolk sac and on the transition to circulation stage, when progenitor activity is lost and a peak is observed in the number of genes whose expression changes. TRANSFAC analysis of promoters of differentially expressed genes allowed us to identify candidate transcriptional regulators, some of which have not previously been implicated in erythroid development (e.g. Nkx3.1, known previously as a regulator of prostate stem cells). We designed experiments to test predictions from our microarray analysis and found that EryP progenitor numbers are regulated by TGF-beta1 and hypoxia. In most mammalian cells, the response to hypoxia is mediated by the transcription factor HIF-1. Hif-1 is apparently not expressed in EryP. Howver, Hif3a/Ipas, a Hif-1 target gene that encodes a dominant negative regulator of HIFs and that is thought to function as a feedback regulator in response to hypoxia, is expressed in EryP as early as E7.5 and is upregulated as the cells mature. These findings suggest that the response to hypoxia by EryP may involve a pathway that is distinct from that of most other cells. EryP progenitors express genes associated with aerobic glucose metabolism (the Warburg effect), a phenotype characteristic of cancer and other rapidly proliferating cells. Whether this glycolytic profile reflects the energy needs of these cells or a more unique feature of primitive erythropoiesis is under investigation. Currently we are using computational methods to identify transcription factor (ChEA, ChIP Enrichment Analysis) and kinase (KEA, Kinase Enrichment Analysis) networks that may play a role in the regulation of primitive erythroid development. This study is the first lineage specific transcription profiling of a differentiating cell type in the early mouse embryo and will provide a strong basis for future work on normal erythropoiesis throughout ontogeny. It may also help guide efforts to direct the differentiation of stem/progenitor and cells of other lineages to an erythroid cell fate. Disclosures: No relevant conflicts of interest to declare.
12
Davey, Cristina, Alan Lill, and John Baldwin. "Variation during breeding in parameters that influence blood oxygen carrying capacity in shearwaters." Australian Journal of Zoology 48, no. 4 (2000): 347. http://dx.doi.org/10.1071/zo00047.
Full textAbstract:
Parameters that influence blood oxygen carrying capacity (whole-blood haemoglobin content, haematocrit and red blood cell count) were measured in samples of 30 breeding, adult short-tailed shearwaters (Puffinus tenuirostris) on Phillip Island, Victoria at seven key stages of their reproductive cycle. The aim of the investigation was to determine whether variation in blood oxygen carrying capacity during the birds’ 7-month breeding cycle was correlated with variation in the energy demands they experienced or was an incidental by-product of other physiological changes. All the blood parameters varied significantly during breeding, but the pattern of variation was only partly correlated with the likely pattern of changing energy demand imposed on parents by their schedule of breeding activities. The main trend conceivably related to energy demand was that significantly higher values were recorded for these blood parameters during the nestling stage than earlier in the breeding cycle. This could have reflected the high costs of the very long foraging trips undertaken by parents feeding nestlings, but it could also have occurred in preparation for the long migration undertaken soon after breeding finished. It involved an ~10% increase in blood oxygen carrying capacity above the lowest mean value recorded during the breeding cycle and so other mechanisms must also be employed to achieve the increase in aerobic metabolism likely to be required at this stage. The lack of adjustment of blood oxygen carrying capacity to energy demand early in the breeding cycle suggests that either oxygen delivery was not a rate-limiting process for aerobic metabolism at that time or that delivery was enhanced through other mechanisms. At egg laying, females had a lower haematocrit and erythrocyte count than males, which could be attributable to either estrogenic suppression of erythropoiesis or an increase in osmotic pressure of the blood associated with yolk synthesis. Immature, non-breeding birds attending the colony were of similar mass to adults, but did not show the increase in the parameters determining blood oxygen carrying capacity that occurred in adults later in the breeding cycle. Factors other than changing energy requirements (dehydration, burrow hypoxia and differential responsiveness to capture stress) that might have influenced the pattern of variation in blood oxygen carrying capacity of adults during breeding are discussed.
13
Zhou, X. J., and N. D. Vaziri. "Erythropoietin metabolism and pharmacokinetics in experimental nephrosis." American Journal of Physiology-Renal Physiology 263, no. 5 (November 1, 1992): F812—F815. http://dx.doi.org/10.1152/ajprenal.1992.263.5.f812.
Full textAbstract:
We studied erythropoietin (EPO) metabolism, regulation, and pharmacokinetics in rats with nephrotic syndrome. Sprague-Dawley rats were randomized into nephrotic (puromycin-induced) and pair-fed control groups. Animals were studied at baseline and after induction of anemia or exposure to hypobaric conditions (32 cmHg). The nephrotic group showed a reduced hematocrit (P < 0.05), a significant urinary EPO excretion, and an inappropriately low plasma EPO. Induction of anemia and exposure to hypoxia resulted in a less pronounced elevation of plasma EPO in the nephrotic group than in the control group (P < 0.05). The blunted plasma EPO response to hypoxia in nephrotic animals was associated with a marked rise in urinary EPO excretion. Pharmacokinetic studies following intravenous injection of recombinant EPO, 100 U/kg, revealed a shorter plasma half-life (t1/2) (P < 0.05), larger apparent volume of distribution (P < 0.05), and greater clearance (P < 0.02) in the nephrotic group than in the controls. Estimated endogenous EPO production rate in nephrotic rats with severe anemia was significantly lower (P < 0.05) than that of equally anemic controls. Thus puromycin-induced nephrotic syndrome is associated with marked urinary loss of EPO, relatively depressed plasma EPO response to anemia and hypoxia, as well as reduced plasma t1/2, increased volume of distribution, and clearance of exogenous EPO.
14
Yoon, Donghoon, Prem Ponka, and Josef T. Prchal. "Hypoxia. 5. Hypoxia and hematopoiesis." American Journal of Physiology-Cell Physiology 300, no. 6 (June 2011): C1215—C1222. http://dx.doi.org/10.1152/ajpcell.00044.2011.
Full textAbstract:
Our understanding of organismal responses to hypoxia has stemmed from studies of erythropoietin regulation by hypoxia that led to the discovery of the master regulator of the hypoxic response, i.e., hypoxia-inducible factor (HIF). This is a transcription factor that is now known to induce the expression of a battery of genes in response to hypoxia. HIF-1 and HIF-2 regulate many genes that are involved in erythropoiesis and iron metabolism, which are essential for tissue oxygen delivery.
15
GUTIERREZ, GUILLERMO. "Cellular energy metabolism during hypoxia." Critical Care Medicine 19, no. 5 (May 1991): 619–26. http://dx.doi.org/10.1097/00003246-199105000-00008.
Full text
16
Haase, Volker H. "Hypoxic regulation of erythropoiesis and iron metabolism." American Journal of Physiology-Renal Physiology 299, no. 1 (July 2010): F1—F13. http://dx.doi.org/10.1152/ajprenal.00174.2010.
Full textAbstract:
The kidney is a highly sensitive oxygen sensor and plays a central role in mediating the hypoxic induction of red blood cell production. Efforts to understand the molecular basis of oxygen-regulated erythropoiesis have led to the identification of erythropoietin (EPO), which is essential for normal erythropoiesis and to the purification of hypoxia-inducible factor (HIF), the transcription factor that regulates EPO synthesis and mediates cellular adaptation to hypoxia. Recent insights into the molecular mechanisms that control and integrate cellular and systemic erythropoiesis-promoting hypoxia responses and their potential as a therapeutic target for the treatment of renal anemia are discussed in this review.
17
Shestakova, Anna, Felipe Lorenzo, Tsewang Tashi, Lucie Lanikova, Carl T. Wittwer, and Josef T. Prchal. "Tibetan PHD2D4E High Altitude Adapted Gene Can be Rapidly Detected By High Resolution Melting Assay." Blood 124, no. 21 (December 6, 2014): 4875. http://dx.doi.org/10.1182/blood.v124.21.4875.4875.
Full textAbstract:
Abstract High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensatory physiological responses mediated by hypoxia-inducible factors (HIFs) that regulate erythropoiesis, iron and energy metabolism, and other essential organismal responses. Excessive HIF responses occurring at high altitude may be accompanied by morbidity (polycythemia and pulmonary hypertension) or mortality (brain and pulmonary edema). HIFs are down regulated by two principal factors, i.e. prolyl hydroxylases (PHDs) and von Hippel Lindau proteins (VHL). Tibetans have lived at 3,000-5,000 meters for approximately 20,000 years and have acquired a number of beneficial genetic adaptations which appear to prevent negative responses to hypoxia at high-altitude. Deciphering these genetic changes is crucial to improve our understanding of the underlying hypoxia-mediated response mechanisms and to develop targeted therapies. We recently identified the first Tibetan-specific mutation, PHD2D4E, caused by a missense mutation (rs186996510) in EGLN1. PHD2D4E has an allelic frequency of ~85% in Tibetans and a low Km for oxygen, accounting for the protection of Tibetans from high-altitude polycythemia. Other effects of PHD2D4E on HIF-regulated pathophysiology remain to be delineated. A 77% GC-rich area surrounds rs186996510, resulting in a low success rate of detecting the mutation by Sanger sequencing or next-generation sequencing. PHD2D4E was unreported in published whole-genome analyses of Tibetans (Xin Yi et. al. Science 2010). Here we describe a high-resolution melting assay of a small PCR product for targeted genotyping of rs186996510. The single base-pair change (G to C) is visualized by melting small amplicons in the presence of a fluorescent DNA-binding dye. Heterozygotes are differentiated from homozygous genotypes by a pronounced change in the shape of the melting curve caused by the formation of heteroduplexes. However, wild type and homozygous variants are difficult to distinguish by melting alone, and require an additional step of a second melting analysis after mixing with known wild type DNA. Upon melting these mixtures, homozygotes appear as heterozygous melting curves, while wild type genotypes will remain wild type (Figure 1). We developed and validated a high resolution melting assay for rapid genotyping of PHD2D4E suitable for population and disease association studies. In our ongoing analyses, we genotyped DNA from over 300 Tibetans residing at sea level, 1300 meters, 1730-2300 meters and 4320 meters, and are correlating the allelic frequency of PHD2D4E with hematocrit levels. The high resolution melting assay for genotyping PHD2D4E is a simple, accurate, rapid, and inexpensive approach to identify SNP-targeted mutations, especially suitable for a large number of samples such as needed for population studies, without the expense and time required for sequencing studies. Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Disclosures Wittwer: BioFire Diagnostics: Aspects of melting analysis Patents & Royalties, Membership on an entity's Board of Directors or advisory committees, Research Funding.
18
D’Anna, María Cecilia, and Marta Elena Roque. "Physiological focus on the erythropoietin–hepcidin–ferroportin axis." Canadian Journal of Physiology and Pharmacology 91, no. 5 (May 2013): 338–45. http://dx.doi.org/10.1139/cjpp-2012-0214.
Full textAbstract:
To analyze the interconnection between erythropoiesis and iron metabolism, one of the issues raised in this study was to know iron bioavailability under physiopathological conditions. Our aim was to understand the functional axis response composed of erythropoietin (Epo)—hepcidin—ferroportin (FPN), when 2 dysfunctional states coexist, using an animal model of iron overload followed by hypoxia. FPN and prohepcidin were assessed by immunohistochemistry using rabbit anti-mouse FPN polyclonal and prohepcidin monoclonal antibodies. Goat-labeled polymer − horseradish peroxidase anti-rabbit EnVision + System (DAB) was used as the secondary antibody. Epo levels were measured by ELISA. Tissue iron was studied by Prussian blue iron staining. Erythropoietic response was assessed using conventional hematological tests. Iron overload increased prohepcidin that remained high in hypoxia, coexisting with high levels of Epo in hypoxia, with or without iron overload. In hypoxia, FPN was clearly evident in reticuloendothelial macrophages, more than in hypoxia with iron overload. Interestingly, duodenal FPN was clearly identified on the basolateral membrane in hypoxia, with or without iron overload. Our data indicate that 2 signals could induce the cell-specific response as follows: (i) iron signal, induced prohepcidin, which reduced reticuloendothelial FPN and reduced iron availability; and (ii) hypoxia signal, stimulated Epo, which affected iron absorption by stabilizing duodenal FPN and allowed iron supply to erythropoiesis independently of store size.
19
Schobersberger, W., W. Jelkmann, J. Fandrey, S. Frede, H. Wachter, and D. Fuchs. "Neopterin-induced Suppression of Erythropoietin Production In Vitro." Pteridines 6, no. 1 (February 1995): 12–16. http://dx.doi.org/10.1515/pteridines.1995.6.1.12.
Full textAbstract:
Summary The production of neopterin increases in several diseases with activation of the ceIlular immune response. As previously shown serum concentrations of neopterin are inversely correlated with blood hemoglobin concentrations in the anemia of hematological and malignant disorders. Besides the role of chronic immune activation on the disturbed iron metabolism, an inhibitory influence of pteridines on cellular erythropoietin production could not be excluded. To test the possibility that pteridines are able to suppress the hypoxia-induced production of erythropoietin, the effects of neopterin and 7,8-dihydroneopterin on the human ceIl line HepG2 (hepatoceIlular carcinoma) were investigated. 24 h incubation with neopterin induced a dose-dependent reduction of erythropoietin production. The erythropoietin concentration significantly decreased by - 57.6% with 300 11M and by - 34.9% with 100 11M neopterin, respectively. 7,8 dihydroneopterin did not influence erythropoietin production. The inhibitory effect of neopterin on erythropoietin production was a consequence of reduced erythropoietin-mRNA levels. The results of this study show a neopterin-induced suppression of hypoxia-induced erythropoietin formation in HepG2 cultures in a dose dependent manner. We speculate that under in vivo conditions high concentrations of neopterin can aggravate the anemia of chronic disease.
20
Masuda, Seiji, Toshihiro Kobayashi, Mariko Chikuma, Masaya Nagao, and Ryuzo Sasaki. "The oviduct produces erythropoietin in an estrogen- and oxygen-dependent manner." American Journal of Physiology-Endocrinology and Metabolism 278, no. 6 (June 1, 2000): E1038—E1044. http://dx.doi.org/10.1152/ajpendo.2000.278.6.e1038.
Full textAbstract:
Previously, we showed that erythropoietin (Epo) is produced in the mouse uterus, where Epo is indispensable for estrogen (E2)-dependent angiogenesis. Expression of uterine Epo mRNA is stimulated by E2and hypoxia. The hypoxic induction requires the presence of E2. In the present study, we examined other female reproductive organs in the mouse with respect to Epo mRNA expression and its stimuli (E2and hypoxia)-induced changes. Although Epo mRNA expression was seen in the ovary and oviduct, the E2-induced stimulation of Epo mRNA was found only in the oviduct. The E2-induced stimulation in the oviduct was transient and rapidly downregulated. Epo mRNA expression in the oviduct was hypoxia inducible, in both the presence and the absence of E2. E2-dependent production of Epo and its mRNA expression were also found by use of cultured oviducts. The E2action is probably mediated through the E2receptor, and de novo protein synthesis is not required for E2induction of Epo mRNA. In the oviduct, the ampulla and isthmus regions produce Epo.
21
Chikuma, Mariko, Seiji Masuda, Toshihiro Kobayashi, Masaya Nagao, and Ryuzo Sasaki. "Tissue-specific regulation of erythropoietin production in the murine kidney, brain, and uterus." American Journal of Physiology-Endocrinology and Metabolism 279, no. 6 (December 1, 2000): E1242—E1248. http://dx.doi.org/10.1152/ajpendo.2000.279.6.e1242.
Full textAbstract:
Erythropoietin (Epo) produced by the kidney regulates erythropoiesis. Recent evidence suggests that Epo in the cerebrum prevents neuron death and Epo in the uterus induces estrogen (E2)-dependent uterine angiogenesis. To elucidate how Epo expression is regulated in these tissues, ovariectomized mice were given E2and/or exposed to hypoxia, and the temporal patterns of Epo mRNA levels were examined. Epo mRNA levels in the kidney and cerebrum were elevated markedly within 4 h after exposure to hypoxia. Although the elevated level of Epo mRNA in the kidney decreased markedly within 8 h despite continuous hypoxia, the high level in the cerebrum was sustained for ≥24 h, indicating that downregulation operates in the kidney but not in the brain. E2transiently induced Epo mRNA in the uterus but not in the kidney and cerebrum. Interestingly, the uterine Epo mRNA was hypoxia inducible only in the presence of E2. Thus Epo expression appears to be regulated in a tissue-specific manner, endorsing the tissue-specific functions of Epo.
22
Hagag, Adel A., Mohamed S. El Frargy, and Amal E. Abd El-Latif. "Study of Cord Blood Erythropoietin, Leptin and Adiponectin Levels in Neonates with Hypoxic Ischemic Encephalopathy." Endocrine, Metabolic & Immune Disorders - Drug Targets 20, no. 2 (February 14, 2020): 213–20. http://dx.doi.org/10.2174/1871530319666190725110619.
Full textAbstract:
Background: Hypoxic ischemic encephalopathy (HIE) is a serious condition which results in neonatal morbidity and mortality. Early prediction of HIE especially in the first six hours of birth leads to early treatment with better prognosis. Aim: The aim of this study was to compare the concentrations of leptin, adiponectin, and erythropoietin between normal neonates and those with HIE for the possible use of these markers for assessment of the degree of HIE and as markers for early prediction of HIE. Patients and Methods: This study was carried out on 50 appropriate for gestational age (AGA) neonates with HIE born in Tanta University Hospital during the period from June 2016 to March 2018 (Group I). This study also included 50 appropriate for gestational age (AGA) normal neonates not suffering from any complications and matched with group I in age and sex as a control group (Group II). For all neonates in both groups, the following were done: Complete prenatal, natal, and postnatal history, assessment of APGAR score at 5 and 10 minutes, complete clinical examination with special account on clinical evidence of encephalopathy including hypotonia, abnormal oculomotor or pupillary movements, weak or absent suckling, apnea, hyperpnea, or seizures, measurement of cord blood gases and measurement of serum erythropoietin, leptin and adiponectin levels by ELISA immediately after birth. Results: There were no significant differences between Group I and Group II regarding gestational age, male to female ratio, mode of delivery, and weight while there were significant differences regarding Apgar score at 1 and 5 minutes with significantly lower Apgar score at 1 and 5 minutes in group I compared with Group II. There were significantly lower cord blood PH and adiponectin level and significantly higher cord blood Leptin and erythropoietin in group I compared with group II. There were significant differences between cord blood adiponectin, leptin, erythropoietin, and PH in different degrees of HIE with significantly lower cord blood adiponectin and PH and significantly higher cord blood leptin and erythropoietin in severe degree of hypoxia compared with moderate degree and in moderate degree compared with mild degree of hypoxia. There was a significant positive correlation between cord blood erythropoietin and leptin and a significant negative correlation between cord blood erythropoietin and both adiponectin and PH in studied neonates with hypoxia. ROC curve showed that EPO had the best sensitivity and specificity followed by leptin then adiponectin while the PH had the least sensitivity and specificity as early predictors of hypoxic neonates. Conclusion and Recommendations: Neonates with HIE had lower cord blood PH and adiponectin levels and higher leptin and erythropoietin levels than normal healthy neonates at birth and during the early postnatal period. The significant differences between cord blood erythropoietin, leptin, and adiponectin between neonates with hypoxia compared with normal neonates may arouse our attention about the use of these markers in the cord blood as early predictors of neonatal HIE which can lead early treatment and subsequently better prognosis.
23
Gordeuk, Victor R., Galina Y. Miasnikova, Adelina I. Sergueeva, Xiaomei Niu, Mehdi Nouraie, Daniel J. Okhotin, Lydia A. Polyakova, et al. "Chuvash polycythemia VHLR200W mutation is associated with down-regulation of hepcidin expression." Blood 118, no. 19 (November 10, 2011): 5278–82. http://dx.doi.org/10.1182/blood-2011-03-345512.
Full textAbstract:
Abstract Hypoxia is known to reduce the expression of hepcidin, the master regulator of iron metabolism. However, it is not clear whether this response is primarily related to increased erythropoiesis driven by hypoxically stimulated erythropoietin or to a more direct effect of hypoxia on hepcidin expression. The germline loss-of-function VHLR200W mutation is common in Chuvashia, Russia, and also occurs elsewhere. VHLR200W homozygotes have elevated hypoxia-inducible factor 1α (HIF-1α) and HIF-2α levels, increased red cell mass, propensity to thrombosis, and early mortality. Ninety VHLR200W homozygotes and 52 controls with normal VHL alleles from Chuvashia, Russia, were studied under basal circumstances. In univariate analyses, serum hepcidin concentration was correlated positively with serum ferritin concentration and negatively with homozygosity for VHLR200W. After adjustment for serum erythropoietin and ferritin concentrations by multiple linear regression, the geometric mean (95% confidence interval of mean) hepcidin concentration was 8.1 (6.3-10.5) ng/mL in VHLR200W homozygotes versus 26.9 (18.6-38.0) ng/mL in controls (P < .001). In contrast, a significant independent relationship of serum erythropoietin, hemoglobin, or RBC count with hepcidin was not observed. In conclusion, up-regulation of the hypoxic response leads to decreased expression of hepcidin that may be independent of increased erythropoietin levels and increased RBC counts.
24
Portnichenko, Vladimir I., Valentina I. Nosar, Alla G. Portnychenko, Tatyana I. Drevitskaya, Alla M. Sydorenko, and Irina N. Mankovska. "Periodic Hypoxia Influences Energy Metabolism in Phasic Way." International Journal of Physiology and Pathophysiology 4, no. 1 (2013): 55–68. http://dx.doi.org/10.1615/intjphyspathophys.v4.i1.70.
Full text
25
Azzouzi, Hamid el, Stefanos Leptidis, Pieter A. Doevendans, and Leon J. De Windt. "HypoxamiRs: regulators of cardiac hypoxia and energy metabolism." Trends in Endocrinology & Metabolism 26, no. 9 (September 2015): 502–8. http://dx.doi.org/10.1016/j.tem.2015.06.008.
Full text
26
Fermor, B., A. Gurumurthy, and B. O. Diekman. "Hypoxia, RONS and energy metabolism in articular cartilage." Osteoarthritis and Cartilage 18, no. 9 (September 2010): 1167–73. http://dx.doi.org/10.1016/j.joca.2010.06.004.
Full text
27
PARK, IAN R., MICHAEL B. THORN, and HERMAN S. BACHELARD. "Hypoxia in synaptosomes: oxygen thresholds for energy metabolism." Biochemical Society Transactions 13, no. 5 (October 1, 1985): 915–16. http://dx.doi.org/10.1042/bst0130915.
Full text
28
Portnichenko, VI, VI Nosar', AG Portnichenko, TI Drevitskaia, AM Sidorenko, and IN Man'kovskaia. "Phase changes in energy metabolism during periodic hypoxia." Fiziolohichnyĭ zhurnal 58, no. 4 (August 23, 2012): 3–12. http://dx.doi.org/10.15407/fz58.04.003.
Full text
29
Kawaguchi, Takumi, Richard L. Veech, and Kosaku Uyeda. "Regulation of Energy Metabolism in Macrophages during Hypoxia." Journal of Biological Chemistry 276, no. 30 (May 23, 2001): 28554–61. http://dx.doi.org/10.1074/jbc.m101396200.
Full text
30
Zhong, Hongzhen, Wenshan Lin, and Tianbiao Zhou. "Current and Emerging Drugs in the Treatment of Anemia in Patients with Chronic Kidney Disease." Journal of Pharmacy & Pharmaceutical Sciences 23 (August 4, 2020): 278–88. http://dx.doi.org/10.18433/jpps30919.
Full textAbstract:
Anemia is a common complication of chronic kidney disease (CKD), and its prevalence has shown a tendency to increase in many countries. Anemia is associated with incident heart failure and increases mortality in CKD patients, garnering public attention. Here, we reviewed recent studies about CKD with anemia, and tried to summarize the risks and causes and new progress in the treatment of renal anemia. Among the risks and causes, calcium and phosphorus metabolism disorders should be pointed out along with common causes such as iron and erythropoietin deficiencies, hypoxia, inflammation and uremic toxins, and so on. The new anti-anemia treatments mainly include hematopoietic materials supplementation, erythropoietin-stimulating agents, calcium and phosphorus regulators and hypoxia-inducible factor prolyl hydroxylase inhibitors.
31
Brown, J. H., G. E. Elder, M. Afrasiabi, G. A. Savage, M. G. McGeown, and J. M. Bridges. "The effect of hypoxia on the erythropoietin response of the uremic rabbit model." Biochemical Medicine and Metabolic Biology 44, no. 3 (December 1990): 201–6. http://dx.doi.org/10.1016/0885-4505(90)90062-6.
Full text
32
Mani, Koushiki, Johnny Karini, Kuntolika Mani, and Ananya Amrit. "Hypoxia inducible factor stabilizers: a promising treatment for chronic kidney disease." International Journal of Basic & Clinical Pharmacology 9, no. 11 (October 21, 2020): 1766. http://dx.doi.org/10.18203/2319-2003.ijbcp20204508.
Full textAbstract:
Anemia in chronic kidney disease (CKD) is a very common complication. The two main factors contributing to the development of anemia in CKD is decreased erythropoietin production and iron deficiency. Other factors that might play a role in the pathogenesis of renal anemia are: chronic inflammation leading to increased hepcidin, uremic toxins, and shorter red blood cell life span. The mainstay of treatment is iron supplementation, blood transfusion and erythropoietin stimulating agents (ESA). The discovery of hypoxia inducible factor (HIF) pathway has opened a new chapter in the treatment of anemia in CKD. The oxygen-sensitive HIF pathway plays a prominent role in the control of erythropoiesis and iron metabolism. HIF stabilizers are a new set of drugs that inhibits prolyl hydroxylase domain (PHD) proteins which are key regulators of HIF activity. Several such compounds are being developed to revolutionize the treatment of renal anemia.
33
Dorigatti, M., G. Krumschnabel, P. J. Schwarzbaum, and W. Wieser. "Effects of Hypoxia on Energy Metabolism in Goldfish Hepatocytes." Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology 117, no. 1 (May 1997): 151–58. http://dx.doi.org/10.1016/s0305-0491(96)00318-5.
Full text
34
Rumsey, William L., Brian Abbott, Darci Bertelsen, Michael Mallamaci, Kevin Hagan, David Nelson, and Maria Erecinska. "Adaptation to hypoxia alters energy metabolism in rat heart." American Journal of Physiology-Heart and Circulatory Physiology 276, no. 1 (January 1, 1999): H71—H80. http://dx.doi.org/10.1152/ajpheart.1999.276.1.h71.
Full textAbstract:
The present study characterized metabolic changes in the heart associated with long-term exposure to hypoxia, a potent stimulus for pulmonary hypertension and right ventricular hypertrophy. When anesthetized rats adapted to chronic hypoxia spontaneously respired room air, their mean right intraventricular peak systolic pressure (RVSP) was twice that in normal control animals with the same arterial [Formula: see text]. RVSP was linearly related to right ventricular mass ( r = 0.78). Oxidative capacity (O2consumption) of homogenates of right and left ventricles from both groups of rats was measured with one of the following substrates: pyruvate, glutamate, acetate, and palmitoyl-l-carnitine. Oxidation of all substrates was significantly greater in the left than in the right ventricle in normal rats but not in hypoxia-adapted animals, where it was the same, within the experimental error. O2 consumption by the left ventricle was greater in control than in experimental rats, but right ventricular O2 consumption was similar in the two groups. Maximal reaction velocity of cytochrome- c oxidase was about the same in the two ventricles, and there were no significant differences between control and hypoxia-adapted animals. HPLC analyses showed significantly higher aspartate levels and aspartate-to glutamate concentration ratios in both ventricles of hypoxic rats than in corresponding tissues from controls, indicative of a decreased flux through the malate-aspartate shuttle under conditions of O2 limitation. Myocardial glutamine levels were lower in hypoxic rats, and glutamine-to-glutamate concentration ratios decreased, although primarily in the pressure-overloaded right ventricle. These findings indicate that normal energy metabolism in the left ventricle differs from that in the right and that the differences, particularly those of amino acid metabolism, are markedly influenced by chronic exposure to hypoxia.
35
Homma, Toshiyuki, Nobuhisa Ugaya, Takashi Kawahara, and Hideyuki Takahashi. "Effects Of Hypoxia On Muscle Energy Metabolism During Exercise." Medicine & Science in Sports & Exercise 41 (May 2009): 239. http://dx.doi.org/10.1249/01.mss.0000355284.55740.30.
Full text
36
Goda, Nobuhito, and Mai Kanai. "Hypoxia-inducible factors and their roles in energy metabolism." International Journal of Hematology 95, no. 5 (April 26, 2012): 457–63. http://dx.doi.org/10.1007/s12185-012-1069-y.
Full text
37
von Wussow, Ursula, Janina Klaus, and Horst Pagel. "Is the renal production of erythropoietin controlled by the brain stem?" American Journal of Physiology-Endocrinology and Metabolism 289, no. 1 (July 2005): E82—E86. http://dx.doi.org/10.1152/ajpendo.00182.2004.
Full textAbstract:
Although the structure and function of erythropoietin (Epo) are well documented, the mechanisms of the regulation of the renal synthesis of Epo are still poorly understood. Especially, the description of the localization and function of the O2-sensitive sensor regulating the renal synthesis of Epo is insufficient. A body of evidence suggests that extrarenal O2-sensitive sensors, localized particularly in the brain stem, play an important role in this connection. To support this concept, high cerebral pressure with consecutive hypoxia of the brain stem was generated by insufflation of synthetic cerebrospinal fluid into the catheterized cisterna magna of rats. When the cerebral pressure of the rats was above the level of their mean arterial blood pressure or the high cerebral pressure persisted for a longer period (≥10 min), the Epo plasma concentration increased significantly. Bilateral nephrectomy or hypophysectomy before initiation of high intracranial pressure abolished this effect. Systemic parameters (heart rate, blood pressure, PaO2, PaCO2, arterial pH, renal blood flow, glucose concentration in blood) were not affected. Other stressors, like restricting the mobility of the rats, had no effect on Epo production. Hence, the effect of high cerebral pressure on renal synthesis of Epo seems to be specific. Increasing cerebral hydrostatic pressure leads to increased renal synthesis of Epo. Obviously, during hypoxia, cerebral O2-sensitive sensors release humoral factors, triggering the renal synthesis of Epo. The structure and function of these “Epo-releasing-factors” will have to be characterized in future experiments.
38
Watts, Deepika, Diana Gaete, Diego Rodriguez, David Hoogewijs, Martina Rauner, Sundary Sormendi, and Ben Wielockx. "Hypoxia Pathway Proteins are Master Regulators of Erythropoiesis." International Journal of Molecular Sciences 21, no. 21 (October 30, 2020): 8131. http://dx.doi.org/10.3390/ijms21218131.
Full textAbstract:
Erythropoiesis is a complex process driving the production of red blood cells. During homeostasis, adult erythropoiesis takes place in the bone marrow and is tightly controlled by erythropoietin (EPO), a central hormone mainly produced in renal EPO-producing cells. The expression of EPO is strictly regulated by local changes in oxygen partial pressure (pO2) as under-deprived oxygen (hypoxia); the transcription factor hypoxia-inducible factor-2 induces EPO. However, erythropoiesis regulation extends beyond the well-established hypoxia-inducible factor (HIF)–EPO axis and involves processes modulated by other hypoxia pathway proteins (HPPs), including proteins involved in iron metabolism. The importance of a number of these factors is evident as their altered expression has been associated with various anemia-related disorders, including chronic kidney disease. Eventually, our emerging understanding of HPPs and their regulatory feedback will be instrumental in developing specific therapies for anemic patients and beyond.
39
Benzi, G., and A. M. Giuffrida. "Changes of synaptosomal energy metabolism induced by hypoxia during aging." Neurochemical Research 12, no. 2 (February 1987): 149–57. http://dx.doi.org/10.1007/bf00979531.
Full text
40
Wang, Li, Lijun Di, and Constance Tom Noguchi. "Erythropoietin, a Novel Versatile Player Regulating Energy Metabolism beyond the Erythroid System." International Journal of Biological Sciences 10, no. 8 (2014): 921–39. http://dx.doi.org/10.7150/ijbs.9518.
Full text
41
Ogawa, Chie, Ken Tsuchiya, Naohisa Tomosugi, and Kunimi Maeda. "A Hypoxia-Inducible Factor Stabilizer Improves Hematopoiesis and Iron Metabolism Early after Administration to Treat Anemia in Hemodialysis Patients." International Journal of Molecular Sciences 21, no. 19 (September 28, 2020): 7153. http://dx.doi.org/10.3390/ijms21197153.
Full textAbstract:
Roxadustat (Rox), a hypoxia-inducible factor (HIF) stabilizer, is now available for the treatment of anemia in hemodialysis (HD) patients. To investigate hematopoietic effect and iron metabolism, this study involved 30 HD patients who were initially treated with darbepoetin (DA), a conventional erythropoietin-stimulating agent, and then switched to Rox. We measured erythrocyte, reticulocyte indices, and iron-related factors at every HD during the first two weeks after the treatment switch (Days 0–14) and again on Days 21 and 28. We measured erythropoietin (EPO) concentration every week and examined their changes from Day-0 values. The same variables were measured in 15 HD patients who continued DA at every HD for one week. Iron-related factors were also measured on Days 14 and 28. In the Rox group, hepcidin significantly decreased from Day 2. The reticulocyte hemoglobin content (CHr) significantly increased on Day 4, but decreased with a significant increase in reticulocyte count from Day 7. Log10(serum ferritin) significantly decreased after Day 11. Log10(EPO concentration) was lower at all time points. Compared with the DA group, the Rox group showed significant differences in all variables except CHr. These results suggest that Rox improves hematopoiesis and iron metabolism early after administration independent of EPO concentration.
42
Christensen, Britt, Mikkel H. Vendelbo, Thomas Krusenstjerna-Hafstrøm, Michael Madsen, Steen B. Pedersen, Niels Jessen, Niels Møller, and Jens Otto L. Jørgensen. "Erythropoietin administration acutely stimulates resting energy expenditure in healthy young men." Journal of Applied Physiology 112, no. 7 (April 1, 2012): 1114–21. http://dx.doi.org/10.1152/japplphysiol.01391.2011.
Full textAbstract:
Treatment with recombinant human erythropoietin (rHuEpo) improves insulin sensitivity in patients with end-stage renal disease, and animal studies indicate that Epo increases fat oxidation. However, the metabolic effects of rHuEpo have never been experimentally studied in healthy humans. The aim was to investigate the effects of an acute rHuEpo bolus on substrate metabolism and insulin sensitivity in healthy young men. Ten healthy young men were studied in a single-blinded, randomized crossover design with a 2-wk washout period receiving 400 IU/kg rHuEpo or placebo. Substrate metabolism was evaluated by indirect calorimetry and tracer infusions, and insulin sensitivity by a hyperinsulinemic euglycemic clamp; and PCR and Western blotting measured protein expression and content, respectively. Resting energy expenditure (REE) increased significantly after rHuEpo [basal: 1,863.3 ± 67.2 (kcal/day) (placebo) vs. 2,041.6 ± 81.2 (rHuEpo), P < 0.001; clamp: 1,903.9 ± 68.3 (placebo) vs. 2,015.7 ± 114.4 (rHuEpo), P = 0.03], but the increase could not be explained by changes in mRNA levels of uncoupling protein 2 or 3. Fat oxidation in the basal state tended to be higher after rHuEpo but could not be explained by changes in mRNA levels of CPT1 and PPARα or AMPK and ACC protein phosphorylation. Insulin-stimulated glucose disposal, glucose metabolism, and whole body and forearm protein metabolism did not change significantly in response to rHuEpo. In conclusion, a single injection of rHuEpo acutely increases REE in healthy human subjects. This calorigenic effect is not accompanied by distinct alterations in the pattern of substrate metabolism or insulin sensitivity.
43
Yager, J. Y., R. M. Brucklacher, and R. C. Vannucci. "Cerebral energy metabolism during hypoxia-ischemia and early recovery in immature rats." American Journal of Physiology-Heart and Circulatory Physiology 262, no. 3 (March 1, 1992): H672—H677. http://dx.doi.org/10.1152/ajpheart.1992.262.3.h672.
Full textAbstract:
Persistent alterations in cellular energy homeostasis may contribute to the brain damage that evolves from perinatal cerebral hypoxia-ischemia. Accordingly, the presence and extent of perturbations in high-energy phosphate reserves were analyzed during hypoxia-ischemia and the early recovery period in the immature rat. Seven-day postnatal rats were subjected to unilateral common carotid artery ligation and hypoxia with 8% oxygen at 37 degrees C for 3 h, an insult that produces damage (selective neuronal necrosis or infarction) of the cerebral hemisphere ipsilateral to the common carotid artery ligation in 92% of animals. Rat pups were quick frozen in liquid nitrogen during hypoxia-ischemia and at 10, 30, and 60 min and 4 and 24 h of recovery for enzymatic, fluorometric analysis of phosphocreatine (PCr), creatine, ATP, ADP, and AMP. During hypoxia-ischemia, PCr, ATP, and total adenine nucleotides were decreased by 87, 72, and 50% of control, respectively. During recovery, PCr, ATP, and total adenine nucleotides exhibited a rapid (within 10 min) although incomplete and heterogeneous recovery that persisted for at least 24 h. Mean values for PCr remained between 55 and 85% of control, whereas ATP values remained between 57 and 67% of control. Individual ATP values were inversely related to tissue water content at 10 min of recovery, indicating a close correlation between failure of energy restoration and the extent of cerebral edema as a reflection of brain damage. Thus high-energy phosphate reserves display lingering alterations during recovery from hypoxia-ischemia. The interanimal variability in energy restoration presumably reflects the spectrum of brain damage seen in this model of perinatal cerebral hypoxia-ischemia.
44
Farhat, Elie, Hang Cheng, Caroline Romestaing, Matthew Pamenter, and Jean-Michel Weber. "Goldfish Response to Chronic Hypoxia: Mitochondrial Respiration, Fuel Preference and Energy Metabolism." Metabolites 11, no. 3 (March 22, 2021): 187. http://dx.doi.org/10.3390/metabo11030187.
Full textAbstract:
Hypometabolism is a hallmark strategy of hypoxia tolerance. To identify potential mechanisms of metabolic suppression, we have used the goldfish to quantify the effects of chronically low oxygen (4 weeks; 10% air saturation) on mitochondrial respiration capacity and fuel preference. The responses of key enzymes from glycolysis, β-oxidation and the tricarboxylic acid (TCA) cycle, and Na+/K+-ATPase were also monitored in various tissues of this champion of hypoxia tolerance. Results show that mitochondrial respiration of individual tissues depends on oxygen availability as well as metabolic fuel oxidized. All the respiration parameters measured in this study (LEAK, OXPHOS, Respiratory Control Ratio, CCCP-uncoupled, and COX) are affected by hypoxia, at least for one of the metabolic fuels. However, no common pattern of changes in respiration states is observed across tissues, except for the general downregulation of COX that may help metabolic suppression. Hypoxia causes the brain to switch from carbohydrates to lipids, with no clear fuel preference in other tissues. It also downregulates brain Na+/K+-ATPase (40%) and causes widespread tissue-specific effects on glycolysis and beta-oxidation. This study shows that hypoxia-acclimated goldfish mainly promote metabolic suppression by adjusting the glycolytic supply of pyruvate, reducing brain Na+/K+-ATPase, and downregulating COX, most likely decreasing mitochondrial density.
45
Coburn, R. F., C. Baron, and M. T. Papadopoulos. "Phosphoinositide metabolism and metabolism-contraction coupling in rabbit aorta." American Journal of Physiology-Heart and Circulatory Physiology 255, no. 6 (December 1, 1988): H1476—H1483. http://dx.doi.org/10.1152/ajpheart.1988.255.6.h1476.
Full textAbstract:
We tested a hypothesis that metabolism-contraction coupling in vascular smooth muscle is controlled by the rate of delivery of energy to ATP-dependent reactions in the inositol phospholipid transduction system that generate second messengers exerting control on smooth muscle force. Rabbit aorta was contracted by norepinephrine (NOR) under conditions of normoxia and hypoxia (bath PO2 less than 40 mmHg), and changes in inositol phospholipid pool sizes and metabolic flux rates (JF) were determined. JF was determined by labeling free cytosolic myo-inositol by incubation of unstimulated muscle with myo-[3H]inositol and then measuring rates of incorporation of this isotope into inositol phospholipids and inositol phosphates when the muscle was activated by NOR. JF measured during maintenance of NOR-induced force was markedly inhibited during hypoxia to 40-50% of that determined during normoxia; rates of increases in inositol phosphate radioactivities were similarly depressed during NOR activation under hypoxia. The hypoxia-induced decrease in JF was associated with four- to fivefold increase in phosphatidylinositol 4-phosphate (PIP) total pool size, suggesting PIP kinase was inhibited and rate limiting. Total pool sizes of phosphatidylinositol, phosphatidylinositol bisphosphate, and phosphatidic acid were unchanged from values seen during activation under normoxia. These data suggest that activation of inositol phospholipid metabolism, which generates inositol 1,4,5-trisphosphate (IP3) and diacylglycerol, is blunted under conditions where aerobic energy production is inhibited. Data are consistent with “rate-limiting” effects of decreased ATP delivery, or decreased phosphate potential, on PIP kinase and reactions that control resynthesis of phosphatidylinositol.
46
Speers-Roesch, Ben, Erik Sandblom, Gigi Y. Lau, Anthony P. Farrell, and Jeffrey G. Richards. "Effects of environmental hypoxia on cardiac energy metabolism and performance in tilapia." American Journal of Physiology-Regulatory, Integrative and Comparative Physiology 298, no. 1 (January 2010): R104—R119. http://dx.doi.org/10.1152/ajpregu.00418.2009.
Full textAbstract:
The ability of an animal to depress ATP turnover while maintaining metabolic energy balance is important for survival during hypoxia. In the present study, we investigated the responses of cardiac energy metabolism and performance in the hypoxia-tolerant tilapia ( Oreochromis hybrid sp.) during exposure to environmental hypoxia. Exposure to graded hypoxia (≥92% to 2.5% air saturation over 3.6 ± 0.2 h) followed by exposure to 5% air saturation for 8 h caused a depression of whole animal oxygen consumption rate that was accompanied by parallel decreases in heart rate, cardiac output, and cardiac power output (CPO, analogous to ATP demand of the heart). These cardiac parameters remained depressed by 50–60% compared with normoxic values throughout the 8-h exposure. During a 24-h exposure to 5% air saturation, cardiac ATP concentration was unchanged compared with normoxia and anaerobic glycolysis contributed to ATP supply as evidenced by considerable accumulation of lactate in the heart and plasma. Reductions in the provision of aerobic substrates were apparent from a large and rapid (in <1 h) decrease in plasma nonesterified fatty acids concentration and a modest decrease in activity of pyruvate dehydrogenase. Depression of cardiac ATP demand via bradycardia and an associated decrease in CPO appears to be an integral component of hypoxia-induced metabolic rate depression in tilapia and likely contributes to hypoxic survival.
47
Bosman, D. R., C. A. Osborne, J. T. Marsden, I. C. Macdougall, W. N. Gardner, and P. J. Watkins. "Erythropoietin response to hypoxia in patients with diabetic autonomic neuropathy and non-diabetic chronic renal failure." Diabetic Medicine 19, no. 1 (January 2002): 65–69. http://dx.doi.org/10.1046/j.1464-5491.2002.00634.x.
Full text
48
Hou, Cuilan, Juan Chen, Yuqi Zhao, Yanhua Niu, Shujia Lin, Shun Chen, Yanfang Zong, Xiaomin Sun, Lijian Xie, and Tingting Xiao. "The Emerging Role of Fatty Acid Synthase in Hypoxia-Induced Pulmonary Hypertensive Mouse Energy Metabolism." Oxidative Medicine and Cellular Longevity 2021 (August 17, 2021): 1–15. http://dx.doi.org/10.1155/2021/9990794.
Full textAbstract:
Aims. This study is aimed at examining whether fatty acid synthase (FAS) can regulate mitochondrial function in hypoxia-induced pulmonary arterial hypertension (PAH) and its related mechanism. Results. The expression of FAS significantly increased in the lung tissue of mice with hypoxia-induced PAH, and its pharmacological inhibition by C75 ameliorated right ventricle cardiac function as revealed by echocardiographic analysis. Based on transmission electron microscopy and Seahorse assays, the mitochondrial function of mice with hypoxia was abnormal but was partially reversed after C75 injection. In vitro studies also showed an increase in the expression of FAS in hypoxia-induced human pulmonary artery smooth muscle cells (HPASMCs), which could be attenuated by FAS shRNA as well as C75 treatment. Meanwhile, C75 treatment reversed hypoxia-induced oxidative stress and activated PI3K/AKT signaling. shRNA-mediated inhibition of FAS reduced its expression and oxidative stress levels and improved mitochondrial respiratory capacity and ATP levels of hypoxia-induced HPASMCs. Conclusions. Inhibition of FAS plays a crucial role in shielding mice from hypoxia-induced PAH, which was partially achieved through the activation of PI3K/AKT signaling, indicating that the inhibition of FAS may provide a potential future direction for reversing PAH in humans.
49
Headrick, J. P., and R. J. Willis. "Adenosine formation and energy metabolism: a 31P-NMR study in isolated rat heart." American Journal of Physiology-Heart and Circulatory Physiology 258, no. 3 (March 1, 1990): H617—H624. http://dx.doi.org/10.1152/ajpheart.1990.258.3.h617.
Full textAbstract:
Temporal and quantitative relations between cytosolic energy metabolism, adenosine efflux, and coronary flow were examined during 10 min of isoproterenol (ISO) infusion (60 nM) or hypoxia (5% O2) in isolated isovolumic rat heart. Myocardial metabolism was monitored using 31P-nuclear magnetic resonance spectroscopy, and venous effluent was collected and assayed for adenosine. During ISO infusion, coronary flow increased to approximately 170%, and [ATP]/[ADP] [Pi] (cytosolic phosphorylation potential) declined to less than 25% of preinfusion levels, respectively (P less than 0.001). During hypoxia, coronary flow increased to 190%, and [ATP]/[ADP] [Pi] declined to less than 25% of normoxic levels (P less than 0.001). Release of adenosine into the coronary venous effluent increased greater than 10-fold and displayed significant inverse linear correlations with log[ATP]/[ADP] [Pi] and positive linear correlations with free cytosolic [AMP] and coronary flow during ISO infusion and hypoxia. Adenosine deaminase (ADA) treatment reduced coronary vasodilation by approximately 30% during ISO infusion and 40% during hypoxia (P less than 0.001) and augmented chronotropic and inotropic responses to ISO infusion (P less than 0.01). Infusion of ADA potentiated changes in [ATP]/[ADP] [Pi] and [AMP] observed during ISO infusion and hypoxia (P less than 0.05). These results indicate that 1) endogenous adenosine mediates metabolic vasodilation in the heart, 2) adenosine modulates the response of isolated myocardium to catecholamines, 3) myocardial adenosine formation appears to be linked to cytosolic metabolism via changes in [ATP]/[ADP] [Pi] and [AMP], and 4) endogenous adenosine provides a significant, metabolically beneficial action in isolated hearts during hypoxia and inotropic stimulation.
50
Schurr, Avital. "Energy metabolism, stress hormones and neural recovery from cerebral ischemia/hypoxia." Neurochemistry International 41, no. 1 (July 2002): 1–8. http://dx.doi.org/10.1016/s0197-0186(01)00142-5.
Full text