Journal articles on the topic 'Dried milk spot'

Abstract Background: Newborn screening (NBS) is an established screening procedure in many countries worldwide, aiming at the early detection of inborn errors of metabolism. For decades, dried blood spots have been the standard specimen for NBS. The procedure of blood collection is well described and standardized and includes many critical pre-analytical steps. We examined the impact of contamination of some anticipated common substances on NBS results obtained from dry spot samples. This possible pre-analytical source of uncertainty has been poorly examined in the past. Methods: Capillary blood was obtained from 15 adult volunteers and applied to 10 screening filter papers per volunteer. Nine filter papers were contaminated without visible trace. The contaminants were baby diaper rash cream, baby wet wipes, disinfectant, liquid infant formula, liquid infant formula hypoallergenic (HA), ultrasonic gel, breast milk, feces, and urine. The differences between control and contaminated samples were evaluated for 45 NBS quantities. We estimated if the contaminations might lead to false-positive NBS results. Results: Eight of nine investigated contaminants significantly altered NBS analyte concentrations and potentially caused false-positive screening outcomes. A contamination with feces was most influential, affecting 24 of 45 tested analytes followed by liquid infant formula (HA) and urine, affecting 19 and 13 of 45 analytes, respectively. Conclusions: A contamination of filter paper samples can have a substantial effect on the NBS results. Our results underline the importance of good pre-analytical training to make the staff aware of the threat and ensure reliable screening results.

Metabolites are generated from exogenous sources such as diet. This scoping review will summarize nascent metabolite literature and discriminating metabolites for formula vs. human- milk-fed infants. Using the PICOS framework (P—Patient, Problem or Population; I—Intervention; C—Comparison; O—Outcome; S—Study Design) and PRISMA item-reporting protocols, infants less than 12 months old, full-term, and previously healthy were included. Protocol was registered with Open Science Framework (OSF). Publications from 1 January 2009–2019 were selected, for various biofluids, study designs, and techniques (such as high-performance liquid chromatography (HPLC)). From 711 articles, blinded screening of 214 articles using Abstrackr® software, resulted in 24 for final review. Strengthening the Reporting of Observational studies in Epidemiology (STROBE) guidelines were adopted, which included a 24-point checklist. Articles were stratified according to biofluid. Of articles reporting discriminating metabolites between formula- and human milk-fed infants, 62.5% (5/8) of plasma/serum/dried blood spot, 88% (7/8) of urine and 100% (6/6) of feces related articles reported such discriminating metabolites. Overall, no differences were found between analytical approach used (targeted (n = 9) vs. un-targeted (n = 10)). Current articles are limited by small sample sizes and differing methodological approaches. Of the metabolites reviewed herein, fecal metabolites provided the greatest distinction between diets, which may be indicative of usefulness for future diet metabolite-focused work.

Mucopolysaccharidosis type I (MPS I) is a hereditary metabolic disease that manifests itself in childhood by systemic damage to tissues and organs, a constantly progressive course leading to disability. Diagnosis of mild forms of the disease is particularly difficult due to the absence of specific symptoms. A specific symptom of the mild forms of MPS I (as for other types of MPS) is joint stiffness in children combined with hernia, frequent infections, or valvular defects. Stiffness in MPS I is often interpreted as a manifestation of rheumatological diseases (arthrogriposis, juvenile idiopathic arthritis). The article offers a simple algorithm for diagnosing MPS I, which helps to eliminate the disease using a simple test for determining the activity of an enzyme called alpha-L-iduronidase in a dried blood spot.

Abstract Zellweger spectrum disorders (ZSD) constitute a group of rare autosomal recessive disorders characterized by a defect in peroxisome biogenesis due to mutations in one of 13 PEX genes. The broad clinical heterogeneity especially in late-onset presenting patients and a mild phenotype complicates and delays the diagnostic process. Here, we report a case of mild ZSD, due to novel PEX1 variants. The patient presented with an early hearing loss, bilateral cataracts, and leukodystrophy on magnetic resonance (MR) images. Normal results of serum very-long-chain fatty acids (VLCFA) and phytanic acid were found. Molecular diagnostics were performed to uncover the etiology of the clinical phenotype. Using whole exome sequencing, there have been found two variants in the PEX1 gene—c.3450T>A (p.Cys1150*) and c.1769T>C (p.Leu590Pro). VLCFA measurement in skin fibroblasts and C26:0-lysoPC in dried blood spot therefore was performed. Both results were in line with the diagnosis of ZSD. To conclude, normal results of routine serum VLCFA and branched-chain fatty acid measurement do not exclude mild forms of ZSD. The investigation of C26:0-lysoPC should be included in the diagnostic work-up in patients with cataract, hearing loss, and leukodystrophy on MR images suspected to suffer from ZSD.

Since 1994, tomato (Lycopersicon esculentum Mill.) grown in Mérida State, located in the Venezuelan Andes, have been consistently affected by a gray leaf spot disease with symptoms on leaves, petioles, and stems. Yield is reduced, and in some cases entire crops have been destroyed over short time. Because of its prevalence, distribution, and severity, the disease has become the major factor limiting tomato production in this region. Disease symptoms were commonly observed on seedlings and plants. On leaves the disease first appeared as circular to elongated dark specks. As the spots enlarged, they became gray and bright. Old lesions dried and usually cracked. Severely infected leaves turned yellow and then died and dropped. Lesions on petioles and stems were elongate. Disease severity was generally higher following the beginning of fruiting. The fungus was isolated from leaves, petioles, and stems of tomato cv. Rio Grande on 2% water agar acidified with lactic acid. On potato-carrot agar, conidiophores and conidia were produced with the characteristics of Stemphylium. Two species of Stemphylium, S. solani G. F. Weber and S. lycopersici (Enjoji) W. Yamamoto, cause gray leaf spot symptoms on tomato. Based on morphology, size, and the length/width ratio of the conidia, the fungus was identified as S. solani (1). Inoculations done by spraying a conidial suspension on plants of tomato cv. Rio Grande produced symptoms similar to those observed in the field. S. solani was consistently isolated from experimentally infected tissues, thus confirming Koch's postulates. This is the first report of S. solani causing gray leaf spot on tomato grown in the Andes of Venezuela. Reference: (1) G. F. Weber. Phytopathology 20:513, 1930.

The role of glucosylsphingosine (lyso-Gb1), a downstream metabolic product of glucosylceramide, for monitoring treated and untreated children with Gaucher disease (GD) has not yet been studied. We reviewed the clinical charts of 81 children (<18 years), 35 with mild type 1 GD (GD1), 34 with severe GD1 and 12 with type 3 GD (GD3), followed at Shaare Zedek Medical Center between 2014–2018. Disease severity for GD1 was based on genotypes. Forty children (87%) with severe GD1 and GD3 received enzyme replacement therapy (ERT) compared to two children (6%) with mild GD1. Lyso-Gb1 measurements were conducted on dried blood spot samples taken at each clinic visit. Lyso-Gb1 levels were significantly lower in children with mild compared to severe GD1 (p = 0.009). In untreated children, lyso-Gb1 levels were inversely correlated with platelet counts. During follow-up, lyso-Gb1 increased in almost 50% of untreated children, more commonly in younger children. In treated children, lyso-Gb1 levels were inversely correlated with hemoglobin levels. The increase of lyso-Gb1 while receiving ERT, seen in eight children, was partly associated with compliance and weight gain. Lyso-Gb1 seems to be a useful biomarker for monitoring children with GD and should be included in the routine follow-up. Progressive increase in lyso-Gb1 levels in untreated children suggests ERT initiation.

For years, the gold standard for diagnosing Gaucher disease (GD) has been detecting reduced β-glucocerebrosidase (GCase) activity in peripheral blood cells combined with GBA1 mutation analysis. The use of dried blood spot (DBS) specimens offers many advantages, including easy collection, the need for a small amount of blood, and simpler transportation. However, DBS has limitations for measuring GCase activity. In this paper, we recount our cross-sectional study and publish seven years of experience using DBS samples and levels of the deacylated form of glucocerebroside, glucosylsphingosine (lyso-Gb1), for GD diagnosis. Of 444 screened subjects, 99 (22.3%) were diagnosed with GD at a median (range) age of 21 (1–78) years. Lyso-Gb levels for genetically confirmed GD patients vs. subjects negative to GD diagnosis were 252 (9–1340) ng/mL and 5.4 (1.5–16) ng/mL, respectively. Patients diagnosed with GD1 and mild GBA1 variants had lower median (range) lyso-Gb1, 194 (9–1050), compared to GD1 and severe GBA1 variants, 447 (38–1340) ng/mL, and neuronopathic GD, 325 (116–1270) ng/mL (p = 0.001). Subjects with heterozygous GBA1 variants (carrier) had higher lyso-Gb1 levels, 5.8 (2.5–15.3) ng/mL, compared to wild-type GBA1, 4.9 (1.5–16), ng/mL (p = 0.001). Lyso-Gb1 levels, median (range), were 5 (2.7–10.7) in heterozygous GBA1 carriers with Parkinson’s disease (PD), similar to lyso-Gb1 levels in subjects without PD. We call for a paradigm change for the diagnosis of GD based on lyso-Gb1 measurements and confirmatory GBA1 mutation analyses in DBS. Lyso-Gb1 levels could not be used to differentiate between heterozygous GBA1 carriers and wild type.

As is well known, the COVID-19 infection is affecting the whole world, causing a serious health, social and economic crisis. The viral infection can cause a mild or severe illness, depending on how effectively the virus is countered by the immune system. In this context, the position of pregnant women remains rather unknown. The case described here reports the immune response in a woman in good health and in her newborn son, having undergone complete vaccination during the first trimester of her pregnancy. We performed a serological assay, measuring IgG antibodies to SARS-CoV-2, by a fully automated solid phase DELFIA (time-resolved fluorescence) immunoassay in a few drops of blood, collected by a finger-prick and spotted on filter paper. The dried blood spot (DBS) sample we used is the same type of sample routinely used in a newborn screening program test. Such a simple and minimally invasive approach allowed us to monitor both the mother and the newborn soon after birth for their anti-SARS-CoV-2 IgG levels. The serological test on the DBS carried out on both mother and newborn revealed the presence of anti-SARS-CoV-2 IgG antibodies up to 7 months after vaccination in the mother, and already at 48 h of life in the newborn.

AimsAs of 2016, there were five patients with Pompe in Slovenia (two infantile, one childhood and two adult onset) with a prevalence of 1:400 000; however, the prevalence of late-onset Pompe disease (LOPD) in some other countries means this ratio could be an underestimate. Since an LOPD muscle biopsy could be unspecific or even normal, the purpose of this study is to assess the prevalence of LOPD in patients with non-diagnostic muscle biopsies.MethodsSix hundred biopsies were recorded at the Neuromuscular Tissue Bank of the University of Ljubljana for the period 2004–2014. All adult patients with non-diagnostic muscle biopsies were invited to the National Slovenian Neuromuscular Centre for dried blood spot testing for LOPD.ResultsA total of 90 patients (56% of those invited) responded. No patient with LOPD was found. A total of 49 patients (54%) had fixed muscle weakness, 31 (34%) had mild symptoms and no weakness and 10 (11%) had asymptomatic hyperCKemia. Ventilatory insufficiency associated with proximal muscle weakness was found in two patients (2%). No patients exhibited vacuolar myopathy, globular accumulations of glycogen or regions of increased acid phosphatase activity within the sarcoplasm.ConclusionsThe study results do not support the hypothesis that LOPD is underestimated in Slovenian patients with non-diagnostic muscle biopsies; this could be consistent with the fact that LOPD is of low prevalence in Slovenia, as is the case in the populations of Finland, French-speaking Belgium, west Sweden and west Denmark.

Lablab purpureus (L.) Sweet (Indian bean) is an important pulse crop grown in arid and semi-arid regions of India. It is one of the most widely cultivated legume species and has multiple uses. During a September 2010 survey, we recorded a new leaf spot disease on L. purpureus in and around Mysore district (Karnataka state) with 40 to 80% disease incidence in 130 ha of field crop studied, which accounted for 20 to 35% estimated yield loss. The symptoms appeared as small necrotic spots on the upper leaf surface. The leaf spots were persistent under mild infection throughout the season with production of conidia in clusters on abaxial leaf surface. A Dueteromyceteous fungus was isolated from affected leaf tissues that were surface sterilized with 2% NaOCl2 solution then washed thrice, dried, inoculated on potato dextrose agar (PDA) medium, and incubated at 28 ± 2°C at 12 h alternate light and dark period for 7 days. The fungal colony with aerial mycelia interspersed with dark cushion-shaped sporodochia consists of short, compact conidiophores bearing large isodiametric, solitary, muricate, brown, globular to pear shaped conidia (29.43 to 23.92 μm). Fungal isolate was identified as Epicoccum sp. based on micro-morphological and cultural features (1). Further authenticity of the fungus was confirmed by PCR amplification of the internal transcribed spacer (ITS) region using ITS1/ITS4 universal primer. The amplified PCR product was purified, sequenced directly, and BLASTn search revealed 100% homology to Epicoccum nigrum Link. (DQ093668.1 and JX914480.1). A representative sequence of E. nigrum was deposited in GenBank (Accession No. KC568289.1). The isolated fungus was further tested for its pathogenicity on 30-day-old healthy L. purpureus plants under greenhouse conditions. A conidial suspension (106 conidia/ml) was applied as foliar spray (three replicates of 15 plants each) along with suitable controls. The plants were kept under high humidity (80%) for 5 days and at ambient temperature (28 ± 2°C). The appearance of leaf spot symptoms were observed after 25 days post inoculation. Further, the pathogen was re-isolated and confirmed by micro-morphological characteristics. E. nigrum has been reported to cause post-harvest decay of cantaloupe in Oklahoma (2). It has also been reported as an endophyte (3). Occurrence as a pathogen on lablab bean has not been previously reported. To our knowledge, this is the first report of the occurrence of E. nigrum on L. purpureus in India causing leaf spot disease. References: (1) H. L. Barnet and B. B. Hunter. Page 150 in: Illustrated Genera of Imperfect Fungi, 1972. (2) B. D. Bruten et al. Plant Dis. 77:1060, 1993. (3) L. C. Fávaro et al. PLoS One 7(6):e36826, 2012.

Light-to-dark brown leaf spots and general chlorosis were observed on ‘Alamo’ switchgrass (Panicum virgatum L.) grown in ornamental plantings on the campus of the University of Tennessee in Knoxville in December 2007. Disease distribution was patchy, infecting ~10% of plants. Patches had mild to severely infected plants with stunting in areas of severe infection. Symptomatic leaf tissue was surface sterilized, air dried on sterile filter paper, and plated on 2% water agar amended with 10 mg/liter of rifampicin (Sigma-Aldrich, St. Louis, MO) and 10 μl/liter of 2.4 EC Danitol miticide (Valent Chemical, Walnut Creek, CA). Plates were incubated at 26°C in darkness for 5 days. A sporulating, dematiaceous mitosporic fungus was observed and transferred to potato dextrose agar (PDA). Conidiophores were single, light brown, multiseptate, mostly straight, polytretic, geniculate, and sympodial. Conidia were 17.5 × 12 (22) to 30 × 14 (12.5) μm, oval, light brown, and distoseptate, with one to three septa and a flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris spicifera (Bainier) Subram. Morphological features were as described for B. spicifera (2). Pathogenicity studies were conducted with 5-week-old ‘Alamo’ switchgrass plants grown from surface-sterilized seed in 9 × 9-cm pots containing 50% ProMix Potting and Seeding Mix (Premier Tech Horticulture, Rivière-du-Loup, Québec, Canada) and 50% Turface ProLeague (Profile Products, Buffalo Grove, IL) (vol/vol). Ten replicate pots with ~20 plants each were sprayed with a spore suspension of 4.5 × 106 spores/ml of sterile water prepared from 6-day-old cultures grown on PDA. Plants were subjected to high humidity for 45 h then incubated at 25/20°C with a 12-h photoperiod in a growth chamber. Leaf spot symptoms similar to the original disease appeared on plants in each of the 10 replicate pots 6 days postinoculation. Lesions were excised from leaves, surface sterilized, plated on water agar, and the resulting cultures were again identified as B. spicifera. The internal transcribed spacer (ITS) region of ribosomal DNA from the original isolate used for inoculation and the reisolated culture recovered from plants in the pathogenicity studies were amplified with PCR using primers ITS4 and ITS5 (3). PCR amplicons of ~560 bp were obtained from both isolates and sequenced. Amplicon sequences were identical and the sequence was submitted to GenBank (Accession No. HQ015445). The DNA sequence had 100% homology to the ITS sequence of B. spicifera strain NRRL 47508 (GenBank Accession No. GU183125.1) that had been isolated from sorghum seed. To our knowledge, leaf spot caused by B. spicifera has not been described on switchgrass (1). B. spicifera can be seedborne and has been reported on turfgrass seed exported from the United States to Korea (2). As switchgrass is transitioned from a prairie grass to a biofuels crop planted in large acreages, disease incidences and severities will likely increase, necessitating rapid disease identification and cost effective management strategies. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 4 August 2010. (2) H.-M. Koo et al. Plant Pathol. J. 19:133, 2003. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds, Academic Press, San Diego, 1990.

Abstract Purpose Voluntary salt iodization at 50 mg/kg salt ensures adequate iodine nutrition in Swedish school-aged children, but iodine status in pregnant women is uncertain. Methods We conducted a cross-sectional national study of 743 pregnant women, at median gestational age of 23 weeks (IQR 9, 38), recruited from maternal health care centers. We measured: urinary iodine concentration (UIC) and urinary creatinine concentration in spot urine samples; thyroglobulin (Tg), thyroid-stimulating hormone (TSH), and total thyroxine (tT4) on dried blood spots (DBS); and thyreoperoxidase antibodies in serum samples. Data on dietary supplement use were obtained, and women were classified as supplement users (consuming multivitamins containing ≥ 150 µg iodine/day) and non-supplement users (no supplements or < 150 µg iodine/day from supplements). Results Overall median UIC [bootstrapped 95% confidence interval (CI)] was 101 µg/L (95, 108; n = 737): 149 µg/L (132, 164) in supplement users (n = 253) and 85 µg/L (79, 92) in non-supplement users (n = 440) (p < 0.001). Overall geometric mean DBS-Tg (95% CI) was 22.1 μg/L (20.8, 23.5; n = 675) and the prevalence of elevated DBS-Tg was 19%. DBS-Tg was lower in supplement users (n = 229) than in non-supplement users (n = 405) (19.1 vs 24.4 μg/L, p < 0.001). DBS-TSH, DBS-tT4, and S-TPOab positivity did not differ between the two groups. Conclusions Pregnant women in Sweden have inadequate iodine nutrition. Women not taking iodine supplements containing ≥ 150 µg iodine/day are affected by mild iodine deficiency and are at higher risk for increased thyroid activity, while maintaining euthyroidism. Iodine intake should be improved in women both before and after conception by promotion of iodized salt instead of non-iodized salt. We urge regular monitoring of iodine status in the general Swedish population, as well as in risk groups.

Allogeneic hematopoietic stem cell transplantation (HSCT) performed early in life is the current standard of care for patients with severe type 1 mucopolysaccharidosis (Hurler disease), a metabolic disorder caused by mutations in the alpha-L-iduronidase (IDUA) gene, leading to impaired breakdown of glycosaminoglycans (GAG). Secretion of IDUA by donor-derived hematopoietic cells may cross-correct non-hematopoietic cells, slowing progression of tissue damage and cognitive decline. Nevertheless, Hurler patients undergoing HSCT manifest substantial residual disease burden, e.g. on the skeleton and central nervous system (CNS). We conducted a phase I/II clinical study (NCT03488394) to test whether infusion of autologous CD34+ hematopoietic stem and progenitor cells (HSPC) transduced ex vivo with a lentiviral vector coding for the IDUA gene was feasible, safe and capable of restoring enzymatic activity in the patients' blood and tissues, up to supraphysiologic levels. The trial originally planned to enroll 6 Hurler patients with preserved neurocognitive function (DQ/IQ&gt;70) that had no access to a suitable allogeneic donor. Sample size has recently been increased to 8 patients. By July 2019, six patients have been treated at a median age of 24 months (range: 14-34), with a median follow up of 4 months (range: 1-13). In all patients, we collected a high number of autologous HSPC by leukapheresis following mobilization with lenograstim and plerixafor, resulting in drug products with a median of 21 million CD34+ cells/kg (range: 13-29). Transduction efficiency was high with a median above 80% and a vector copy number (VCN) of 1.7 (range: 1.0-5.2), employing a shortened, 2 day transduction protocol that included prostaglandin E2. All patients showed rapid hematopoietic recovery following myeloablative conditioning with busulfan (targeted to an AUC of 80mg*h/L), fludarabine (160mg/sqm) and rituximab (375mg/sqm). Median duration of grade 4 neutropenia associated with conditioning was 15.5 days (range: 13-19). Also associated with conditioning, Grade 3 thrombocytopenia lasted 4 days, while only 2 out of 6 patients experienced a platelet drop below 20,000/mcL on a single day, in the absence of transfusion support. Adverse events were mild and compatible with myeloablative conditioning, with the exception of patient 3 who experienced an anaphylactic reaction on day+12, which promptly responded to antihistamines, IV fluids and steroids. All evaluable patients showed sustained, supraphysiologic blood IDUA activity (dried blood spot), which was on average 3 fold above the upper limit of normal (evaluable patients: n=5 at 1 month, n=4 at 2 months, n=3 at 3 months). Notably, in n=4 Hurler patients treated with allogeneic HSCT, we detected IDUA activity that ranged within the lowest quartile of normal in spite of full donor chimerism, suggesting substantial gain achieved by overexpressing IDUA in ex vivo genetically-modified autologous HSPC. Urinary GAG excretion fell to normal levels within 3-6 months. IDUA activity was also detected in the cerebrospinal fluid (CSF) of treated patients, accompanied by a logfold reduction in CSF GAGs in the 2 patients with longest follow up. This suggests that gene therapy accomplishes full metabolic correction of tissues, including the CNS. Gene therapy did not induce antibodies against the IDUA protein, while pre-existing antibodies induced by enzyme replacement therapy before gene therapy rapidly disappeared. Patient 1 who reached the 1-year follow-up demonstrated a stable cognitive score, improved findings on brain and spine MRI, resumed growth velocity and an improvement of his skeletal phenotype. The preliminary results from our phase I/II study compare favorably with the standard of care in terms of safety and efficacy, and highlight the potential of genetic engineering of HSPC grafts for therapeutic gain-of-function. Disclosures Gentner: Genenta Science: Consultancy, Equity Ownership, Research Funding. Parini:Shire: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Financial Support; BioMarin: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Financial Support; Ultragenyx: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Financial Support; SOBI: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Financial Support; Orphan Europe: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Financial Support; Sanofi-Genzyme: Honoraria, Membership on an entity's Board of Directors or advisory committees, Other: Financial Support. Naldini:San Raffaele Telethon Institute for Gene Therapy (SR-TIGET), a joint venture between Fondazione Telethon and Ospedale San Raffaele (OSR): Other: Wiskott-Aldrich Syndrome (WAS) gene therapy was licensed to GlaxoSmithKline (GSK) in 2014. It was then licensed to Orchard Therapeutics (OTL) in April 2018. OTL is the current sponsor of the clinical trial.; Genenta Science: Consultancy, Equity Ownership; Magenta Therapeutics: Equity Ownership. Aiuti:San Raffaele Telethon Institute for Gene Therapy (SR-TIGET), a joint venture between Fondazione Telethon and Ospedale San Raffaele (OSR): Other: Wiskott-Aldrich Syndrome (WAS) gene therapy was licensed to GlaxoSmithKline (GSK) in 2014. It was than licensed to Orchard Therapeutics (OTL) in April 2018. OTL is the current sponsor of the clinical trial.; San Raffaele Telethon Institute for Gene Therapy (SR-TIGET), a joint venture between Fondazione Telethon and Ospedale San Raffaele (OSR): Other: Study PI.

Milk contributes a vital role in nutritional security in most of the countries of the world. Recently a debate is going on worldwide that, A1 milk is harmful and A2 milk is beneficial. Though there was no supporting clinical evidence to claim these, milk is selling in the name of A2 milk for high cost without proper identification in the field level. To address this issue to both consumer and producers, scientists are in a position to rule out the A1 and A2 milk. In this study TANUVAS A1A2 detect kit was used in the A1 or A2 type milk with dried blood or milk spot. 31 samples were collected from farms and individual farmers from different places of Tiruchirappalli district. All the samples were analysed with the ready to use primer based PCRÂ test TANUVAS A1A2 detect kit. This study revealed that 20% of the crossbred cows, 78.95% of the indigenous breed cows, 66.67 % of non descriptive cows and 100 percent of the buffaloes had A2A2 genotype. The results of this study is giving the fact that, milk needs to be checked out with proper test like TANUVAS A1A2 detect before claiming for A2 milk.

Katuk (Sauropus androgynus) leaves have been traditionally used in Indonesia for increasing human breast milk production. In the previous research, katuk leaves have high moisture content, therefore katuk leaves extract were being prepared as spray dried S. androgynus extract. The freeze dried leaves were extracted with ultrasonic assisted extraction method using ethanol 80% as a solvent. Then, katuk extract was dried with spray drying method using maltodextrin as a drying aid. To improve the physical characteristics of this extract, it was mixed with mannitol, spray dried lactose, and crospovidone into S. androgynus extract powder. The results showed better physical characteristics, especially on moisture content and flow properties of powders. Metabolic profiles of all samples were analysed by thin layer chromatography (TLC) densitometry method, while the dried extract was dissolved in a suitable solvent and then spotted on GF254 and the plate was developed using a mixture of n-butanol:acetic acid:water (60:22:1.2). Based on TLC profiles, there are three different spots can be seen clearly at 366 nm on chromatogram of S. androgynus leaves, freeze dried leaves, spray dried leaves extract, and leaves extract powder. There is one spot (S3) at Rf 0.80 which is a stable chemical compound that is not affected by all factors in the entire process in S. androgynus extract powder formulations from extraction, drying, to formulation.

Abstract Objectives It is often cited that insulin in human milk (HM) increases postprandially along with maternal serum insulin. However, this response has never been documented in humans, and the characteristics of this increase remain unstudied. Methods Two healthy lactating women emptied their breasts after a fast (> 8 hours) using an electric breast pump. After consuming a 50g glucose water, each woman emptied a single breast at 15, 30, 60, 90, and 120 minutes. Skim milk was generated via centrifugation and HM glucose and insulin were measured via hexokinase assay and chemiluminescent immunoassay (Beckman Coulter). At each of these time points maternal blood was collected via finger prick and capillary glucose measured via handheld glucometer. Additional blood was spotted onto a dried blood spot (DBS) card, and maternal insulin was measured from the DBS cards via Ultrasensitive ELISA (Mercodia). Results Both insulin and glucose concentrations rose in HM after the glucose load (Figure A, B). The amplitudes of both HM insulin and glucose were lower than that of maternal circulation. Neither HM insulin nor glucose were correlated with concentrations in maternal blood. However insulin concentrations were tightly correlated with glucose concentrations in both HM (P < 0.0001, R2 = 0.84) and maternal blood (P < 0.001, R2 = 0.72). At 2 hours post-glucose challenge, both maternal blood insulin and glucose had returned to near fasting levels (insulin: 15.1 ± 7.8 µU/mL; glucose: 107 ± 4 mg/dL). However, HM insulin and glucose concentrations remained elevated (Figure A, B). At 2 hours, HM insulin remained 13 times higher than fasting concentrations and HM glucose remained 3.9 times higher than fasting concentrations. Conclusions To our knowledge, these are the first data in humans to characterize the time course of HM insulin response to an oral glucose challenge. These data will inform the design of HM composition studies when free-living HM samples are collected. The impact of variation in these components over the day on the recipient infant deserves further research. Funding Sources Internally Funded. Supporting Tables, Images and/or Graphs

Abstract Background Commencing lifelong antiretroviral therapy (ART) immediately following HIV diagnosis (Option B+), has greatly improved maternal-infant health. Thus, large and increasing numbers of HIV-infected women are on ART during pregnancy, a situation concurrently increasing numbers of HIV-exposed-uninfected (HEU) infants. Compared to their HIV-unexposed-uninfected (HUU) counterparts, HEU infants show higher rates of adverse birth outcomes, mortality, infectious/non-communicable diseases including impaired growth and neurocognitive development. There is an urgent need to understand the impact of HIV and early life ART exposures, immune-metabolic dysregulation, comorbidities and environmental confounders on adverse paediatric outcomes. Methods Six hundred (600) HIV-infected and 600 HIV-uninfected pregnant women ≥20 weeks of gestation will be enrolled from four primary health centres in high density residential areas of Harare. Participants will be followed up as mother-infant-pairs at delivery, week(s) 1, 6, 10, 14, 24, 36, 48, 72 and 96 after birth. Clinical, socio-economic, nutritional and environmental data will be assessed for adverse birth outcomes, impaired growth, immune/neurodevelopment, vertical transmission of HIV, hepatitis-B/C viruses, cytomegalovirus and syphilis. Maternal urine, stool, plasma, cord blood, amniotic fluid, placenta and milk including infant plasma, dried blood spot and stool will be collected at enrolment and follow-up visits. The composite primary endpoint is stillbirth and infant mortality within the first two years of life in HEU versus HUU infants. Maternal mortality in HIV-infected versus -uninfected women is another primary outcome. Secondary endpoints include a range of maternal and infant outcomes. Sub-studies will address maternal stress and malnutrition, maternal-infant latent tuberculosis, Helicobacter pylori infections, immune-metabolomic dysregulation including gut, breast milk and amniotic fluid dysbiosis. Discussion The University of Zimbabwe-College of Health-Sciences-Birth-Cohort study will provide a comprehensive assessment of risk factors and biomarkers for HEU infants’ adverse outcomes. This will ultimately help developing strategies to mitigate effects of maternal HIV, early-life ART exposures and comorbidities on infants’ mortality and morbidity. Trial registration ClinicalTrial.gov Identifier: NCT04087239. Registered 12 September 2019.

Late-onset Pompe disease (LOPD) is a rare autosomal recessive metabolic disorder that is caused by deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA), which is responsible for glycogen breakdown. It has a wide clinical spectrum but usually presents with limb girdle and respiratory muscles weakness. Tongue involvement has been rarely reported as the sole initial symptom of LOPD. A 65-year-old male presented with difficulty in speech and eating for a 4-year duration. He started to notice speech difficulty with production of particular speech sounds such as /l/, /d/, and /t/. Within 1 year, he developed difficulties in manipulating food with the tongue and oral residue in lateral sulci requiring digital manipulation, which was suggestive of tongue muscles weakness. Clinical examination showed tongue fasciculations, mild atrophic changes, and mild tongue weakness. Investigations showed mildly elevated creatine kinase levels, and electromyography of the tongue muscles revealed moderate spontaneous activity, denervation, chronic reinnervation with high-amplitude motor unit potentials, and positive sharp waves, with preserved recruitment. Given the diagnostic uncertainty, a screening for LOPD was performed using a dried blood spot, and GAA enzyme activity levels were found to be low; 1.06 μmol/L/h (reference values in adults: 2.10–29.00 μmol/L/h). Next-generation sequencing showed pathogenic variant in <i>GAA</i> gene, confirming the diagnosis of LOPD. This rare report of LOPD presenting with isolated tongue involvement adds to the expanding phenotypic variability of this disease. Tongue involvement is an important and early clinical sign of LOPD that needs careful evaluation and can aid in early diagnosis of this rare and treatable disease.

BACKGROUND: The rate of breakthrough infection in vaccinated Ontarians during the Omicron wave is unknown. METHODS: Active participants of the Safety and Efficacy of Preventative COVID Vaccines (STOPCoV) study (892 >age 70 years and 369 aged 30–50 years) were invited to participate in a sub-study evaluating breakthrough COVID-19 infection. Self-administered rapid antigen tests (RAT) were reported twice weekly and symptom questionnaires weekly for 6 weeks. The primary outcome was the proportion reporting positive RAT. RESULTS: 806 e-consented, 727 (90%) completed >1 RAT with total 7,116 RATs completed January 28–March 29, 2022. Twenty out of twenty-five with a positive RAT had a booster vaccine prior to the positive test. All cases were mild, none requiring hospitalization. Nineteen had positive dried blood spot analysis for IgG antibody to the receptor binding domain (RBD) prior to the positive RAT. The mean (SD) of the normalized IgG ratio to RBD was 1.22 (0.29) for younger and 0.98 (0.44) for older participants, values similar to corresponding ratios for those without positive RAT and those in the main cohort. 105 participants reported one and 96 reported >2 possible COVID-19 symptoms despite negative RAT. The false negative RAT was low (4% to 6.6 %) compared to subsequent positive nucleoprotein antibody. CONCLUSIONS: Positive RAT for COVID-19 was infrequent (3.4%). We were unable to determine a protective antibody level against breakthrough infection. Our findings can inform public health COVID-19 restrictions guidelines. Our decentralized study provides a model for rapid institution of new questions during a pandemic.

Pinus thunbergii Parl., known as black pine, is widely distributed all over China. This pine variety can prevent soil desertification and promote soil conservation and is excellent for constructing fast-growing forests and shelter belts. The timber of this species can be used for infrastructure construction and furniture production. In August 2020, needle blight symptoms were found on several trees of black pine in Sichuan Province, China. Further surveys showed that these symptoms are common while the disease incidence is less than 30% which indicated the severity of the disease is mild. The tips of old needles first turn grayish green and developed into brown bands ranging from 1 to 2 mm. To determine the pathogen, 20 needle samples with typical symptoms were disinfected with 75% alcohol, and sections of the tissue were cut from joints of diseased and healthy tissues (visually healthy) with a sterilized scalpel, surface sterilized for 45 seconds in 75% alcohol, soaked for 90 seconds in 1.5% NaCIO, rinsed in sterilized water and dried. Small cut tissues were placed on potato dextrose agar (PDA) at 25℃ for 10 days. Pure cultures were obtained by monosporic isolation. The colonies initially appeared white to cream, yeast-like, and later turned to pink and remained at least 10 days. Conidia were hyaline, smooth-walled, single-celled, and ellipsoidal with variable shape and size, 7.5 to 16 × 3.5 to 7 µm (Zalar et al. 2008). DNA was extracted from the mycelium of the isolate by the cetyltriethylammonium bromide (CTAB) method and amplified through polymerase chain reaction (PCR) with the internal transcribed spacer (ITS) region of rDNA and partial β-tubulin genes of a representative isolate (SC05) were amplified using the ITS1/ITS4 and Bt2a/Bt2b primer pairs, respectively(Wu et al. 2017). The sequences submitted to GenBank (Accession Nos. MW228368 for ITS and MW256762 for β-tubulin) showed high similarity with BLAST sequences of Aureobasidium pullulans (ITS, KR704881 [100%]; β-tubulin, MT671934 [99.49%]). For the pathogenicity test, a conidial suspension was prepared with a concentration of 2.0 × 107 conidia/ml. The suspension was sprayed onto 3 annual seedlings’ needles, and the control was sprayed with sterile water. Inoculated and non-inoculated plants were kept in humid chambers in a glasshouse. After 10 days, typical symptoms appeared on inoculated needles, whereas control needles remained symptomless. The fungus, A. pullulans, was reisolated from those lesions, confirming Koch's postulates. No symptoms were observed on control plants. Aureobasidium pullulans, a ubiquitous saprophytic fungus on many fruits and very rarely reported to cause disease on pine needles. Only reported invasion of Ozone‐injured needles in P. strobus (Costonis and Sinclair 1972) and needles damaged by acid rain in P. sylvestris (Ranta 1990). To our knowledge, this is the first report of brown spot needle blight on P. thunbergii caused by A. pullulans in China. The disease represents a threat to pine manufactures and more research on the pathogenesis and management is needed.

Arylsulfatase B is an enzyme present in the lysosomes that involves in the breakdown of large sugar molecules known as glycosaminoglycans (GAGs). Arylsulfatase B chemically modifies two GAGs, namely, dermatan sulfate and chondroitin sulfate, by removing the sulfate group. Mutations in the gene encoding the arylsulfataseB enzyme causes lysosomal storage disorder, mucopolysaccharidosis type VI (MPS VI), or Maroteaux–Lamy syndrome. In this study, we report a case of congenital hearing loss with mild pigmentary changes in the retina, indicative of Usher syndrome, and a missense variant reported as likely pathogenic for MPS VI. Sequencing results identified a pathogenic missense variant p.Arg1746Gln in the CDH23 gene. However, another missense variant ARSB:p.Arg159Cys was reported as likely pathogenic to the treating physician. Mutations in ARSB gene have been associated with MPS VI. Subsequently, ARSB enzyme activity was found low twice in dried blood spot (DBS), suggestive of MPS VI. The patient did not have the clinical features of MPS VI, but considering the wide clinical spectrum, progressive nature of MPS VI, and the fact that a treatment for MPS VI is available to prevent disease progression, further biochemical, enzymatic, and in silico studies were performed to confirm the pathogenicity of this variant. In silico tools predicted this variant to be pathogenic. However, the results of urine and serum GAGs and ARSB enzyme levels measured from patient's fibroblast were found normal. Based on clinical and biochemical findings, ARSB:p.Arg159Cys is likely benign and did not support the diagnosis of MPS VI. However, CDH23:p.Arg1746Gln, a pathogenic variant, supports the underlying cause of hearing loss. This study highlights the importance of a robust correlation between genetic results and clinical presentation, and biochemical and enzymatic studies, to achieve a differential diagnosis.

Abstract Introduction A 67-year-old man was referred for care of "asymptomatic hypertrophic cardiomyopathy". He did not have hypertension. No significant positive family history could be elicited. Electrocardiogram showed sinus rhythm with voltage criteria of left ventricular hypertrophy (LVH). Outside Transthoracic Echocardiogram (TTE) reported normal ejection fraction with asymmetric septal hypertrophy without outflow obstruction. He was put on observation for few years and was not any treatment. On first encounter in our clinic, physical examination including skin and eye assessment, and laboratory tests including renal function were unremarkable. Procedure TTE was repeated in our clinic showing normal left ventricular size with ejection fraction 55%, and impaired diastolic relaxation. There was asymmetric septal hypertrophy with septal thickness 2.1 cm (Figure A). There was mild systolic anterior motion of mitral apparatus and mild mitral regurgitation, without resting or Valsalva provoked outflow obstruction. Global longitudinal strain was -7.7% with most prominent abnormalities seen at apex, mid to basal anteroseptal and anterior wall (Figure B). Further assessment by Cardiac MRI showed similar asymmetric septal wall thickening. Late gandolinium enhancement study demonstrated patchy fluffy hyperenhancement of the mid wall of the basal to mid anteroseptal segment, and mid to apical anterior segment, suggestive of myocardial fibrosis (Figure C1 and C2). Dried spot blood was sent to Taiwan for enzyme study which revealed partial acid alpha-galactosidase A deficiency. Further genetic study detected a mutation of Hemizygous NM_000169.2(GLA):c.640-801[G &gt; A] at intron 4. Finally endomyocardial biopsy was done which confirmed the cardiac involvement of Fabry disease (Figure D, myelin body shown under electron microscopy). This gentleman was referred for consideration of Enzyme Replacement Therapy (ERT). Discussion Fabry disease is an X-linked glycolipid storage disease with accumulation of globotriaosylceramide in lysosomes in multiple cell types throughout the body leading to various organ involvement. Cardiac manifestations include unexplained LVH, valvular regurgitation, conduction abnormalities etc. It occurs in up to 0.3-5% of patients with hypertrophic cardiomyopathy. Fabry disease should be considered as a differential diagnosis in all men with sporadic or non-autosomal dominant transmission of unexplained LVH, since treatment with ERT is available which may reduce LVH and improve myocardial function, although any impact on long term outcome has not yet been established. Conclusion This case illustrated a rare but potentially treatable cause of hypertrophic cardiomyopathy. Myocardial strain imaging should be integrated in routine TTE study for assessment of unexplained left ventricular hypertrophy. Multi-modality imaging and multi-specialty approach help in identifying patients of cardiac variant of Fabry disease who may benefit from ERT. Abstract P873 Figure.

Polygonatum odoratum (Mill.) Druce is a perennial herb in the Liliaceae family and it is one of the traditional Chinese medicinal plants. Modern pharmaceutical studies demonstrate that P. odoratum contains polysaccharides, saponins, alkaloids, flavonoids, volatile oil, and other active components (Jiang-Nan, et al., 2018). From May to June 2022, the stem spot disease was discovered on P. odoratum in the planting demonstration garden in Changsha (28°20N; 113°07E), Hunan province of China. The disease seriously retarded plant growth and was estimated to have affected approximately 40-50% of the plants, significant economic losses to growers. Plants had oval tan spots on the stems, which were light in the center and dark at the margin. The spots in the back expanded and joined together, where the disease was severe, and chlorosis was near the stem spot, while many leaves turned completely yellow and withered before falling to the ground. Finally, the whole plant faded to light green and dried up. In order to isolate pathogens, symptomatic stem samples (5×5 mm) were collected from the edges of the lesions and excised symptomatic tissues consisting of diseased and healthy parts were surface-sterilized with 2% solution of sodium hypochlorite (0.1% active ingredient of chlorine) for 1 min and 75% ethanol for 30 s. The samples were then washed thrice with sterile distilled water, air-dried on the sterile filter papers under aseptic conditions, and finally plated onto Potato Dextrose Agar (PDA) plates, which were incubated at 25 °C for 24 h to 36 h in the dark. Additionally, the emerging fungal hyphal tips were transferred to PDA and purified by the single-spore method. Next, forty plants with stem spots were isolated, and 8 cultures with the same appearance were obtained. Two strains coded hnxryzj and hnxryzj1 were randomly selected, for identification. With a mean radial growth rate of 7.5 mm/day, white and dense colonies were observed after 6 days of culture on PDA. After hnxryzj was cultured on SNA, microconidia were oval or ovate (9.25-14.8µm × 2.18-3.76µm), macroconidia were sickle-shaped and slightly curved, with 2-5 septa (21.52-23.49µm × 2.64-4.51µm (n = 50)). These morphological characteristics were consistent with the description of Fusarium oxysporum (Mirghasempour, et al., 2022) Furthermore, we amplified the partial region of the internal transcribed spacer (ITS) region, the translation elongation factors EF-1α, β-tubulin, polymerase II largest subunit (RPB1) and RNA polymerase II second largest subunit (RPB2) genes from strain hnxryzj and hnxryzj1, based on the primer pairs ITS1/ITS4, EF728F/EF986R, Bt2a/Bt2b, RPB1-F5/RPB1-R8 and fRPB2-5F2/fRPB2-7cR (Li, et al., 2013, Xie, et al., 2022), and amplicons were sequenced by Tsingke Biotechnology Co. Ltd. By sequence alignment, the ITS, EF-1α, β-tubulin , RPB1 and RPB2 of hnxryzj and hnxryzj1 were identical, respectively. The sequence alignment of hnxryzj and hnxryzj1 with the Fusarium ID database and NCBI shows the following results: the ITS region, EF-1α, RPB1 and RPB2 sequences of the strain hnxryzj (GenBank accession nos. ON872218, ON897740, OP467556 and OP467557) and hnxryzj1 (GenBank accession nos. OP071248, OP087208, OP467558 and OP467559) were 100% identical to those of F. oxysporum (GenBank accession nos. MZ890536, LC469784 , MT179509 and MW368380, respectively); whereas the β-tubulin sequences of the strain hnxryzj (GenBank accession nos. ON897741) and hnxryzj1 (GenBank accession nos. OP087207) were 96.9% identical to those of F.oxysporum (CBS144135 GenBank accession nos. MH485136). Subsequently, a phylogenetic tree was established combining EF-1α, RPB1, and RPB2. Strains hnxryzj and hnxryzj1 were F.oxysporum (JW257006 GenBank accession nos. MZ921883, MZ921657 and MZ921752)(Torres-Cruz, et al., 2022), with bootstrap values 100%. The pathogenicity test was carried out by placing mycelial discs obtained from colonies that had been actively growing on PDA for 6 days. In the pathogenicity test, two sets (5 plants in each set) of potted plants, whose stems were wounded, were taken. In one set (5 plants), the PDA cakes with F. oxysporum (d=5mm, the same below) were inoculated on the stems scratched by an inoculation needle (sterilized) (the front of the colony was close to the wound of the stem). In the other set (5 plants), potted plants inoculated with the sterile PDA cakes were served as controls. In a 25 °C greenhouse, each treatment was given a 12h/12h light/dark cycl(Nabi, et al., 2019). The symptoms were observed, and the fungus cake was removed 5 days after inoculation. Then, after 18 days, typical symptoms of oval tan spots similar to original diseased plants in the field were found on the inoculated stems, and 32 days later, the inoculated plant died, while the control stems remained asymptomatic. In addition, F. oxysporum was isolated and identified from the inoculated, symptomatic stems, verifying Koch's postulates. Based on our knowledge, this is the first report of F. oxysporum causing stem spots on P. odoratum in China. Only one other study from China that root rot of Phyllostachys officinalis also resulted from F. oxysporum (Pang, et al., 2022). Furthermore, P. odoratum is an medicinal material in Hunan province. Therefore, comprehensive prevention and control methods are required.

Abstract Background Anderson-Fabry Disease (AFD, OMIM 301500) is a rare X-linked lysosomal storage disorder caused by GLA gene mutation resulting in a deficit or absent activity of the α-galactosidase A enzyme (α-Gal A). This deficiency involves the impossibility of cleavage of glycophospholipids, resulting in an intralisosomal accumulation of them in different tissues. Due to an incidence of 1 in 80000, AFD is considered the second most common glycosphingolipid storage disorder after Gaucher disease. Cardiac manifestations include left ventricular hypertrophy (LVH) and arrhythmias. The rate of pacemaker implantation (PMI) in AFD has been described to be 25 times higher than in the general population, and the requirement of PMI has been reported to be as high as 8% in some AFD series. In this context, the presence of conduction abnormalities in young patients may suggest an undiagnosed AFD.1 Therefore, early diagnosis is important in AFD because appropriate therapies seem to be more effective when initiated promptly. Purpose Our aim is to detect AFD among relatively patients with unexplained conduction disturbances requiring PMI, not submitted to newborn screening. Methods Among 650 patients afferent to our ambulatory for routinary pacemaker follow-up, we considered a selected population with diagnosis of sinus node dysfunction or atrioventricular block (confirmed by atrial pacing rate ≥ 60% or ventricular pacing percentage ≥ 80%) and an age, at the time of PMI, ranging between ≥40 and ≤70 years old. The exclusion criteria were: patients with previous myocardial infarction; patient whit known cardiac disease (such as hypertrophic cardiomyopathy); patients who underwent cardiac surgery and patients with extracardiac disease with cardiac involvement such as autoimmune disorders. For this cohort of 26 adult patients (13 males; 13 females; mean age 63 ± 7 years) a prospective screening study for AFD was performed. After clinical evaluation, transthoracic echocardiography (analyzing signs of left ventricular hypertrophy) and pacemaker check, a dried blood spot sampled in filter paper was analyzed. This filter paper assay was performed in male patients in order to evaluate the α-Galactosidase A enzyme activity through the detection of Fabry disease biomarkers; only in the case of abnormal values, genetic investigation was performed. In female patients, the analysis was exclusively genetic. Results The analyses revealed 58% (15/26) of patients affected by mild LVH (IVS diameter ranging from 11 to 15 mm). No patient had severe LVH (IVS diameter ≥15 mm) or moderate-severe renal dysfunction (more than stage 3B, GFR below than 30-44 mL/min). In the restrict cohort considered, we found one 69 yo female patient with heterozygosis GLA pathogenic mutation, NM_000169.2:c.638A&gt;C p.(Lys213Thr). She had normal value of liso-Gb3 1,1 ng/ml (n.v. ≤ 1,8 ng/ml). She had mild LVH (IVS diameter 12 mm) and no renal dysfunction. Familiar screening was programmed. Conclusion In a highly selected sample of relatively young patients with conduction disturbances requiring pacemaker implantation, a female patient with genetic mutation causing AFD has been identified. Therefore, it seems that screening efforts should be increased in this patient population. 1 Hemelsoet D, De Keyser J, Van Heuverswyn F et al. Screening for Fabry Disease in Male Patients With Arrhythmia Requiring a Pacemaker or an Implantable Cardioverter-Defibrillator. Circulation. 2021 Feb 23;143(8):872-874. doi: 10.1161/CIRCULATIONAHA.120.051400.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

The first time I read Hélène Cixous’s The Laugh of the Medusa I swooned. I wanted to write the whole thing out, large, and black, and pin it across an entire wall. I was 32 and vulnerable around polemic texts (I was always copying out quotes and sticking them to my walls, trying to hold onto meaning, unable to let the writing I read slip out and away). You must "write your self, your body must be heard" (Cixous 880), I read, as if for the hundredth time, even though it was the first. Those decades old words had an echoing, a resonance to them, as if each person who had read them had left their own mnemonic mark there, so that by the time they reached me, they struck, immediately, at my core (not the heart or the spine, or even the gut, but somewhere stickier; some pulsing place in amongst my organs, somewhere not touched, a space forgotten). The body that read The Laugh was so big its knees had trouble lifting it from chairs (“more body, hence more writing”, Cixous 886), and was soon to have its gallbladder taken. Its polycystic ovaries dreamed, lumpily and without much hope, of zygotes. The body that read The Laugh was a wobbling thing, sheathed in fat (as if this could protect it), with a yearning for sveltness, for muscle, for strength. Cixous sang through its cells, and called it to itself. The body that read The Laugh wrote itself back. It spoke about dungeons, and walls that had collected teenaged fists, and needles that turned it somnambulant and concave and warm until it was not. It wrote trauma in short and staggering sentences (out, get it out) as if narrative could save it from a fat-laden and static decline. Text leaked from tissue and bone, out through fingers and onto the page, and in increments so small I did not notice them, the body took its place. I was, all-of-a-sudden, more than my head. And then the body that read The Laugh performed the ultimate coup, and conceived.The body wrote then about its own birth, and the birth of its mother, and when its own children were born, of course, of course, about them. “Oral drive, anal drive, vocal drive–all these drives are our strengths, and among them is the gestation drive–all just like the desire to write: a desire to live self from within, a desire for the swollen belly, for language, for blood” (Cixous 891). The fat was gone, and in its place this other tissue, that later would be he. What I know now is that the body gets what the body wants. What I know now is that the body will tell its story, because if you “censor the body [… then] you censor breath and speech at the same time” (Cixous 880).I am trying to find a beginning. Because where is the place where I start? I was never a twinkle in my mother’s eye. It was the seventies. She was 22 and then 23–there was nothing planned about me. Her eyes a flinty green, hair long and straight. When I think of her then I remember this photo: black and white on the thick photo paper that is hard to get now. No shiny oblong spat from a machine, this paper was pulled in and out of three chemical trays and hung, dripping, in a dark red room to show me a woman in a long white t-shirt and nothing else. She stares straight out at me. On the shirt is a women’s symbol with a fist in the middle of it. Do you know the one? It might have been purple (the symbol I mean). When I think of her then I see her David Bowie teeth, the ones she hated, and a packet of Drum tobacco with Tally-Hos tucked inside, and some of the scars on her forearms, but not all of them, not yet. I can imagine her pregnant with me, the slow gait, that fleshy weight dragging at her spine and pelvis. She told me the story of my birth every year on my birthday. She remembers what day of the week the contractions started. The story is told with a kind of glory in the detail, with a relishing of small facts. I do the same with my children now. I was delivered by forceps. The dent in my skull, up above my right ear, was a party trick when I was a teenager, and an annoyance when I wanted to shave my head down to the bone at 18. Just before Jem was born, I discovered a second dent behind my left ear. My skull holds the footprint of those silver clamps. My bones say here, and here, this is where I was pulled from you. I have seen babies being born this way. They don’t slide out all sealish and purple and slippy. They are pulled. The person holding the forcep handles uses their whole body weight to yank that baby out. It makes me squirm, all that pulling, those tiny neck bones concertinaing out, the silver scoops sinking into the skull and leaving prints, like a warm spoon in dough. The urgency of separation, of the need to make two things from one. After Jem was born he lay on my chest for hours. As the placenta was birthed he weed on me. I felt the warm trickle down my side and was glad. There was nothing so right as my naked body making a bed for his. I lay in a pool of wet (blood and lichor and Jem’s little wee) and the midwives pushed towels under me so I wouldn’t get cold. He sucked. White waffle weave blankets over both of us. That bloody nest. I lay in it and rested my free hand on his vernix covered back; the softest thing I had ever touched. We basked in the warm wet. We basked. How do I sew theory into this writing? Julia Kristeva especially, whose Stabat Mater describes those early moments of holding the one who was inside and then out so perfectly that I am left silent. The smell of milk, dew-drenched greenery, sour and clear, a memory of wind, of air, of seaweed (as if a body lived without waste): it glides under my skin, not stopping at the mouth or nose but caressing my veins, and stripping the skin from the bones fills me like a balloon full of ozone and I plant my feet firmly on the ground in order to carry him, safe, stable, unuprootable, while he dances in my neck, floats with my hair, looks right and left for a soft shoulder, “slips on the breast, swingles, silver vivid blossom of my belly” and finally flies up from my navel in his dream, borne by my hands. My son (Kristeva, Stabat Mater 141). Is theory more important than this? The smell of milk (dried, it is soursweet and will draw any baby to you, nuzzling and mewling), which resides alongside the Virgin Mother and the semiotics of milk and tears. The language of fluid. While the rest of this writing, the stories not of mothers and babies, but one mother and one baby, came out smooth and fast, as soon as I see or hear or write that word, theory, I slow. I am concerned with the placement of things. I do not have the sense of being free. But if there’s anything that should come from this vain attempt to answer Cixous, to “write your self. Your body must be heard” (880), it should be that freedom and theory, boundary-lessness, is where I reside. If anything should come from this, it is the knowing that theory is the most creative pursuit, and that creativity will always speak to theory. There are fewer divisions than any of us realise, and the leakiness of bodies, of this body, will get me there. The smell of this page is of lichor; a clean but heady smell, thick with old cells and a foetus’s breath. The smell of this page is of blood and saliva and milk mixed (the colour like rotten strawberries or the soaked pad at the bottom of your tray of supermarket mince). It is a smell that you will secretly savour, breathe deeply, and then long for lemon zest or the sharpness of coffee beans to send away that angelic fug. That milk and tears have a language of their own is undeniable. Kristeva says they are “metaphors of non-language, of a ‘semiotic’ that does not coincide with linguistic communication” (Stabat Mater 143) but what I know is that these fluids were the first language for my children. Were they the first language for me? Because “it must be true: babies drink language along with the breastmilk: Curling up over their tongues while they take siestas–Mots au lait, verbae cum lacta, palabros con leche” (Wasserman quoted in Giles 223). The enduring picture I have of myself as an infant is of a baby who didn’t cry, but my mother will tell you a different story, in the way that all of us do. She will tell you I didn’t smile until I was five months old (Soli and Jem were both beaming at three months). Born six weeks premature, my muscles took longer to find their place, to assemble themselves under my skin. She will tell you I screamed in the night, because all babies do. Is this non-language? Jem was unintelligible much of the time. I felt as if I was holding a puzzle. Three o’clock in the morning, having tried breastfeeds, a bath with Nick Drake’s Pink Moon, bouncing him in a baby sling on the fitball (wedged into a corner so that if I nodded off I would hopefully swoon backwards, and the wall would wake me), walking him around and around while rocking and singing, then breastfeeding again, and still he did not sleep, and still he cried and clawed at my cheeks and shoulders and wrists and writhed; I could not guess at what it was he needed. I had never been less concerned with the self that was me. I was all breasts and milk and a craving for barbecued chicken and watermelon at three in the morning because he was drinking every ounce of energy I had. I was arms and a voice. I was food. And then I learnt other things; about let downs and waking up in pools of the stuff. Wet. Everywhere. “Lactating bodies tend towards anarchy” (Bartlett 163). Any body will tend towards anarchy – there is so much to keep in – but there are only so many openings a person can keep track of, and breastfeeding meant a kind of levelling up, meant I was as far from clean and proper as I possibly could be (Kristeva, Powers of Horror 72).In the nights I was not alone. Caren could not breastfeed him, but could do everything else, and never said I have to work tomorrow, because she knew I was working too. During waking hours I watched him constantly for those mystical tired signs, which often were hungry signs, which quickly became overtired signs. There was no figuring it out. But Soli, with Soli, I knew. The language of babies had been sung into my bones. There is a grammar in crying, a calling out and telling, a way of knowing that is older than I’ll ever be. Those tiny bodies are brimming with semiotics. Knees pulled up is belly ache, arching is tired, a look to the side I-want-that-take-me-there-not-there. There. Curling in, the whole of him, is don’t-look-at-me-now-hands-away. Now he is one he uses his hands to tell me what he wants. Sign language because I sign and so, then, does he, but also an emphatic placing of my hands on his body or toys, utensils, swings, things. In the early hours of a Wednesday morning I tried to stroke his head, to close his wide-open eyes with my fingertips. He grabbed my hand and moved it to his chest before I could alight on the bridge of his nose. And yesterday he raised his arm into the air, then got my hand and placed it into his raised hand, then stood, and led me down to the laundry to play with the dustpan and broom. His body, literally, speaks.This is the language of mothers and babies. It is laid down in the darkest part of the night. Laid down like memory, like dreams, stitched into tiredness and circled with dread adrenalin and fear. It will never stop. That baby will cry and I will stare owl-eyed into the dark and bend my cracking knees (don’t shake the baby it will only make it worse don’t shake don’t). These babies will grow into children and then adults who will never remember those screaming nights, cots like cages, a stuffed toy pushed on them as if it could replace the warmth of skin and breath (please, please, little bear, replace the warmth of skin and breath). I will never remember it, but she will. They will never remember it, but we will. Kristeva says too that mothers are in a “catastrophe of identity which plunges the proper Name into that ‘unnameable’ that somehow involves our imaginary representations of femininity, non-language, or the body” (Stabat Mater 134). A catastrophe of identity. The me and the not-me. In the night, with a wrapped baby and aching biceps, the I-was batting quietly at the I-am. The I-am is all body. Arms to hold and bathe and change him, milk to feed him, a voice to sing and soothe him. The I-was is a different beast, made of words and books, uninterrupted conversation and the kind of self-obsession and autonomy I didn’t know existed until it was gone. Old friends stopped asking me about my day. They asked Caren, who had been at work, but not me. It did not matter that she was a woman; in this, for most people we spoke to, she was the public and I was the private, her work mattered and mine did not. Later she would commiserate and I would fume, but while it was happening, it was near impossible to contest. A catastrophe of identity. In a day I had fed and walked and cried and sung and fed and rocked and pointed and read books with no words and rolled inane balls across the lounge room floor and washed and sung and fed. I had circled in and around while the sun traced its arc. I had waited with impatience for adult company. I had loved harder than I ever had before. I had metamorphosed and nobody noticed. Nobody noticed. A catastrophe of identity it was, but the noise and visibility that the word catastrophe invokes was entirely absent. And where was the language to describe this peeling inside out? I was burnished bright by those sleepless nights, by the requirement of the I-am. And in those nights I learned what my mother already knew. That having children is a form of grief. That we lose. But that we gain. At 23, what’s lost is possibility. She must have seen her writer’s life drilling down to nothing. She knew that Sylvia Plath had placed her head, so carefully on its pillow, in that gas filled place. No pungent metaphor, just a poet, a mother, who could not continue. I had my babies at 34 and 36. I knew some of what I would lose, but had more than I needed. My mother had started out with not enough, and so was left concave and edged with desperation as she made her way through inner-city Sydney’s grime, her children singing from behind her wait for me, wait for me, Mama please wait for me, I’m going just as fast as I can.Nothing could be more ‘normal’ than that a maternal image should establish itself on the site of that tempered anguish known as love. No one is spared. Except perhaps the saint or the mystic, or the writer who, by force of language, can still manage nothing more than to demolish the fiction of the mother-as-love’s-mainstay and to identify with love as it really is: a fire of tongues, an escape from representation (Kristeva, Stabat Mater 145).We transformed, she and I. She hoped to make herself new with children. A writer born of writers, the growing and birthing of our tiny bodies forced her to place pen to paper, to fight to write. She carved a place for herself with words but it kept collapsing in on her. My father’s bi-polar rages, his scrubbing evil spirits from the soles of her shoes in the middle of the night, wore her down, and soon she inhabited that maternal image anyway, in spite of all her attempts to side step it. The mad mother, the single mother, the sad mother. And yes I remember those mothers. But I also remember her holding me so hard sometimes I couldn’t breathe properly, and that some nights when I couldn’t sleep she had warm eyes and made chamomile tea, and that she called me angel. A fire of tongues, but even she, with her words, couldn’t escape from representation. I am a writer born of writers born of writers (triply blessed or cursed with text). In my scramble to not be mad or bad or sad, I still could not escape the maternal image. More days than I can count I lay under my babies wishing I could be somewhere, anywhere else, but they needed to sleep or feed or be. With me. Held captive by the need to be a good mother, to be the best mother, no saint or mystic presenting itself, all I could do was write. Whole poems sprang unbidden and complete from my pen. My love for my children, that fire of tongues, was demolishing me, and the only way through was to inhabit this vessel of text, to imbibe the language of bodies and tears and night, and make from it my boat.Those children wrote my body in the night. They taught me about desire, that unbounded scribbling thing that will not be bound by subjectivity, by me. They taught me that “the body is literally written on, inscribed, by desire and signification” (Grosz 60), and every morning I woke with ashen bones and poetry aching out through my pores, with my body writing me.This Mother ThingI maintain that I do not have to leavethe house at nightall leathery and eyelinered,all booted up and raw.I maintain that I do not miss thosesmoky rooms (wait that’s not allowed any more)where we strut and, without looking,compare tattoos.Because two years ago I had you.You with your blonde hair shining, your eyes like a creek after rain, that veinthat’s so blue on the side of your small nosethat people think you’ve been bruised.Because two years ago you cameout of me and landed here and grew. There is no going out. We (she and me) washand cook and wash and clean and love.This mother thing is the making of me but I missthose pulsing rooms,the feel of all of you pressing in onall of me.This mother thing is the making of me. And in text, in poetry, I find my home. “You only have to look at the Medusa straight on to see her. And she’s not deadly. She’s beautiful and she’s laughing” (Cixous 885). The mother-body writes herself, and is made new. The mother-body writes her own mother, and knows she was always-already here. The mother-body births, and breastfeeds, and turns to me in the aching night and says this: the Medusa? The Medusa is me.ReferencesBartlett, Alison. Breastwork: Rethinking Breastfeeding. Sydney: UNSW Press, 2005.Cixous, Hélène, Keith Cohen, and Paula Cohen (Trans.). "The Laugh of the Medusa." Signs 1.4 (1976): 875-93. Giles, Fiona. Fresh Milk. Crows Nest, NSW: Allen & Unwin, 2003. Grosz, Elizabeth. Volatile Bodies: Toward a Corporeal Feminism. St Leonards, NSW: Allen & Unwin, 1994.Kristeva, Julia, and Leon S. Roudiez (Trans.) Powers of Horror: An Essay on Abjection. New York: Columbia University Press, 1982.Kristeva, Julia, and Arthur Goldhammer (Trans.). "Stabat Mater." Poetics Today 6.1-2 (1985): 133-52.