To see the other types of publications on this topic, follow the link: Dominican identities.
Journal articles on the topic 'Dominican identities'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Dominican identities.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Bailey, Benjamin. "The Language of Multiple Identities among Dominican Americans." Journal of Linguistic Anthropology 10, no. 2 (December 2000): 190–223. http://dx.doi.org/10.1525/jlin.2000.10.2.190.
Full text
2
Arias Álvarez, Alba. "A Little Caribbean in Madrid: analysis of the Dominican identity in the public space." Lengua y migración 2, no. 15 (January 24, 2024): 105–31. http://dx.doi.org/10.37536/lym.2.15.2023.2198.
Full textAbstract:
According to the field of sociolinguistics of globalization, migrants resettle in new countries through deterritorialization and reterritorialization processes, which entail changes in the perception of the language and symbols of the homeland and those of the communities that migrants establish themselves in. Given that this contextual relation is expressed in the public space, the present study analyzes how Dominican resources are used in the linguistic and semiotic landscape of Tetuán, a well-known Dominican neighborhood of Madrid. Using both quantitative and qualitative methodologies, results show both the presence of the Dominican Spanish as well as Dominican symbols in the public space. Findings suggest that the Dominican community in Madrid has adapted their new place to make it more similar to their homeland, the Dominican Republic, reterritorializing the linguistic and semiotic landscape of Tetuán while building and shaping new identities. This study contributes to the body of research on linguistic landscape and linguistic attitudes in multilingual settings.
3
Zimmerman, Tegan. "Unauthorized Storytelling: Reevaluating Racial Politics in Julia Alvarez’s In the Time of the Butterflies." MELUS 45, no. 1 (2020): 95–116. http://dx.doi.org/10.1093/melus/mlz067.
Full textAbstract:
Abstract This article revisits Julia Alvarez’s critically acclaimed historical novel In the Time of the Butterflies (1994). While much scholarship has paid attention to the novel as historiographic metafiction, its depiction of Rafael Leónidas Trujillo’s regime (1930-61), and its feminist perspective on the Dominican Republic, its racial politics are under-studied. In particular, scholars have overlooked Fela, the Afra-Dominican servant, spirit medium, and storyteller. I argue that studying Fela’s presence in the text as an unauthorized and unauthored voice not only adds complexity to the production of historiography and storytelling but also provides new insight into postcolonial feminist critiques of voice/lessness, narrative, and marginalized identities in the novel and criticism on it. Closely analyzing Fela’s voice—as it intersects with storytelling, historical slave narratives, Vodou, the maternal, and Haiti’s contribution to the Dominican Republic’s history—makes visible the unacknowledged yet essential role of the Afra-Dominican not only in this novel specifically but also to the Dominican Republic more generally.
4
Bormpoudaki, Maria. "Evidence of Dominican Imagery and Cultural Identities on Venetian Crete at the Time of the Revolt of St Titus." Frankokratia 3, no. 2 (November 18, 2022): 121–42. http://dx.doi.org/10.1163/25895931-12340021.
Full textAbstract:
Abstract Current discourse on Latin imagery in rural Greek churches in Venetian Crete is habitually focused on images of St Francis. The explanations offered by scholars concerning his appearances in this context usually revolve around Francis’s perceived interconfessional appeal, but the introduction of another Latin saint from a different mendicant order into the monumental art of Byzantine character on Crete revises this picture significantly. The present article discusses images of Dominican saints found in Cretan churches of the Venetian period. With statutes promulgated in 1254 and 1256, the General Chapter of the Dominicans encouraged the veneration of Dominican saints through the dissemination of their images, and the representation of St Peter Martyr in his eponymous church in Candia clearly constitutes a visual testimony to this policy. At the same time, the portrait of St Peter Martyr in the Greek (Orthodox) church of St George in the village of Apostoloi in Pediada (in the wider Candia region) provides grounds for a discussion of cultural difference in Venetian Crete, as well as for the interaction between the Latin and Greek communities around the time of the revolt of St Titus. In my view, this representation, which is currently the only known example in a Greek church, should be re-examined in light of the prominent Venetian presence in the aforementioned region and the specificity of the local context.
5
Candelario, Ginetta E. B. ""Black Behind the Ears"——and Up Front Too? Dominicans in The Black Mosaic." Public Historian 23, no. 4 (2001): 55–72. http://dx.doi.org/10.1525/tph.2001.23.4.55.
Full textAbstract:
This article considers the formation and representation of Washington, D.C.'s Dominican community in the Anacostia Museum's 1994 -1995 exhibit, Black Mosaic: Community, Race and Ethnicity Among Black Immigrants in D.C. The exhibit successfully pointed to the extensive historical presence of African Diaspora peoples in Latin America and explored the development of subsequent Diaspora from those communities into Washington, D.C. The case of Dominican immigrants to D.C., however, illustrates the continued privileging of a U.S.- or Anglo-centric ideation of African-American history and identity. I argue that a more accurate and politically useful formulation would call for an understanding that the African Diaspora first arrived in what would become Santo Domingo and was constitutive of Latin America several centuries before the arrival of Anglo colonizers and the formation of what would become the United States; that slavery was a polyfacetic institution that articulated with particular colonial and imperial systems and local economies in the Americas in ways that subsequently influenced racial orders and identities in multiple ways, both at home and in Diaspora; and that Dominicans' negotiations of the competing demands of blackness and Latinidad make these points especially salient.
6
DURÁN-ALMARZA, EMILIA MARÍA. "Ciguapas in New York: Transcultural Ethnicity and Transracialization in Dominican American Performance." Journal of American Studies 46, no. 1 (February 2012): 139–53. http://dx.doi.org/10.1017/s0021875811001332.
Full textAbstract:
The Dominican American community in New York is perhaps one of the best examples of how processes of transculturation are affecting traditional definitions of ethnic identification. Given the intense economic, social and cultural transnational exchanges between the island and the USA from the 1960s, Dominicanyorks have been challenging the illusion of homogeneity in the definition of Americanness for decades, creating transnational social networks that transcend traditional national and ethnographic boundaries. The theatrical works of Josefina Báez, a Dominican American performer living in New York, and Sherezada (Chiqui) Vicioso, a Dominican poet and playwright who lived and worked in the US metropolis for decades before moving back to the Dominican Republic, lyrically explore issues of diaspora, identity and migration and the impact these phenomena might have in the lives of migrant Dominican women. Presenting diasporic experiences from two differing but interconnected locales – New York and the Dominican Republic – these plays offer two complementary views on the ways in which ethnicity, race, social class, age and geopolitical location interact in the formation of transcultural identities, thus contributing to develop a hemispheric approach to the study of identity formation in the Americas.
7
Bailey, Benjamin. "Dominican-American Ethnic/ Racial Identities and United States Social Categories." International Migration Review 35, no. 3 (September 2001): 677–708. http://dx.doi.org/10.1111/j.1747-7379.2001.tb00036.x.
Full text
8
Majkowska, Karolina. "“Neither Here Nor There.” The Experience of Borderless Nation in Contemporary Dominican-American Literature." Colloquia Humanistica, no. 6 (November 22, 2017): 113–24. http://dx.doi.org/10.11649/ch.2017.009.
Full textAbstract:
“Neither Here Nor There.” The Experience of Borderless Nation in Contemporary Dominican-American LiteratureDiscussing migrant identities, critics very often focus on the state in-between, the state between the borders, or being neither here nor there, and a migrant group that seems to epitomize this in-between condition is the Dominican-Americans. Consequently, the article seeks to examine the experience of in-betweenness, of being suspended between the boundaries and borders of two countries in selected texts of contemporary Dominican-American writers: Junot Díaz’s novel The Brief Wondrous Life of Oscar Wao and a short story “Monstro,” and Angie Cruz’s Soledad. It aims to analyze how the texts discuss the experience of in-betweenness through hybridity (for instance intertextuality and magical realism) with the use of tools offered by the neo-baroque esthetics. „Ani tu, ani tam”. Doświadczenie narodu bez granic we współczesnej literaturze dominikańsko-amerykańskiejAnaliza tożsamości imigrantów często skupia się na byciu pomiędzy, egzystowaniu między granicami, a także braku przynależności do żadnej z kultur. Grupa, która wydaje się uosabiać ten stan, to migranci z Republiki Dominikany w Stanach Zjednoczonych. Niniejszy artykuł podejmuje temat doświadczenia bycia pomiędzy, zawieszenia pomiędzy granicami i między dwoma krajami w wybranych tekstach współczesnych pisarzy dominikańsko-amerykańskich: powieści Krótki i niezwykły żywot Oscara Wao i opowiadania „Monstro” Junota Díaza oraz powieści Soledad Angie Cruz. Celem artykułu jest analiza doświadczenia bycia pomiędzy wyrażanego poprzez hybrydę, czemu służą narzędzia oferowane przez estetykę neobarokową, a także poprzez intertekstualność i realizm magiczny.
9
Ögüt, Özlem. "(Dis)Claiming Identity: Christina García's The Agüero Sisters and Julia Alvarez' How the García Girls Lost Their Accents." Ethnic Studies Review 26, no. 1 (January 1, 2003): 135–56. http://dx.doi.org/10.1525/esr.2003.26.1.135.
Full textAbstract:
Christine Garcia's The Aguero Sisters and Julia Alvarez's How the Garcia Girls Lost Their Accents are novels that revolve around the conflicts and tensions among the members of the two immigrant families, the Aguero sisters from Cuba and the Garcia sisters from the Dominican Republic, arising mainly from their need to come to terms with their ambiguous identities. This article focuses on the ways in which the Aguero and Garcia sisters through their hybrid identities overcome boundaries and exclusive categories so as to challenge homogenizing, hegemonic systems, and open vistas into new, non-essentialist modes of identity that still can be represented in their specific configurations.
10
Sawyer, Mark Q., and Tianna S. Paschel. "“WE DIDN'T CROSS THE COLOR LINE, THE COLOR LINE CROSSED US”." Du Bois Review: Social Science Research on Race 4, no. 2 (2007): 303–15. http://dx.doi.org/10.1017/s1742058x07070178.
Full textAbstract:
We examine the interlinked migrations between the Dominican Republic and Haiti, between the Dominican Republic and the Commonwealth of Puerto Rico, and, finally, migrations from these three countries to the United States. The literature tends to draw stark differences between race and racism in the United States and the nonracial societies of Puerto Rico and the Dominican Republic. However, although Blackness is a contextual category, through analyzing how “Black” migrants are racialized using these three contexts, we find that there is a simultaneously global and local derogation of “Blackness” that places Black migrants at the bottom of socioeconomic hierarchies. Further, these migrants remain largely outside of conceptions of the nation, and thus Blackness is constructed as a blend of racial phenotype and national origin, whereby native “Blacks” attempt to opt out of Blackness on account of their national identity. This dynamic is particularly true in the Caribbean where Blanqueamiento, or Whitening, is made possible through a dialectical process in which a person's Whiteness, or at least his or her non-Blackness, is made possible by contrast to an “Other.” Consequently, we argue that immigration becomes a key site for national processes of racialization, the construction of racial identities, and the maintenance of and contestation over racial boundaries.
11
Jones, Claire Taylor. "Negotiating Liturgical Obligations in Late Medieval Dominican Convents." Church History 91, no. 1 (March 2022): 20–40. http://dx.doi.org/10.1017/s0009640722000646.
Full textAbstract:
AbstractLiturgy has often served as a source for studying the identities of medieval religious communities through examining local saints and special chants or ceremonies. This article deepens such approaches by considering the practice of liturgical coordination, which required each convent to reconcile the obligations imposed upon it by the order to which it belonged, the diocese in which it lay, and the personal networks of its sisters. The shifting dates of the Easter cycle created a wide variety of possible calendrical conflicts and necessitated that each convent's liturgical practice be organized anew every year. Focusing on German-language liturgical manuals from Observant Dominican convents, this article introduces these sources and examines the various obligations, authorities, and sources of advice that Dominican sisters coordinated when planning each year's liturgy. It then turns to the concrete example of a major calendrical conflict on May 1, 1519, which illustrates how convents negotiated their networked obligations and defended their decisions. Supplementing traditional sources such as chronicles and charters, liturgical administrative documents reveal how each convent's liturgical identity was both iterative and networked and how the tensions between these features opened up spaces for assertive decision-making.
12
Roessingh, Carel, and Hanneke Duijnhoven. "Small Entrepreneurs and Shifting Identities: The Case of Tourism in Puerto Plata (Northern Dominican Republic)." Journal of Tourism and Cultural Change 2, no. 3 (March 2005): 185–202. http://dx.doi.org/10.1080/14766820508668663.
Full text
13
Decena, Carlos Ulises. "Code-Swishing." Journal of Language and Sexuality 1, no. 1 (March 1, 2012): 59–78. http://dx.doi.org/10.1075/jls.1.1.04dec.
Full textAbstract:
This article is based on retrospective life history interviews with Dominican gay and bisexual immigrant men who live or have lived in New York City. It offers an alternative to established and influential interpretations of queer subject constitution that overemphasize abjection while ignoring the polyvalence of identities. Through an engagement with the conditions that make the figure of la loca [the effeminate homosexual] instrumental in the expression of closeness and intimacy among the men with whom I spoke, the article analyzes the way this signifier operates in the making and regulation of networks of self-identified Dominican gay and bisexual men. It conceptualizes “code swishing,” borrowing from scholarship on bilingualism and “code switching.” But it revises this work to implicate the body and gender dissent as communicative practices and to make clear that these men juggled their desire to establish and sustain networks with one another so long as expressions of camaraderie and connection did not threaten their legitimacy in daily life and their investments in normative masculinity. For them, surviving and being respected was more important than any sense of “community” they may have felt toward one another.
14
KEVANE, BRIDGET. "The Hispanic Absence in the North American Literary Canon." Journal of American Studies 35, no. 1 (April 2001): 95–109. http://dx.doi.org/10.1017/s0021875801006545.
Full textAbstract:
I recently completed a book of interviews (Latina Self-Portraits: Interviews with Contemporary Women Writers, co-edited with Juanita Heredia, University of New Mexico Press, 2000) with ten of the most prominent Latina writers in the US; Julia Alvarez, Denise Chávez, Sandra Cisneros, Rosario Ferré, Cristina García, Nicholasa Mohr, Cherríe Moraga, Judith Ortiz Cofer, Esmeralda Santiago and Helena María Viramontes. These women, Cuban, Dominican, Mexican and Puerto Rican Americans, raised issues that ranged from the craft of writing to the inherent problems of national identities. The themes generated in our conversations with these women – their doubled ethnic identities, their complicated relationship to their communities, their difficulties in representing their communities and, finally, their work as part of the larger American canon – revealed a powerful discourse about what it means to be Latina American in the United States. After spending two years talking with these women, it is evident to me that Latina literature is a vital part of American literature and should be included in any study of comparative American literatures.
15
Batuman, O., M. R. Rojas, A. Almanzar, and R. L. Gilbertson. "First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic." Plant Disease 98, no. 2 (February 2014): 286. http://dx.doi.org/10.1094/pdis-07-13-0685-pdn.
Full textAbstract:
Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5′ATGTCTAAGGTCAAGCTCACC3′ and NR5′TTATGCAACACCTGAAATTTTGGC3′), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.
16
Jesús López-Peláez Casellas. "Fashioning Identities and Building an Empire: Thomas Gage’s The English-American (1648) and English Puritan Proto-colonialism." Miscelánea: A Journal of English and American Studies 56 (December 20, 2017): 91–108. http://dx.doi.org/10.26754/ojs_misc/mj.20176790.
Full textAbstract:
Thomas Gage, a seventeenth century English priest, traveler, and scholar was the first non-Spanish person to settle in, and travel extensively through, the Spanish Main. After his twelve-year experience as a Dominican in, mostly, Mexico and Guatemala, he returned to England and, after recanting, published his very popular The English-American, his Travail by Sea and Land, or, A New Survey of the West-India’s (1648).The success of this book (which rapidly went through several editions and translations) was mostly due to its coincidence, both in aim and content, with early seventeenth century English colonial ambitions —especially as devised by Oliver Cromwell in his so-called Western Design of 1655— to which it actively contributed. Gage’s successful retrospective construction of himself gained him a relatively influential position in Cromwell’s failed project to replace the Spaniards in the New World. In this paper I will examine how Gage’s insufficiently studied narrative influenced Cromwell’s military project, and will also focus on how this and similar writing produced a number of precarious and self-cancelling identities from which he tried to profit.
17
Thi Vu, Thu Huong, and Tuan Dung Nguyen. "Vietnam." Actas de Arquitectura Religiosa Contemporánea 8 (December 21, 2021): 28–47. http://dx.doi.org/10.17979/aarc.2021.8.0.8850.
Full textAbstract:
In the 16th century, the first Spanish and Portuguese Dominican missionaries arrived in Southeast Asia, included Vietnam, but only after the first decades of the seventeenth century, Christianity began to take hold and lived through different episodes of the Proclamation of the Christian faith: first it was tolerated and then abandoned by the dynasties, supported by the colonialists, declined in the north by the communists, it expanded in the south under the Republic of Vietnam and stabilized until now after the reunification of the country followed by a long breakage due to political change. Along with this story, sacred architecture was interpreted in various ways to define identities in religious life and faith. However, the most difficult period of religious architecture is not only in the political conflict of the past, but also until now, the time of the economic boom. The change of values as well as the aesthetic system make sacred art and architecture remain a giant wheel stuck in mud.
18
Girgis, Liza. "Counternarratives of Nationalist Anti-Black Images: Normalizing and Extolling Blackness in Contemporary Art of the Hispanic Caribbean." Caribbean Quilt 6, no. 2 (February 4, 2022): 101–17. http://dx.doi.org/10.33137/cq.v6i2.36899.
Full textAbstract:
This article examines contemporary art of the Hispanic Caribbean as a counternarrative to the antiblack aesthetic ideals in the region. By exploring beauty standards on these islands through quotidian language and images that portray beauty, the prolif- eration of whiteness as the epitome of the aesthetic is exhibited in modern day Dominican Republic, Puerto Rico and Cuba. This article follows the work of scholars who have theorized and evidenced that the post-independence narrative has dominated the islands’ perceived racial identities, marginalizing blackness and praising whiteness. We add that this discourse has also impacted its peoples’ daily beauty rituals, as most of them facilitate the ‘whitening’ of one’s appearance. Present-day art that extolls blackness and questions the exclusion of people of African descent on the islands thus serves as a powerful truth reveal; contrarily to the official history, negritude is not rebellion, rather it is the region’s nature and beauty. In other words, this research seeks to explore how this art portrays negritude as the face of the Hispanic Caribbean, normalizing and celebrating the appearance of the majority of its people.
19
Wiarda, Howard J. "The Political Sociology of a Concept: Corporatism and the “Distinct Tradition”." Americas 66, no. 01 (July 2009): 81–106. http://dx.doi.org/10.1017/s0003161500004430.
Full textAbstract:
The field of Latin American Studies owes much to Professor Howard J. Wiarda, whose pioneering work on “corporatism” and political culture during the 1960s and 1970s helped establish a new conceptual paradigm for interpreting the persistence of corporately defined, institutional identities throughout Latin America, despite the purported triumph of the “Liberal Tradition.” A child of Dutch parents, his early travels throughout Africa, Asia, and Latin America sparked a keen interest in the question of “third world development.” Entering graduate school in the early 1960s, Professor Wiarda gravitated to the newly emergent field of modernization studies at the University of Florida, where he received his masters and doctorate degrees in Latin American politics. It was a time of tremendous social ferment in Latin America and his early fieldwork took him to the Dominican Republic, Mexico and Brazil, among other places. In each instance, he found recognizable patterns that transcended geographic locations, patterns that seemed to directly challenge the predominant arguments set forth in the modernization literature at the time.
20
Wiarda, Howard J. "The Political Sociology of a Concept: Corporatism and the “Distinct Tradition”." Americas 66, no. 1 (July 2009): 81–106. http://dx.doi.org/10.1353/tam.0.0155.
Full textAbstract:
The field of Latin American Studies owes much to Professor Howard J. Wiarda, whose pioneering work on “corporatism” and political culture during the 1960s and 1970s helped establish a new conceptual paradigm for interpreting the persistence of corporately defined, institutional identities throughout Latin America, despite the purported triumph of the “Liberal Tradition.” A child of Dutch parents, his early travels throughout Africa, Asia, and Latin America sparked a keen interest in the question of “third world development.” Entering graduate school in the early 1960s, Professor Wiarda gravitated to the newly emergent field of modernization studies at the University of Florida, where he received his masters and doctorate degrees in Latin American politics. It was a time of tremendous social ferment in Latin America and his early fieldwork took him to the Dominican Republic, Mexico and Brazil, among other places. In each instance, he found recognizable patterns that transcended geographic locations, patterns that seemed to directly challenge the predominant arguments set forth in the modernization literature at the time.
21
Gainor, Kerry, Yussaira Castillo Fortuna, Angeline Steny Alakkaparambil, Wendy González, Yashpal Singh Malik, and Souvik Ghosh. "Detection and Complete Genomic Analysis of Porcine circovirus 3 (PCV3) in Diarrheic Pigs from the Dominican Republic: First Report on PCV3 from the Caribbean Region." Pathogens 12, no. 2 (February 4, 2023): 250. http://dx.doi.org/10.3390/pathogens12020250.
Full textAbstract:
The increasing detection of Porcine circovirus 3 (PCV3, family Circoviridae) in clinically ill pigs worldwide has raised concerns on the implications of the virus on porcine health and the pork industry. Although pork production constitutes an important component of the livestock economy and is a major source of animal protein in the Caribbean Islands, there are no reports on PCV3 in pigs from the region so far. In the present study, PCV3 was detected in 21% (21/100) of diarrheic pigs (sampled at three farms) from the Caribbean nation of the Dominican Republic (DR). Although the sample size varied between porcine age groups, the highest PCV3 detection rates (35.3% each, respectively) were observed in piglets and growers. Co-infections with PCV2 and porcine adenovirus were observed in 38.09% and 9.52% of the PCV3 positive samples, respectively. The complete genomes of 11 DR PCV3 strains were analyzed in the present study, revealing a unique deletion (corresponding to nucleotide residue at position 1165 of reference PCV3 sequences) in one of the DR PCV3 sequences. Based on sequence identities and phylogenetic analysis (open reading frame 2 and complete genome sequences), the DR PCV3 strains were assigned to genotype PCV3a, and shared high sequence homologies (>98% identities) between themselves and with those of other PCV3a (Clade-1) strains, corroborating previous observations on the genetic stability of PCV3 worldwide. To our knowledge, this is the first report on the detection and molecular characterization of PCV3 in pigs from the Caribbean region, providing important insights into the expanding global distribution of the virus, even in isolated geographical regions (the Island of Hispaniola). Our findings warrant further investigations on the molecular epidemiology and economic implications of PCV3 in pigs with diarrhea and other clinical conditions across the Caribbean region.
22
Gombin-Sperling, Jeremy. "The Development of Student's Understanding of Self, Inequality, and Service during a Critical International Service Learning Program in the Dominican Republict." Journal of Comparative & International Higher Education 11, Winter (March 14, 2020): 110–13. http://dx.doi.org/10.32674/jcihe.v11iwinter.1534.
Full textAbstract:
Since January 2018, my colleague and I have co-led a two-week, three-credit critical international service learning course to Santiago de Los Caballeros, Dominican Republic. Our course is designed to question and complicate students’ relationship to service through the use of intergroup dialogue pedagogy and theory. Intergroup dialogue (IGD) encourages students to understand one another across their social identities (e.g., race, gender, sexuality, ability, nationality, ability, etc.) by engaging in conversations around social issues and power that allow us to unpack our relationship to systems of oppression and inequality (Zúñiga 2003). My proposed research is focused on the 2020 iteration of this program and will look more closely at the impact on student learning to see how, if it all, students' ideas around identity, the nature of inequality, and the purpose of service shift throughout their experience abroad. Through analysis of student reflection journals and multiple interviews with participants, I hope to gain insight into this question. This research will add to the growing field of critical studies of international service learning by assessing whether or not our program and its pedagogy is able to undo oppressive ideologies and/or strengthen existing ideologies built on collective solidarity that our students carry regarding identity, inequality and service.
23
Melgarejo, Tomas A., Tatsuya Kon, and Robert L. Gilbertson. "Molecular and Biological Characterization of Distinct Strains of Jatropha mosaic virus from the Dominican Republic Reveal a Potential to Infect Crop Plants." Phytopathology® 105, no. 1 (January 2015): 141–53. http://dx.doi.org/10.1094/phyto-05-14-0135-r.
Full textAbstract:
In the Dominican Republic (DO), jatropha plants with yellow mosaic symptoms are commonly observed in and around fields of various crop plants. Complete nucleotide sequences of DNA-A and DNA-B components of four bipartite begomovirus isolates associated with symptomatic jatropha plants collected from three geographical locations in the DO were determined. Sequence comparisons revealed highest identities (91 to 92%) with the DNA-A component of an isolate of Jatropha mosaic virus (JMV) from Jamaica, indicating that the bipartite begomovirus isolates from the DO are strains of JMV. When introduced into jatropha seedlings by particle bombardment, the cloned components of the JMV strains from the DO induced stunting and yellow mosaic, indistinguishable from symptoms observed in the field, thereby fulfilling Koch's postulates for the disease. The JMV strains also induced disease symptoms in Nicotiana benthamiana, tobacco, and several cultivars of common bean from the Andean gene pool, including one locally grown in the DO. Asymmetry in the infectivity and symptomatology of pseudorecombinants provided further support for the strain designation of the JMV isolates from the DO. Thus, JMV in the DO is a complex of genetically distinct strains that have undergone local evolution and have the potential to cause disease in crop plants.
24
Ernst, Marlieke. "Old World Methods, New World Pots. The Introduction of the Potter’s Wheel to the Spanish Colonies of Concepción de la Vega and Cotuí (Dominican Republic 1495–1562)." Interdisciplinaria Archaeologica Natural Sciences in Archaeology XII, no. 2 (December 30, 2021): 247–56. http://dx.doi.org/10.24916/iansa.2021.2.10.
Full textAbstract:
Wheel-made ceramics from early colonial Caribbean sites (1492–1562) have traditionally been labelled as European imports. This paper challenges that assumption, as the intercultural interactions within colonies in the New World have led to the creation of new social identities and changing material culture repertoires. Macro-trace ceramic analysis from the sites of Concepción de la Vega and Cotuí (Hispaniola, present-day Dominican Republic) show that the potter’s wheel was in fact introduced to the Spanish colonies at an early stage. The evidence of RKE (rotative kinetic energy) on sherds and the discovery of parts of a potter’s wheel are the earliest traces of the potter’s wheel found in the Americas. Here we aim to present how the potter’s wheel was introduced within the context of transcultural pottery forming. This paper will show that traditional coiling techniques were supplemented with finishing techniques on the wheel. The transformation processes within ceramic repertoires are assessed through theories of colonialism and learning processes, combined with archaeological and ethnoarchaeological assessment of the ceramic chaîne opératoire. Evidence from ceramic analysis is combined with historical sources to understand social processes surrounding the technological changes behind the introduction of the potter’s wheel to the New World colonies.
25
SAINTE, Guerby. "Zonas transfronteiriças, delimitação socioespacial e territorial do Estado: o caso da cidade de Jimaní (República Dominicana) e posto fronteiriço de Malpasse/Fonds-Parisien (Haiti)." Caderno de Geografia 29, no. 2 (August 29, 2019): 36–54. http://dx.doi.org/10.5752/p.2318-2962.2019v29n2p36-54.
Full textAbstract:
Este trabalho tem como principal objetivo realizar uma discussão sobre a fronteira entre o Haiti e a República Dominicana partindo de uma reflexão sobre as zonas de fronteiras e a dinâmica socioespacial e territorial no caso da cidade de Jimaní e o posto fronteiriço de Malpasse/Fonds-Parisien. Essas relações mantidas na fronteira dos dois países são relevantes para a dinamização socioespacial e a formação territorial nas escalas nacionais dos Estados. Percebermos que a dinâmica da economia local criada na fronteira permite que as populações comercializem bens e serviços, tornando-se atrativas ao se observar o movimento da mercadoria binacional. Buscamos, então, analisar, por processo de abertura e fechamento da fronteira, os principais papéis da fronteira na política da economia urbana voltada a uma desaceleração ou aceleração da economia das cidades fronteiriças. Sendo assim, a economia promovida na fronteira visa à mudança de escala, e, portanto, busca-se analisar as realidades socioculturais regionais em condições de criar identidades e estruturas econômicas de maior valor agregado nas relações comerciais entre esses Estados.Palavras–chave: Fronteira, Estado, território nacional, população de fronteira.Abstract This work has as main objective to carry out a discussion about the border between Haiti and the Dominican Republic. Starting from a reflection on the zones of sources and the socio-spatial and territorial dynamics in the case of the city of Jimaní and the border post of Malpasse/Fonds-Parisien. These relations maintained at the border of the two countries are relevant for socio-spatial dynamization and territorial formation in the national scales of the States. We realise that the dynamics of the local economy created at the border allows the populations to market goods and services, becoming attractive when observing the movement of the binational merchandise. We seek to analyse, by process of opening and closing the frontier, the primary roles of the frontier in the urban economic policy aimed at a slowdown or acceleration in the economy of the border cities.Thus, the economy promoted at the frontier aims at a change of scale, and then, we will seek to analyse regional socio-cultural realities capable of creating identities and economic structures of more significant value added in commercial relations between states.Keywords: Border, State, national territory, border of population.
26
Melgarejo, Tomas A., Maria R. Rojas, and Robert L. Gilbertson. "A Bipartite Begomovirus Infecting Boerhavia erecta (Family Nyctaginaceae) in the Dominican Republic Represents a Distinct Phylogenetic Lineage and has a High Degree of Host Specificity." Phytopathology® 109, no. 8 (August 2019): 1464–74. http://dx.doi.org/10.1094/phyto-02-19-0061-r.
Full textAbstract:
Boerhavia erecta plants in and around agricultural fields in the Azua Valley of the southeastern Dominican Republic often show striking golden mosaic symptoms. Leaf samples from B. erecta plants showing these symptoms were collected in 2012 and 2013, and PCR tests with degenerate primers revealed begomovirus DNA-A and DNA-B components. The complete sequences of the DNA-A and DNA-B components of four isolates show a high degree of sequence identity (>96%) and a genome organization typical of New World (NW) bipartite begomoviruses. Sequence comparisons and phylogenetic analyses revealed that these isolates composed a new phylogenetic lineage of NW bipartite begomoviruses. The most closely related begomovirus is Merremia mosaic virus, a weed-infecting species from Puerto Rico. Because DNA-A sequence identities are well below the 91% threshold, these isolates represent a new begomovirus species, for which the name Boerhavia golden mosaic virus (BoGMV) is proposed. Infectious cloned BoGMV DNA-A and DNA-B components induced golden mosaic symptoms in agroinoculated B. erecta plants, thereby fulfilling Koch’s postulates for this disease. Agroinoculation and mechanical transmission experiments revealed that BoGMV has an unusually narrow host range, limited to members of the family Nyctaginaceae and not including the permissive host Nicotiana benthamiana. The inability of BoGMV to infect N. benthamiana was due to a deficiency in cell-to-cell movement but not to a unique amino acid residue in the movement protein.
27
Gainor, Kerry, Yussaira Castillo Fortuna, Angeline Steny Alakkaparambil, Wendy González, Yashpal Singh Malik, and Souvik Ghosh. "High Rates of Detection and Molecular Characterization of Porcine Adenovirus Serotype 5 (Porcine mastadenovirus C) from Diarrheic Pigs." Pathogens 11, no. 10 (October 20, 2022): 1210. http://dx.doi.org/10.3390/pathogens11101210.
Full textAbstract:
Since the first report on isolation of porcine adenovirus serotype 5 (PAdV-5, species Porcine mastadenovirus C (PAdV-C)) from pigs with respiratory illness in Japan in 1987, PAdV-5 have been detected in a few fecal samples from healthy pigs and in some environmental samples. To date, only a single PAdV-5 strain (isolate HNF-70 from 1987) has been analyzed for the complete genome. We report here high detection rates of PAdV-5 (25.74%, 26/101 fecal samples) in diarrheic pigs at 3 different farms in the Caribbean country of Dominican Republic. After a long gap, the complete deduced amino acid sequences of the DNA-dependent DNA polymerase (pol) and hexon of two PAdV-5 strains (GES7 and Z11) were determined, revealing >99% sequence identities between PAdV-5 strains (HNF-70, GES7 and Z11) detected in different parts of the world and during different time periods (1987, and 2020–2021). By phylogenetic analysis, the putative hexon and pol of HNF-70, GES7 and Z11 exhibited similar clustering patterns, with the PAdV-5 strains forming a tight cluster near ruminant AdVs, distinct from the species PAdV-A and -B. GES7 and Z11 retained the various conserved features present in the putative pol and major late promoter region of HNF-70. Considering the paucity of data on current epidemiological status and genetic diversity of PAdV in porcine populations, our findings warrant similar studies on PAdV-5 and other PAdVs in clinically ill and healthy pigs. To our knowledge, this is the first report on detection and molecular characterization of PAdV-5 (PAdV-C) from diarrheic pigs.
28
Parker, Maria A., Catalina Lopez-Quintero, and James C. Anthony. "Young, American Indian or Alaskan Native, and born in the USA: at excess risk of starting extra-medical prescription pain reliever use?" PeerJ 6 (October 8, 2018): e5713. http://dx.doi.org/10.7717/peerj.5713.
Full textAbstract:
Background Prescription pain reliever (PPR) overdoses differentially affect ‘American Indian/Alaskan Natives’ in the United States (US). Here, studying onset of extra-medical PPR use in 12-24-year-olds, we examine subgroup variations in rates of starting to use prescription pain relievers extra-medically (i.e., to get ‘high’ or for other reasons outside boundaries of prescriber’s intent). Risk differences (RD) are estimated for US-born versus non-US-born young people, stratified by American Indian/Alaskan Natives versus other ethnic self-identities. Methods Between 2002–2009, nationally representative cross-sectional samples of 12–24-year-old non-institutionalized civilians completed interviews for the US National Surveys of Drug Use and Health. Analysis-weighted annual incidence estimates, RD, and confidence intervals (CI) are from the Restricted-use Data Analysis System, an online software tool for US National Surveys of Drug Use and Health. Results Each year, an estimated 2.5% of 12-24-year-olds in the US start using PPR extra-medically (95% CI [2.1%–3.0%]). Estimates for the US-born (3.8%; 95% CI [3.7%–3.9%]) are larger (non-US-born: 1.8%; 95% CI [1.5%–2.0%]; RD = 2.0; p < 0.05). US-born American Indian/Alaskan Natives youths have the largest incidence rate (4.8%). Robust RD for US-born can be seen for ‘non-Hispanic White’ subgroups, and for others (e.g., ‘Cuban’, ‘Dominican’). Discussion Each year, one in 20 of US-born American Indian/Alaskan Natives starts using PPR extra-medically. Overdose prevention is important, but is no substitute for primary prevention initiatives for all young people. The observed epidemiological patterns can guide targeted prevention initiatives for the identified higher risk subgroups in complement with more universal prevention efforts intended to reduce incidence of first extra-medical PPR use, a crucial rate-limiting step on the path toward more serious drug involvement (i.e., progressing past initial use).
29
Maclin, Beth J., Yan Wang, Carlos Rodriguez-Diaz, Yeycy Donastorg, Martha Perez, Hoisex Gomez, Clare Barrington, and Deanna Kerrigan. "Beyond a deficit-based approach: Characterizing typologies of assets for cisgender and transgender female sex workers and their relationship with syndemic health outcomes." PLOS Global Public Health 3, no. 8 (August 30, 2023): e0002314. http://dx.doi.org/10.1371/journal.pgph.0002314.
Full textAbstract:
Female sex workers (FSWs) live and work at the intersection of multiple marginalized identities that place them at greater risk for various negative health outcomes. Resilience theory asserts that an individual or community needs assets from which they can draw in response to stressors, such as chronic discrimination and abuse. This study characterizes and compares patterns of assets among cisgender and transgender FSWs living with HIV in the Dominican Republic and their relations with syndemic health outcomes. With Latent Class Analysis, we used companion cross-sectional datasets comprised of cisgender and transgender FSWs (N = 211 and 100, respectively) to estimate typologies of interpersonal, community, and institutional assets. We used multivariate logistic regression to model the relationship between class membership and HIV care and treatment, mental health, violence exposure, and substance use outcomes, respectively. Among cisgender FSWs, we identified three classes: Internal and External Multilevel Assets (Class 1); External Institutional Assets (Class 2); and Low Reported Assets (Class 3). Compared to Class 3, Class 1 membership among cisgender FSWs was significantly associated with ART adherence and marginally associated with viral suppression, and Class 2 membership was marginally associated with currently taking ART. We identified two classes in the transgender sample: Internal and External Multilevel Assets (Class 1) and External Institutional Assets (Class 2). Class 1 membership among transgender FSWs was significantly associated with ART adherence and marginally associated with current ART use and physical or sexual violence, compared to Class 2. Having a variety of assets may explain the ability of some FSWs to more effectively engage with healthcare and maintain their HIV medication regimen. Future interventions should seek to expand FSWs’ interpersonal and community assets, both from within and outside of the sex worker community, to bolster their ability to care for themselves and their community.
30
Echemendía, A. L., P. L. Ramos, R. Peral, A. Fuentes, G. González, J. Sanpedro, and F. Morales. "Cuban Isolate of Bean golden yellow mosaic virus is a Member of the Mesoamerican BGYMV Group." Plant Disease 85, no. 9 (September 2001): 1030. http://dx.doi.org/10.1094/pdis.2001.85.9.1030c.
Full textAbstract:
In Cuba, the emergence of bean golden mosaic was associated with high populations of Bemisia tabaci in common bean (Phaseolus vulgaris L.) plantings in the 1970s (1). During the last two decades, the disease has caused significant economic losses, forcing some growers to abandon bean production. In Holguín, one of the main bean producing provinces of the country, about 2,000 ha of beans were abandoned in 1991 due to the high incidence of this whitefly-transmitted virus. At that time, yield losses associated with this disease reached 90 to 100% in farmer's fields. In spite of various control measures, the disease affected 33, 28, and 6.5% of the total area planted in Cuba to common bean in 1990, 1992, and 1996, respectively. For this investigation, common bean leaves showing systemic yellowing symptoms were collected in fields located in the provinces of Havana, Matanzas, and Holguín during 1998-1999. Sap and total DNA leaf extracts were used to inoculate healthy bean plants by manual and biolistic procedures, respectively. Characteristic yellowing symptoms were more efficiently reproduced using a particle gun device than by manual inoculation (18/20 plants and 5/20 plants, respectively, for a Holguín virus isolate). DNA extracts were further analyzed by polymerase chain reaction using two degenerate primer sets: PAL1v1978-PAR1c715 and PAL1c1960-PAR1v722 (2). Fragments of approximately 1.4 and 1.2 kb were amplified and cloned. Restriction fragment length polymorphism analysis of the cloned 1.4-kb fragments was performed with BglII, HincII, SalI, EcoRI, PstI, and XbaI, indicating that selected isolates from the three Cuban provinces shared identical restriction patterns. The nucleotide sequence obtained from two clones of a virus isolate from Holguín, was compared to sequences available for other begomoviruses using BLAST. The Cuban isolate shared up to 94% nt sequence identity with various strains of Bean golden yellow mosaic virus (BGYMV) in the first 250 nt of the rep gene. For the common region (CR), scores were 93% for BGYMV-GA (Guatemala), 92% for BGYMV-MX (southern Mexico) and BGYMV-PR (Puerto Rico), and 91% for BGYMV-DR (Dominican Republic). The iterative sequence ATGGAG was identified in the CR of the Cuban BGYMV isolate, as reported for other BGYMV isolates. Finally, the Cuban begomovirus, hereafter referred to as BGYMV-CU, shared nt and aa sequence identities of 94 and 100%, respectively, with the coat protein gene of BGYMV-MX. We conclude that the begomovirus isolated from mosaic-affected common bean plants in the province of Holguín is a member of the Mesoamerican BGYMV group (3). References: (1) N. Blanco and C. Bencomo. Cienc. Agric. 2:39, 1978. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) Morales and Anderson, Arch. Virol. 146:415, 2001.
31
Samuel, Shana S., Dominika Seblova, Adam M. Brickman, Jennifer J. Manly, and Desiree A. Byrd. "5 Association of Discrimination to Cognition Among US-Born and Immigrant Latinx." Journal of the International Neuropsychological Society 29, s1 (November 2023): 89–90. http://dx.doi.org/10.1017/s1355617723001790.
Full textAbstract:
Objective:Neuropsychology is in a nascent stage of understanding the mechanisms that link social forces, psychosocial experiences, and brain health. Discrimination is associated with lower quality of life, higher stress, and worse physical health outcomes in Latinx, but contradictory findings in prior research complicate our understanding of its relationship to cognition. These contradictory results may be explained by heterogeneity within the broad category of Latinx, a cultural identity that requires more nuanced conceptualization. Immigration status is a primary social identifier for Latinx people that carries significant stigma. However, prior research found enculturation promotes better physical and mental health outcomes in immigrants compared to their US-born counterparts, which may protect immigrant Latinx from the cognitive costs of discrimination. The current study hypothesized that the effect of discrimination on cognition will be stronger in US-born Latinx compared to immigrant Latinx.Participants and Methods:We partnered with 1,023 neurologically healthy, community dwelling Latinx adults (M age=56.1(±10.7); M education=12.5(±3.7); 69% women) in a prospective cohort study in NYC investigating risks factors for Alzheimer’s disease. Immigration status was determined by self-report of birthplace. Measures of attention, language, and memory were administered by bilingual examiners in the participants’ self-selected preferred language of English (n = 388) or Spanish (n=635). Discrimination, measured with the Everyday Discrimination Scale and Major Experiences of Discrimination Scale, was chronicity coded to weigh experiences of discrimination according to yearly chronicity. Linear regression models were employed for US-born and immigrant participants to assess the relationship between both discrimination measures and each cognitive measure.Results:Compared to US-born Latinx (n = 224), immigrant Latinx (n = 799; primarily from the Dominican Republic) were older, had fewer years of school, had lower income, and were much more likely to have chosen to be assessed in Spanish. Immigrants reported experiencing significantly fewer everyday and major experiences of discrimination than nonimmigrants. In unadjusted models, discrimination did not predict cognitive performance among US-born Latinx. Among immigrant Latinx, more major experiences of discrimination across the lifetime predicted better phonemic (F(2,362) = 4.167, p<0.05, R2=0.017) and semantic fluency (F(2,362) = 3.304, p<0.05, R2=0.013) but was not associated with measures of attention or memory.Conclusions:Discrimination is an important life stressor for Latinx people living in the US, particularly when its impact is summed across intersectional identities. The current study is among the first to explore the potential cognitive impact of discrimination within a group of Latinx adults. The described relationship between discrimination and language performance in this cohort may be confounded by the language in which cognitive tests were administered. Future studies should consider how discrimination measures may be limited in their ability to accurately capture the experiences of US-born and immigrant Latinx groups and expand the measurement of cognition to additional domains.
32
Jensen, Leif, Jeffrey H. Cohen, Almeida Jacqueline Toribio, Gordon F. De Jong, and Leila Rodríguez. "Ethnic Identities, Language, and Economic Outcomes Among Dominicans in a New Destination." Social Science Quarterly 87, s1 (December 2006): 1088–99. http://dx.doi.org/10.1111/j.1540-6237.2006.00417.x.
Full text
33
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 71, no. 1-2 (January 1, 1997): 107–78. http://dx.doi.org/10.1163/13822373-90002619.
Full textAbstract:
-Peter Hulme, Polly Pattullo, Last resorts: The cost of tourism in the Caribbean. London: Cassell/Latin America Bureau and Kingston: Ian Randle, 1996. xiii + 220 pp.-Michel-Rolph Trouillot, Édouard Glissant, Introduction à une poétique du Divers. Montréal: Presses de l'Université de Montréal, 1995. 106 pp.-Bruce King, Tejumola Olaniyan, Scars of conquest / Masks of resistance: The invention of cultural identities in African, African-American, and Caribbean drama. New York: Oxford University Press, 1995. xii + 196 pp.-Sidney W. Mintz, Raymond T. Smith, The Matrifocal family: Power, pluralism and politics. New York: Routledge, 1996. x + 236 pp.-Raymond T. Smith, Michel-Rolph Trouillot, Silencing the past: Power and the production of history. Boston: Beacon, 1995. xix + 191 pp.-Michiel Baud, Samuel Martínez, Peripheral migrants: Haitians and Dominican Republic sugar plantations. Knoxville: University of Tennessee Press, 1995. xxi + 228 pp.-Samuel Martínez, Michiel Baud, Peasants and Tobacco in the Dominican Republic, 1870-1930. Knoxville; University of Tennessee Press, 1995. x + 326 pp.-Robert C. Paquette, Aline Helg, Our rightful share: The Afro-Cuban struggle for equality, 1886-1912. Chapel Hill: University of North Carolina Press, 1995. xii + 361 pp.-Daniel C. Littlefield, Roderick A. McDonald, The economy and material culture of slaves: Goods and Chattels on the sugar plantations of Jamaica and Louisiana. Baton Rouge: Louisiana State University Press, 1993. xiv + 339 pp.-Jorge L. Chinea, Luis M. Díaz Soler, Puerto Rico: desde sus orígenes hasta el cese de la dominación española. Río Piedras: Editorial de la Universidad de Puerto Rico, 1994. xix + 758 pp.-David Buisseret, Edward E. Crain, Historic architecture in the Caribbean Islands. Gainesville: University Press of Florida, 1994. ix + 256 pp.-Hilary McD. Beckles, Mavis C. Campbell, Back to Africa. George Ross and the Maroons: From Nova Scotia to Sierra Leone. Trenton NJ: Africa World Press, 1993. xxv + 115 pp.-Sandra Burr, Gretchen Gerzina, Black London: Life before emancipation. New Brunswick NJ: Rutgers University Press, 1995. xii + 244 pp.-Carlene J. Edie, Trevor Munroe, The cold war and the Jamaican Left 1950-1955: Reopening the files. Kingston: Kingston Publishers, 1992. xii + 242 pp.-Carlene J. Edie, David Panton, Jamaica's Michael Manley: The great transformation (1972-92). Kingston: Kingston Publishers, 1993. xx + 225 pp.-Percy C. Hintzen, Cary Fraser, Ambivalent anti-colonialism: The United States and the genesis of West Indian independence, 1940-1964. Westport CT: Greenwood, 1994. vii + 233 pp.-Anthony J. Payne, Carlene J. Edie, Democracy in the Caribbean: Myths and realities. Westport CT: Praeger, 1994. xvi + 296 pp.-Alma H. Young, Jean Grugel, Politics and development in the Caribbean basin: Central America and the Caribbean in the New World Order. Bloomington: Indiana University Press, 1995. xii + 270 pp.-Alma H. Young, Douglas G. Lockhart ,The development process in small island states. London: Routledge, 1993. xv + 275 pp., David Drakakis-Smith, John Schembri (eds)-Virginia Heyer Young, José Solis, Public school reform in Puerto Rico: Sustaining colonial models of development. Westport CT: Greenwood Press, 1994. x + 171 pp.-Carolyn Cooper, Christian Habekost, Verbal Riddim: The politics and aesthetics of African-Caribbean Dub poetry. Amsterdam: Rodopi, 1993. vii + 262 pp.-Clarisse Zimra, Jaqueline Leiner, Aimé Césaire: Le terreau primordial. Tübingen: Gunter Narr Verlag, 1993. 175 pp.-Clarisse Zimra, Abiola Írélé, Aimé Césaire: Cahier d'un retour au pays natal. With introduction, commentary and notes. Abiola Írélé. Ibadan: New Horn Press, 1994. 158 pp.-Alvina Ruprecht, Stella Algoo-Baksh, Austin C. Clarke: A biography. Barbados: The Press - University of the West Indies; Toronto: ECW Press, 1994. 234 pp.-Sue N. Greene, Glyne A. Griffith, Deconstruction, imperialism and the West Indian novel. Kingston: The Press - University of the West Indies, 1996. xxiii + 147 pp.-Donald R. Hill, Peter Manuel ,Caribbean currents: Caribbean music from Rumba to Reggae. Philadelphia: Temple University Press, 1995. xi + 272 pp., Kenneth Bilby, Michael Largey (eds)-Daniel J. Crowley, Judith Bettelheim, Cuban festivals: An illustrated anthology. New York: Garland Publishing, 1993. x + 261 pp.-Judith Bettelheim, Ramón Marín, Las fiestas populares de Ponce. San Juan: Editorial de la Universidad de Puerto Rico, 1994. 277 pp.-Marijke Koning, Eric O. Ayisi, St. Eustatius: The treasure island of the Caribbean. Trenton NJ: Africa World Press, 1992. xviii + 224 pp.-Peter L. Patrick, Marcyliena Morgan, Language & the social construction of identity in Creole situations. Los Angeles: Center for Afro-American studies, UCLA, 1994. vii + 158 pp.-John McWhorter, Tonjes Veenstra, Serial verbs in Saramaccan: Predication and Creole genesis. The Hague: Holland Academic Graphic, 1996. x + 217 pp.-John McWhorter, Jacques Arends, The early stages of creolization. Amsterdam/Philadelphia: John Benjamins, 1995. xv + 297 pp.
34
Louie, Vivian. "GROWING UP ETHNIC IN TRANSNATIONAL WORLDS: IDENTITIES AMONG SECOND-GENERATION CHINESE AND DOMINICANS." Identities 13, no. 3 (September 2006): 363–94. http://dx.doi.org/10.1080/10702890600838118.
Full text
35
Rojas, M. R., T. Kon, E. T. Natwick, J. E. Polston, F. Akad, and R. L. Gilbertson. "First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California." Plant Disease 91, no. 8 (August 2007): 1056. http://dx.doi.org/10.1094/pdis-91-8-1056a.
Full textAbstract:
Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5′-GGATCCACTTCTAAATGAATTTCCTG-3′ and TYBamHI2c: 5′-GGATCCCACATAGTGCAAGACAAAC-3′), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.
36
Yan, Lin. "Identity, Place and Non-belonging in Jean Rhys’s Fiction." Theory and Practice in Language Studies 8, no. 10 (October 1, 2018): 1278. http://dx.doi.org/10.17507/tpls.0810.04.
Full textAbstract:
Place is considered as a distinguishable factor among Jean Rhys’s novels, most concretely represented by three countries: Dominica, England and France. In locating her outsider and outcast heroines in these places of interconnectedness, Rhys’s fiction responds to a time of crisis in the history of Empire. With a much stigmatized white West Indian creole identity, her heroines are unacceptably white in Dominica, and unacceptably “black” in Europe. In Voyage in the Dark, Anna is stranded in a modernist London that was at once racially heterogeneous, cosmopolitan and xenophobic. Her transgressive and mobile identities (racial, sexual, national), are forever making her stranger in the metropole. In Quartet and Good Morning, Midnight, both Marya and Sasha occupy the temporary and liminal spaces of the metropolis of Paris and try to buy themselves an illusion of a respectable identity. Rejected, unhoused, wandering in a state of limbo, their existence becomes mechanical and ghostly. It is this sense of having no identity and no place of belonging resulted from a very specific and traumatic colonial experience that best explains the pervasive tone of loss, melancholy, and paralysis of spirit underlying all of Rhys’s fiction.
37
Richard, Arnaud. "Insularité et espaces transfrontaliers : discours et tensions identitaires entre Haïti et la République dominicaine." Semen, no. 52 (December 6, 2022): 121–41. http://dx.doi.org/10.4000/semen.18581.
Full text
38
Кючуков, Хрісто, and Сава Самуїлов. "Language Use and Identity Among Migrant Roma." East European Journal of Psycholinguistics 6, no. 1 (June 30, 2019): 47–57. http://dx.doi.org/10.29038/eejpl.2019.6.1.hky.
Full textAbstract:
The paper presents the issue of language use and identity among Muslim Roma youth from Bulgaria, living in Berlin, Germany. Interviews with a structured questionnaire on language use and identity was conducted with Bulgarian Muslim Roma living in Berlin, Germany. The results showed that, in order to be accepted by the German Turks, Bulgarian Muslim Roma youth change their language use and identity from Muslim Roma to a new identity - Bulgarian “Osmanli” Turks. The findings showed that the change of language and identity among young Roma in this study served as strategies for integration and acceptance in the German society.
References
Bailey, B. (2001). The language of multiple identities among Dominican Americans. Journal of Linguistic Anthropology, 10(2), 190-223.
Berry, J. (1997). Immigration, acculturation and adaptation. Applied Psychology: An International Review, 46, 5-36.
Bleich, E. (2009). Where do Muslims Stand on Ethno-Racial Hierarchies in Britain and France? Evidence from Public Opinion Surveys, 1998-2008; 43, 379-400.
Brizic, K. (2006). The secret life of a languages. Origin-specific differences in L1/L2 acquisition by immigrant children. International Journal of Applied Linguistics, 16(3), 339-362.
Broeder, P. & Extra, G. (1995). Ethnic identity and community languages in the Netherlands In: Sociolinguistica – International Yearbook of European Sociolinguistics/ Internationales Jahrbuch für europäische Soziolinguistik, 9, 96-112.
Dimitrova, R., Ferrer-Wreder, L. (2017). Positive Youth Development of Roma Ethnic minority Across Europe. In: Handbook on positive development of minority children and youth (pp. 307-320). N. Cabrera & B. Leyendeker, (Eds.). New York: Springer
Erikson, E. (1964). Childhood and Society. New York: W. W. Norton & Company.
Fishman, J. (1998). Language and ethnicity: The view from within. In: The Handbook of Sociolinguistics. (pp. 327-343). F. Coulmas (Ed.). Oxford: Blackwell.
Fought, C. (2006). Language and ethnicity. Cambridge: Cambridge University Press.
Giles, H. (ed.) (1984). The Dynamics of speech accommodation. International Journal of Sociology of Language, 46, 1-155
Giray, B. (2015). Code-switching among Bulgarian Muslim Roma in Berlin. In: Ankara Papers in Turkish and Turkic Linguistics. (pp. 420-430). D. Zeyrek, C.S. Șimșek, U. Ataș and J. Rehbein (Eds.). Wiessbaden: Harrassowitz Verlag.
Kivisto, P. (2013). (Mis)Reading Muslims and multiculturalism. Social Inclusion, 1, 126-135.
Kyuchukov, H. (2016). The Turkish in Berlin spoken by Bulgarian Muslim Roma. Ural-Altaic Studies, 22, 7-12.
Kyuchukov, H. (2007). Turkish and Roma children learning Bulgarian. Veliko Tarnovo: Faber.
Larson, R. W. (2000). Toward a psychology of positive youth development. American Psychologist, 55, 170-183.
Lerner, R. Et al. (2005) Positive youth development. A view of the issues. Journal of Early Adolescence, 25(1), 10-16.
Lerner, R., Dowling, E., Anderson, P. (2003) Positive youth development: Thriving as the basis of personhood and civil society. Applied Developmental Science, 7(3), 172-180.
Marushiakova, E. & Popov, V. (2004). Muslim Minorities in Bulgaria. In: Migration and Political Intervention: Diasporas in Transition Countries. (pp. 18-32). Blaschke, J. (Ed.). Berlin: Parabolis.
Merton, R. (1968). The Matthew effect in Science. Science, 159(3810), 56-63.
Ochs, E. (1993). Constructing social identity: a language socialization perspective. Research on Language and Social Interaction, 26, 287-306.
Organista, P. B, Marin, G., Chun, K. M. (2010). The psychology of ethnic groups in United States. London: SAGE Publication.
Padilla, A., Perez, W. (2003). Acculturation, social identity and social cognition: A new Perspective. Hispanic Journal of Behavioral Sciences, 25, 35-55.
Peoples, J., Bailey, G. (2010). Humanity: An Introduction to Cultural Anthropology (9th ed.). Belmont, CA: Wadsworth Cengage learning.
Rovira, L. (2008). The relationship between language and identity. The use of the home language as a human right of the immigrant. Revista Interdisciplinar da Mobilidade Humana, XVI (31), 63-81.
Tajfel, H. Turner, J.C. (1986). The social identity theory of intergroup behavior. In: Psychology of Intergroup Relations (pp. 7-24). Worchel, S. & Austin, W. G. (Eds.). Chicago: Nelson-Hall.
Tabouret-Keller, A. (1998). Language and identity. In: The Handbook of Sociolinguistics. (pp. 315-326). F. Coulmas (Ed.). Oxford: Blackwell.
Trudgill, P. (1992). Ausbau sociolinguistics and the perception of language status in contemporary Europe. International Journal of Applied Linguistics, 2, 167-178.
39
Ghilardi, Marcello. "Des images (et) de Dieu." Thème 20, no. 1-2 (October 16, 2013): 61–81. http://dx.doi.org/10.7202/1018854ar.
Full textAbstract:
Cet article porte sur l’affinité de pensée entre le maître dominicain Johannes Eckhart (1260-1327) et le philosophe japonais Nishida Kitarō (1870-1945) à propos de la dimension de l’image par rapport au questionnement de ce qui se trouve au-delà de la parole, mais qui demeure comme l’objet central de la recherche théologique et philosophique pour les deux penseurs. L’attitude qui soutient une rencontre entre les pensées de Eckhart et Nishida peut réduire les prétentions absolutistes et identitaires qui empêchent un renouvellement de la philosophie et de la théologie. La vérité qui apparaît dans la rencontre de deux penseurs est une vérité qui reste une, mais pluraliste, puisqu’elle sait respecter la différence des identifications religieuses et philosophiques — il ne s’agit pas de les nier en mêlant tout dans un même système indifférencié — et à la fois elle sait garder un fond qui résiste au-delà ou en deçà des différences.
40
Elvy, Stacy-Ann. "A Postcolonial Theory of Spousal Rape: The Carribean and Beyond." Michigan Journal of Gender & Law, no. 22.1 (2015): 89. http://dx.doi.org/10.36641/mjgl.22.1.postcolonial.
Full textAbstract:
Many postcolonial states in the Caribbean continue to struggle to comply with their international treaty obligations to protect women from sexual violence. Reports from various United Nations programs, including UNICEF, and the annual U.S. State Department Country Reports on Antigua and Barbuda, the Bahamas, Barbados, Dominica, Jamaica, and Saint Lucia (“Commonwealth Countries”), indicate that sexual violence against women, including spousal abuse, is a significant problem in the Caribbean. Despite ratification of various international instruments intended to eliminate sexual violence against women, such as the Convention on the Elimination of All Forms of Discrimination Against Women, Commonwealth Countries have retained the common law spousal rape exemption. While much has been written on the topic of spousal rape in common law jurisdictions, this Article is unique in at least three respects. First, this Article is part of a larger project that seeks to trace the connections between colonial history and contemporary law in postcolonial states with the aim of developing a typology of the enduring effects of colonial laws and norms. Second, this Article uses postcolonial theory to provide a theoretical framework for critiquing the colonial roots of the modern-day spousal rape exemption in Commonwealth Countries. Third, this Article posits that postcolonial theory offers many insights regarding the history of colonialism and modern-day power dynamics and identities in Commonwealth Countries. The Article uses postcolonial theory to advocate for a norms-based approach to changing the structures that perpetuate inequality, and goes on to suggest the need for changes to negative norms regarding the role of women in marriage, with the aim of creating national and individual identities that value compliance with modern human rights norms. The Article recommends legal, social, legislative, and judicial internalization of human rights norms. While these solutions are not new, the Article uses postcolonial theory to assess which solution may be more viable, as well as to determine the best way to implement internalization of human rights norms given the colonial heritage and politics of postcolonial Commonwealth Countries.
41
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 75, no. 3-4 (January 1, 2001): 297–357. http://dx.doi.org/10.1163/13822373-90002555.
Full textAbstract:
-Stanley L. Engerman, Heather Cateau ,Capitalism and slavery fifty years later: Eric Eustace Williams - A reassessment of the man and his work. New York: Peter Lang, 2000. xvii + 247 pp., S.H.H. Carrington (eds)-Philip D. Morgan, B.W. Higman, Writing West Indian histories. London: Macmillan Caribbean, 1999. xiv + 289 pp.-Daniel Vickers, Alison Games, Migration and the origins of the English Atlantic world. Cambridge MA: Harvard University Press, 1999. xiii + 322 pp.-Christopher L. Brown, Andrew Jackson O'Shaughnessy, An empire divided: The American revolution and the British Caribbean. Philadelphia: University of Pennsylvania Press, 2000. xviii + 357 pp.-Lennox Honychurch, Samuel M. Wilson, The indigenous people of the Caribbean. Gainesville: University Press of Florida, 1997. xiv + 253 pp.-Kenneth Bilby, Bev Carey, The Maroon story: The authentic and original history of the Maroons in the history of Jamaica 1490-1880. St. Andrew, Jamaica: Agouti Press, 1997. xvi + 656 pp.-Bernard Moitt, Doris Y. Kadish, Slavery in the Caribbean Francophone world: Distant voices, forgotten acts, forged identities. Athens: University of Georgia Press, 2000. xxiii + 247 pp.-Michael J. Guasco, Virginia Bernhard, Slaves and slaveholders in Bermuda, 1616-1782. Columbia: University of Missouri Press, 1999. xviii + 316 pp.-Michael J. Jarvis, Roger C. Smith, The maritime heritage of the Cayman Islands. Gainesville: University Press of Florida, 2000. xxii + 230 pp.-Paul E. Hoffman, Peter R. Galvin, Patterns of pillage: A geography of Caribbean-based piracy in Spanish America, 1536-1718. New York: Peter Lang, 1999. xiv + 271 pp.-David M. Stark, Raúl Mayo Santana ,Cadenas de esclavitud...y de solidaridad: Esclavos y libertos en San Juan,siglo XIX. Río Piedras: Centro de Investigaciones Sociales, Universidad de Puerto Rico, 1997. 204 pp., Mariano Negrón Portillo, Manuel Mayo López (eds)-Ada Ferrer, Philip A. Howard, Changing history: Afro-Cuban Cabildos and societies of color in the nineteenth century. Baton Rouge: Louisiana State University Press, 1998. xxii + 227 pp.-Alvin O. Thompson, Maurice St. Pierre, Anatomy of resistance: Anti-colonialism in Guyana 1823-1966. London: Macmillan, 1999. x + 214 pp.-Linda Peake, Barry Munslow, Guyana: Microcosm of sustainable development challenges. Aldershot, U.K. and Brookfield VT: Ashgate, 1998. x + 130 pp.-Stephen Stuempfle, Peter Mason, Bacchanal! The carnival culture of Trinidad. Philadelphia PA: Temple University Press, 1998. 191 pp.-Christine Chivallon, Catherine Benoît, Corps, jardins, mémoires: Anthropologie du corps et de l' espace à la Guadeloupe. Paris: CNRS Éditions, 2000. 309 pp.-Katherine E. Browne, Mary C. Waters, Black identities: Wsst Indian immigrant dreams and American realities. New York: Russell Sage Foundation; Cambridge MA: Harvard University Press, 1999. xvii + 413 pp.-Eric Paul Roorda, Bernardo Vega, Los Estados Unidos y Trujillo - Los días finales: 1960-61. Colección de documentos del Departamento de Estado, la CIA y los archivos del Palacio Nacional Dominicano. Santo Domingo: Fundación Cultural Dominicana, 1999. xx+ 783 pp.-Javier Figueroa-de Cárdenas, Charles D. Ameringer, The Cuban democratic experience: The Auténtico years, 1944-1952. Gainesville: University Press of Florida, 2000. ix + 230 pp.-Robert Lawless, Charles T. Williamson, The U.S. Naval mission to Haiti, 1959-1963. Annapolis MD: Naval Institute Press, 1999. xv + 395 pp.-Noel Leo Erskine, Arthur Charles Dayfoot, The shaping of the West Indian Church, 1492-1962. Kingston: The Press University of the West Indies; Gainesville: University Press of Florida, 1999. xvii + 360 pp.-Edward Baugh, Laurence A. Breiner, An introduction to West Indian poetry. Cambridge: Cambridge University Press, 1998. xxii + 261 pp.-Lydie Moudileno, Heather Hathaway, Caribbean waves: Relocating Claude McKay and Paule Marshall. Bloomington: Indiana University Press, 1999. xi + 201 pp.-Nicole Roberts, Claudette M. Williams, Charcoal and cinnamon: The politics of color in Spanish Caribbean literature. Gainesville: University Press of Florida, 2000. xii + 174 pp.-Nicole Roberts, Marie Ramos Rosado, La mujer negra en la literatura puertorriqueña: Cuentística de los setenta: (Luis Rafael Sánchez, Carmelo Rodríguez Torres, Rosario Ferré y Ana Lydia Vega). San Juan: Ed. de la Universidad de Puerto Rico, Ed. Cultural, and Instituto de Cultura Puertorriqueña, 1999. xxiv + 397 pp.-William W. Megenney, John H. McWhorter, The missing Spanish Creoles: Recovering the birth of plantation contact languages. Berkeley: University of California Press, 2000. xi + 281 pp.-Robert Chaudenson, Chris Corne, From French to Creole: The development of New Vernaculars in the French colonial world. London: University of Westminster Press, 1999. x + 263 pp.
42
Lamontagne, André. "La médiation intertextuelle." Dossier 40, no. 3 (August 11, 2015): 53–67. http://dx.doi.org/10.7202/1032634ar.
Full textAbstract:
La vie provisoire et À quoi ça rime ? ont en commun un parcours diégétique qui s’ouvre sur une scène extraterritoriale (respectivement la République dominicaine et le Portugal), retourne à Montréal et se déplace dans les Laurentides, lieu de retraite et d’ermitage littéraire. Dans chacun des deux romans, le personnage central fait une multitude de deuils (oncle, épouse, ami, relations amoureuses, vie antérieure) et aspire au détachement, à devenir autre. Cette découverte de l’autre en soi prend une dimension hautement intertextuelle : le protagoniste de La vie provisoire lit et relit les auteurs russes dans son refuge et invente un conte sur le modèle des Mille et une nuits, tandis que le narrateur d’À quoi ça rime ? suit les traces de Fernando Pessoa (lui-même connu pour ses hétéronymes) dans Lisbonne et cherche des vecteurs identitaires dans la littérature. Cet article se propose d’étudier la représentation de la lecture dans les deux derniers romans d’André Major : ses modalités et ses dispositifs intertextuels, ses incidences diégétiques et son potentiel d’altérité. Comme le montre l’auteur, l’acte de lire prolonge l’axe thématique des oeuvres antérieures de l’écrivain, ainsi l’idée de désertion, et reprend certaines questions récurrentes de la littérature québécoise, notamment les oppositions vie-écriture (Réjean Ducharme, Jacques Godbout) et nature-culture (Louis Hamelin).
43
KITLV, Redactie. "Book Reviews." New West Indian Guide / Nieuwe West-Indische Gids 67, no. 1-2 (January 1, 1993): 109–82. http://dx.doi.org/10.1163/13822373-90002678.
Full textAbstract:
-Louis Allaire, Samuel M. Wilson, Hispaniola: Caribbean chiefdoms in the age of Columbus. Tuscaloosa: University of Alabama Press, 1990. xi + 170 pp.-Douglas Melvin Haynes, Philip D. Curtin, Death by migration: Europe's encounter with the tropical world in the nineteenth century. Cambridge: Cambridge University Press, 1989. xviii + 251 pp.-Dale Tomich, J.H. Galloway, The sugar cane industry: An historical geography from its origins to 1914. Cambridge: Cambridge University Press, 1989. xii + 266 pp.-Myriam Cottias, Dale Tomich, Slavery in the circuit of sugar: Martinique and the world economy, 1830 -1848. Baltimore: John Hopkins University Press, 1990. xiv + 352 pp.-Robert Forster, Pierre Dessalles, La vie d'un colon à la Martinique au XIXe siècle. Pré-senté par Henri de Frémont. Courbevoie: s.n., 1984-1988, four volumes, 1310 pp.-Hilary Beckles, Douglas V. Armstrong, The old village and the great house: An archaeological and historical examination of Drax Hall Plantation, St Ann's Bay, Jamaica. Chicago: University of Illinois Press, 1990. xiii + 393 pp.-John Stewart, John A. Lent, Caribbean popular culture. Bowling Green OH: Bowling Green State University Popular Press, 1990. 157 pp.-W. Marvin Will, Susanne Jonas ,Democracy in Latin America: Visions and realities. New York: Bergin & Garvey Publishers, 1990. viii + 224 pp., Nancy Stein (eds)-Forrest D. Colburn, Kathy McAfee, Storm signals: Structural adjustment and development alternatives in the Caribbean. London: Zed books, 1991. xii + 259 pp.-Derwin S. Munroe, Peggy Antrobus ,In the shadows of the sun: Caribbean development alternatives and U.S. policy. Carmen Diana Deere (coordinator), Peter Phillips, Marcia Rivera & Helen Safa. Boulder CO: Westview Press, 1990. xvii + 246 pp., Lynne Bolles, Edwin Melendez (eds)-William Roseberry, Louis A. Pérez, Jr., Lords of the mountain: Social banditry and peasant protest in Cuba, 1878-1918. Pittsburgh: University of Pittsburgh Press, 1989. xvii + 267 pp.-William Roseberry, Rosalie Schwartz, Lawless liberators, political banditry and Cuban independence. Durham NC: Duke University Press, 1989. x + 297 pp.-Robert L. Paquette, Robert M. Levine, Cuba in the 1850's: Through the lens of Charles DeForest Fredricks. Tampa: University of South Florida Press, 1990. xv + 86 pp.-José Sánchez-Boudy, Gustavo Pérez Firmat, The Cuban condition: Translation and identity in modern Cuban literature. Cambridge: Cambridge University Press, 1989. viii + 185 pp.-Dick Parker, Jules R. Benjamin, The United States and the origins of the Cuban revolution: An empire of liberty in an age of national liberation. Princeton: Princeton University Press, 1990. xi + 235 pp.-George Irvin, Andrew Zimbalist ,The Cuban economy: Measurement and analysis of socialist performance. Baltimore: John Hopkins University Press, 1989. xiv + 220 pp., Claes Brundenius (eds)-Menno Vellinga, Frank T. Fitzgerald, Managing socialism: From old Cadres to new professionals in revolutionary Cuba. New York: Praeger, 1990. xiv + 161 pp.-Patricia R. Pessar, Eugenia Georges, The making of a transnational community: Migration, development, and cultural change in the Dominican republic. New York: Columbia University Press, 1990. xi + 270 pp.-Lucía Désir, Maria Dolores Hajosy Benedetti, Earth and spirit: Healing lore and more from Puerto Rico. Maplewood NJ: Waterfront Press, 1989. xvii + 245 pp.-Thomas J. Spinner, Jr., Percy C. Hintzen, The costs of regime survival: Racial mobilization, elite domination and control of the state in Guyana and Trinidad. Cambridge: Cambridge University Press, 1989. x + 240 pp.-Judith Johnson, Morton Klass, Singing with the Sai Baba: The politics of revitalization in Trinidad. Boulder CO: Westview, 1991. xvi + 187 pp.-Aisha Khan, Selwyn Ryan, The Muslimeen grab for power: Race, religion and revolution in Trinidad and Tobago. Port of Spain: Inprint Caribbean, 1991. vii + 345 pp.-Drexel G. Woodson, Patrick Bellegarde-Smith, Haiti: The Breached Citadel. Boulder CO: Westview Press, 1990. xxi + 217 pp.-O. Nigel Bolland, Howard Johnson, The Bahamas in slavery and freedom. Kingston, Jamaica: Ian Randle; London: James Currey, 1991. viii + 184 pp.-Keith F. Otterbein, Charles C. Foster, Conchtown USA: Bahamian fisherfolk in Riviera beach, Florida. (with folk songs and tales collected by Veronica Huss). Boca Raton: Florida Atlantic University Press, 1991. x + 176 pp.-Peter van Baarle, John P. Bennett ,Kabethechino: A correspondence on Arawak. Edited by Janette Forte. Georgetown: Demerara Publishers, 1991. vi + 271 pp., Richard Hart (eds)-Fabiola Jara, Joop Vernooij, Indianen en kerken in Suriname: identiteit en autonomie in het binnenland. Paramaribo: Stichting Wetenschappelijke Informatie (SWI), 1989. 178 pp.-Jay Edwards, C.L. Temminck Groll ,Curacao: Willemstad, city of monuments. R.G. Gill. The Hague: Gary Schwartz/SDU Publishers, 1990. 123 pp., W. van Alphen, R. Apell (eds)-Mineke Schipper, Maritza Coomans-Eustatia ,Drie Curacaose schrijvers in veelvoud. Zutphen: De Walburg Pers, 1991. 544 pp., H.E. Coomans, Wim Rutgers (eds)-Arie Boomert, P. Wagenaar Hummelinck, De rotstekeningen van Aruba/The prehistoric rock drawings of Aruba. Utrecht: Uitgeverij Presse-Papier, 1991. 228 pp.-J.K. Brandsma, Ruben S. Gowricharn, Economische transformatie en de staat: over agrarische modernisering en economische ontwikkeling in Suriname, 1930-1960. Den Haag: Uitgeverij Ruward, 1990. 208 pp.-Henk N. Hoogendonk, M. van Schaaijk, Een macro-model van een micro-economie. Den Haag: STUSECO, 1991. 359 pp.-Bim G. Mungra, Corstiaan van der Burg ,Hindostanen in Nederland. Leuven (Belgium)/ Apeldoorn (the Netherlands): Garant Publishers, 1990. 223 pp., Theo Damsteegt, Krishna Autar (eds)-Adrienne Bruyn, J. van Donselaar, Woordenboek van het Surinaams-Nederlands. Muiderberg: Dick Coutinho, 1989. 482 pp.-Wim S. Hoogbergen, Michiel Baud ,'Cultuur in beweging': creolisering en Afro-Caraïbische cultuur. Rotterdam: Bureau Studium Generale, 1989. 93 pp., Marianne C. Ketting (eds)
44
Manley, Elizabeth S., and April J. Mayes. "Situating Blackness and Antiracism in a Global Frame: Key Works for a Study of the Dominican Republic." Kalfou 7, no. 2 (April 27, 2021). http://dx.doi.org/10.15367/kf.v7i2.340.
Full textAbstract:
This syllabus provides a starting point for those interested in learning and teaching about race and Blackness in the Dominican Republic, both within and beyond the U.S. academic context. While the dominant narrative emerging from the United States tends to cast all Dominicans as both anti-Black and anti-Haitian, the Dominican Republic has a long history of Black liberation that can be understood only if we pay attention to the complicated, nuanced, and historical ways in which race and national identities, as in all places, have been constructed by various groups and forces. This reading list provides a point of departure for understanding the many scholarly and public-facing works in English that have, over the past decade, grappled with these many complications of race, nation, and identity-making. Specifically, it traces the three main frameworks that have become axiomatic in the field for contextualizing Dominican concepts of race and nation: (1) island-wide struggles for sovereignty and emancipation across the late seventeenth and eighteenth centuries, (2) the powerful forces of neocolonialism that facilitated U.S. occupation of the island in the early twentieth century, and (3) the struggles for modern sovereignty and the legacies of occupation that resulted in dictatorial leadership across Hispaniola, namely by François and Jean-Claude Duvalier in Haiti and Rafael Trujillo and Joaquín Balaguer in the Dominican Republic.
45
Dilla Alfonso, Haroldo, and Karen Hansen Figueroa. "Borderland Political Regimes in Latin America." Latin American Perspectives, September 11, 2020, 0094582X2093910. http://dx.doi.org/10.1177/0094582x20939102.
Full textAbstract:
One of the characteristics of contemporary political geography is the transformation of international borders into resources for capitalist value creation. This has been accompanied by the emergence of new identities and practices that challenge the nationalist doxa. Borderland political regimes seek to account for this complexity as it is expressed in the way in which the nation-states perceive and try to govern these spaces of overlapping territorialities. An analysis of the ways in which Chile, Colombia, and the Dominican Republic perceive their borders and produce regulations and institutional frameworks based on both their particular histories and the requirements of neoliberal capitalist accumulation concludes with a series of proposals for inclusive governance systems that take the aforementioned complexities into account. Una de las características de la geografía política contemporánea es la transformación de las fronteras internacionales en recursos para la creación de valor capitalista. Esto se ha acompañado de la aparición de nuevas identidades y prácticas que desafían la doxa nacionalista. Los regímenes políticos fronterizos tratan de dar cuenta de esta complejidad, expresada en la forma en que los Estados-nación perciben y tratan de gobernar estos espacios de supuestas territorialidades. Un análisis de las maneras en que Chile, Colombia y República Dominicana perciben sus fronteras y emiten regulaciones y marcos institucionales basados tanto en sus historias nacionales particulares como en los requisitos de la acumulación capitalista neoliberal concluye con una serie de propuestas para sistemas de gobierno inclusivos que tomen en cuenta las complejidades antes mencionadas.
46
Hamm-Rodríguez, Molly, and Carmen Liliana Medina. "Intra-Caribbean Solidarities and the Language of Social Protest." Applied Linguistics, July 13, 2021. http://dx.doi.org/10.1093/applin/amab038.
Full textAbstract:
Abstract This essay explores the language of social protest in two geographic and diasporic locations in the Caribbean (Puerto Rico and the Dominican Republic) with long and ongoing histories of colonialism and imperialism. We analyze social media and digital mobilizing to examine how, in the midst of social protest, linguistic and semiotic tools indexed historicity, contemporaneity, and futurity through relational strategies that are not just textual and discursive, but also historical, social, and political. Throughout this essay, we share examples of intertextual and interdiscursive strategies that marked particular moments of protest as articulations of historical precedents, imperial and colonial presents, and alternative futures. These examples reveal how collective identities (i.e. el pueblo) are mobilized in social protest to generate counternarratives that address structures and systems rather than locate social critiques in particular individuals and political parties. In shedding light on the intra-Caribbean solidarities that emerge over time, this analysis also points to a need to examine the erasures (Gal and Irvine 2019) performed through claims to unity and collective organizing.
47
Regis, Daniele. "Visages de la contemplation." ArchAlp 2023 Vol. 11, no. 11 (March 19, 2024). http://dx.doi.org/10.30682/aa2311s.
Full textAbstract:
Visages del la contemplation (1980) is the title of a photography book with images by Michele Pellegrino, a preface by Roger Etchegaray, Archbishop of Marseille at the time of publication, and Cardinal Presbyter of St. Leo I, former president of the Council of Conferences of Bishops of Europe and of the Episcopal Conference of France, with the full text and historical notes by Jean Pier Ravotti. The work, now quite rare and preserved in the Vatican Apostolic Library, unparalleled in its reflection, remains a powerful fresco of monasteries and contemplative life, the identities and differences of charisms, and the vows of poverty, chastity and obedience of the different orders and monasteries: the Benedictines, the Camaldolese, the Cistercians, the Canons Regular, the Trappists, the Carthusians, the Poor Clares, the Dominican and Carmelite nuns, the Passionists and the Little Sisters of Bethlehem, and the Little Brothers. A sister dimension to that of the cloistered emerges in the book, a dimension that could be considered the most neglected by historians, especially in the oblivion of sapiential traditions: cloistered monasteries as citadels of culture and art, custodians of priceless heritages, and at the same time extraordinary centres of production that admirably shape territories and landscapes. This world of partially lost sapiential traditions, of care, intelligence, love of nature, harmony, sustainability, invites us to think about the issue of sustainability in the mountains.
48
Palenzuela, Nilo. "Europe: Passages or reflections." Cultural Dynamics, January 8, 2024. http://dx.doi.org/10.1177/09213740231223833.
Full textAbstract:
This text reflects on identities from an African archipelago in the Atlantic that is part of the Spanish state. The Canary Islands were the first place colonized by Europeans in their expansion toward America. The text focuses on identity formation throughout the twentieth century. Reference is made to Canarian artists and poets such as Tomás Morales and Alonso Quesada, and more recent artists of international stature such as Manolo Millares, Martín Chirino, and César Manrique. The international context and the destruction of the idea of Europe are reflected from various perspectives. Reference is made to travelers who drew analogies between Canary Islanders and Native Americans, and the notion of “displacement” at every level is addressed. The article also discusses “foreigners” traveling back and forth in the era of advanced technology, globalization, and mass tourism. As Stefan Zweig and Franz Rosenzweig have observed since the 1920s, in the age of border control, anyone can become a “foreigner.” “Europe: Passage and Reflections” was born within the context of the exhibition “Europe, that Exotic Place” (2019–2020) and expands upon the reflection on insularities undertaken in the exhibition “Island Horizons” (2009–2010), which featured artists and writers from Cuba, the Dominican Republic, Puerto Rico, Martinique, Guadeloupe, French Guiana, the Canary Islands, the Azores, Madeira, Cape Verde, and Réunion. The article also arose from the “Islands, Images, Imaginaries” discussion series held at Duke University in 2011.
49
Yao, Jean-Arsène. "Pratiques religieuses et conflits identitaires en République dominicaine." Études caribéennes, no. 4 (May 20, 2020). http://dx.doi.org/10.4000/etudescaribeennes.18067.
Full text
50
Tapia Medina, Ariel Osvaldo. "Faisceaux d’isoglosses en République Dominicaine et leurs questions identitaires." HispanismeS, no. 17 (June 1, 2021). http://dx.doi.org/10.4000/hispanismes.13307.
Full text