Relevant bibliographies by topics / Dental policy

Journal articles
Dissertations / Theses
Books
Book chapters
Conference papers
Reports

Academic literature on the topic 'Dental policy'

Author: Grafiati

Published: 4 June 2021

Last updated: 1 August 2024

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Dental policy.'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Journal articles on the topic "Dental policy"

Takefuji, Y. "New Japan dental policy." British Dental Journal 232, no. 12 (June 24, 2022): 840. http://dx.doi.org/10.1038/s41415-022-4408-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Redig, DF. "Dental health policy development." Journal of Dental Education 49, no. 11 (November 1985): 746–47. http://dx.doi.org/10.1002/j.0022-0337.1985.49.11.tb01945.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Morris, AL. "A dental education perspective on dental health policy." Journal of Dental Education 49, no. 11 (November 1985): 736–38. http://dx.doi.org/10.1002/j.0022-0337.1985.49.11.tb01942.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Takefuji, Y. "Dental fluoride policy in Japan." British Dental Journal 227, no. 2 (July 2019): 71. http://dx.doi.org/10.1038/s41415-019-0566-2.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Burkett, Nina. "Policy writing for dental nurses." Dental Nursing 6, no. 1 (January 2010): 34–38. http://dx.doi.org/10.12968/denn.2010.6.1.46282.

Full text

APA, Harvard, Vancouver, ISO, and other styles

SHEIHAM, AUBREY. "Giving dental policy more bite." Health Policy and Planning 3, no. 2 (1988): 164–66. http://dx.doi.org/10.1093/heapol/3.2.164.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Loe, H. "Dental research policy: who decides?" Journal of Dental Education 49, no. 11 (November 1985): 739–42. http://dx.doi.org/10.1002/j.0022-0337.1985.49.11.tb01943.x.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Wada, Koji. "About Japanese policy on dental technology." Annals of Japan Prosthodontic Society 8, no. 3 (2016): 231–36. http://dx.doi.org/10.2186/ajps.8.231.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Lee, Jei-Young, and Mi-Ae Jeong. "Subjectivity about Policy of Dental Treatment." Journal of the Korea Contents Association 12, no. 1 (January 28, 2012): 386–99. http://dx.doi.org/10.5392/jkca.2012.12.01.386.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Murniwati, Murniwati, Rizanda Machmud, and Suci Rahmasari. "GAMBARAN PENGETAHUAN DOKTER GIGI TENTANG REKAM MEDIK GIGI." Andalas Dental Journal 1, no. 1 (February 13, 2019): 57–70. http://dx.doi.org/10.25077/adj.v1i1.14.

Full text

Abstract:

Dental records must comply with National Standard of Dentistry, Medical Record must contain data that identity of the patient, patient's general condition, odontogram, dental care data and the name and signature of the dentist and dental records are more important filled completely. This study aim to know the knowledge of all dentists in Padang to dentall record. The design of this study is Descriptive. The populations in this study were all dentists who working in health centers and hospitals of Padang. The sampling technique is Total Sampling and data collection through questionnaires and observation of dental records. The results showed that the rate of the level of knowledge about the importance of dentall record low according to national standards where knowledge about medikolegal aspects is the subject to a level of knowledge is low, reaching only 4.2%. Knowledge of dentists about the medical records dental national standards is low because of the lock of socialization and conducted a related-party factor. It could be need to socialization and provide the policy of dental record based on national standard for all dentists.

APA, Harvard, Vancouver, ISO, and other styles

More sources

Dissertations / Theses on the topic "Dental policy"

Satur, Julie, and julie satur@deakin edu au. "Australian dental policy reform and the use of dental therapists and hygienists." Deakin University. School of Health Sciences, 2002. http://tux.lib.deakin.edu.au./adt-VDU/public/adt-VDU20061207.115552.

Full text

Abstract:

Oral diseases including dental caries and periodontal disease are among the most prevalent and costly diseases in Australia today. Around 5.4% of Australias health dollar is spent on dental services totalling around $2.6 billion, 84% of which are delivered through the private sector (AIHW 2001). The other 16% is spent providing public sector services in varied and inadequate ways. While disease rates among school children have declined significantly in the past 20 years the gains made among children are not flowing on to adult dentitions and our aging population will place increasing demands on an inadequate system into the future (AHMAC 2001). Around 50% of adults do not received regular care and this has implications for widening health inequalities as the greatest burden falls on lower income groups (AIHW DSRU 2001). The National Competition Policy agenda has initiated, Australia-wide, reviews of dental legislation applying to delivery of services by dentists, dental specialists, dental therapists and hygienists and dental technicians and prosthetists. The review of the Victorian Dentists Act 1972, was completed first in 1999, followed by the other Australian states with Queensland, the ACT and the Northern Territory still developing legislation. One of the objectives of the new Victorian Act is to promote access to dental care. This study has grown out of the need to know more about how dental therapists and hygienists might be utilised to achieve this and the legislative frameworks that could enable such roles. This study used qualitative methods to explore dental health policy making associated with strategies that may increase access to dental care using dental therapists and hygienists. The study used a multiple case study design to critically examine the dental policy development process around the Review of the Dentists Act 1972 in Victoria; to assess legislative and regulatory dental policy reforms in other states in Australia and to conduct a comparative analysis of dental health policy as it relates to dental auxiliary practice internationally. Data collection has involved (I) semi-structured interviews with key participants and stakeholders in the policy development processes in Victoria, interstate and overseas, and (ii) analysis of documentary data sources. The study has taken a grounded theory approach whereby theoretical issues that emerged from the Victorian case study were further developed and challenged in the subsequent interstate and international case studies. A component of this study has required the development of indicators in regulatory models for dental hygienists and therapists that will increase access to dental care for the community. These indicators have been used to analyse regulation reform and the likely impacts in each setting. Despite evidence of need, evidence of the effectiveness and efficiency of dental therapists and hygienists, and the National Competition Policy agenda of increasing efficiency, the legislation reviews have mostly produces only minor changes. Results show that almost all Australian states have regulated dental therapists and hygienists in more prescriptive ways than they do dentists. The study has found that dental policy making is still dominated by the views of private practice dentists under elitist models that largely protect dentist authority, autonomy and sovereignty. The influence of dentist professional dominance has meant that governments have been reluctant to make sweeping changes. The study has demonstrated alternative models of regulation for dental therapists and hygienists, which would allow wider utilisation of their skills, more effective use of public sector funding, increased access to services and a grater focus on preventive care. In the light of theses outcomes, there is a need to continue to advocate for changes that will increase the public health focus of oral health care.

APA, Harvard, Vancouver, ISO, and other styles

Winheim, Matthew. "The Effect of Medicaid Policy Reform on Dental Utilization Rates for Children." VCU Scholars Compass, 2010. http://scholarscompass.vcu.edu/etd/2072.

Full text

Abstract:

Background: Regular access to dental services is a well-known factor in the oral health and development of children.1 As such, the United States federal government mandates each state to include dental services for children enrolled in Medicaid through the age of 21. Despite this mandate, the utilization rate of dental services among Medicaid enrolled children has remained remarkably low.2 In July 2005, Virginia implemented a sweeping Medicaid policy reform titled “Smiles for Children,” specifically aiming to increase Medicaid pediatric dental utilization rates. The purpose of this study aims to assess the effect of this 2005 policy reform on the utilization of dental services by children enrolled in Medicaid. Objective: The purpose of this study is to examine the impact of the 2005 Virginia Smiles for Children Medicaid policy reform on the utilization of dental services among Medicaid enrolled children. Methods: This was a retrospective cohort study of children (pre-reform n=559,820, post-reform n=690,538) enrolled in Virginia Medicaid from 2002 through 2008. Descriptive statistics and repeated measures multivariate logistic regressions were used to determine the relationship between enrollment (Pre- and Post-policy reform) and the utilization of dental services (1+ Dental Visits vs. No Dental Visits). Results: Descriptive analysis of the cohort found that 34% of pre-reform children had a dental visit while 44% of post-reform children. The logistic regression models revealed that children in the post reform period were 1.39 as likely to have had a dental visit. Stratifying for enrollment length reveals that as the length of exposure time to the post-reform policy increases, the odds of having a dental visit also increase as compared to the pre-reform period: for 31-36 months of enrollment the odds increase 1.54 times. Conclusions: Medicaid policy reform can significantly improve access to dental services for children and can therefore play an important role in promoting public health.

APA, Harvard, Vancouver, ISO, and other styles

Bonwell, Patricia Brown. "COHORT MEMBERSHIP, DENTAL INSURANCE AND UTILIZATION OF DENTAL SERVICES IN ADULTS AGE 47 AND OVER RECEIVING DENTAL CARE AT VIRGINIA COMMONWEALTH UNIVERSITY’S SCHOOL OF DENTISTRY." VCU Scholars Compass, 2012. http://scholarscompass.vcu.edu/etd/2823.

Full text

Abstract:

This cross-sectional, non-experimental study evaluates associations between cohort membership, type of dental coverage, and utilization of dental services in all patients age 47 and over who received dental care at Virginia Commonwealth University’s (VCU) School of Dentistry in 2011. Structural Lag Theory poses that society’s institutions lag behind the actuality of a healthy and capable older adult population. The two dynamisms of the Structural Lag Theory were used for this study. The Dynamism of Changing Lives is represented by Cohort differences. Cohort differences include cohort size, people living longer and retaining more of their natural teeth along with different attitudes toward dental care. This dynamism impacts the Dynamism of Structural Change, represented by the institutions of dental coverage and utilization of dental services. Cohort membership is an independent variable. The dependent variable, utilization, is defined as Financial-Total amount spent and Procedural-Routine adult dental prophylaxis. Dental coverage, a dichotomous variable, is used as an independent and dependent variable. Descriptive statistics revealed employer provided dental coverage is the most prevalent type of dental coverage. However, when considered a payment source, out of pocket funding is the primary source of payment for dental services. Using Chi-square and logistic regression, examination of Cohorts (1-Greatest Generation, 2-Silent Generation, 3-Baby Boomer Generation) revealed that Cohort 2 had more dental coverage than Cohort 1, and Cohort 3 had more dental coverage than Cohort 2. Using logistic regression, Cohort 2 showed the highest level of Procedural utilization. Evaluating Financial utilization, multiple regression models showed Cohort 1 utilized more than Cohort 2 and Cohort 2 utilized more than Cohort 3. Those with dental coverage spend more on dental services, fees for routine adult dental prophylaxis make up the majority of the total amount spent, and those with dental coverage utilize more dental services when defined as total amount spent. Because they have experienced different social, political, economic, and technological changes at different times in their life course, the receipt of dental services by new cohorts of older people differs from previous ones. Findings from this study confirm that there is a structural lag in Medicare policy and its coverage of dental services.

APA, Harvard, Vancouver, ISO, and other styles

Patton, Michael. "Effective methods in the treatment of patients with dental anxiety." Thesis, Boston University, 2013. https://hdl.handle.net/2144/21235.

Full text

Abstract:

Thesis (M.A.) PLEASE NOTE: Boston University Libraries did not receive an Authorization To Manage form for this thesis or dissertation. It is therefore not openly accessible, though it may be available by request. If you are the author or principal advisor of this work and would like to request open access for it, please contact us at open-help@bu.edu. Thank you.
Dental phobia, also referred to as "dental anxiety," or "odontophobia," is a significant and intense fear of visiting the dentist for oral treatments. Individuals who experience high levels of this anxious condition avoid going to the dentist. It is estimated that 9 to 15% of both children and adults in America, about 30 – 40 million individuals, experience a level of dental phobia that causes them to avoid visiting the dentist. Individuals affected with this specific form of anxiety often neglect necessary dental visits for varying periods of time, which can, obviously, lead to health concerns in the oral cavity and other parts of the human body, as well as result in mental health and image concerns. When dental phobic patients do manage to attend a dental session, the individual often experiences great levels of anxiety and stress throughout the entire experience, not only creating pain and discomfort for the patient, but also creating adverse treatment circumstances for the dental practitioners that serve to help the patient. Efforts have been made in investigating the effectiveness of various techniques and approaches that could be implemented in the dental setting to ease phobic patients, granting them a less-stressful experience and allowing the dental staff to do their jobs more efficiently in providing the patient with appropriate oral care. There are several techniques used in the dental office today to reduce anxiety such as distraction, controlled breathing techniques, attention focusing, and several sedating methods employing various types of medication, as well as different types of administration. Distraction, controlled breathing, and attention focusing require special attention and an extension of time on the end of not only the patient, but also of the dental staff. These techniques, while possibly offering a reduction in feelings of anxiety, may require multiple attempts and a greater investment of time to show substantial results. Sedation methods may consist of various medications used alone or in a combination to successfully achieve a reduction in anxiety. With the various types of medications and techniques that can be used when sedating a patient, along with the various routes of administration, such as oral, intravenous, and intranasal, sedation methods can be adapted to best suit a patient in terms of their personal preferences and level of comfort, as well as to accommodate time requirements for specific procedures. Each of the techniques and methods used in today’s dental setting should be carefully and strategically evaluated and customized for the anxious or phobic patient in mind. Some methods are favored for certain attributes, varying from ease of use, time required, and speed of onset, to the efficiency in reducing a patient’s anxious or phobic symptoms. Professionals in the field of dentistry must act as providers of the treatment options and resources of the information in regards to the methods so that patients may become aware of the current tactics used in aiding such affected people.
2031-01-01

APA, Harvard, Vancouver, ISO, and other styles

Hammersmith, Kimberly Jan. "Ohio Dentists’ Awareness and Adoption of the Dental Home Concept." The Ohio State University, 2011. http://rave.ohiolink.edu/etdc/view?acc_num=osu1306326715.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Filgueira, Ana Carolina Cavalcanti. "Performance evaluation of public policy center dental specialties in the region cariri - ce." Universidade Federal do CearÃ, 2012. http://www.teses.ufc.br/tde_busca/arquivo.php?codArquivo=9333.

Full text

Abstract:

nÃo hÃ
The aim of this study aimed to evaluate the performance of specialized dental clinics that have Ordinance Qualification Program Smiling Brazil located in the Region Cariri (CearÃ, Brazil) in 2010. We used the data recorded in the database of the Department of the SUS (DATASUS), information from SIA / SUS. After collection, the information was imported into the program TAB for Windows - TabWin - developed by DATASUS in order to allow for rapid tabs on DBF files that constitute the basic components of information systems of the SUS. An indicator called Global Compliance Goals (CGM) developed by E FIGUEREDO GÃES, 2009, was used to evaluate the performance of the services performed by CEOs. Data analysis was built a table with the number of procedures by specialty (subgroup) for each Specialty Dental Center (EOC). We calculated the average monthly procedures performed by CEO and the ratio of the average number of procedures performed monthly and the target unit of each evaluated according to the type of procedure. The efficacy of the CEO was obtained by the average of this ratio. Still, graphs were made of the number of procedures performed and advocated for the Centers. Of the seven CEOs studied, measurement of the CGM, it was found that 42.85% of the specialized obtained, poor performance, fulfilling only one of the four goals set by Ordinance 600/2006 of the Ministry of Health The only CEO who has fulfilled all goals, achieving optimal performance was the municipality of Farias Brito. In contrast, the center located in the city of Crato failed to execute the goals of the procedures in any branch of dentistry, not reaching a score (poor performance). It was found that the AB Specialty (Primary) all centers achieved the targets except the CEO Barbalha and Crato where 9% and 11%, respectively, certain procedures have not occurred. In the surgery procedure, it is emphasized that only the CEO of Farias Brito has achieved the number of attendances defined for it (1.36 times the expected number). Of those who did not reach the target the most critical situation was the CEO who left Old Mission to achieve 89% (71 cases) of the surgeries. It was concluded that the performance of specialized dental clinics of Cariri in 2010 is unsatisfactory as production proposed by the Ministry of Health.
O presente estudo visa avaliar o desempenho dos Centros de Especialidades OdontolÃgicas que possuem Portaria de HabilitaÃÃo do Programa Brasil Sorridente localizados na RegiÃo do Cariri (CearÃ, Brasil) no ano de 2010. Utilizou-se os dados registrados no banco de dados do Departamento de InformÃtica do SUS (DATASUS), informaÃÃes do SIA/SUS. ApÃs coleta, as informaÃÃes foram importadas para o programa TAB para Windows â TabWin - desenvolvido pelo DATASUS com a finalidade de permitir a realizaÃÃo de tabulaÃÃes rÃpidas sobre os arquivos DBF que se constituem nos componentes bÃsicos dos sistemas de informaÃÃes do SUS. Um indicador denominado Cumprimento Global de Metas (CGM) desenvolvido por FIGUEREDO E GÃES, 2009, foi usado para avaliar o desempenho dos serviÃos executados pelos CEOs. Para anÃlise dos dados foi construÃda uma tabela com o nÃmero de procedimentos segundo a especialidade (subgrupo) para cada Centro de Especialidade OdontolÃgico (CEO). Calculou-se a mÃdia de procedimentos mensais realizados pelos CEOs e a razÃo entre o nÃmero mÃdio de procedimentos realizados e a meta mensal de cada unidade avaliada, de acordo com o tipo de procedimento. A avaliaÃÃo da eficÃcia dos CEOs foi obtida atravÃs desta razÃo entre a mÃdia. Ainda, foram confeccionados grÃficos do nÃmero de procedimentos realizados e preconizados para os Centros. Dos 7 CEOs estudados, medido o CGM, constatou-se que 42,85% dos Centros de Especialidades obtivera, desempenho ruim, cumprindo apenas 1 das 4 metas preconizadas pela Portaria 600/2006 do MinistÃrio da SaÃde. O Ãnico CEO que cumpriu a totalidade das metas, alcanÃando desempenho Ãtimo foi o do MunicÃpio de Farias Brito. Em contrapartida, o centro localizado na cidade do Crato nÃo conseguiu executar as metas dos procedimentos de nenhuma especialidade odontolÃgica, nÃo alcanÃando pontuaÃÃo alguma (desempenho pÃssimo). Verificou-se que na Especialidade AB (AtenÃÃo BÃsica) todos os centros atingiram as metas exceto o CEO de Barbalha e do Crato em que 9% e 11%, respectivamente, dos procedimentos determinados nÃo ocorreram. JÃ no procedimento CIRURGIA, ressalta-se que apenas o CEO de Farias Brito conseguiu realizar o nÃmero de atendimentos definidos para ele (1,36 vezes o nÃmero esperado). Dos que nÃo atingiram a meta a situaÃÃo mais crÃtica foi o CEO MissÃo Velha que deixou de realizar 89% (71 casos) das cirurgias. PÃde-se concluir que o desempenho dos 5 Centros de Especialidades OdontolÃgicas da regiÃo do Cariri no exercÃcio de 2010 estÃ insatisfatÃrio quanto a produÃÃo proposta pelo MinistÃrio da SaÃde.

APA, Harvard, Vancouver, ISO, and other styles

Clovis, Joanne. "Professionalism in dental hygiene, an investigation of knowledge of oral cancer and public policy." Thesis, National Library of Canada = Bibliothèque nationale du Canada, 2000. http://www.collectionscanada.ca/obj/s4/f2/dsk1/tape4/PQDD_0015/NQ57355.pdf.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Singh, Shenuka. "A critical analysis of the provision for oral health promotion in South African health policy development." Thesis, University of the Western Cape, 2004. http://etd.uwc.ac.za/index.php?module=etd&action=viewtitle&id=init_4116_1178278944.

Full text

Abstract:

The rhetoric of primary health care, health promotion and health service integration is ubiquitous in health policy development in post-apartheid South Africa. However the form in which oral health promotion elements have actually been incorporated into other areas of health care in South Africa and the extent to which they have been implemented, remains unclear. The central aim of this research was to critically analyse oral health promotion elements in health policies in South Africa and determine the extent to which they have been implemented. The study set out to test the hypothesis that oral health promotion is fully integrated into South African health policy and practice.

APA, Harvard, Vancouver, ISO, and other styles

Zhang, Min H. "The Effect of Change in Medi-Cal Dental Coverage on Dental Care Utilization Among Medi-Cal Beneficiaries." VCU Scholars Compass, 2019. https://scholarscompass.vcu.edu/etd/6045.

Full text

Abstract:

One of the most important factors in accessing dental care is having dental insurance. For people with low incomes, Medicaid is the main source of health insurance. Medi-Cal is California’s Medicaid program. Adult dental services were mostly eliminated in Medi-Cal in 2009 due to the economic downturn and partially restored in 2014. The objective of this study is to evaluate the effect of change in Medi-Cal dental coverage, specifically the partial restoration of adult dental coverage in 2014, on dental care utilization among Medi-Cal beneficiaries. The partial restoration significantly increased the utilization rates in dental clinics from 2014 to 2017 (22% in 2017 vs. 12% in 2013) for the overall population. However, the magnitude of increase differs in different age groups and ethnic groups. More statistically significant findings show greater utilization rates among beneficiaries of 19-64 than 65-74 and 75+ years old. Also, more significant findings show lower utilization among Black than White, Hispanic or Asian beneficiaries. The partial restoration significantly reduced the dental related ER visits among Medi-Cal beneficiaries from 2015 to 2017. However, the reduction is largely seen in beneficiaries of 19-64 years old in the ethnic groups of White and Black with reductions of 20 and 15 visits per 1,000 enrollees respectively in 2017 comparing to 2013. The dental related ER visits were lower for Hispanics and Asians, and remained very low among those 65 years old and above. In addition, the partial restoration resulted in increases in participation of dental care providers in the Medi-Cal program.

APA, Harvard, Vancouver, ISO, and other styles

Singhal, Astha. "Emergency department use : role of medical home, impact of state Medicaid dental policy and continuity of care." Diss., University of Iowa, 2015. https://ir.uiowa.edu/etd/3190.

Full text

Abstract:

Avoidable use of the Emergency Departments (EDs) constitutes a significant public health problem, which has health, economic and ethical implications. The factors that affect avoidable use of the EDs are complex and poorly understood. The goal of this dissertation was to examine the role of medical home in avoidable pediatric ED visits, assess the impact of Medicaid policy on ED visits for dental problems and assess the factors affecting follow-up dental care after a dental ED visit. Iowa Household Health Survey data was used for the first study, which included a sample of families with at least one child residing in Iowa. It was found that 68% of parents who took their child to an ED in the previous year thought the ED visit could have been avoided if primary care was available to them. Having a medical home was not found to be associated with pediatric ED visits; however, food insecurity was significantly associated. Parents of children with public insurance, those who were not referred by a healthcare provider and those who reported difficulty in getting routine care appointments were more likely to report an avoidable ED visit by their child. The second study examined a policy change in California where Medicaid eliminated its comprehensive adult dental coverage on July 1, 2009. State Emergency Department Database were obtained from Agency for Healthcare Research and Quality for California for 2006 through 2011. Interrupted time series, a quasi-experimental approach of was used to examine the impact of the policy change on rate of dental ED visits by Medicaid enrolled adults. Segmented linear regression revealed that policy change led to an immediate significant increase in the rate of dental ED visits. The policy had a differential impact on various subgroups based on age, race-ethnicity and residential location. The annual costs associated with dental ED visits made by Medicaid adults also increase 68%. Survival analytic approach was used in the final study to examine the patterns of dental care following a dental ED visit by Medicaid enrolled adults in Iowa. Medicaid claims and enrollment data were used to identify adults with an index dental ED visit in 2011, and then each subject was followed for up to 6 months. About 52% of all adults who satisfied the study inclusion criteria, had a follow up dental visit within 6 months of the index dental ED visit. Cox regression model revealed that adults who had visited a dentist in the year prior to the ED visit had greater hazards of having an early dental follow up after the ED visit. Having repeated dental ED visits was found to have a dose-response relationship to follow-up time to dentist visit, with those having 1 repeat ED visit having 53% hazards and those with 2 or more repeat ED visits having 34% hazards of having a follow-up dentist visit, compared to those with no repeat ED visits. Collectively, the results from this dissertation provide important insights in understanding the complex problem of avoidable ED visits. Factors such as food insecurity and medical home need to be further investigated in their association with avoidable ED visits. State Medicaid policy plays an important role and limiting Medicaid adult dental coverage may lead to an increased reliance of the affected population on EDs for dental care. However, EDs do not provide any definitive dental care, and our results indicate that almost half of the adults with dental ED visit do not have a follow-up dentist visit in the next 6 months.

APA, Harvard, Vancouver, ISO, and other styles

More sources

Books on the topic "Dental policy"

Washington (State). Legislature. Joint Select Committee on Oral Health., Washington (State). Dept. of Social and Health Services., and Washington (State). Dept. of Health., eds. Status report on oral health activities: Based on the recommendations and options for consideration from the 1996 Joint Select Committee on Oral Health. Olympia, Wash: Washington State Dept. of Health, 2000.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Washington (State). Dept. of Ecology. and Washington (State). Hazardous Waste and Toxics Reduction Program., eds. Dental programs environmental competency. Olympia, WA: Dept. of Ecology, Hazardous Waste and Toxics Reduction Program, 1997.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Find full text

APA, Harvard, Vancouver, ISO, and other styles

United States. Congress. Senate. Committee on Health, Education, Labor, and Pensions. Subcommittee on Primary Health and Aging, ed. Dental services: Information on coverage, payments, and fee variation : report to the Chairman, Subcommittee on Primary Health and Aging, Committee on Health, Education, Labor, and Pensions, U.S. Senate. [Washington, D.C.]: United States Government Accountability Office, 2013.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Levine, R. S. The Scientific basis of dental health education: A policy document. 4th ed. London: Health Education Authority, 1996.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

National, Consortium Meeting of Oral Health 2000 (1992 Irvine Calif ). National Consortium Meeting Oral Health 2000: Adapted from a symposium at Beckman Conference Center, Institute of Medicine, Irvine, California, January 7-9, 1992. Chicago, Ill: American Fund for Dental Health, 1992.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Spencer, A. J. The dental labour force in Australia: The position and policy directions. [Canberra]: Australian Institute for Health and Welfare, 2003.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

United States. Congress. House. Committee on Government Reform. Subcommittee on Human Rights and Wellness. California's compliance with dental amalgam disclosure policies: Hearing before the Subcommittee on Human Rights and Wellness of the Committee on Government Reform, House of Representatives, One Hundred Eighth Congress, second session, January 26, 2004. Washington: U.S. G.P.O., 2004.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Canada. Dept. of National Health and Welfare., ed. Dental care programs in Canada: Historical development, current status, and future directions : a report. Ottawa, Canada: Health and Welfare, Canada, 1986.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

Scotland. Scottish Executive. Health Department., ed. An action plan for dental services in Scotland. [Edinburgh]: Scottish Executive, 2000.

Find full text

APA, Harvard, Vancouver, ISO, and other styles

More sources

Book chapters on the topic "Dental policy"

Downer, Martin C. "The role of oral health promotion in oral health policy." In Oral Health Promotion, 121–44. New York, NY: Oxford University Press, 1993. http://dx.doi.org/10.1093/oso/9780192620033.003.0005.

Full text

Abstract:

Abstract Policy is a plan for action adopted or pursued by an individual, government, political party, commercial enterprise, or any other organization. The nub of the definition is ‘plan for action’ and this implies action towards a specified objective or goal. In many places in the world examples may be found of governments, professional organizations, or other groups prescribing broad aims for their communities’ dental services or adopting goals for oral health. In those countries where health care and related systems are most highly developed, action towards these goals is generally supported by a strong statutory framework. Nevertheless, while some countries have a long history of slow and gradual development of their dental services underpinned by networks of laws and regulations, health promotion has been included in oral health and related legislation only relatively recently. In countries at the opposite end of the spectrum health promotional activities, where they exist, have arisen haphazardly mostly from the initiative of local authorities or professional groups. These countries have not yet come to rely on formal legislation.

APA, Harvard, Vancouver, ISO, and other styles

Steier, Liviu, Regina Steier, and Gabriela Steier. "Intersections of Dental Health and Food Law: The Conflict of Systemic Flouridation as a Public Health Instrument to Prevent Tooth Decay." In International Food Law and Policy, 291–318. Cham: Springer International Publishing, 2016. http://dx.doi.org/10.1007/978-3-319-07542-6_13.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Samuelsson, Jonatan. "The state of tooth decay: dental knowledge, medical policy and fluoridation in Sweden, 1952–1962." In Cultures of Oral Health, 204–21. London: Routledge, 2022. http://dx.doi.org/10.4324/9781003047674-17.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Andell, Paul. "Policy Denial of New Gang Cities." In Thinking Seriously About Gangs, 81–106. Cham: Springer International Publishing, 2019. http://dx.doi.org/10.1007/978-3-030-12891-3_4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Barton, Stuart John. "Crisis: Decline and Denial (1975–1981)." In Policy Signals and Market Responses, 91–116. London: Palgrave Macmillan UK, 2016. http://dx.doi.org/10.1057/9781137390981_5.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Caelli, W. J., S. V. Raghavan, S. M. Bhaskar, and J. Georgiades. "Policy and Law: Denial of Service Threat." In An Investigation into the Detection and Mitigation of Denial of Service (DoS) Attacks, 41–114. India: Springer India, 2011. http://dx.doi.org/10.1007/978-81-322-0277-6_3.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Pellissery, Sony. "Social Policy in India: One Hundred Years of the (Stifled) Social Question." In One Hundred Years of Social Protection, 121–56. Cham: Springer International Publishing, 2020. http://dx.doi.org/10.1007/978-3-030-54959-6_4.

Full text

Abstract:

AbstractWhat social policy is possible in a context where equality among citizens is culturally denied but at the same time constitutionally guaranteed? This chapter attempts to answer this question by periodising how the social question was articulated in India during the last 100 years. While philosophical and religious traditions of India created “duty-oriented” social relations, the rise of the modern state prompted to change this into “right-oriented” social obligations. This tension resurfaced in the history of Indian social question through prioritising political freedom over social unfreedom, nation-building over poverty alleviation, homogenised national identity over the particularistic demands of marginalised sections, and authoritarian polity over decentralised systems. It suffices to say that Indian polity is in a denial mode regarding the social question.

APA, Harvard, Vancouver, ISO, and other styles

Arstein-Kerslake, Anna. "Gendered Denials: Law, Policy and Practice." In Legal Capacity & Gender, 83–116. Cham: Springer International Publishing, 2021. http://dx.doi.org/10.1007/978-3-030-63493-3_4.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Ramli, Intan Murnira. "Denial of Benefits in Investment Arbitration: Genesis, Trends, and Application." In Handbook of International Investment Law and Policy, 1013–32. Singapore: Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-13-3615-7_101.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Ramli, Intan Murnira. "Denial of Benefits in Investment Arbitration: Genesis, Trends, and Application." In Handbook of International Investment Law and Policy, 1–20. Singapore: Springer Singapore, 2021. http://dx.doi.org/10.1007/978-981-13-5744-2_101-1.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Conference papers on the topic "Dental policy"

Lucey, Siobhán, Frank Burke, Briony Supple, and Jennie Foley. "Learning spaces in community-based dental education." In Learning Connections 2019: Spaces, People, Practice. University College Cork||National Forum for the Enhancement of Teaching and Learning in Higher Education, 2019. http://dx.doi.org/10.33178/lc.2019.17.

Full text

Abstract:

In response to various institutional and national policy drivers (University College Cork, 2018; Department of Health, 2019), a community-based dental education (CBDE) initiative in a non-dental setting has been proposed as a new curriculum offering in Paediatric Dentistry in University College Cork. The student-led clinic for children aged 0-5 years will be located in a new primary healthcare centre, which serves as a community hub for health and wellbeing services. The innovative use of learning spaces to imbue a culture of community-engaged scholarship in higher education is widely encouraged (Campus Engage, 2014; Galvin, O’Mahony, Powell & Neville, 2017). This work seeks to explore the features of the proposed learning environment, which may impact upon teaching and learning practice.

APA, Harvard, Vancouver, ISO, and other styles

Biswas, Rajorshi, and Jie Wu. "Filter Assignment Policy Against Distributed Denial-of-Service Attack." In 2018 IEEE 24th International Conference on Parallel and Distributed Systems (ICPADS). IEEE, 2018. http://dx.doi.org/10.1109/padsw.2018.8644584.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Biswas, Rajorshi, Jie Wu, and Avinash Srinivasan. "Cost-Aware Optimal Filter Assignment Policy Against Distributed Denial-of-Service Attack." In 2019 Resilience Week (RWS). IEEE, 2019. http://dx.doi.org/10.1109/rws47064.2019.8972008.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Biswas, Rajorshi, Jie Wu, and Yang Chen. "Optimal Monitor Placement Policy Against Distributed Denial-of-Service Attack in Datacenter." In 2019 Resilience Week (RWS). IEEE, 2019. http://dx.doi.org/10.1109/rws47064.2019.8972010.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Biswas, Rajorshi, Jie Wu, Wei Chang, and Pouya Ostovari. "Optimal Filter Assignment Policy against Transit-Link Distributed Denial-of-Service Attack." In GLOBECOM 2019 - 2019 IEEE Global Communications Conference. IEEE, 2019. http://dx.doi.org/10.1109/globecom38437.2019.9013985.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Fisdiana, Usken, Rima Ajeng Anggriani, Budi Hariyanto, and Faridatul Hasanah. "Analisis Tingkat Kesukaan Konsumen Pada Produk Sirup Kopi dengan Penambahan Susu Full Cream." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.222.

Full text

Abstract:

Sirup kopi merupakan salah satu produk olahan biji kopi berbasis minuman kekinian dengan penyajian yang lebih praktis. Penambahan susu merupakan upaya untuk menarik minat konsumen sekaligus mengembangkan variasi rasa dan meningkatkan nilai jual. Oleh karena itu tujuan penelitian ini adalah menganalisis tingkat kesukaan konsumen pada produk sirup kopi dengan penambahan susu full cream melalui uji organoleptik. Penelitian dilaksanakan di laboratorium Pengolahan Hasil Pertanian Politeknik Negeri Jember pada bulan Juni-Agsutus 2020 dengan menggunakan metode Rancangan Acak Kelompok (RAK) faktor tunggal dan uji lanjut BNT 5%. Perlakuan berupa perbandingan antara susu bubuk full cream dengan bubuk kopi yang mempunyai komposisi perbandingan 1/7; 1,5/7 dan 2/7. Pengujian tingkat kesukaan dilakukan kepada 75 panelis laki-laki dan perempuan berumur 18-25 tahun. Hasil penelitian menunjukkan bahwa 1) Tingkat kesukaan konsumen terhadap minuman sirup kopi dengan penambahan susu full cream berbeda pada kekentalan yang mempunyai rerata nilai hedonik tertinggi 8,40 pada campuran penambahan susu full cream sebanyak 1,5/7 bagian dari bubuk kopi dengan tekstur lebih kental dan creamy, 2) Tingkat kesukaan konsumen terhadap minuman sirup kopi dengan penambahan susu full cream tidak berbeda pada aroma, rasa, warna, endapan dan aftertaste dengan rerata nilai hedonik berkisar antara 7,64 – 8,96 yang menandakan tingkat kesukaan moderat sampai suka.

APA, Harvard, Vancouver, ISO, and other styles

Fanshuri, Buyung Al, and Yunimar. "Pemetaan Kesehatan Tanaman Jeruk Dengan Metode Supervised Classification Berdasarkan Hasil Citra Drone." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.215.

Full text

Abstract:

Luas tanaman jeruk dilaporkan mengalami penurunan di beberapa daerah. Hal tersebut disebabkan oleh beberapa hal, diantaranya serangan penyakit dan kurangnya perawatan. Badan Pusat Statistik (BPS) hanya menyediakan data luasan produksi saja sehingga informasi tentang luasan tanaman yang sakit belum ada. Pemantauan kondisi tanaman dapat menggunakan penginderaan jauh. Penelitian ini bertujuan untuk mengembangkan metode penginderaan jauh dengan drone untuk mendeteksi kesehatan tanaman jeruk. Lokasi percobaan dilakukan di Banyuwangi dengan menggunakan drone phantom 4 dengan kamera RGB. Hasil foto dianalisa menggunakan software agisoft photoscan dalam beberapa tahap, yaitu: align photos, build dense cloud, build digital elevation model, build orthomosaic dan export geotiff. Ratusan foto akan menjadi satu kesatuan gambar dengan proses tersebut. Hasil proses gambar tersebut kemudian di analisa di software QGIS dengan metode Supervised Classification. Percobaan dilakukan pada tanaman muda dan dewasa. Dengan metode tersebut klasifikasi kesehatan tanaman jeruk dewasa dapat dibagi menjadi tiga, yaitu : sehat, sakit dan mati. Hasil ini kemungkinan bias lebih sedikit dibandingkan pada tanaman muda.

APA, Harvard, Vancouver, ISO, and other styles

Firdaus, Wildannisa Maghfirotul, and Sepdian Luri Asmono. "Respon Pertumbuhan Planltet Stevia (Stevia rebaudiana Bertoni) pada Beberapa Konsentrasi Kinetin dengan Pencahayaan Lampu LED Merah Biru." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.218.

Full text

Abstract:

Tanaman Stevia sangat berpotensi menjadi alternatif tanaman pemanis yang memiliki tingkat kemanisan 300 kali dari gula tebu. Oleh sebab itu penelitian terhadap perbanyakan secara in vitro dilakukan untuk memacu perbanyakan masal bibit Stevia. Tujuan penelitian ini adalah untuk mengetahui respon pertumbuhan plantlet stevia (Stevia rebaudiana Bertoni) pada beberapa konsentrasi kinetin dengan pencahayaan lampu LED merah biru secara in vitro. Penelitian ini dilaksanakan di Laboratorium Kultur Jaringan, Politeknik Negeri Jember mulai bulan Oktober 2019 sampai dengan bulan Februari 2020. Analisis yang digunakan Rancangan Acak Lengkap Faktorial dengan 2 perlakuan dan 5 kali ulangan. Perlakuan pertama yaitu pencahayaan lampu LED (Putih dan Merah Biru). Perlakuan kedua yaitu konsentrasi kinetin dengan 3 taraf konsentrasi ( 2 ppm:3 ppm:4 ppm). Dianalisis dengan uji Duncan Multiple Range Test (DMRT) 5%. Hasil dari penelitian ini menunjukkan bahwa penggunaan warna cahaya LED merah biru tidak banyak memberikan pengaruh yang nyata pada pertumbuhan planlet stevia. Cahaya merah biru hanya memacu kecepatan munculnya tunas saja, sedangkan pada parameter jumlah tunas dan tinggi tunas sangat dipengaruhi oleh cahaya putih yang dikombinasikan dengan kinetin pada konsentrasi 2 ppm dan 3 ppm.

APA, Harvard, Vancouver, ISO, and other styles

Laraswati, Rini, Evan Purnama Ramdan, and Umi Kulsum. "Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.234.

Full text

Abstract:

Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.

APA, Harvard, Vancouver, ISO, and other styles

Ariyanti, Nur Khofifah, Dyah Nuning Erawati, Rahma Sarita, and Sabilla Jasmine Belinda. "Analisis Peran Air Kelapa Terhadap Pertumbuhan Eksplan Kultur Vanili (Vanilla planifolia)." In Seminar Nasional Semanis Tani Polije 2021. Politeknik Negeri Jember, 2021. http://dx.doi.org/10.25047/agropross.2021.210.

Full text

Abstract:

Prospek vanili (Vanilla planifolia) sebagai komoditas penghasil devisa negara masih sangat berpeluang untuk dikembangkan. Salah satu teknik dalam pengembangan vanili melalui metode budidaya kultur jaringan tanaman dengan penambahan air kelapa sebagai sumber zat pengatur tumbuh alami agar eksplan asal ruas batang vanili dapat tumbuh dan berkembang secara optimal. Air kelapa dapat diperoleh dengan mudah sehingga lebih efisien pada segi biaya dan waktu. Oleh karena itu, tujuan dari penelitian ini adalah menganalisis peran air kelapa terhadap pertumbuhan eksplan kultur vanili. Pelaksanaan penelitian pada bulan Februari - Juni 2021 di Laboratorium Kultur Jaringan Politeknik Negeri Jember. Metode analisis T test digunakan untuk membandingkan perlakuan tanpa penambahan air kelapa (P0) dengan perlakuan penambahan air kelapa 15% (P1) pada media dasar Murashige-Skoog. Hasil penelitian memperlihatkan bahwa 1) Penambahan air kelapa 15% mempengaruhi tinggi tunas eksplan vanili dengan rerata 4,45 cm/eksplan dan jumlah akar dengan rerata 2,03 akar/eksplan pada umur eksplan 56 hsi, 2) Penambahan air kelapa 15% memiliki pengaruh yang sama dengan tanpa penambahan air kelapa terhadap kedinian bertunas, jumlah akar pada 14, 28, 42 hsi dan panjang akar eksplan vanili, 3) Penambahan air kelapa 15% mampu mendukung pertumbuhan panjang tunas dan akar tetapi tidak mampu menggandakan tunas eksplan vanili.

APA, Harvard, Vancouver, ISO, and other styles

Reports on the topic "Dental policy"

Brow, Avery R., Ilya Okunev, Eric P. Tranby, Sean G. Boynes, Steven Brady, Brent Martin, Crystal D. Manners, James A. Gillcrist, and Victor Wu. Impact of Opioid Prescribing Policy Changes The TennCare Dental Experience. DentaQuest Partnership for Oral Health Advancement, August 2019. http://dx.doi.org/10.35565/dqp.2019.2004.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Boynes, Sean, Hayam Megally, Don Clermont, Valerie Nieto, Helen Hawkey, and Annaliese Cothron. The Financial and Policy Impacts of the COVID-19 Pandemic on U.S. Dental Care Workers. Edited by Grace Linn, Kristina Lusk, and Amber Shaver. American Institute of Dental Public Health, October 2022. http://dx.doi.org/10.58677/zwnx2421.

Full text

Abstract:

The COVID-19 pandemic negatively affected oral health care teams across the U.S. Beginning in March of 2020, dental care was considered non-essential health care, thereby canceling non-emergency dental procedures for several months. Now, two years later, the long-term impacts on the dental health care workforce can be examined.

APA, Harvard, Vancouver, ISO, and other styles

Fitzgerald, Constance. The health policy gap: income, health insurance and source of care effects on utilization of and access to dental, physician and hospital services by Oregon households. Portland State University Library, January 2000. http://dx.doi.org/10.15760/etd.830.

Full text

APA, Harvard, Vancouver, ISO, and other styles

Capps, Denny, Cassandra Knight, Phil Brease, Samantha Hilburn, and Vincent Santucci. Denali National Park and Preserve paleontological resources management plan. National Park Service, 2024. http://dx.doi.org/10.36967/2303431.

Full text

Abstract:

Denali National Park and Preserve (DENA) in central Alaska is one of the most geologically and paleontologically diverse parks in the national park system. Fossils found at DENA help to untangle the convoluted bedrock history, record a Late Cretaceous ecosystem, and show changes in life here over several hundred million years. We have prepared a paleontological resources management plan (PRMP) to successfully administer these non-renewable resources in accordance with law and policy. This PRMP establishes goals and strategies for the comprehensive management of paleontological resources at DENA, considering more than a century of change and development of park programs and themes, agency policies and guidelines, and state and federal laws and regulations. Objectives include informing decisions and implementing best practices for paleontological resource management; ensuring the highest protection and preservation of paleontological resources; supporting and overseeing research on these resources; and promoting public outreach and education. This paleontological resources management plan provides a variety of information and recommendations to address these objectives. A brief geological history of DENA and descriptions of fossiliferous rock units provide context for the fossils. Fossil areas of interest and paleontological localities of concern are detailed for management. Practices and recommendations are presented for inventory and monitoring. The process of research permitting and practices for researchers are described. The state of collections and curation is considered. Interpretation and education are tied into existing themes, and venues and opportunities for additional outreach are described. A series of overall recommendations are provided that consider the objectives. Finally, data forms are provided for reference. This PRMP should be used as the foundation of future, more specialized, management plans or reports relating to paleontological resources at DENA.

APA, Harvard, Vancouver, ISO, and other styles

Kamp, Bart, Francisco Carrillo, and Francesco Pescarin. Euskal ekonomiako eta enpresetako atzerriko zuzeneko inbertsioaren analisia eta lehiarkortasunean duen eraginaren balioespena. Edited by Patricia Canto. Universidad de Deusto, 2024. http://dx.doi.org/10.18543/frjr6381.

Full text

Abstract:

Atzerriko zuzeneko inbertsioa (AZI), bai herrialdera sartzen dena eta bai herrialdetik ateratzen dena, garrantzi handikoa da herrialde baten ekonomiarako, hazkunde ekonomikoa lortzen, enplegua sortzen, teknologia transferitzen eta mugaz haraindiko balio kateetan eta nazioarteko espazio ekonomikoetan integratzen laguntzen duelako. Hori jakinik, “Euskal ekonomiako eta bertako enpresetako atzerriko zuzeneko inbertsioaren analisia” txostenak Euskal Autonomia Erkidegora sartzen den eta bertatik ateratzen den zuzeneko inbertsioa ditu aztergai. Horretarako, 2014-2021 aldiko datu agregatuak erabili ditu eta atzerriko entitateek eskuratu zituzten euskal enpresa batzuen kasuak aztertu ditu. Amaitzeko, policy makerrentzat zenbait gomendio ematen dira, herrialdera sartzen den atzerriko zuzeneko inbertsioan eragina duten elementuei buruz.

APA, Harvard, Vancouver, ISO, and other styles

Linares Llamas, Pedro, and Natalia Collado Van-Baumberghen. ¿Cuál va a ser el efecto en España del nuevo impuesto de la UE sobre las emisiones en las importaciones? Esade EcPol, June 2023. http://dx.doi.org/10.56269/20230602/pll.

Full text

Abstract:

La UE ha aprobado un Mecanismo de Ajuste en Frontera al Carbono (CBAM) que grava los productos importados en función de sus emisiones. Pese a su importancia para alinear incentivos para la descarbonización entre el nivel europeo y el global, trae un riesgo doble: reducir la competitividad de las exportaciones europeas y subir los precios que pagan los consumidores dentro de la UE. En este policy brief analizamos ambas cuestiones para España observando que los sectores más afectados serían el automovilístico y la metalurgia. Para la industria agroalimentaria, pese a ser otro de los sectores líderes de nuestro comercio internacional, el efecto sería más moderado. Finalmente, el impacto sobre los hogares sería pequeño y ligeramente progresivo siendo los de mayor renta, especialmente aquellos de entornos rurales, los que se enfrentan a mayores costes.

APA, Harvard, Vancouver, ISO, and other styles

Belser, Patrick, Rosalia Vazquez-Alvarez, and Ding Xu. Global wage report 2022-23 : the impact of inflation and COVID-19 on wages and purchasing power. ILO, November 2022. http://dx.doi.org/10.54394/zlfg5119.

Full text

Abstract:

The report shows that wages and the purchasing power of households have been dented considerably during the past three years, first by the COVID-19 pandemic and then, as the world economy started to recover from that crisis, by the global rise in inflation. Available evidence for 2022 suggests that rising inflation is causing real wage growth to dip into negative figures in many countries, reducing the purchasing power of the middle class and hitting low-income groups particularly hard. This cost-ofliving crisis comes on top of significant losses in the total wage bill for workers and their families during the COVID-19 crisis, which in many countries had the greatest impact on low-income groups. In the absence of adequate policy responses, the near future could see a sharp erosion of the real incomes of workers and their families and an increase in inequality, threatening the economic recovery and possibly fuelling further social unrest.

APA, Harvard, Vancouver, ISO, and other styles

Zhytaryuk, Marian. Агресія росії проти України і світу. Рефлексії в контексті виправдання війни д. мєдвєдєвим та в. путіним 4 листопада 2022 р. Ivan Franko National University of Lviv, March 2023. http://dx.doi.org/10.30970/vjo.2023.52-53.11744.

Full text

Abstract:

In this article the author analyzes in detail the “holiday” speeches by the former president of the russian federation dmitry medvedev and the current president vladimir putin devoted to the day of national unity of russia on November 4, 2022, in which politicians justify the war, call it sacred, a struggle between Good and Evil and predict their own victory. With the help of methods of critical analysis, the refutation of historical myths, the denial, an exposure and the generalization, the falsity and cynicism of the statements made regarding the expediency and possibility of geopolitical changes are demonstrated. The civilizational war of the russian federation against the Western democratic world, which began with aggression against the disobedience of neighboring Ukraine, which chose the Western vector of development, is gaining momentum. It would seem that in the 21st century global conflicts over territories are almost impossible, it is the time for the fourth-generation of war, but we can see that russia has various means in its arsenal, including weapons of mass destruction: aerial bombs, artillery, aviation, missile attacks, nuclear blackmail, rewriting history and ordinary lies. An analysis of the kremlin leaders’ military-strategic narratives about Ukraine and the West, shows the inadequacy and detachment of moscow politicians at the highest echelon of power from reality. Their aggressive and false rhetoric based on historical manipulations and maniacal efforts to transform the world order suggests that the kremlin will not stop on its own. Someone must stop him just decisively: either Ukraine or Ukraine’s allies. Sanction policy against the russian federation, political statements and words of support for Ukraine, even assistance with military equipment and finances may not be enough, because all these are certain procedures, a waste of time, and time today is the greatest value. Key words: Ukraine, russian federation, russian aggression, dmitry medvedev, vladimir putin, geopolitics.

APA, Harvard, Vancouver, ISO, and other styles

Rubio, Mauricio. La violencia en Colombia: Dimensionamiento y politicas de control. Inter-American Development Bank, December 1998. http://dx.doi.org/10.18235/0011827.

Full text

Abstract:

"Incierto era ayer el nœmero de victimas que dejaron las incursiones de un grupo de autodefensas en Mapiripán (Meta). Aunque en el casco urbano fueron hallados tres cuerpos sin cabezas y otros dos que no fueron identificados, los pobladores aseguran que cerca de 30 personas fueron sacadas de sus casas, mutiladas y arrojadas a las aguas del río Guaviare. Según los habitantes, el grupo armado comenzó a matar a sus víctimas el martes y terminó el domingo. A las 8 de la noche, obligaba a apagar la planta eléctrica que le suministra la luz a todo el pueblo. "Sacaban a la gente de sus casas y amanecían muertos. Nunca se escucharon tiros, porque los degollaban", dijo un poblador. Esta incursión generó un éxodo de campesinos. El domingo, por avión, salieron de Mapiripán cerca de 200 personas. .. Hasta el juez promiscuo municipal tuvo que salir de la región. El era la única representación de la justicia en dicho municipio, porque de la policía lo único que quedan son las ruinas de una estación llena de maleza, que fue abandonada el 16 de enero de 1995, tras un ataque guerrillero". Este incidente, casi rutinario para la prensa colombiana , presenta varias facetas de la violencia colombiana que se pretenden destacar con este trabajo. Ilustra la incertidumbre acerca de la magnitud de la violencia. Muestra que en el país ya se está perdiendo la capacidad para contar los muertos. Sugiere que una fracción importante y creciente del fenómeno no encaja dentro del diagnóstico tradicional, el de una violencia urbana, ajena a los grupos armados y producto de la intolerancia. Señala un impacto devastador y cada vez más difícil de cuantificar, resaltando que los esfuerzos contra la violencia no se deben sustentar en análisis beneficio-costo. Pone de presente la total ausencia de autoridad estatal en algunas regiones en donde quienes mandan son los grupos armados ilegales. Señala, en particular, la fragilidad de la justicia penal ante la violencia ejercida por los dictadores locales. Resalta las limitaciones de las políticas preventivas basadas en un mayor gasto público, sobretodo mientras el estado colombiano no recupere la autoridad y el monopolio de la coerción. Destaca la prioridad que debe recibir la tarea estatal de administrar justicia y sancionar a los homicidas.

APA, Harvard, Vancouver, ISO, and other styles

Artemisa: En defensa del medio ambiente. Universidad Militar Nueva Granada, May 2022. http://dx.doi.org/10.18359/docinst.6281.

Full text

Abstract:

Estamos ante una encrucijada global de proporciones nunca vistas. El planeta se calienta más rápido de lo esperado y enfrentamos condiciones climáticas cada vez más extremas, lo que pone en riesgo la sostenibilidad de la vida humana en el mediano y largo plazo. El nivel de los océanos está aumentando, los arrecifes de coral están muriendo, las especies se están extinguiendo, los glaciares se están derritiendo y las condiciones climáticas extremas se hacen cada vez más frecuentes con intensas olas de calor, inundaciones, huracanes, incendios y/o sequías. Para hacer frente a esta compleja situación, todos, personas e instituciones en los ámbitos nacional, regional y global, tenemos que hacer nuestra parte para evitar llegar a un punto de no retorno. Aunque Colombia solo genera el 0,6 % de los gases de efecto invernadero (GEI), es uno de los veinte países más amenazados por la crisis climática. Nuestro país alberga el 50 % de los páramos del mundo y es catalogado como una potencia en agua, biodiversidad y ambiente, aloja alrededor del 10 % de la fauna y flora del mundo, teniendo por ello un rol central en los esfuerzos globales que se realizan para mitigar los efectos del cambio climático. También es reconocido por ser el segundo país con más alta presencia en biodiversidad en la tierra, goza de dos océanos, cinco vertientes hidrográficas, ríos, lagunas y ciénagas, siendo de esta manera el agua un recurso fundamental para el desarrollo de las generaciones futuras. El país cuenta con grandes extensiones de páramos, los cuales son la fuente del 70 % de agua dulce en nuestro país y comparte al sur de nuestras fronteras con la Amazonía, considerada la selva tropical más extensa del planeta y el pulmón del mundo. Una porción representativa de ese 10 % del total de la biodiversidad mundial que tiene nuestro país, se encuentra dentro del Sistema Nacional de Áreas Protegidas (SINAP), del que hace parte el Sistema de Parques Nacionales Naturales y las Reservas Forestales (más de 17 millones de hectáreas), una fuente importante de bienes y servicios ecosistémicos, entre los cuales, el suministro del recurso hídrico incluye más del 62 % de los nacimientos de los acuíferos nacionales y abastece a casi un 80 % de la población colombiana. Así mismo, protege lagunas y ciénagas que contienen el 20 % de los recursos hídricos que abastecen la generación de energía eléctrica del país. En estas áreas protegidas se conservan muestras representativas de los ecosistemas naturales marinos y continentales, los cuales, además de albergar un gran número de especies de fauna y flora, contribuyen a la regulación del clima y protegen las cuencas hidrográficas. Es así como por su especial importancia ecológica, los Parques Nacionales Naturales tienen la función de conservar, proteger y salvaguardar sus ecosistemas de especial valor por medio del Estado y de los particulares. Esta gran riqueza ambiental del país está siendo amenazada por el uso indebido de los recursos naturales, lo que genera un acelerado deterioro de los ecosistemas, alterando su funcionalidad y poniendo en riesgo la biodiversidad. Esta problemática se ha convertido en un reto de primer orden para el Estado colombiano, sus autoridades ambientales y la sociedad en general. El Sector Defensa no ha sido ajeno a esta realidad, por lo que en el marco definido por la ley, la Presidencia de la República y el Ministerio de Ambiente y Desarrollo Sostenible, ha reconocido el potencial desestabilizador de las afectaciones causadas por las diversas actividades ilícitas de los Grupos Armados Organizados (GAO), los Grupos Delincuenciales Organizados (GDO) y ciudadanos que hacen un uso indebido de los recursos naturales. Fenómenos como la siembra de cultivos ilícitos, la extracción ilícita de minerales, la tala indiscriminada, la ganadería extensiva, el acaparamiento de tierras, la pesca ilegal, la contaminación, el vertimiento de sustancias peligrosas y el tráfico ilegal de flora y fauna, han debilitado los ecosistemas nacionales. Estas actividades ilegales afectan los recursos hídricos del país, los suelos, los páramos y la atmósfera, produciendo efectos negativos que generan deforestación, pérdida de hábitats, extinción de especies, la destrucción de fuentes de agua, el deterioro de las tierras de cultivos e impactos negativos en las reservas forestales y las áreas que integran el Sistema Nacional de Áreas Protegidas (SINAP). La degradación ambiental que hemos visto no solo es utilizada por las organizaciones criminales para obtener recursos que les permiten sostener su accionar delictivo en diversas zonas del país, más grave aún, se constituye en un atentado directo contra el porvenir de las generaciones futuras. Es por ello que el Sector Defensa ha reconocido el agua, la biodiversidad y el medio ambiente como activos estratégicos de interés nacional, con un carácter principal y prevalente, buscando apoyar con sus capacidades a las autoridades ambientales del país, con el fin de realizar acciones cada vez más eficaces contra las organizaciones criminales responsables del deterioro ambiental. Es en ese contexto surge la idea de este libro, que busca presentar la problemática que se enfrenta y visibilizar las acciones realizadas por el Sector Defensa en coordinación con las autoridades ambientales, con el fin de apoyar la defensa de estos activos estratégicos, así como prevenir los daños futuros a los mismos, en aras de trabajar en la protección de los recursos naturales, bajo una visión multidimensional de la seguridad. El Ministerio de Defensa (MDN) ha sido consciente de los desafíos climáticos a los que se enfrenta, no solo el Sector, sino el territorio nacional, en cuanto a los impactos cada vez mayores derivados de las condiciones meteorológicas extremas y la explotación de los recursos. Por ello, el Sector ha trabajado para alinearse con la Política Nacional de Cambio Climático, los compromisos del país ante la Contribución Nacionalmente Determinada (NDC), el cumplimiento del CONPES 4021 de diciembre de 2020 para el Control de la Deforestación y la Gestión Sostenible de Bosques, para así aportar con acciones de adaptación, mitigación y gestión del riesgo ante el cambio climático y variabilidad climática mediante del Plan de Gestión de Cambio Climático del Sector Defensa (PIGCCSD). Este libro reúne los principales resultados del Sector Defensa en materia de protección del medio ambiente y resalta la articulación de las políticas, así como de la operativización de las mismas por parte de las Fuerzas Militares y la Policía Nacional, por la protección de los recursos naturales de la Nación, una responsabilidad que ha quedado claramente plasmada en la “Estrategia Artemisa”, que es un esfuerzo permanente, sostenido, conjunto, coordinado, e interinstitucional que permitirá proteger y defender el agua, la biodiversidad y el medio ambiente como activos estratégicos de la Nación, a partir de la lucha contra la deforestación, sus causas directas o subyacentes y contrarrestar los efectos del cambio climático, como también la lucha contra la explotación ilícita de minerales, contra los cultivos ilícitos que afectan el medio ambiente y el conjunto de actividades de control y vigilancia que apoya nuestra Fuerza Pública para la defensa de los recursos naturales. Trabajando de forma articulada con la Fiscalía, el Ministerio de Medio Ambiente y Desarrollo Sostenible, el Instituto de Hidrología, Meteorología y Estudios Ambientales (Ideam), y la Unidad de Parques Nacionales Naturales, en diversas zonas del país, la Estrategia Artemisa ha permitido brindar apoyo a las autoridades ambientales y administrativas, para preservar y defender el agua, la biodiversidad y el medio ambiente en las áreas de reserva forestal, áreas protegidas y 59 Parques Nacionales Naturales. Mediante la Directiva Permanente 008 del 22 de marzo de 2022, el MDN institucionalizó e impartió lineamientos e instrucciones al Comando General de las Fueras Militares, la Dirección General de la Policía Nacional y la Unidad de Gestión General del MDN, con el propósito de implementar medidas, desplegar operaciones, actividades de apoyo y gestión ambiental, para la implementación de la Estrategia Artemisa. De esta forma y bajo un enfoque sostenido, conjunto, coordinado, interinstitucional y multilateral, se trabajará para incluir dentro de la doctrina militar y policial las acciones relacionadas con la protección del agua, la diversidad y el medio ambiente, al tiempo que se concentrarán los esfuerzos de inteligencia en la identificación del modus operandi de las organizaciones criminales que afectan el medio ambiente, desarrollando operaciones contra los GAO y los GDO que atentan contra el medio ambiente. Desde el 2019 a la fecha se han realizado diecisiete (17) operaciones sobre las áreas de los Parques Nacionales Naturales, especialmente en las regiones de la Amazonía y la Orinoquía, como son los Parques Nacionales Naturales (PNN) Serranía de Chiribiquete, PNN La Paya, PNN Tinigua, PNN Picachos, PNN Sierra de La Macarena, la Zona de Reserva Forestal de la Amazonía y la Reserva Natural Nukak. Se han dispuesto, para esta campaña, 22.300 hombres de la Fuerza Pública, que, desde sus respectivas unidades militares y policiales resguardan las áreas protegidas del territorio nacional. Estas unidades incluyen: 10 batallones de alta montaña (páramos), una brigada contra el narcotráfico, una brigada contra la minería ilegal, unidades de guardacostas, infantería de marina y efectivos de la Policía Nacional. El Sector Defensa es consciente de que a futuro será fundamental continuar fortaleciendo las capacidades de la Fuerza Pública para, en el marco de sus competencias, continuar apoyando a las autoridades ambientales, entes territoriales y a la comunidad en la defensa y preservación del agua, la biodiversidad y el medio ambiente como activos estratégicos de la Nación. Será fundamental profundizar la disrupción del delito de la explotación ilícita de minerales, mediante el desmantelamiento de las economías ilícitas que se lucran de ella y de la afectación de la cadena criminal. En igual medida, será vital apoyar la recuperación de los ecosistemas más afectados por las actividades ilegales, por medio de actividades de restauración de áreas, del trabajo articulado con las comunidades, la construcción y mantenimiento de viveros forestales y el fortalecimiento a las investigaciones científicas lideradas desde la Armada Nacional y la Dirección General Marítima para la protección de los océanos, el recurso hídrico y sus ecosistemas. De esta forma será posible continuar trabajando en la reducción de los riesgos que se ciernen sobre los ecosistemas del país y disminuir los índices de deforestación, y tras la búsqueda de soluciones que contribuyan a la reducción y mitigación de los GEI. Esta estrategia que ha puesto en marcha el Sector Defensa y que es recogido en esta obra, presenta los aportes sectoriales del trabajo interinstitucional que se han venido realizando en los últimos años, siendo un ejemplo de la forma en la que se pueden sumar esfuerzos para contribuir a la superación de la encrucijada global que nos afecta a todos y que debe ser enfrentada con un esfuerzo común.

APA, Harvard, Vancouver, ISO, and other styles

We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!