Journal articles on the topic 'Dendritic olivine'
To see the other types of publications on this topic, follow the link: Dendritic olivine.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 44 journal articles for your research on the topic 'Dendritic olivine.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
Welsch, Benoit, Julia Hammer, and Eric Hellebrand. "Phosphorus zoning reveals dendritic architecture of olivine." Geology 42, no. 10 (October 2014): 867–70. http://dx.doi.org/10.1130/g35691.1.
Full text
2
Lee, Cin-Ty, Chenguang Sun, Eytan Sharton-Bierig, Patrick Phelps, Jackson Borchardt, Boda Liu, Gelu Costin, and A. Dana Johnston. "Widespread phosphorous excess in olivine, rapid crystal growth, and implications for magma dynamics." Volcanica 5, no. 2 (November 18, 2022): 433–50. http://dx.doi.org/10.30909/vol.05.02.433450.
Full textAbstract:
Trace element zoning is often used to unravel the crystallization history of phenocrysts in magmatic systems, but interpretation requires quantifying the relative importance of equilibrium versus disequilibrium. Published partition coefficients for phosphorous (P) in olivine vary by more than a factor of ten. After considering kinetic effects, a new equilibrium partition coefficient was extrapolated from a re-examination of natural and experimental systems, indicating that P partition coefficients in olivine are significantly over-estimated. These new partitioning constraints allow us to establish a theoretical P Equilibrium Fractionation Array (PEFA) for mid-ocean ridge basalts (MORBs), revealing that most olivines from MORBs have excess P (2–15 times PEFA) and are thus in disequilibrium. Using an independent case study of natural dendritic olivines, we show that such P enrichments can be explained by diffusion-limited incorporation of P during rapid crystal growth. If growth rate can be related to cooling, the rapid growth rates of olivines have implications for magma system dynamics, such as the size of magma bodies or where crystallization occurs within the body.
3
Xing, Chang-Ming, Christina Yan Wang, Bernard Charlier, and Olivier Namur. "Ubiquitous dendritic olivine constructs initial crystal framework of mafic magma chamber." Earth and Planetary Science Letters 594 (September 2022): 117710. http://dx.doi.org/10.1016/j.epsl.2022.117710.
Full text
4
Wieser, Penny E., Zoja Vukmanovic, Rüdiger Kilian, Emilie Ringe, Marian B. Holness, John Maclennan, and Marie Edmonds. "To sink, swim, twin, or nucleate: A critical appraisal of crystal aggregation processes." Geology 47, no. 10 (August 20, 2019): 948–52. http://dx.doi.org/10.1130/g46660.1.
Full textAbstract:
Abstract Crystal aggregates in igneous rocks have been variously ascribed to growth processes (e.g., twinning, heterogeneous nucleation, epitaxial growth, dendritic growth), or dynamical processes (e.g., synneusis, accumulation during settling). We tested these hypotheses by quantifying the relative orientation of adjacent crystals using electron backscatter diffraction. Both olivine aggregates from Kīlauea volcano (Hawaiʻi, USA) and chromite aggregates from the Bushveld Complex (South Africa) show diverse attachment geometries inconsistent with growth processes. Near-random attachments in chromite aggregates are consistent with accumulation by settling of individual crystals. Attachment geometries and prominent geochemical differences across grain boundaries in olivine aggregates are indicative of synneusis.
5
Welsch, Benoît, François Faure, Vincent Famin, Alain Baronnet, and Patrick Bachèlery. "Dendritic Crystallization: A Single Process for all the Textures of Olivine in Basalts?" Journal of Petrology 54, no. 3 (November 17, 2012): 539–74. http://dx.doi.org/10.1093/petrology/egs077.
Full text
6
Basch, Valentin, Elisabetta Rampone, Laura Crispini, Carlotta Ferrando, Benoit Ildefonse, and Marguerite Godard. "Multi-stage Reactive Formation of Troctolites in Slow-spreading Oceanic Lithosphere (Erro–Tobbio, Italy): a Combined Field and Petrochemical Study." Journal of Petrology 60, no. 5 (March 29, 2019): 873–906. http://dx.doi.org/10.1093/petrology/egz019.
Full textAbstract:
Abstract Many recent studies have investigated the replacive formation of troctolites from mantle protoliths and the compositional evolution of the percolating melt during melt–rock interaction processes. However, strong structural and geochemical constraints for a replacive origin have not yet been established. The Erro–Tobbio impregnated mantle peridotites are primarily associated with a hectometre-size troctolitic body and crosscutting gabbroic dykes, providing a good field control on melt–rock interaction processes and subsequent magmatic intrusions. The troctolitic body exhibits high inner complexity, with a host troctolite (Troctolite A) crosscut by a second generation of troctolitic metre-size pseudo-tabular bodies (Troctolite B). The host Troctolite A is characterized by two different textural types of olivine, corroded deformed millimetre- to centimetre-size olivine and fine-grained rounded undeformed olivine, both embedded in interstitial to poikilitic plagioclase and clinopyroxene. Troctolite A shows melt–rock reaction microstructures indicative of replacive formation after percolation and impregnation of mantle dunites by a reactive melt. The evolution of the texture and crystallographic preferred orientation (CPO) of olivine are correlated and depend on the melt/rock ratio involved in the impregnation process. A low melt/rock ratio allows the preservation of the protolith structure, whereas a high melt/rock ratio leads to the disaggregation of the pre-existing matrix. The mineral compositions in Troctolite A define reactive trends, indicative of the buffering of the melt composition by assimilation of olivine during impregnation. The magmatic Troctolite B bodies are intruded within the pre-existing Troctolite A and are characterized by extreme textural variations of olivine, from decimetre-size dendritic to fine-grained euhedral crystals embedded in poikilitic plagioclase. This textural variability is the result of olivine assimilation during melt–rock reaction and the correlated increase in the degree of undercooling of the percolating melt. In the late gabbroic intrusions, mineral compositions are consistent with the fractional crystallization of melts modified after the reactive crystallization of Troctolites A and B. The Erro–Tobbio troctolitic body has a multi-stage origin, marked by the transition from reactive to fractional crystallization and diffuse to focused melt percolation and intrusion, related to progressive exhumation. During the formation of the troctolitic body, the melt composition was modified and controlled by assimilation and concomitant crystallization reactions occurring at low melt supply. Similar processes have been described in ultraslow-spreading oceanic settings characterized by scarce magmatic activity.
7
Vítková, M., V. Ettler, Z. Johan, B. Kříbek, O. Šebek, and M. Mihaljevič. "Primary and secondary phases in copper-cobalt smelting slags from the Copperbelt Province, Zambia." Mineralogical Magazine 74, no. 4 (August 2010): 581–600. http://dx.doi.org/10.1180/minmag.2010.074.4.581.
Full textAbstract:
AbstractPyrometallurgical slags from three Cu-Co smelters (Nkana, Mufulira, Chambishi) in the Copperbelt Province, Zambia, were studied from mineralogical and chemical points of view. The slags were enriched in metals and metalloids, mainly Cu (up to 35 wt.%), Co (up to 2.4 wt.%) and As (up to 3650 ppm). The following primary phases were observed in slags: Ca-Fe silicates (clinopyroxene, olivine) and leucite, oxides (spinel-series phases), ubiquitous silicate glass and sulphide/metallic droplets of various sizes. The presence of glass and skeletal/dendritic crystal shapes indicated rapid cooling of the slag melt. Copper and cobalt were found in low concentrations in the majority of silicates (olivine, clinopyroxene) and oxides, substituting for Fe in their structures (up to 7.15 wt.% CoO in olivine, 4.11 wt.% CuO in spinel). Similarly, up to 0.91 wt.% CoO and 6.90 wt.% CuO were observed in the interstitial glass. Nevertheless, the main carriers of these metals in the slags studied were Cu sulphides (digenite, chalcocite, bornite, chalcopyrite), Co-Fe sulphides (cobaltpentlandite), Co-bearing intermetallic phases ((Fe,Co)2As) and alloys. Weathering features corresponding to the presence of secondary metal-bearing phases, such as malachite (Cu2(CO3)(OH)2), brochantite (Cu4SO4(OH)6) and sphaerocobaltite (CoCO3), were observed on the slag surfaces. They indicate that the slags studied are reactive on contact with water/atmosphere and that their environmental stability and release of potentially harmful metals and metalloids must be evaluated further.
8
Wenk, Hans-Rudolf, Rong Yu, Nobumichi Tamura, Duri Bischoff, and Walter Hunkeler. "Slags as Evidence for Copper Mining above Casaccia, Val Bregaglia (Central Alps)." Minerals 9, no. 5 (May 12, 2019): 292. http://dx.doi.org/10.3390/min9050292.
Full textAbstract:
Slags from the remote Mota Farun locality above Casaccia (Val Bregaglia, Swiss Alps) have been analyzed with scanning electron microscopy, X-ray powder diffraction and microfocus synchrotron X-ray diffraction to determine mineralogical composition and microstructures. Non-magnetic slag samples are largely composed of euhedral and dendritic iron-rich olivine in a glassy matrix. Locally there are zones with globular inclusions rich in bornite ((Cu5Fe)S4) and locally metallic copper. Some regions display dendritic pentlandite ((Fe,Ni)9S8). Magnetic samples are mainly composed of fayalite (Fe2SiO4) and wüstite (FeO), with minor magnetite (Fe3O4). The mineralogical composition indicates that slags were the product of copper smelting. The slag compositions and morphologies are analogous to slags described from the Oberhalbstein (Graubünden, Switzerland) and the Trentino Alps (Italy) which are attributed to metallurgical exploitations of the Late Bronze Age. While the origin of the ore could not be determined, it may be related to ore deposits of chalcopyrite in greenschists and serpentinites in the vicinity, such as Alp Tgavretga (Septimer Pass) and Val Perossa (Val Bregaglia).
9
Kitchen, D. E. "The partial melting of basalt and its enclosed mineral-filled cavities at Scawt Hill, Co. Antrim." Mineralogical Magazine 49, no. 354 (December 1985): 655–62. http://dx.doi.org/10.1180/minmag.1985.049.354.04.
Full textAbstract:
AbstractPartially melted basalts enclosing amygdales which have been completely melted formed at Scawt Hill adjacent to a Tertiary dolerite plug. Melting of the basalts commenced in a clay-rich mesostasis to produce a feldspathic liquid which then crystallized to an assemblage of dendritic olivine, skeletal hypersthene, opaque oxide and Mg-hercynite in a microcrystalline plagioclase matrix. An original mineral assemblage of zeolite, calcite, and saponite-nontronite in the amygdales melted and quenched to a brown glass now containing complexly zoned pyroxenes with plagioclase and opaque oxide. Melting commenced between 700–800°C, reaching a maximum temperature of 1168°C, and was followed by rapid cooling. The assimilation of remelted basalt may alter the course of crystallization of contaminated magmas.
10
Wilson, Allan H. "The Late-Paleoarchean Ultra-Depleted Commondale Komatiites: Earth's Hottest Lavas and Consequences for Eruption." Journal of Petrology 60, no. 8 (August 1, 2019): 1575–620. http://dx.doi.org/10.1093/petrology/egz040.
Full textAbstract:
Abstract The c.3·3 Ga Commondale komatiites located south of the Barberton greenstone belt in the Kaapvaal Craton are different from other komatiites, possessing compositional and textural features unique to this occurrence. Unlike almost all other known komatiite occurrences, they are not associated with komatiitic basalts or basalts. The komatiite flows are 0·5–25 m thick and are made up of a marginal zone of spinifex-textured and fine-grained aphyric rocks (low-Mg group) and an inner zone of olivine cumulates (high-Mg group), arranged in such a way to give highly symmetrical compositional profiles for many flows. Olivine is the dominant phase in all rocks, but orthopyroxene occurs as spinifex and elongate laths in the marginal zone. Clinopyroxene and plagioclase are entirely absent. The olivine cumulates formed from Mg-rich magma (36·1% MgO, 6·8% FeO) which caused inflation of the thicker flows. The maximum observed olivine composition in cores (Fo 96·6) is the highest recorded for any komatiite worldwide. The high-Mg magma would have erupted at a temperature close to 1670°C, the highest inferred temperature for an anhydrous terrestrial lava. The marginal zone is enriched in incompatible elements compared with the inner zone and formed by fractionation of the parental melt. However, all rock-types in the marginal zone are depleted in FeO (some as low as 3·5%) which could not have been derived by any primary magmatic process. The marginal zone rocks were modified by assimilation and/or alteration by seawater (or brine) components causing migration of iron and strong enrichment of sodium (up to 1·6 wt % Na2O) and chlorine (up to 2400 ppm). Zirconium has an identical distribution to sodium, with both elements greatly enriched above what would result from fractional crystallization, and may result from speciation of these elements at high temperature followed by post-crystallization alteration. Rare earth elements, Y and Nb have contents commensurate with fractionation of the primitive parental magma. Dendritic-textured olivine-rich rocks with orthopyroxene spinifex spatially and compositionally transitional between the marginal zone and the olivine cumulates resulted from interaction of the high temperature parental magma in the centre of the flows with the fractionated melt at the flow margins. A further manifestation of this association is the development of highly regular fine-scale (5–15 cm) layering (up to 45 layers) of alternating olivine cumulate and spinifex near the base of thick flows. This is overlain by olivine cumulates in which the melt/crystal-mush became arranged into a 3-dimensional network controlled by re-distribution of the trapped melt manifest by a spectacular knobbly texture in outcrop. Over 200 flow units are recognized and detailed chemical and mineralogical studies were carried out on drill cores intersecting 375 m of stratigraphy. The parental magma was highly depleted (in ppm Nb 0·017, Zr 1·18, total REE 1·7 and Gd/YbN=0·3, La/YbN=0·038) and although generally regarded to fall into the rare category of Al-enriched komatiites (AEKs), it is considered that these lavas are a unique class of their own of ultra-depleted komatiites. Relative to other AEKs the Commondale komatiites are both enriched in Al as well as being markedly depleted in Ti (390 ppm), giving rise to the extremely high Al2O3/TiO2 (81). The high temperature and low viscosity of the magma resulted in emplacement processes previously unrecognized in komatiites. The primary melt was derived by melting of mantle peridotite in equilibrium with olivine and orthopyroxene. The initial source was depleted in incompatible elements by small degrees of melting (3–4%) followed by high degrees of partial melting (70%) of the subsequent refractory source at 5 GPa (∼150 km).
11
Claydon, R. V., and B. R. Bell. "The structure and petrology of ultrabasic rocks in the southern part of the Cuillin Igneous Complex, Isle of Skye." Transactions of the Royal Society of Edinburgh: Earth Sciences 83, no. 4 (1992): 635–53. http://dx.doi.org/10.1017/s0263593300003345.
Full textAbstract:
AbstractThe ultrabasic rocks of the southern portion of the Early Tertiary Cuillin Igneous Complex, Isle of Skye, are recognised as forming a Peridotite Series s.l. and have been separated into six distinct structural–lithological units. These units range from almost pure dunite (Unit 1, at the lowest structural level), through to feldspathic peridotites and allivalites (Units 5 and 6, at the highest structural levels). Detailed field and mineralogical studies indicate that both cumulus and postcumulus processes involving ultrabasic (picritic) magmas may be identified, and that the latter processes have significantly modified many of the primary features of these rocks.Layering, both modal and phase, is present within all six units, although it is more prominent within the higher units, especially Units 5 and 6. Differing orientations of fabrics defined by cumulus spinel and intercumulus plagioclase layers within Unit 3 indicate the important role of compaction and intercumulus melt migration. Unit 4 is extremely heterogeneous, involving material ranging in composition from peridotite to allivalite, and provides clear evidence for postcumulus melt movement, magma-mixing, disruption and brecciation. Units 5 and 6 developed with a more porous cumulus framework, giving rise to dendritic growths involving cumulus olivine and poikilitic plagioclase.It is concluded that postcumulus melt movement, injection and magma-mixing, involving ultrabasic magmas, were significant processes in the formation of the ultrabasic rocks of the Cuillin Igneous Complex.
12
De Zeeuw, C. I., S. K. E. Koekkoek, D. R. W. Wylie, and J. I. Simpson. "Association Between Dendritic Lamellar Bodies and Complex Spike Synchrony in the Olivocerebellar System." Journal of Neurophysiology 77, no. 4 (April 1, 1997): 1747–58. http://dx.doi.org/10.1152/jn.1997.77.4.1747.
Full textAbstract:
De Zeeuw, C. I., S.K.E. Koekkoek, D.R.W. Wylie, and J. I. Simpson. Association between dendritic lamellar bodies and complex spike synchrony in the olivocerebellar system. J. Neurophysiol. 77: 1747–1758, 1997. Dendritic lamellar bodies have been reported to be associated with dendrodendritic gap junctions. In the present study we investigated this association at both the morphological and electrophysiological level in the olivocerebellar system. Because cerebellar GABAergic terminals are apposed to olivary dendrites coupled by gap junctions, and because lesions of cerebellar nuclei influence the coupling between neurons in the inferior olive, we postulated that if lamellar bodies and gap junctions are related, then the densities of both structures will change together when the cerebellar input is removed. Lesions of the cerebellar nuclei in rats and rabbits resulted in a reduction of the density of lamellar bodies, the number of lamellae per lamellar body, and the density of gap junctions in the inferior olive, whereas the number of olivary neurons was not significantly reduced. The association between lamellar bodies and electrotonic coupling was evaluated electrophysiologically in alert rabbits by comparing the occurrence of complex spike synchrony in different Purkinje cell zones of the flocculus that receive their climbing fibers from olivary subnuclei with different densities of lamellar bodies. The complex spike synchrony of Purkinje cell pairs, that receive their climbing fibers from an olivary subnucleus with a high density of lamellar bodies, was significantly higher than that of Purkinje cells, that receive their climbing fibers from a subnucleus with a low density of lamellar bodies. To investigate whether the complex spike synchrony is related to a possible synchrony between simple spikes, we recorded simultaneously the complex spike and simple spike responses of Purkinje cell pairs during natural visual stimulation. Synchronous simple spike responses did occur, and this synchrony tended to increase as the synchrony between the complex spikes increased. This relation raises the possibility that synchronously activated climbing fibers evoke their effects in part via the simple spike response of Purkinje cells. The present results indicate that dendritic lamellar bodies and dendrodendritic gap junctions can be downregulated concomitantly, and that the density of lamellar bodies in different olivary subdivisions is correlated with the degree of synchrony of their climbing fiber activity. Therefore these data support the hypothesis that dendritic lamellar bodies can be associated with dendrodendritic gap junctions. Considering that the density of dedritic lamellar bodies in the inferior olive is higher than in any other area of the brain, this conclusion implies that electrotonic coupling is important for the function of the olivocerebellar system.
13
Visavadiya, Nishant P., and Joe E. Springer. "Altered Cerebellar Circuitry following Thoracic Spinal Cord Injury in Adult Rats." Neural Plasticity 2016 (2016): 1–5. http://dx.doi.org/10.1155/2016/8181393.
Full textAbstract:
Cerebellar function is critical for coordinating movement and motor learning. However, events occurring in the cerebellum following spinal cord injury (SCI) have not been investigated in detail. We provide evidence of SCI-induced cerebellar synaptic changes involving a loss of granule cell parallel fiber input to distal regions of the Purkinje cell dendritic tree. This is accompanied by an apparent increase in synaptic contacts to Purkinje cell proximal dendrites, presumably from climbing fibers originating in the inferior olive. We also observed an early stage injury-induced decrease in the levels of cerebellin-1, a synaptic organizing molecule that is critical for establishing and maintaining parallel fiber-Purkinje cell synaptic integrity. Interestingly, this transsynaptic reorganizational pattern is consistent with that reported during development and in certain transgenic mouse models. To our knowledge, such a reorganizational event has not been described in response to SCI in adult rats. Regardless, the novel results of this study are important for understanding SCI-induced synaptic changes in the cerebellum, which may prove critical for strategies focusing on promoting functional recovery.
14
Kawamura, K., S. Murase, and S. Yuasa. "Development of the rodent cerebellum and synaptic re-formation of donor climbing terminals on spines of the host Purkinje dendrites after chemical deafferentation." Journal of Experimental Biology 153, no. 1 (October 1, 1990): 289–303. http://dx.doi.org/10.1242/jeb.153.1.289.
Full textAbstract:
Reinnervation of host Purkinje cells by donor climbing fibers was observed in the following experiments. Medullary primordial tissue (from E14-E16) containing the inferior olive was grafted into a host rat cerebellum, in which the inferior olivary complex and climbing fibers had been destroyed by intraperitoneal injection of 3-acetylpyridine (3-AP). After 3 weeks, immature as well as mature types of climbing fiber terminals bearing packed round vesicles were found that had established synaptic contacts on dendritic spines of the host Purkinje cells. Quantitative analysis at the ultrastructural level has been carried out. The main results are as follows. (1) The number of preterminals that formed synaptic contacts with spines of the host Purkinje dendrites in the transplanted material increased by 3.4-fold compared to the control (3-AP-treated non-grafted material). (2) The number of mature climbing-type preterminals increased from 0.3-0.9% to 5% after grafting (cf. 22% in normal brain tissue), and the number of immature climbing-type preterminals also increased from 2–10% (control) to 20% after grafting. These changes were statistically significant (P less than 0.01). (3) The number of parallel-type preterminals increased from 13% (control) to 27% after grafting, which was also statistically significant (P less than 0.01). Thus, it appears that the donor climbing fibers grow and develop to find unoccupied spines on the host Purkinje dendrites and establish synaptic contacts, and also that the host parallel fibers may generate axonal sprouts to search their new targets and ultimately to form synaptic contacts with unoccupied spines. In the process of re-modeling the brain, competition for targets is likely to occur between the two kinds of axonal processes, i.e. the donor climbing fibers and the host parallel fibers.
15
Esquius, Laura, Casimiro Javierre, Inés Llaudó, Inés Rama, Guillermo R. Oviedo, Marta Massip-Salcedo, Alicia Aguilar-Martínez, Oscar Niño, and Núria Lloberas. "Impact of Olive Oil Supplement Intake on Dendritic Cell Maturation after Strenuous Physical Exercise: A Preliminary Study." International Journal of Environmental Research and Public Health 18, no. 8 (April 14, 2021): 4128. http://dx.doi.org/10.3390/ijerph18084128.
Full textAbstract:
Physical exercise is known to have a dose-dependent effect on the immune system and can result in an inflammatory process in athletes that is proportional to the intensity and duration of exertion. This inflammatory process can be measured by cell markers such as dendritic cells (DCs), which, in humans, consist of the myeloid DC (mDCs) and plasmacytoid DC (pDCs) subpopulations. The aim of this study was to measure DC differentiation to determine the possible anti-inflammatory effects, after intense aerobic effort, of the intake of a 25 mL extra-virgin olive oil supplement. Three healthy sports-trained subjects went through resistance exercise loads on two days separated by a week: on one day after active supplement intake and on the other day after placebo supplement intake. The results show that the highest increase (77%) in the percentage of mDCs as a proportion of pDCs was immediately after testing. Independently of the supplement taken, mature mDCs showed a decreasing trend between the test one hour after and 24 h after testing ended. Nevertheless, measured in terms of the coefficient of variation, only the decrease (46%) for extra-virgin olive oil supplementation was statistically significant (95% CI: 30–62%; p = 0.05). In conclusion, an extra-virgin olive oil supplement could reduce the inflammatory impact of intense aerobic effort and improve recovery at 24 h.
16
Liu, Feng-Quan, Wen-Peng Wang, Ya-Xia Yin, Shuai-Feng Zhang, Ji-Lei Shi, Lu Wang, Xu-Dong Zhang, et al. "Upgrading traditional liquid electrolyte via in situ gelation for future lithium metal batteries." Science Advances 4, no. 10 (October 2018): eaat5383. http://dx.doi.org/10.1126/sciadv.aat5383.
Full textAbstract:
High-energy lithium metal batteries (LMBs) are expected to play important roles in the next-generation energy storage systems. However, the uncontrolled Li dendrite growth in liquid electrolytes still impedes LMBs from authentic commercialization. Upgrading the traditional electrolyte system from liquid to solid and quasi-solid has therefore become a key issue for prospective LMBs. From this premise, it is particularly urgent to exploit facile strategies to accomplish this goal. We report that commercialized liquid electrolyte can be easily converted into a novel quasi-solid gel polymer electrolyte (GPE) via a simple and efficient in situ gelation strategy, which, in essence, is to use LiPF6 to induce the cationic polymerization of the ether-based 1,3-dioxolane and 1,2-dimethoxyethane liquid electrolyte under ambient temperature. The newly developed GPE exhibits elevated protective effects on Li anodes and has universality for diversified cathodes including but not restricted to sulfur, olivine-type LiFePO4, and layered LiNi0.6Co0.2Mn0.2O2, revealing tremendous potential in promoting the large-scale application of future LMBs.
17
Schweighofer, Nicolas, Kenji Doya, and Mitsuo Kawato. "Electrophysiological Properties of Inferior Olive Neurons: A Compartmental Model." Journal of Neurophysiology 82, no. 2 (August 1, 1999): 804–17. http://dx.doi.org/10.1152/jn.1999.82.2.804.
Full textAbstract:
As a step in exploring the functions of the inferior olive, we constructed a biophysical model of the olivary neurons to examine their unique electrophysiological properties. The model consists of two compartments to represent the known distribution of ionic currents across the cell membrane, as well as the dendritic location of the gap junctions and synaptic inputs. The somatic compartment includes a low-threshold calcium current ( I Ca_l), an anomalous inward rectifier current ( I h), a sodium current ( I Na), and a delayed rectifier potassium current ( I K_dr). The dendritic compartment contains a high-threshold calcium current ( I Ca_h), a calcium-dependent potassium current ( I K_Ca), and a current flowing into other cells through electrical coupling ( I c). First, kinetic parameters for these currents were set according to previously reported experimental data. Next, the remaining free parameters were determined to account for both static and spiking properties of single olivary neurons in vitro. We then performed a series of simulated pharmacological experiments using bifurcation analysis and extensive two-parameter searches. Consistent with previous studies, we quantitatively demonstrated the major role of I Ca_l in spiking excitability. In addition, I h had an important modulatory role in the spike generation and period of oscillations, as previously suggested by Bal and McCormick. Finally, we investigated the role of electrical coupling in two coupled spiking cells. Depending on the coupling strength, the hyperpolarization level, and the I Ca_l and I hmodulation, the coupled cells had four different synchronization modes: the cells could be in-phase, phase-shifted, or anti-phase or could exhibit a complex desynchronized spiking mode. Hence these simulation results support the counterintuitive hypothesis that electrical coupling can desynchronize coupled inferior olive cells.
18
De Santis, Stefania, Marina Liso, Giulio Verna, Francesca Curci, Gualtiero Milani, Maria Felicia Faienza, Carlo Franchini, et al. "Extra Virgin Olive Oil Extracts Modulate the Inflammatory Ability of Murine Dendritic Cells Based on Their Polyphenols Pattern: Correlation between Chemical Composition and Biological Function." Antioxidants 10, no. 7 (June 24, 2021): 1016. http://dx.doi.org/10.3390/antiox10071016.
Full textAbstract:
Extra virgin olive oil (EVOO) represents one of the most important health-promoting foods whose antioxidant and anti-inflammatory activities are mainly associated to its polyphenols content. To date, studies exploring the effect of EVOO polyphenols on dendritic cells (DCs), acting as a crosstalk between the innate and the adaptive immune response, are scanty. Therefore, we studied the ability of three EVOO extracts (cv. Coratina, Cima di Mola/Coratina, and Casaliva), characterized by different polyphenols amount, to regulate DCs maturation in resting conditions or after an inflammatory stimulus. Cima di Mola/Coratina and Casaliva extracts were demonstrated to be the most effective in modulating DCs toward an anti-inflammatory profile by reduction of TNF and IL-6 secretion and CD86 expression, along with a down-modulation of Il-1β and iNOS expression. From factorial analysis results, 9 polyphenols were tentatively established to play a synergistic role in modulating DCs inflammatory ability, thus reducing the risk of chronic inflammation.
19
Smith, Philip H., Philip X. Joris, and Tom C. T. Yin. "Anatomy and Physiology of Principal Cells of the Medial Nucleus of the Trapezoid Body (MNTB) of the Cat." Journal of Neurophysiology 79, no. 6 (June 1, 1998): 3127–42. http://dx.doi.org/10.1152/jn.1998.79.6.3127.
Full textAbstract:
Smith, Philip H., Philip X. Joris, and Tom C. T. Yin. Anatomy and physiology of principal cells of the medial nucleus of the trapezoid body (MNTB) of the cat. J. Neurophysiol. 79: 3127–3142, 1998. We have recorded from principal cells of the medial nucleus of the trapezoid body (MNTB) in the cat's superior olivary complex using either glass micropipettes filled with Neurobiotin or horseradish peroxidase for intracellular recording and subsequent labeling or extracellular metal microelectrodes relying on prepotentials and electrode location. Labeled principal cells had cell bodies that usually gave rise to one or two primary dendrites, which branched profusely in the vicinity of the cell. At the electron microscopic (EM) level, there was a dense synaptic terminal distribution on the cell body and proximal dendrites. Up to half the measured cell surface could be covered with excitatory terminals, whereas inhibitory terminals consistently covered about one-fifth. The distal dendrites were very sparsely innervated. The thick myelinated axon originated from the cell body and innervated nuclei exclusively in the ipsilateral auditory brain stem. These include the lateral superior olive (LSO), ventral nucleus of the lateral lemniscus, medial superior olive, dorsomedial and ventromedial periolivary nuclei, and the MNTB itself. At the EM level the myelinated collaterals gave rise to terminals that contained nonround vesicles and, in the LSO, were seen terminating on cell bodies and primary dendrites. Responses of MNTB cells were similar to their primary excitatory input, the globular bushy cell (GBC), in a number of ways. The spontaneous spike rate of MNTB cells with low characteristic frequencies (CFs) was low, whereas it tended to be higher for higher CF units. In response to short tones, a low frequency MNTB cell showed enhanced phase-locking abilities, relative to auditory nerve fibers. For cells with CFs >1 kHz, the short tone response often resembled the primary-like with notch response seen in many globular bushy cells, with a well-timed onset component. Exceptions to and variations of this standard response were also noted. When compared with GBCs with comparable CFs, the latency of the MNTB cell response was delayed slightly, as would be expected given the synapse interposed between the two cell types. Our data thus confirm that, in the cat, the MNTB receives and converts synaptic inputs from globular bushy cells into a reasonably accurate reproduction of the bushy cell spike response. This MNTB cell output then becomes an important inhibitory input to a number of ipsilateral auditory brain stem nuclei.
20
Hoffmann, Caroline, Floriane Noël, Maximilien Grandclaudon, Lucile Massenet-Regad, Paula Michea, Philemon Sirven, Lilith Faucheux, et al. "Abstract 2105: PD-L1 high ICOSL low Secretory dendritic cells infiltrate human solid tumors." Cancer Research 82, no. 12_Supplement (June 15, 2022): 2105. http://dx.doi.org/10.1158/1538-7445.am2022-2105.
Full textAbstract:
Abstract Background: Human conventional dendritic cells (cDC) are essential for the anti-tumor immune response. Their immunogenic and tolerogenic states in cancer remain controversial. Our objective was to define the range of DC activation states in vitro and to determine their relevance ex vivo in cancer. Methods: First, in vitro, we activated healthy donor cDC with 16 different stimuli and measured cDC and T cells cytokine and chemokine secretion upon co-culture (n = 130 individual experiments) to define new maturation archetypes. Second, we established the relevance of these archetypes in cancer, ex vivo in human. We performed in depth analysis of cDC infiltrating head and neck cancer (HNSCC) by flow cytometry (n = 22 patients), transcriptomic analysis (n = 6 patients), and cDC-enriched single-cell transcriptomics (ScRNAseq) (n = 10503 cells from 2 patients). Then we performed a merged analysis of cDC from in house and public ScRNAseq datasets (n = 36 tumor samples from HNSCC, Lung, and Breast cancer, and, as comparator, n = 33 blood and juxtatumor samples, n = 19 healthy donor samples, and n = 23 samples from inflammatory diseases). Results: In vitro, we identified two archetypes of cDC activation: (i) PD-L1highICOSLlow cDC that produce large amounts of inflammatory cytokines and chemokines, labeled Secretory cDC; (ii)PD-L1lowICOSLhigh cDC that induce a broad range of Th cytokines, labeled Helper cDC. This functional dichotomy of cDC was mutually exclusive and not receptor specific. In cancer, we identified Secretory cDC, and these cells aligned with mature LAMP3+cDC. Helper cDC were not found ex vivo. Secretory cDC simultaneously expressed stimulatory (CD40, TNFRSF9 (4-1BB)), inhibitory (CD274, CD200, IDO1), and mixed (PVR) checkpoints. Secretory cDC were associated with T cell inflammation in HNSCC, triple-negative breast cancer (TNBC), and melanoma (all p < 1.10-15), with improved overall survival in HNSCC and TNBC (all p < 0.01), and with response to checkpoint blockade in 2 melanoma cohorts (all p < 0.01). Conclusion: We identify and characterize Secretory cDC in several solid cancers. This novel phenotypic and functional dichotomy of human cDC activation states has broad implications for all types of immunotherapies and provides rational for drug combinations. Citation Format: Caroline Hoffmann, Floriane Noël, Maximilien Grandclaudon, Lucile Massenet-Regad, Paula Michea, Philemon Sirven, Lilith Faucheux, Aurore Surun, Olivier Lantz, Mylene Bohec, Jian Ye, Weihua Guo, Juliette Rochefort, Jerzy Klijanienko, Sylvain Baulande, Charlotte Lecerf, Maud Kamal, Christophe Le Tourneau, Maude Guillot-Delost, Vassili Soumelis. PD-L1 high ICOSL low Secretory dendritic cells infiltrate human solid tumors [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2105.
21
Vazquez-Madrigal, Carlos, Soledad Lopez, Elena Grao-Cruces, Maria C. Millan-Linares, Noelia M. Rodriguez-Martin, Maria E. Martin, Gonzalo Alba, Consuelo Santa-Maria, Beatriz Bermudez, and Sergio Montserrat-de la Paz. "Dietary Fatty Acids in Postprandial Triglyceride-Rich Lipoproteins Modulate Human Monocyte-Derived Dendritic Cell Maturation and Activation." Nutrients 12, no. 10 (October 14, 2020): 3139. http://dx.doi.org/10.3390/nu12103139.
Full textAbstract:
Dietary fatty acids have been demonstrated to modulate systemic inflammation and induce the postprandial inflammatory response of circulating immune cells. We hypothesized that postprandial triglyceride-rich lipoproteins (TRLs) may have acute effects on immunometabolic homeostasis by modulating dendritic cells (DCs), sentinels of the immunity that link innate and adaptive immune systems. In healthy volunteers, saturated fatty acid (SFA)-enriched meal raised serum levels of granulocyte/macrophage colony-stimulating factor GM-CSF (SFAs > monounsaturated fatty acids (MUFAs) = polyunsaturated fatty acids (PUFAs)) in the postprandial period. Autologous TRL-SFAs upregulated the gene expression of DC maturation (CD123 and CCR7) and DC pro-inflammatory activation (CD80 and CD86) genes while downregulating tolerogenic genes (PD-L1 and PD-L2) in human monocyte-derived DCs (moDCs). These effects were reversed with oleic acid-enriched TRLs. Moreover, postprandial SFAs raised IL-12p70 levels, while TRL-MUFAs and TRL-PUFAs increased IL-10 levels in serum of healthy volunteers and in the medium of TRL-treated moDCs. In conclusion, postprandial TRLs are metabolic entities with DC-related tolerogenic activity, and this function is linked to the type of dietary fat in the meal. This study shows that the intake of meals enriched in MUFAs from olive oil, when compared with meals enriched in SFAs, prevents the postprandial production and priming of circulating pro-inflammatory DCs, and promotes tolerogenic response in healthy subjects. However, functional assays with moDCs generated in the presence of different fatty acids and T cells could increase the knowledge of postprandial TRLs’ effects on DC differentiation and function.
22
Delgado-Arévalo, C., M. Calvet-Mirabent, A. Triguero-Martinez, E. Vazquez de Luis, A. Benguría-Filippini, D. Calzada, I. Sánchez-Cerrillo, et al. "POS0367 NLRC4 AND FC-γ-R CROSSTALK ON CD1C+ DENDRITIC CELLS DIFFERENTIALLY CONTRIBUTES TO RHEUMATOID ARTHRITIS IMMUNOPATHOLOGY." Annals of the Rheumatic Diseases 80, Suppl 1 (May 19, 2021): 413.2–413. http://dx.doi.org/10.1136/annrheumdis-2021-eular.3192.
Full textAbstract:
Background:Rheumatoid arthritis (RA) is an autoimmune disorder in which Th17 cells, B cells and inflammatory cytokines (1-3) contribute to joint tissue damage, however the role of specific myeloid populations to immunopathogenesis of RA remains unclear.Objectives:To address this question, we studied transcriptional, phenotypical and functional characteristics of monocytes (Mo), CD1c+ and CD141+ conventional dendritic cells (cDC) from RA patients.Methods:Frequencies and maturation patterns of Lin-CD14-HLADR+ plasmacytoid (CD11c-), CD1c+ and CD141+ cDC (CD11c+) subsets and CD14+ Mo from n=25 RA patients at baseline were analyzed by multicolor flow cytometry. In addition, longitudinal studies on the evolution of these populations after treatment initiation were conducted on a smaller group of RA patients. Moreover, CD1c+ and CD141+ cDC subsets and total Mo were sorted from the peripheral blood from n=4 untreated RA and healthy individuals and the synovial fluid from n=3 RA and chondrocalcinosis patients. Differential transcriptional patterns within each population were analyzed by RNAseq. Functional validation of targets were performed in vitro with cDC subsets isolated form the synoviual fluid of RA patients. Finally, silencing of expression of NLRC4 and NLRP3 on CD1c+cDCs was performed with specific siRNAs.Results:Both CD1c+ (p=0.0001) and CD141+ (p=0.0008) cDCs were significantly depleted from the blood and enriched in the synovial fluid from untreated RA patients, but proportions of CD1c+ cDCs were more significantly recovered after treatment initiation and associated with improved clinical parameters. In addition, specific increased expression levels of the IgG-Fc receptor CD64 on CD1c+ cDC was associated with higher DAS28 (p=0.0002). Moreover, differential transcriptional patterns of circulating CD1c+cDCs from RA patients were characterized by genes linked to toll-like receptor, Fc-receptor, inflammasome pathways and elevated CCR2 expression (p=0.016), while CD141+cDCs transcribed interferon-related genes. Importantly, CCR2+ CD64Hi CD1c+cDCs from the synovial fluid from RA patients transcribed proinflammatory cytokines such as IL1-β, CCL3 and IL-8, actively expressed the inflammasome mediator caspase 1 and were more effective activating pathogenic IFNγ+IL-17+ CD4+ T cells in vitro than CD141+ cDC (p=0.0019). These functional profiles could be artificially induced stimulating CD1c+ cDCs with dsDNA in the presence of IgGs and was dependent on caspase 1 and the NLRC4 inflammasome.Conclusion:Our data provides novel insights about specific activation and functional patterns on CD1c+cDC contributing to RA pathogenesis and identifies new sensors that could represent novel therapeutic target to treat RA.References:[1]Alvandpur N, Tabatabaei R, Tahamoli-Roudsari A, Basiri Z, Behzad M, Rezaeepoor M, et al. Circulating IFN-gamma producing CD4+ T cells and IL-17A producing CD4+ T cells, HLA-shared epitope and ACPA may characterize the clinical response to therapy in rheumatoid arthritis patients. Human immunology. 2020.[2]Nistala K, Adams S, Cambrook H, Ursu S, Olivito B, de Jager W, et al. Th17 plasticity in human autoimmune arthritis is driven by the inflammatory environment. Proceedings of the National Academy of Sciences of the United States of America. 2010;107(33):14751-6.[3]Chapuy-Regaud S, Nogueira L, Clavel C, Sebbag M, Vincent C, Serre G. IgG subclass distribution of the rheumatoid arthritis-specific autoantibodies to citrullinated fibrin. Clinical and experimental immunology. 2005;139(3):542-50.Disclosure of Interests:None declared
23
Couchman, Kiri, Benedikt Grothe, and Felix Felmy. "Functional localization of neurotransmitter receptors and synaptic inputs to mature neurons of the medial superior olive." Journal of Neurophysiology 107, no. 4 (February 15, 2012): 1186–98. http://dx.doi.org/10.1152/jn.00586.2011.
Full textAbstract:
Neurons of the medial superior olive (MSO) code for the azimuthal location of low-frequency sound sources via a binaural coincidence detection system operating on microsecond time scales. These neurons are morphologically simple and stereotyped, and anatomical studies have indicated a functional segregation of excitatory and inhibitory inputs between cellular compartments. It is thought that this morphological arrangement holds important implications for the computational task of these cells. To date, however, there has been no functional investigation into synaptic input sites or functional receptor distributions on mature neurons of the MSO. Here, functional neurotransmitter receptor maps for amino-3-hydroxyl-5-methyl-4-isoxazole propionate (AMPA), N-methyl-d-aspartate (NMDA), glycine (Gly), and ionotropic γ-aminobutyric acid (GABAA) receptors (Rs) were compared and complemented by their corresponding synaptic input map. We find in MSO neurons from postnatal day 20–35 gerbils that AMPARs and their excitatory inputs target the soma and dendrites. Functional GlyRs and their inhibitory inputs are predominantly refined to the somata, although a pool of functional GlyRs is present extrasynaptically on MSO dendrites. GABAAR responses are present throughout the cell but lack direct synaptic contact indicating an involvement in volume transmission. NMDARs are present both synaptically and extrasynaptically with an overall distribution similar to GlyRs. Interestingly, even at physiological temperatures these functional NMDARs can be potentiated by synaptically released Gly. The functional receptor and synaptic input maps produced here led to the identification of a cross talk between transmitter systems and raises the possibility that extrasynaptic receptors could be modulating leak conductances as a homeostatic mechanism.
24
Goenka, Shilpi, and Sanford R. Simon. "A Novel Pro-Melanogenic Effect of Standardized Dry Olive Leaf Extract on Primary Human Melanocytes from Lightly Pigmented and Moderately Pigmented Skin." Pharmaceuticals 14, no. 3 (March 11, 2021): 252. http://dx.doi.org/10.3390/ph14030252.
Full textAbstract:
Benolea® (EFLA®943) is a standardized dry olive leaf extract (DOLE) considered safe for food consumption and has demonstrated superior pharmaceutical benefits such as antioxidant, anti-obesity, and anti-hypertensive activities. However, there is no study on its effects on melanogenesis yet. Disruption in the sequence of steps in melanogenesis can lead to hypopigmentary disorders which occur due to reduced production or export of pigment melanin in the skin. There is a need for safe and nontoxic therapeutics for the treatment of hypopigmentation disorders. Herein, we studied the effects of DOLE over a concentration range of 10–200 µg/mL on melanin synthesis and melanin secretion in B16F10 mouse melanoma cells and MNT-1 human melanoma cells and validated our results in primary human melanocytes (obtained from lightly pigmented (LP) and moderately pigmented (MP) cells) as well as their cocultures with keratinocytes. The capacity of melanocytes to export melanosomes was also estimated indirectly by the quantitation of melanocyte dendrite lengths and numbers. Our results show that DOLE significantly enhanced levels of extracellular melanin in the absence of effects on intracellular melanin, demonstrating that this plant extract’s pro-melanogenic activity is primarily based on its capacity to augment melanin secretion and stimulate melanocyte dendricity. In summary, our preliminary results demonstrate that DOLE may hold promise as a pro-pigmenting agent for vitiligo therapy and gray hair treatment by its exclusive and novel mechanism of functioning as a dendrite elongator. Further studies to elucidate the mechanisms of action of the pro-melanogenic activity and effects of DOLE on melanosome export as well as the last steps of melanogenesis are warranted.
25
Pagadala, Meghana, Victoria Wu, Eva Pérez-Guijarro, Hyo Kim, Andrea Castro, James Talwar, Cristian Gonzalez-Colin, et al. "Abstract 3825: Germline modifiers of the tumor immune microenvironment reveal drivers of immunotherapy response." Cancer Research 82, no. 12_Supplement (June 15, 2022): 3825. http://dx.doi.org/10.1158/1538-7445.am2022-3825.
Full textAbstract:
Abstract With the continued promise of immunotherapy as an avenue for treating cancer, understanding how host genetics contributes to the tumor immune microenvironment (TIME) is essential to tailoring cancer risk screening and treatment strategies. Using genotypes from over 8,000 European individuals in The Cancer Genome Atlas and 137 heritable tumor immune phenotype components (IP components), we identified and investigated 532 TIME-SNPs. Focusing on 77 variants that were relevant to cancer risk, survival, or treatment response, we explored their potential to reveal novel targets for immunotherapy. Many variants overlapped regions with histone marks indicating active transcription, and influenced gene activities in specific immune cell subsets, such as macrophages and dendritic cells. TIME-SNPs implicated genes such as LAIR1, TREX1, CTSS, CTSW and LILRB2 were differentially expressed between responders and non-responders to immune-checkpoint blockade (ICB) in preclinical studies. Of these, LILRB2 and LAIR1 have already been identified as putative targets for immunotherapy. Here we found that inhibition of CTSS led to better tumor control and survival in murine models, alone or in combination with anti-PD-1. Collectively we show that through an integrative approach, it is possible to link host genetics to TIME characteristics, informing novel biomarkers for cancer risk and target identification in immunotherapy. Citation Format: Meghana Pagadala, Victoria Wu, Eva Pérez-Guijarro, Hyo Kim, Andrea Castro, James Talwar, Cristian Gonzalez-Colin, Steven Cao, Benjamin J. Schmiedel, Timothy Sears, Shervin Goudarzi, Divya Kirani, Rany M. Salem, Gerald P. Morris, Olivier Harismendy, Sandip P. Patel, Jill P. Mesirov, Maurizio Zanetti, Chi-Ping Day, Chun C. Fan, Wesley K. Thompson, Glenn Merlino, J. Silvio Gutkind, Pandurangan Vijayanand, Hannah Carter. Germline modifiers of the tumor immune microenvironment reveal drivers of immunotherapy response [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 3825.
26
Zhang, Jennifer, Olivia Lanchoney, Nikhil Joshi, Nune Markosyan, and Robert Vonderheide. "Abstract A67: CD40 agonism inhibits tumor growth in murine hormone receptor positive breast cancer via CD8 T cells." Cancer Immunology Research 10, no. 12_Supplement (December 1, 2022): A67. http://dx.doi.org/10.1158/2326-6074.tumimm22-a67.
Full textAbstract:
Abstract Breast cancer is the second most common malignancy affecting women and accounts for 15% of cancer-related mortality globally. Over 70% of breast cancers are hormone receptor (HR) positive (estrogen receptor and/or progesterone receptor positive) and human epidermal growth factor receptor 2 negative (HER2-). HR+HER2- breast cancers are poorly responsive to chemotherapy and recurrence and mortality remain high for patients with locally advanced disease. Thus, more therapeutic strategies are needed. Dendritic cell (DC) activation is an important pathway for T cell priming and subsequent improvements in immunosurveillance. In this study, we determined the ability of DC-targeted therapy with agonistic CD40 antibody to restore anti-tumor immunologic function in a murine orthotopic HR+HER2- breast cancer model. The Brpkp110 cell line was injected orthotopically into the abdominal mammary glands of 8 to 10-week-old C57BL/6 mice. Tumor-bearing mice treated with agonistic CD40 antibody (FGK4.5, 100 ug intraperitoneal) demonstrated decreased tumor growth and increased intratumoral CD8 T cells at 2 weeks. Both intratumoral DCs and tumor-associated macrophages in mice treated with agonistic CD40 were found to upregulate PD-L1 and CD40. CD8 T cell depletion abrogated the anti-tumor effect of agonistic CD40. Our data suggest that agonistic CD40 therapy may be a viable strategy for tumor inhibition and activation of anti-tumor immunity in HR+HER2- breast cancer. Citation Format: Jennifer Zhang, Olivia Lanchoney, Nikhil Joshi, Nune Markosyan, Robert Vonderheide. CD40 agonism inhibits tumor growth in murine hormone receptor positive breast cancer via CD8 T cells [abstract]. In: Proceedings of the AACR Special Conference: Tumor Immunology and Immunotherapy; 2022 Oct 21-24; Boston, MA. Philadelphia (PA): AACR; Cancer Immunol Res 2022;10(12 Suppl):Abstract nr A67.
27
Akgoren, N., C. Mathiesen, I. Rubin, and M. Lauritzen. "Laminar analysis of activity-dependent increases of CBF in rat cerebellar cortex: dependence on synaptic strength." American Journal of Physiology-Heart and Circulatory Physiology 273, no. 3 (September 1, 1997): H1166—H1176. http://dx.doi.org/10.1152/ajpheart.1997.273.3.h1166.
Full textAbstract:
The purpose of the present study was to examine mechanisms of activity-dependent changes of cerebral blood flow (CBF) in rat cerebellar cortex by laser-Doppler flowmetry, using two synaptic inputs that excite different regions of the same target cell and with different synaptic strength. The apical part of Purkinje cells was activated by electrical stimulation of parallel fibers, whereas the cell soma and the proximal part of the dendritic tree were activated by climbing fibers using harmaline (40 mg/kg ip) or electrical stimulation of the inferior olive. Glass microelectrodes were used for recordings of field potentials and single-unit activity of Purkinje cells. CBF increases evoked by parallel fibers were most pronounced in the upper cortical layers. In contrast, climbing fiber stimulation increased CBF in the entire cortex. Inhibition of nitric oxide (NO) synthase activity by NG-nitro-L-arginine (L-NNA) or guanylate cyclase activity by 1H-[1,2,4(oxadiazolo)4,3-a]quinoxaline-1-one did not affect basal or harmaline-induced Purkinje cell activity but attenuated harmaline- and parallel fiber-evoked CBF increases by approximately 40-50%. Application of 8-(p-sulfophenyl)theophylline and adenosine deaminase reduced the harmaline-evoked CBF increase without any effect on the parallel fiber-evoked CBF response. The results suggest that CBF increases elicited by activation of Purkinje cells are partially mediated by the NO-guanosine 3',5'-cyclic monophosphate system independent of the input function but that adenosine contributes as well when climbing fibers are activated. This is the first demonstration of variations of coupling as a function of postsynaptic activity in the same cell.
28
Adam, T. J., P. G. Finlayson, and D. W. F. Schwarz. "Membrane Properties of Principal Neurons of the Lateral Superior Olive." Journal of Neurophysiology 86, no. 2 (August 1, 2001): 922–34. http://dx.doi.org/10.1152/jn.2001.86.2.922.
Full textAbstract:
In the lateral superior olive (LSO) the firing rate of principal neurons is a linear function of inter-aural sound intensity difference (IID). The linearity and regularity of the “chopper response” of these neurons have been interpreted as a result of an integration of excitatory ipsilateral and inhibitory contralateral inputs by passive soma-dendritic cable properties. To account for temporal properties of this output, we searched for active time- and voltage-dependent nonlinearities in whole cell recordings from a slice preparation of the rat LSO. We found nonlinear current-voltage relations that varied with the membrane holding potential. Repetitive regular firing, supported by voltage oscillations, was evoked by current pulses injected from holding potentials near rest, but the response was reduced to an onset spike of fixed short latency when the pulse was injected from de- or hyperpolarized holding potentials. The onset spike was triggered by a depolarizing transient potential that was supported by T-type Ca2+-, subthreshold Na+-, and hyperpolarization-activated ( I H) conductances sensitive, respectively, to blockade with Ni2+, tetrodotoxin (TTX), and Cs+. In the hyperpolarized voltage range, the I H, was largely masked by an inwardly rectifying K+ conductance ( I KIR) sensitive to blockade with 200 μM Ba2+. In the depolarized range, a variety of K+ conductances, including A-currents sensitive to blockade with 4-aminopyridine (4-AP) and additional tetraethylammonium (TEA)-sensitive currents, terminated the transient potential and firing of action potentials, supporting a strong spike-rate adaptation. The “chopper response,” a hallmark of LSO principal neuron firing, may depend on the voltage- and time-dependent nonlinearities. These active membrane properties endow the LSO principal neurons with an adaptability that may maintain a stable code for sound direction under changing conditions, for example after partial cochlear hearing loss.
29
Zacksenhouse, Miriam, Don H. Johnson, Jerome Williams, and Chiyeko Tsuchitani. "Single-Neuron Modeling of LSO Unit Responses." Journal of Neurophysiology 79, no. 6 (June 1, 1998): 3098–110. http://dx.doi.org/10.1152/jn.1998.79.6.3098.
Full textAbstract:
Zacksenhouse, Miriam, Don H. Johnson, Jerome Williams, and Chiyeko Tsuchitani. Single-neuron modeling of LSO unit responses. J. Neurophysiol. 79: 3098–3110, 1998. We investigated, using a computational model, the biophysical correlates of measured discharge patterns of lateral superior olive (LSO) neuron responses to monaural and binaural stimuli. The model's geometry was based on morphological data, and static electric properties of the model agree with available intracellular responses to hyperpolarizing current pulses. Inhibitory synapses were located on the soma and excitatory ones on the dendrites, which were modeled as passive cables. The active properties of the model were adjusted to agree with statistical measures derived from extracellular recordings. Calcium-dependent potassium channels supplemented the usual Hodgkin-Huxley characterization for the soma to produce observed serial interspike interval dependence characteristics. Intracellular calcium concentration is controlled by voltage- and calcium-dependent potassium channels and by calcium diffusion and homeostatic mechanisms. By adjusting the density of the calcium-dependent potassium channels, we could span the observed range of transient response patterns found in different LSO neurons. Inputs from the two ears were modeled as Poisson processes to describe the responses to tone-burst stimuli. Transient and sustained responses to monaural and binaural tone-burst stimuli over a wide range of stimulus conditions could be well described by varying only the model's inputs. As found in recordings, model responses having similar discharge rates but different binaural stimulus combinations exhibited differences in interval statistics.
30
Smith, P. H. "Structural and functional differences distinguish principal from nonprincipal cells in the guinea pig MSO slice." Journal of Neurophysiology 73, no. 4 (April 1, 1995): 1653–67. http://dx.doi.org/10.1152/jn.1995.73.4.1653.
Full textAbstract:
1. Principal cells in the medial superior olive (MSO) receive low-frequency information from both ears via left and right cochlear nuclei. In vivo extracellular records suggest that some MSO neurons respond optimally only when the binaural acoustic signal has a precise interaural delay. Thus MSO cells, in particular principal cells, are thought to be the first stage in the processing of interaural time difference cues that provides information as to the location of a low-frequency sound in space. 2. Despite this proposed fundamental role for the MSO, certain features of this nucleus make in vivo recordings from any cell type here very difficult to obtain. Only a small number of extracellular records and no intracellular recordings are reported in the literature. Using sharp, neurobiotin-filled glass electrodes to record intracellularly from cells in an in vitro brain slice of the guinea pig superior olivary complex, I have begun to assess the anatomic and physiological features of cells in the MSO that might be relevant to such a functional role in vivo. 3. Two basic MSO cell types, designated principal and nonprincipal, could be distinguished on the basis of certain anatomic and physiological differences. 4. Labeled principal cell bodies were located at all dorsoventral location within the MSO. Labeled nonprincipal cells were located in or around the dorsal aspects of the nucleus. Principal cells typically had thick bipolar dendrites (1 directed medially, 1 laterally) that did not taper or branch significantly except at their terminations. Nonprincipal cells were multipolar with three to nine thinner primary dendrites that did not branch preferentially in a mediolateral direction. Principal cell axons gave off collaterals terminating in and around the dorsal MSO. Nonprincipal cells also had axon in and around the dorsal MSO. Nonprincipal cells also had axon collateral branches innervating dorsal MSO, but these axons could branch more extensively and project further down the dorsoventral aspect of the nucleus. 5. Principal cells typically responded to depolarizing current pulses with one or a few spikes at current onset. When bathed in saline containing 4-aminopyridine (4-AP), they fired repetitively to the same depolarizing current pulses. This would indicate a depolarization-induced nonlinearity similar to that seen in principal cell types of two other auditory brain stem nuclei, the anteroventral cochlear nucleus and medial nucleus of the trapezoid body. Nonprincipal cells normally fired repetitively to depolarizing current pulses even close to spike threshold. Both cell types could show a sag in the membrane potential to hyperpolarizing current pulses.(ABSTRACT TRUNCATED AT 400 WORDS)
31
Larson-Prior, L. J., D. R. McCrimmon, and N. T. Slater. "Slow excitatory amino acid receptor-mediated synaptic transmission in turtle cerebellar Purkinje cells." Journal of Neurophysiology 63, no. 3 (March 1, 1990): 637–50. http://dx.doi.org/10.1152/jn.1990.63.3.637.
Full textAbstract:
1. The excitatory synaptic responses of turtle Purkinje cells to climbing and parallel fiber (CF and PF) stimulation have been studied by the use of intrasomatic and intradendritic recordings in intact cerebellum and brain stem-cerebellum preparations in vitro. 2. Activation of CF inputs from the cerebellar peduncle or the region of the inferior olive evoked complex spikes followed by slow excitatory postsynaptic potentials (EPSPs), both of which were evoked in an all-or-none fashion. 3. Single stimuli applied to the cerebellar molecular layer activated fast PF-mediated EPSPs; brief trains of PF stimuli (2-5 stimuli, 50-100 Hz) evoked volleys of fast EPSPs followed by a slow, long-lasting EPSP. The amplitude of the fast and slow PF-mediated EPSPs were both graded with stimulus intensity. 4. Slow EPSPs evoked both by CF and PF stimulation were associated with an increase in membrane conductance and were increased in amplitude by hyperpolarization. 5. The CF-evoked slow EPSP was profoundly attenuated by repetitive activation at interstimulus intervals of less than 15-20 s, whereas the PF-evoked slow EPSP was not reduced by repetitive activation. 6. The PF-evoked slow EPSP readily triggered dendritic pacemaker discharges when activated at or near resting membrane potential. The activation of this potential by phasic PF volleys may, therefore, provide an appropriate synaptic drive to cerebellar Purkinje cells to entrain the intrinsic pacemaker properties of these cells to cycles of motor activity. 7. Both slow synaptic potentials were blocked by the excitatory amino acid antagonists kynurenate and 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), but not by DL-2-amino-5-phosphonovalerate (DL-AP5) or L-serine-O-phosphate (L-SOP). The PF-evoked slow EPSP was selectively antagonized by L-2-amino-4-phosphonobutyrate (L-AP4; 20-100 microM). 8. It is suggested that the CF- and PF-evoked slow EPSPs observed in this study represent a novel class of excitatory amino acid receptor-mediated slow synaptic potentials activated by Purkinje cell afferents, which may play a role in synaptic integration and motor pattern generation in the cerebellum.
32
Maier, M. A., E. Olivier, S. N. Baker, P. A. Kirkwood, T. Morris, and R. N. Lemon. "Direct and Indirect Corticospinal Control of Arm and Hand Motoneurons in the Squirrel Monkey (Saimiri sciureus)." Journal of Neurophysiology 78, no. 2 (August 1, 1997): 721–33. http://dx.doi.org/10.1152/jn.1997.78.2.721.
Full textAbstract:
Maier, M. A., E. Olivier, S. N. Baker, P. A. Kirkwood, T. Morris, and R. N. Lemon. Direct and indirect corticospinal control of arm and hand motoneurons in the squirrel monkey ( Saimiri sciureus). J. Neurophysiol. 78: 721–733, 1997. Anatomic evidence suggests that direct corticomotoneuronal (CM) projections to hand motoneurons in the New World squirrel monkey ( Saimiri sciureus) are weak or absent, but electrophysiological evidence is lacking. The nature of the corticospinal linkage to these motoneurons was therefore investigated first with the use of transcranial magnetic stimulation (TMS) of the motor cortex under ketamine sedation in five monkeys. TMS produced early responses in hand muscle electromyogram, but thresholds were high (compared with macaque monkey) and the onset latency was variable. Second, stimulation of the pyramidal tract (PT) was carried out with the use of chronically implanted electrodes in ketamine-sedated monkeys; this produced more robust responses that were markedly facilitated by repetitive stimulation, with little decrease in latency on the third compared with the first shock. Finally, postsynaptic potentials were recorded intracellularly from 93 arm and hand motoneurons in five monkeys under general chloralose anesthesia. After a single PT stimulus, the most common response was a small, slowly rising excitatory postsynaptic potential (EPSP), either alone (35 of 93 motoneurons) or followed by an inhibitory postsynaptic potential (39 of 93). The segmental delay of the early EPSPs was within the monosynaptic range (mean 0.85 ms); however, the rise time of these EPSPs was slow (mean 1.3 ms) and their amplitude was small (mean 0.74 mV). These values are significantly slower and smaller than EPSPs in a comparable sample of Old World macaque monkey motoneurons. The results show that CM connections do exist in the squirrel monkey but that they are weak and possibly located on the remote dendrites of the motoneurons. The findings are consistent with earlier anatomic studies. Repetitive PT stimulation produced large, late EPSPs in some motoneurons, suggesting that, in this species, there are relatively strong nonmonosynaptic pathways linking the corticospinal tract to hand motoneurons.
33
Bunch, Brittany, Krithika N. Kodumudi, Jared Ehrhart, Matt Weitzman, Olivia MacIntosh, Kelly Sussman, and Soner Altiok. "Abstract 246: Application of the 3d fresh patient tumoroid platform 3d-explore to assess the immunomodulatory and phagocytic activity of the receptor tyrosine kinase inhibitor, Sunitinib." Cancer Research 82, no. 12_Supplement (June 15, 2022): 246. http://dx.doi.org/10.1158/1538-7445.am2022-246.
Full textAbstract:
Abstract Background: The receptor tyrosine kinase inhibitor (TKI) Sunitinib has proven useful in the treatment of a variety of tumors. Sunitinib has shown therapeutic activity in patients with metastatic renal cell carcinoma and currently represents a frontline therapy for this disease. The immune modulatory effect of Sunitinib on immune cells within the tumor microenvironment has been well documented. Here, we developed a novel 3D ex-vivo platform (3D-EXplore) using fresh patient tumor samples with intact stromal components and tumor immune microenvironment to assess the therapeutic efficacy of Sunitinib. Methods: All tumor samples were obtained with patient consent and relevant IRB approval. Unpropagated 3D tumoroids with intact TME measuring 150 µm in size were prepared from fresh tumor samples of renal cell carcinoma using a proprietary technology developed at Nilogen Oncosystems. Tumoroids prepared from each patient’s tumor sample were pooled to represent the tumor heterogeneity and treated ex vivo with Sunitinib for 48h to detect treatment-mediated changes in tumor immune cell composition including CD4 and CD8 T-cells, NK cells, and macrophages. Additionally, we analyzed treatment-mediated changes in T-cell activation and phagocytic activity of myeloid cells. Results: Multiparameter flow analysis revealed that Sunitinib treatment led to an increase in CD8+CD25+ central memory-like phenotype and increased granzyme B expression in CD4 and CD8+ T cells indicating T cell activation. Furthermore, multiparameter flow cytometry analysis showed increased EdU uptake by CD8 and NK cells with sunitinib treatment, while cytokine release assays demonstrated increased IFN-γ and IL-2 production accompanied by downregulation of IL-10 and IL-6 cytokines. We observed Sunitinib mediated phagocytotic activity by tumor resident myeloid macrophages, monocytes, and dendritic cells using a quantitative phagocytosis assay. Conclusions: These results demonstrate that 3D-EXplore using fresh tumor samples provides a clinically relevant platform to assess drug response and serves as a critical tool for reflecting the true intact tumor microenvironment for novel immune-oncology drug development. Citation Format: Brittany Bunch, Krithika N. Kodumudi, Jared Ehrhart, Matt Weitzman, Olivia MacIntosh, Kelly Sussman, Soner Altiok. Application of the 3d fresh patient tumoroid platform 3d-explore to assess the immunomodulatory and phagocytic activity of the receptor tyrosine kinase inhibitor, Sunitinib [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 246.
34
Rohlff, Christian, Solmaz Sahebjam, Alain Mita, Rosen Lee, Chander Sekhar Peddaboina, Arnima Bisht, Lindsey Hudson, Wolf Fridman, Abderrahim Fandi, and Olivier Rixe. "Abstract 1975: Potential novel Immuno-oncology mechanism revealed during translational phase I Immuno-blood profiling of experimental ADC medicine OBT076 in a gastric cancer patient." Cancer Research 82, no. 12_Supplement (June 15, 2022): 1975. http://dx.doi.org/10.1158/1538-7445.am2022-1975.
Full textAbstract:
Abstract CD205 is a type I transmembrane glycoprotein, with unique characteristics that make it an ideal target for Antibody Drug Conjugate (ADC) therapy. Here we report on a potential novel immuno-oncology mechanism revealed during the Translational Phase I (NCT04064359) immuno-blood profiling of a chemo-refractory patient treated with OBT076, an experimental CD205-directed ADC. A chemo-refractory advanced gastric cancer patient with 60% CD205 expression in the primary tumor via IHC and having previously undergone 2 lines of chemotherapy treatment (Docetaxel/cisplatin/5FU and Ramucirumab/Paclitaxel), received five 21-day cycles of OBT076 (one at 2.5mg/kg and four cycles at 2.0 mg/kg) followed by 1 cycle of Pembrolizumab (PZ; 200mg) ~4 weeks later. Clinical response was evaluated and immunological markers (CD45, CD205, CD4, CD8, and PD1) in peripheral blood cells were quantified using flow cytometry. After 2 OBT076 cycles at 2.0 mg/kg, there was an ~40% shrinkage in the primary gastric tumor size and resolution of ascites and lymph node metastases were observed. Following 2 further cycles and PZ, complete response was achieved for the primary tumor. Flow cytometry showed (1) an initial decrease in the absolute numbers of dendritic cells by day 8, followed by a 2-fold increase in numbers by day 21 after treatment; (2) a near total decrease in the population of CD8+ CD205+ cells by day 8, no recovery in levels were observed; (3) a 3-fold increase in CD4+ and CD8+ T-cell numbers between days 8 and 21 and (4) an initial decrease in CD4+ PD1+ and CD8+ PD1+ T-cell numbers followed by an ~4-fold increase between days 8 and 21. In summary our results show that increases in PD1+ T-cells, T-cell induction, and decreases in immuno-suppressive CD4+ CD205+ and CD8+ CD205+ cells occur simultaneously; coinciding with rapid resolution of the primary tumor, lymph node metastases and ascites. These findings suggest that OBT076 activates the patient’s immune response against the tumor through a potentially novel mechanism: drug-induced depletion of CD8+ CD205+ immuno-suppressive cells and subsequent T-cell activation. Additionally, our data support the use of immune checkpoint inhibitors in conjunction with OBT076 to achieve favorable clinical outcomes. Citation Format: Christian Rohlff, Solmaz Sahebjam, Alain Mita, Rosen Lee, Chander Sekhar Peddaboina, Arnima Bisht, Lindsey Hudson, Wolf Fridman, Abderrahim Fandi, Olivier Rixe. Potential novel Immuno-oncology mechanism revealed during translational phase I Immuno-blood profiling of experimental ADC medicine OBT076 in a gastric cancer patient [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 1975.
35
Fischl, Matthew J., R. Michael Burger, Myriam Schmidt-Pauly, Olga Alexandrova, James L. Sinclair, Benedikt Grothe, Ian D. Forsythe, and Conny Kopp-Scheinpflug. "Physiology and anatomy of neurons in the medial superior olive of the mouse." Journal of Neurophysiology 116, no. 6 (December 1, 2016): 2676–88. http://dx.doi.org/10.1152/jn.00523.2016.
Full textAbstract:
In mammals with good low-frequency hearing, the medial superior olive (MSO) computes sound location by comparing differences in the arrival time of a sound at each ear, called interaural time disparities (ITDs). Low-frequency sounds are not reflected by the head, and therefore level differences and spectral cues are minimal or absent, leaving ITDs as the only cue for sound localization. Although mammals with high-frequency hearing and small heads (e.g., bats, mice) barely experience ITDs, the MSO is still present in these animals. Yet, aside from studies in specialized bats, in which the MSO appears to serve functions other than ITD processing, it has not been studied in small mammals that do not hear low frequencies. Here we describe neurons in the mouse brain stem that share prominent anatomical, morphological, and physiological properties with the MSO in species known to use ITDs for sound localization. However, these neurons also deviate in some important aspects from the typical MSO, including a less refined arrangement of cell bodies, dendrites, and synaptic inputs. In vitro, the vast majority of neurons exhibited a single, onset action potential in response to suprathreshold depolarization. This spiking pattern is typical of MSO neurons in other species and is generated from a complement of Kv1, Kv3, and IH currents. In vivo, mouse MSO neurons show bilateral excitatory and inhibitory tuning as well as an improvement in temporal acuity of spiking during bilateral acoustic stimulation. The combination of classical MSO features like those observed in gerbils with more unique features similar to those observed in bats and opossums make the mouse MSO an interesting model for exploiting genetic tools to test hypotheses about the molecular mechanisms and evolution of ITD processing.
36
Namsi, Amira, Thomas Nury, Haithem Hamdouni, Aline Yammine, Anne Vejux, Dominique Vervandier-Fasseur, Norbert Latruffe, Olfa Masmoudi-Kouki, and Gérard Lizard. "Induction of Neuronal Differentiation of Murine N2a Cells by Two Polyphenols Present in the Mediterranean Diet Mimicking Neurotrophins Activities: Resveratrol and Apigenin." Diseases 6, no. 3 (July 22, 2018): 67. http://dx.doi.org/10.3390/diseases6030067.
Full textAbstract:
In the prevention of neurodegeneration associated with aging and neurodegenerative diseases (Alzheimer’s disease, Parkinson’s disease), neuronal differentiation is of interest. In this context, neurotrophic factors are a family of peptides capable of promoting the growth, survival, and/or differentiation of both developing and immature neurons. In contrast to these peptidyl compounds, polyphenols are not degraded in the intestinal tract and are able to cross the blood–brain barrier. Consequently, they could potentially be used as therapeutic agents in neurodegenerative pathologies associated with neuronal loss, thus requiring the stimulation of neurogenesis. We therefore studied the ability to induce neuronal differentiation of two major polyphenols present in the Mediterranean diet: resveratrol (RSV), a major compound found in grapes and red wine, and apigenin (API), present in parsley, rosemary, olive oil, and honey. The effects of these compounds (RSV and API: 6.25–50 µM) were studied on murine neuro-2a (N2a) cells after 48 h of treatment without or with 10% fetal bovine serum (FBS). Retinoic acid (RA: 6.25–50 µM) was used as positive control. Neuronal differentiation was morphologically evaluated through the presence of dendrites and axons. Cell growth was determined by cell counting and cell viability by staining with fluorescein diacetate (FDA). Neuronal differentiation was more efficient in the absence of serum than with 10% FBS or 10% delipidized FBS. At concentrations inducing neuronal differentiation, no or slight cytotoxicity was observed with RSV and API, whereas RA was cytotoxic. Without FBS, RSV and API, as well as RA, trigger the neuronal differentiation of N2a cells via signaling pathways simultaneously involving protein kinase A (PKA)/phospholipase C (PLC)/protein kinase C (PKC) and MEK/ERK. With 10% FBS, RSV and RA induce neuronal differentiation via PLC/PKC and PKA/PLC/PKC, respectively. With 10% FBS, PKA and PLC/PKC as well as MEK/ERK signaling pathways were not activated in API-induced neuronal differentiation. In addition, the differentiating effects of RSV and API were not inhibited by cyclo[DLeu5] OP, an antagonist of octadecaneuropeptide (ODN) which is a neurotrophic factor. Moreover, RSV and API do not stimulate the expression of the diazepam-binding inhibitor (DBI), the precursor of ODN. Thus, RSV and API are able to induce neuronal differentiation, ODN and its receptor are not involved in this process, and the activation of the (PLC/PKC) signaling pathway is required, except with apigenin in the presence of 10% FBS. These data show that RSV and API are able to induce neuronal differentiation and therefore mimic neurotrophin activity. Thus, RSV and API could be of interest in regenerative medicine to favor neurogenesis.
37
Zhou, Yanlong, Nicolas Emery, Jean-Pierre Pereira-Ramos, Oliver Nguyen, and Rita Baddour-Hadjean. "(Digital Presentation) Lithium Transition Metal Nitride Li7MnN4 (LMN) As Competitive Negative Electrode Material for Li-Ion Battery: Synthesis Optimization and High Energy Density of the NMC/Li5.3MnN4 Full Cell." ECS Meeting Abstracts MA2022-01, no. 2 (July 7, 2022): 363. http://dx.doi.org/10.1149/ma2022-012363mtgabs.
Full textAbstract:
Li-on battery (LIB) is an important technology which is widely used in portable electronic devices, electric vehicles (EV) and other energy storage applications. Commercial LIB has multiple choices as positive electrode materials such as layered transition metal oxides (LiCoO2, LiNi1-y-zMnyCozO2...), spinel oxides LiNixMn2-xO4 as well as olivine LiFePO4. Conversely, the selection of negative electrodes is mainly limited to graphite or Li4Ti5O12 (LTO). Graphite is inexpensive and delivers large capacity but suffers from the formation of solid electrolyte interphase (SEI) as well as Li dendrites formed at high rate, leading to low rate capability and security problems [1]. Li4Ti5O12 (LTO) on the other hand, is able to circumvent the problems of graphite thanks to its higher working potential (1.5 V vs Li+/Li) and minimal structural change during lithiation [2]. However, LTO has a lower energy density than graphite due to a higher working potential and a moderate specific capacity (∼150 mAh g− 1 and 120 mAh g− 1 at 1C and 5C rate, respectively). Therefore, there is a strong need of researching large-capacity insertion-based negative electrode materials working in the 1.0 < V ≤ 1.5 V voltage range to design new generation high energy density full cells. Transition-metal nitrides are considered to be among the most promising class of anode materials for LiBs [3]. Within this family, Li7MnN4 (LMN) [4] with an anti-fluorite 3D structure has received great attention due to its large specific capacity of 280 mAh g-1, excellent cycle stability and appropriate working potential of 1.2 V. We previously showed this material prepared at high temperature exhibits very large particle size [4]. Therefore, a crucial post-synthesis ball-milling step was required to benefit from the maximum capacity and high rate capability. However, this ball-milling step is hard to reproduce due to its dependence on many instrumental factors such as jar geometry, ball/material mass ratio [4]. In this work, an optimization of the synthesis conditions of LMN is proposed and new key parameters controlling the particle size distribution (PSD) are identified, allowing the suppression of the post-synthesis ball-milling process. Thanks to the specific morphology attained when using our optimized synthesis conditions, the as-synthesized LMN material is able to deliver larger capacity at higher rate (265 mAh g− 1 and 160 mAh g− 1 at 1C and 5C rate, respectively). These capacity values are the best to our knowledge and compete with that of benchmark LTO. Furthermore, the lower working potential of LMN (1.2 V, i. e. 0.35 V lower than LTO) is expected to provide larger energy density in a full cell device compared to LTO. To carry this argument further, NMC/LMN full cell is constructed for the first time with LiNi0.6Mn0.2Co0.2O2 and pre-delithiated LMN (Li5.3MnN4). This NMC/LMN coin cell is applied for galvanostatic cycling at different current densities while a 3-electrode cell using metallic Li as reference electrode is used to clarify potential changes during the charge-discharge process. We show the NMC/LMN full cell replicates the electrochemical performance of NMC/Li half-cell in the 3.2 V - 2 V potential window. These results prove the feasibility and compatibility of the NMC/LMN full cell and the suitability of delithiated LMN as negative electrode material. Remarkably, the maximum energy density of the NMC/LMN full cell, of 256 Wh/kg(based on total active materials mass loading), is 30% to 50% higher than that exhibited by a NMC/LTO full cell. [1] T. Waldmann, B. I. Hogg, and M. Wohlfahrt-Mehrens, “Li plating as unwanted side reaction in commercial Li-ion cells – A review,” J. Power Sources, vol. 384, no. November 2017, pp. 107–124, 2018. [2] T. Ohzuku, A. Ueda, and N. Yamamoto, “Zero‐Strain Insertion Material of Li [ Li1 / 3Ti5 / 3 ] O 4 for Rechargeable Lithium Cells,” J. Electrochem. Soc., vol. 142, no. 5, pp. 1431–1435, 1995. [3] J. M. Tarascon and M. Armand, “Issues and challenges facing rechargeable lithium batteries,” Mater. Sustain. Energy A Collect. Peer-Reviewed Res. Rev. Artic. from Nat. Publ. Gr., vol. 414, no. November, pp. 171–179, 2010. [4] E. Panabière, N. Emery, S. Bach, J. P. Pereira-Ramos, and P. Willmann, “Ball-milled Li7MnN4: An attractive negative electrode material for lithium-ion batteries,” Electrochim. Acta, vol. 97, pp. 393–397, 2013. Figure 1
38
Trivedi, R. S., J. G. Hampton, J. M. Townshend, M. V. Jaspers, and H. J. Ridgway. "First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand." Plant Disease 94, no. 9 (September 2010): 1168. http://dx.doi.org/10.1094/pdis-94-9-1168c.
Full textAbstract:
Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.
39
Salas, Pablo, Philipp Ruprecht, Laura Hernández, and Osvaldo Rabbia. "Out-of-sequence skeletal growth causing oscillatory zoning in arc olivines." Nature Communications 12, no. 1 (July 1, 2021). http://dx.doi.org/10.1038/s41467-021-24275-6.
Full textAbstract:
AbstractPrimitive olivines from the monogenetic cones Los Hornitos, Central-South Andes, preserve dendritic, skeletal, and polyhedral growth textures. Consecutive stages of textural maturation occur along compositional gradients where high Fo–Ni cores of polyhedral olivines (Fo92.5, Ni ~3500 ppm) contrast with the composition of dendritic olivines (Fo < 91.5, Ni < 3000 ppm), indicating sequential nucleation. Here we present a new growth model for oscillatory Fo–Ni olivine zoning that contrasts with the standard interpretation of continuous, sequential core-to-rim growth. Olivine grows rapidly via concentric addition of open-structured crystal frames, leaving behind compositional boundary layers that subsequently fill-in with Fo–Ni-depleted olivine, causing reversals. Elemental diffusion modeling reveals growth of individual crystal frames and eruption at the surface occurred over 3.5–40 days. Those timescales constrain magma ascent rates of 40–500 m/h (0.011 to 0.14 m/s) from the deep crust. Compared to ocean island basalts, where dendritic and skeletal olivines have been often described, magmas erupted at arc settings, experiencing storage and degassing, may lack such textures due to fundamentally different ascent histories.
40
Beno, Carl J., John R. Bowman, Patrick C. Loury, Lorraine M. Tapanila, and Diego P. Fernandez. "Evidence for dendritic crystallization of forsterite olivine during contact metamorphism of siliceous dolostones, Alta stock aureole, Utah." Contributions to Mineralogy and Petrology 175, no. 10 (September 14, 2020). http://dx.doi.org/10.1007/s00410-020-01734-9.
Full text
41
Nozaki, Tatsuo, Junichiro Ohta, Takaaki Noguchi, Honami Sato, Akira Ishikawa, Yutaro Takaya, Jun-Ichi Kimura, et al. "A Miocene impact ejecta layer in the pelagic Pacific Ocean." Scientific Reports 9, no. 1 (November 20, 2019). http://dx.doi.org/10.1038/s41598-019-52709-1.
Full textAbstract:
AbstractMeteorite impacts have caused catastrophic perturbations to the global environment and mass extinctions throughout the Earth’s history. Here, we present petrographic and geochemical evidence of a possible impact ejecta layer, dating from about 11 Ma, in deep-sea clayey sediment in the Northwest Pacific. This clay layer has high platinum group element (PGE) concentrations and features a conspicuous negative Os isotope anomaly (187Os/188Os as low as ~0.2), indicating an influx of extraterrestrial material. It also contains abundant spherules that include pseudomorphs suggestive of porphyritic olivine as well as spinel grains with euhedral, dendritic and spherical forms and NiO contents as great as 23.3 wt%, consistent with impact ejecta. Osmium isotope stratigraphy suggests a most plausible depositional age of ~11 Ma (Miocene) for this layer, as determined by fitting with the seawater evolution curve. No large impact crater of this age is known on land, even within the relatively large uncertainty range of the relative Os age. Thus, we suggest that an unrecognised impact event in the middle or late Miocene produced the impact ejecta layer of the Northwest Pacific.
42
Wieser, Penny E., Marie Edmonds, John Maclennan, and John Wheeler. "Microstructural constraints on magmatic mushes under Kīlauea Volcano, Hawaiʻi." Nature Communications 11, no. 1 (January 7, 2020). http://dx.doi.org/10.1038/s41467-019-13635-y.
Full textAbstract:
AbstractDistorted olivines of enigmatic origin are ubiquitous in erupted products from a wide range of volcanic systems (e.g., Hawaiʻi, Iceland, Andes). Investigation of these features at Kīlauea Volcano, Hawaiʻi, using an integrative crystallographic and chemical approach places quantitative constraints on mush pile thicknesses. Electron backscatter diffraction (EBSD) reveals that the microstructural features of distorted olivines, whose chemical composition is distinct from undistorted olivines, are remarkably similar to olivines within deformed mantle peridotites, but inconsistent with an origin from dendritic growth. This, alongside the spatial distribution of distorted grains and the absence of adcumulate textures, suggests that olivines were deformed within melt-rich mush piles accumulating within the summit reservoir. Quantitative analysis of subgrain geometry reveals that olivines experienced differential stresses of ∼3–12 MPa, consistent with their storage in mush piles with thicknesses of a few hundred metres. Overall, our microstructural analysis of erupted crystals provides novel insights into mush-rich magmatic systems.
43
Voogd, Jan. "The Theories of Gerbrandus Jelgersma (1859–1942) on the Function of the Cerebellum." Cerebellum, August 12, 2021. http://dx.doi.org/10.1007/s12311-021-01273-4.
Full textAbstract:
AbstractGerbrandus Jelgersma published extensively on the (pathological) anatomy of the cerebellum between 1886 and 1934. Based on his observations on the double innervation of the Purkinje cells, he formulated a hypothesis on the function of the cerebellum. Both afferent systems of the cerebellum, the mossy fiber-parallel fiber system and the climbing fibers terminate on the Purkinje cell dendrites. According to Jelgersma, the mossy fiber-parallel fiber system is derived from the pontine nuclei and the inferior olive, and would transmit the movement images derived from the cerebral cortex. Spinocerebellar climbing fibers would transmit information about the execution of the movement. When the Purkinje cell compares these inputs and notices a difference between instruction and execution, it sends a correction through the descending limb of the superior cerebellar peduncle to the anterior horn cells. Jelgersma postulates that this cerebro-cerebellar coordination system shares plasticity with other nervous connections because nerve cell dendritic protrusions possess what he called amoeboid mobility: dendritic protrusions can be extended or retracted and are so able to create new connections or to abolish them. Jelgersma’s theories are discussed against the background of more recent theories of cerebellar function that, similarly, are based on the double innervation of the Purkinje cells. The amoeboid hypothesis is traced to its roots in the late nineteenth century.
44
Williams, Isabella R., Anastasia Filimontseva, Catherine J. Connelly, and David K. Ryugo. "The lateral superior olive in the mouse: Two systems of projecting neurons." Frontiers in Neural Circuits 16 (October 20, 2022). http://dx.doi.org/10.3389/fncir.2022.1038500.
Full textAbstract:
The lateral superior olive (LSO) is a key structure in the central auditory system of mammals that exerts efferent control on cochlear sensitivity and is involved in the processing of binaural level differences for sound localization. Understanding how the LSO contributes to these processes requires knowledge about the resident cells and their connections with other auditory structures. We used standard histological stains and retrograde tracer injections into the inferior colliculus (IC) and cochlea in order to characterize two basic groups of neurons: (1) Principal and periolivary (PO) neurons have projections to the IC as part of the ascending auditory pathway; and (2) lateral olivocochlear (LOC) intrinsic and shell efferents have descending projections to the cochlea. Principal and intrinsic neurons are intermixed within the LSO, exhibit fusiform somata, and have disk-shaped dendritic arborizations. The principal neurons have bilateral, symmetric, and tonotopic projections to the IC. The intrinsic efferents have strictly ipsilateral projections, known to be tonotopic from previous publications. PO and shell neurons represent much smaller populations (<10% of principal and intrinsic neurons, respectively), have multipolar somata, reside outside the LSO, and have non-topographic, bilateral projections. PO and shell neurons appear to have widespread projections to their targets that imply a more diffuse modulatory function. The somata and dendrites of principal and intrinsic neurons form a laminar matrix within the LSO and share quantifiably similar alignment to the tonotopic axis. Their restricted projections emphasize the importance of frequency in binaural processing and efferent control for auditory perception. This study addressed and expanded on previous findings of cell types, circuit laterality, and projection tonotopy in the LSO of the mouse.