Academic literature on the topic 'Citrus'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the lists of relevant articles, books, theses, conference reports, and other scholarly sources on the topic 'Citrus.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Journal articles on the topic "Citrus"
1
Sulaymonov, Otabek Abdushukurovich, Guzal Tulaganovna Dusmurodova, and Bekzod Bekmurod Ugli Sobirov. "STUDYING THE EFFICACY OF ALLCHUNGKILL CYC.K. AGAINST CITRUS CITRUS WHITEFLY (DIALEURODES CITRI ASHM.) IN CULTURE LEMON." American Journal of Agriculture and Biomedical Engineering 04, no. 05 (May 1, 2022): 22–25. http://dx.doi.org/10.37547/tajabe/volume04issue05-07.
Full textAbstract:
This article provides data on the harmfulness, distribution and lifestyle of citrus citrus whitefly , which in recent years has been a harmful object in our republic. In order to determine the effectiveness of insecticides against citrus citrus The whitefly first introduced observational work based on lemon pheromones . On this basis, in three variants, tests were carried out on Allchungkill preparations. cyc .to . 0.35 - 0.4 l / ha . , (reference) Emaben, 5% SDG . 0.4 kg/ha. The highest efficiency was observed in the variant where Allchungkill was used. cyc .to . 0.35 - 0.4 l / ha . In this variant, the efficiency was 7-day 86.1-87.7% .
2
Applequist, Wendy. "Citrus. The Genus Citrus." Economic Botany 58, no. 4 (December 2004): 749. http://dx.doi.org/10.1663/0013-0001(2004)058[0749:bredfa]2.0.co;2.
Full text
3
Brandão, Henrique Cardoso Batista, Ana Laura Santos Anjos, Cristiane de Jesus Barbosa, Walter dos Santos Soares Filho, and Alessandra Selbach Schnadelbach. "Porta-enxertos híbridos de citros tolerantes ao Citrus tristeza vírus (CTV) / Hybrid Citrus Rootstocks Tolerant to Citrus Tristeza Virus (CTV)." Brazilian Journal of Animal and Environmental Research 4, no. 2 (June 25, 2021): 2714–16. http://dx.doi.org/10.34188/bjaerv4n2-093.
Full textAbstract:
A citricultura brasileira lidera o mercado de exportação mundial. A tristeza dos citros é uma doença endêmica causada pelo Citrus tristeza virus (CTV), que é transmitido pelo pulgão preto dos citros, Toxoptera citricida (Kirkaldy). O controle da tristeza é feito, principalmente, pela utilização de porta-enxertos tolerantes ao CTV. Este trabalho teve como objetivo avaliar o comportamento de 50 híbridos de porta-enxerto de citros, gerados pelo Programa de Melhoramento Genético de Citros da Embrapa Mandioca e Fruticultura, quanto à infecção natural pelo CTV. Amostras de cada híbrido foram coletadas no campo experimental e casas teladas da Embrapa em Cruz das Almas. A mostra estava composta por 10 ramos novos, coletados em diferentes quadrantes da planta, que foram avaliados quanto à presença de caneluras por escala de notas: 1. Ausência de caneluras; 2. Presença de caneluras esparsas; 3. Número intermediário de caneluras; 4. Várias caneluras superficiais ou poucas caneluras profundas; 5. Toda a superfície do ramo coberta por caneluras superficiais ou profundas. A avaliação da infecção pelo CTV foi realizada no Laboratório de Biologia Molecular do Campo Avançado da Embrapa no CETAB/Seagri-BA. As amostras inicialmente foram avaliadas por sorologia, utilizando a técnica de ELISA indireto, com antissoro policlonal contra o CTV. Entretanto, as amostras que apresentaram resultados negativos no teste sorológico, foram também avaliadas por RT-PCR. Para tanto, foi realizada a extração de dsRNA a partir da casca de ramos de cada amostra. A extração de dsRNA foi feita com nitrogênio líquido e o precipitado final foi ressuspendindo em 50ul de água livre de RNAse, tratados com DNAse (Promega®). Na reação de transcrição reversa (RT) foi utilizada a enzima M-MLV (Promega®), de acordo com as recomendações do fabricante. Utilizou-se nessa etapa 5ul do dsRNA obtido, primer randômico (250ng/ul), dNTP (10mM), tampão M-MLV, RNase out e M- MLV, totalizando um volume de 25ul. Para PCR, utilizou-se 3ul do DNA obtido na RT, dNTP (2,5mM), tampão Tris/KCl (10x), MgCl2 (50mM), Taq polimerase (5U/ul) e os primers específicos para o CTV F- CN119 (5’ AGATCTACCATGGACGACGAAACAAAG3’) e R-CN120 (5’ GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC 3’), para um volume final de 25ul. O ciclo de reação adotado foi de 94°C/2min, 55°C/30seg e 72°C/1min, respectivamente. A maioria dos híbridos avaliados foi suscetível ao CTV, mas não desenvolveram os sintomas de canelura, sendo considerados tolerantes ao patógeno. Significado e impacto do trabalho: Apesar de atualmente controlada, a tristeza dos citros constitui ainda uma ameaça aos produtores de citros, já que é endêmica no Brasil. Diante desse fato, a avaliação do comportamento de híbridos gerados pelo Programa de Melhoramento Genético de Citros da Embrapa em relação ao CTV, é uma etapa determinante na seleção de novas variedades.
4
Nafisah, Sarah Nur, Suharno Suharno, and Netti Tinaprilla. "SIKAP DAN PERSEPSI KONSUMEN TERHADAP JERUK LOKAL DAN JERUK IMPOR DI PASAR MODERN KOTA BOGOR." Forum Agribisnis 4, no. 1 (March 1, 2014): 71–84. http://dx.doi.org/10.29244/fagb.4.1.71-84.
Full textAbstract:
The trends within citrus consumption have shifted from consumption of local citrus to the imported citrus. The present research investigates th econsumer characteristics of citrus, the consumer purchasing decision process, and consumer attitude and perception towards local citruss and imported citruss. Adopting purposive sampling technique, 100 respondents were chosen among the population of citrus consumers in modern market in Bogor. The data was analyzed with descriptive analysis, multi attribute Fishbein model, and perceptual mapping. The results showed that the majority of consumers were productive age female ranging from 27 to 34 years, married, bachelor degree, housewife with 3-4 family members, and with more than Rp 4.000.000 income per month. For both citrus, taste and freshness are the most important attributes Local citrus’s attributes such as taste, size, juicy, availability, appearance, freshness, the level of maturity, and the texture of pulp, were believed as a good attribute. Meanwhile for imported citrus, the juicyness, appearance, freshness, the level of maturity, the texture of pulp,andthesalespromotion, were believedto be agoodattribute. The price of bothlocal citrus and imported citruswas not believed as a good attribute. The score of consumer attitude and perception toward local citrus were higher than that of imported citrus. This shows that generally the local citrus’ attribute in modern market Bogor City was perceived as good by the consumers. Due to that the local citrus agribusiness actors needs to maintain and improve the performance of local citrus’attribute in such a way that the consumer prefer local citrus than imported citrus.
5
Burrow, Jamie D., and Ariel Singerman. "Children's Citrus Activity: Citrus Counting." EDIS 2019, no. 4 (July 22, 2019): 1. http://dx.doi.org/10.32473/edis-4h402-2019.
Full textAbstract:
Florida is well known for its citrus industry, valued at over eight billion dollars, and is one of the top citrus-producing states in the United States. This new one-page children’s activity sheet about Florida citrus includes an activity for students learning to count and match. Written by Jamie D. Burrow and Ariel Singerman and published by the UF/IFAS Extension 4-H Youth Development Program. https://edis.ifas.ufl.edu/4h402
6
Ozaki, Yoshihiko, Masaki Miyake, Hisao Maeda, Yasushi Ifuku, Raymond D. Bennett, Zareb Herman, Chi H. Fong, and Shin Hasegawa. "Ichangensin glucoside in Citrus junos, Citrus sudachi and Citrus sphaerocarpa." Phytochemistry 30, no. 8 (January 1991): 2659–61. http://dx.doi.org/10.1016/0031-9422(91)85118-j.
Full text
7
Ifmalinda, Ifmalinda, Khandra Fahmy, and Elsa Fitria. "Prediction of Siam Gunung Omeh Citrus Fruit (Citrus Nobilis Var Microcarpa) Maturity Using Image Processing." Jurnal Keteknikan Pertanian 6, no. 3 (December 1, 2018): 335–42. http://dx.doi.org/10.19028/jtep.06.3.335-342.
Full text
8
E.B. "Citrus." Encyclopédie berbère, no. 13 (February 1, 1994): 2027–28. http://dx.doi.org/10.4000/encyclopedieberbere.2311.
Full text
9
Kender, Walter J. "Citrus." HortScience 38, no. 5 (August 2003): 1043–47. http://dx.doi.org/10.21273/hortsci.38.5.1043.
Full text
10
Bower, J. P. "Citrus." Scientia Horticulturae 62, no. 1-2 (April 1995): 147–48. http://dx.doi.org/10.1016/0304-4238(95)90014-4.
Full textDissertations / Theses on the topic "Citrus"
1
Silva, Michele Regina Lopes da. "Controle de Xanthomonas citri subsp. citri em citros (Citrus sinensis) mediado por neonicotinóides." Universidade Estadual de Londrina. Centro de Ciências Agrárias. Programa de Pós-Graduação em Agronomia, 2009. http://www.bibliotecadigital.uel.br/document/?code=vtls000149498.
Full textAbstract:
O cancro cítrico é uma doença de importância mundial para o cultivo comercial de citros. O desenvolvimento de medidas alternativas de controle que contribuam para o manejo da doença é de grande importância. O presente estudo teve como objetivo verificar se o tratamento de plantas cítricas com inseticidas neonicotinóides é capaz de controlar a incidência de cancro cítrico na planta, assim como, verificar se as plantas cítricas apresentam diferenças no vigor em decorrência do tratamento com estes produtos. A atividade antimicrobiana de acetamipride, imidaclopride (IMI) e tiametoxam (TMX) foi testada in vitro com seis isolados de Xanthomonas citri subsp. citri (Xcc). Alíquotas das suspensões bacterianas (108 UFC/ml) foram depositadas em meio Agar Nutriente acrescido dos produtos nas concentrações de 0 a 3000 µg/ml de princípio ativo (p.a.). Em casa-de-vegetação, plantas de laranja Valência foram tratadas com quatro doses de IMI, por rega no solo, em intervalos de tempo variando entre 0 e 10 dias, entre a inoculação de Xcc, por infiltração com seringa, e o tratamento com o neonicotinóide. Plantas controle foram tratadas com água e inoculadas com a bactéria. Foi avaliada a incidência por contagem de lesões de cancro cítrico por cm2 de área foliar, a dinâmica populacional da bactéria por reisolamento e o teor de macronutrientes e micronutrientes das plantas tratadas e inoculadas. A campo, foram conduzidos experimentos nos municípios de Paranavaí e São João do Caiuá, PR, em plantas de laranja Natal (quatro meses) e Valência (oito meses), respectivamente. As plantas foram tratadas com cinco doses de IMI no tronco ou no solo, e uma dose de TMX e de clotianidina no solo. Plantas controle foram tratadas com água. Foram avaliadas bimestralmente as incidências de cancro cítrico, de larva minadora dos citros (LMC) e a desfolha. O vigor vegetativo foi avaliado pelo volume de copa, pelo diâmetro de caule e pela altura de planta. Os neonicotinóides não apresentaram efeito antimicrobiano contra nenhum isolado de Xcc in vitro. O tratamento das plantas com IMI, além de reduzir o número de lesões de cancro cítrico e a população bacteriana na planta, alterou as características dessas lesões, independente da dose, época do ano ou do intervalo de tempo entre o tratamento da planta e a inoculação com Xcc. De maneira geral, nos experimentos a campo, foi constatada diminuição de desfolha e das incidências de cancro cítrico e de LMC para todos os neonicotinóides testados, destacando-se a menor dose de IMI aplicada no tronco da planta e a maior dose de IMI aplicada no solo. Os neonicotinóides testados reduziram a incidência de cancro cítrico, aumentaram os teores de N e K nas folhas e o vigor vegetativo das plantas cítricas. Assim, os neonicotinóides podem ser considerados no manejo do cancro cítrico, não somente por sua ação inseticida, mas também como bioativadores das plantas cítricas.Citrus canker is a disease of global importance for citrus production. The development of alternative measures to control the disease is of great importance. This study aimed to determine if the aplication of neonicotinoid insecticides on citrus plants is capable to control the incidence of citrus canker by induced resistance, as well as to verify if citrus plants differ in vigor due to the treatment with these products. The antimicrobial activity of acetamiprid, imidacloprid (IMI) and thiamethoxan (TMX) was tested in vitro against six isolates of Xanthomonas citri subsp. citri (Xcc). Aliquots of bacterial suspensions (108 CFU / ml) were placed on nutrient agar medium containing the neonicotinoids in concentrations from 0 to 3000 µg/ml of active ingrediente (a.i). In greenhouse, plants of Valencia orange were treated with four doses of IMI by soil drench. Intervals of time ranging from 0 and 10 days, between the inoculation of Xcc by syringe infiltration and treatment with the neonicotinoid were tested. Check plants were treated with water and inoculated with the bacteria. The plants were evaluated by counting the incidence of citrus canker lesions per cm2 of leaf area, the population dynamics of bacteria by reisolations, and macronutrient and micronutrient content of the inoculated and treated plants. Field experiments were carried out in the counties of Paranavaí and São João do Caiuá, PR, on four months old Natal orange plants and eight months old Valencia orange plants, respectively. The plants were treated with five doses of IMI in the trunk or by soil drench. Doses of TMX and clothianidin by soil drench. Check plants were treated with water. The plants were evaluated every two months by determining the incidence of citrus canker, defoliation and citrus leafminer (CLM) incidence. The vigor of the plants was assessed by the volume of canopy, trunk diameter and plant height. The neonicotinoids showed no antimicrobial effect against the strain of Xcc in vitro. The treatment of plants with IMI in addition to reducing the number of lesions of citrus canker and bacterial population in the plant, also changed the characteristics of these injuries, regardless of dose, time of the year or interval between treatment and inoculation of plants with Xcc. In general, experiments in the field showed decrease in the incidence of citrus canker for all neonicotinoids tested, especially the lower dose of IMI applied in the trunk of the plants and the highest dose of IMI by soil drench. The neonicotinoids tested reduced the incidence of citrus canker, increased the levels of N and K and the vigor of citrus plants. Thus the neonicotinoids may be considered in the management of citrus canker not only by its activity as insecticide to control CLM, but also by the bioactivity on citrus plants.
2
FitzGerald, Véronique Chartier. "Screening of entomopathogenic fungi against citrus mealybug (Planococcus citri (Risso)) and citrus thrips (Scirtothrips aurantii (Faure))." Thesis, Rhodes University, 2014. http://hdl.handle.net/10962/d1020887.
Full textAbstract:
Mealybugs (Planococcus citri) and thrips (Scirtothrips aurantii) are common and extremely damaging citrus crop pests which have proven difficult to control via conventional methods, such as chemical pesticides and insect growth regulators. The objective of this study was to determine the efficacy of entomopathogenic fungi against these pests in laboratory bioassays. Isolates of Metarhizium anisopliae and Beauveria bassiana from citrus orchards in the Eastern Cape, South Africa were maintained on Sabouraud Dextrose 4% Agar supplemented with Dodine, chloramphenicol and rifampicin at 25°C. Infectivity of the fungal isolates was initially assessed using 5th instar false codling moth, Thaumatotibia leucotreta, larvae. Mealybug bioassays were performed in 24 well plates using 1 x 107 ml-1 conidial suspensions and kept at 26°C for 5 days with a photoperiod of 12 L:12 D. A Beauveria commercial product and an un-inoculated control were also screened for comparison. Isolates GAR 17 B3 (B. bassiana) and FCM AR 23 B3 (M. anisopliae) both resulted in 67.5% mealybug crawler mortality and GB AR 23 13 3 (B. bassiana) resulted in 64% crawler mortality. These 3 isolates were further tested in dose-dependent assays. Probit analyses were conducted on the dose-dependent assays data using PROBAN to determine LC₅₀ values. For both the mealybug adult and crawlers FCM AR 23 B3 required the lowest concentration to achieve LC₅₀ at 4.96 x 10⁶ conidia ml-1 and 5.29 x 10⁵ conidia ml-1, respectively. Bioassays on adult thrips were conducted in munger cells with leaf buds inoculated with the conidial suspensions. Isolate GAR 17 B3 had the highest mortality rate at 70% on thrips while FCM AR 23 B3 resulted in 60% mortality. Identification of the isolates, FCM AR 23 B3, GAR 17 B3 and GB AR 23 13 3, were confirmed to be correct using both microscopic and molecularly techniques. ITS sequences were compared to other sequences from GenBank and confirmed phylogenetically using MEGA6. Mealybug infection was investigated using scanning electron microscopy, mycosis was confirmed but the infection process could not be followed due to the extensive waxy cuticle. These results indicate that there is potential for the isolates FCM AR 23 B3 and GAR 17 B3 to be developed as biological control agents for the control of citrus mealybug and thrips. Further research would be required to determine their ability to perform under field conditions.
3
Coqueiro, Danila Souza Oliveira 1984. "Expressão gênica diferencial induzida por eliciadores (quitosana e ácido salicílico) nos patossistemas citros-Xanthomonas citri subsp. citri e citros-Xylella fastidiosa = Differential gene expression induced by elicitors (chitosan and salicylic acid) in citrus-Xanthomonas citri subsp. citri and citrus-Xylella fastidiosa pathosystems." [s.n.], 2013. http://repositorio.unicamp.br/jspui/handle/REPOSIP/314472.
Full textAbstract:
Orientadores: Marcos Antonio Machado, Alessandra Alves de SouzaTese (doutorado) - Universidade Estadual de Campinas, Instituto de Biologia
Made available in DSpace on 2018-08-24T04:53:23Z (GMT). No. of bitstreams: 1 Coqueiro_DanilaSouzaOliveira_D.pdf: 3034667 bytes, checksum: 7ce135c75da10c6b26032ec285344dc5 (MD5) Previous issue date: 2013
Resumo: Avaliou-se as alterações transcricionais em laranja 'Pera' (Citrus sinensis L. Osb.) promovidas por quitosana (CHI) e ácido salicílico (SA), utilizando RNA-seq, e o efeito destes compostos no controle do cancro cítrico (Xanthomonas citri subsp. citri) e da clorose variegada dos citros (CVC - Xylella fastidiosa). As plantas foram tratadas com CHI ou SA e após 48h e 24h, respectivamente, foram coletadas amostras foliares para avaliar seus transcriptomas. Para a avaliação dos eliciadores sobre o cancro cítrico e a CVC, as plantas foram tratadas com CHI ou SA e após 48h e 24h, respectivamente, inoculadas com as duas bactérias separadamente. A partir de 24h da inoculação, foram coletadas amostras foliares para avaliar a curva de crescimento de ambas as bactérias, a redução da severidade e/ou incidência das doenças e respostas de defesa da planta por RT-qPCR. Com os resultados do transcriptoma, observou-se que mais genes foram induzidos pelo tratamento com SA do que com CHI. O tratamento com SA aumentou a expressão de genes que participam da via de sinalização do SA na planta (WRKY50, PR2 e PR-9) e genes da biossíntese do etileno e ácido jasmônico (ACS 12, fator de transcrição contendo domínio AP2 e OPR3). Além disso, promoveu a indução de genes relacionados ao metabolismo secundário, processos redox e estresse biótico. No tratamento com CHI, foi observada maior indução de genes relacionados ao metabolismo secundário. Para ambos os tratamentos, a via da auxina foi reprimida. No experimento para controle do cancro cítrico, observou-se que ambos os eliciadores promoveram reduções na severidade e incidência da doença. Entretanto, a CHI pareceu não interferir diretamente na formação do biofilme pela bactéria, mas pode ter dificultado a multiplicação de X. citri na planta. O SA retardou a entrada da bactéria na planta e, aparentemente, inibiu mais a formação do biofilme bacteriano do que a CHI. Comparações da expressão gênica entre os eliciadores reforçam a ideia de que a CHI tem maior potencial de induzir resistência ao cancro cítrico do que SA. No experimento para o controle da CVC, observou-se que a CHI induziu importantes genes da via do SA (NPR1, TGA, EDS1) e etileno (EIN-3, PR-4) 24h após a inoculação. Aplicações exógenas de SA potencializaram o seu efeito endógeno na planta, pois houve indução de NPR1, TGA e PRs. Entretanto, não foi possível estabelecer uma relação clara entre a multiplicação de X. fastidiosa, a incidência da doença e o uso da CHI e SA em laranja 'Pera', já que na maioria das avaliações não houve redução da população bacteriana em amostras foliares e não houve redução da incidência em plantas tratadas. Com base nos resultados, observou-se que CHI e SA induziram diversos genes envolvidos em respostas de defesa em laranja 'Pera'. Entretanto, essas respostas podem ser moduladas diferencialmente a depender do patógeno que afeta a planta, pois os eliciadores foram eficientes no controle da X. citri, um patógeno que coloniza o mesófilo da planta, entretanto não foram efetivos no controle da X. fastidiosa, um patógeno que coloniza o xilema da planta, embora respostas de defesa tenham sido expressas nos momentos iniciais (24h) após a inoculação com X. fastidiosa
Abstract: This study was carried out to evaluate transcriptional modification in sweet orange 'Pera' (Citrus sinensis L. Osb.), promoted by chitosan (CHI) and salicylic acid (SA), using RNA-seq, and the effect of these compounds on citrus canker (Xanthomonas citri subsp. citri) and citrus variegated chlorosis (CVC - Xylella fastidiosa). Plants were treated with CHI or SA and after 48h and 24h, respectively, leaf samples were collected to assess the transcriptome. In the experiments for disease assessment, the plants were treated with CHI or SA and after 48h and 24h, respectively, inoculated. Starting from 24h after inoculation, leaf samples were collected to evaluate the multiplication of the pathogens (X. citri and X. fastidiosa), reduction of the severity and / or incidence and plant defense responses by RT-qPCR. Based upon the transcriptome results, it was observed that more genes were induced by SA than by CHI. SA treatment increased the expression of genes that participate in the SA signaling pathway in the plant (WRKY50, PR2 and-PR9), and genes involved in the biosynthesis of ethylene and jasmonic acid (ACS 12, transcription factor containing AP2 and OPR3 domain). Besides these, SA promoted induction of genes of secondary metabolism, redox processes and biotic stress. The treatment with CHI exhibited higher induction of genes related to secondary metabolism. For both treatments, the auxin pathway was suppressed. In the experiment for the control of citrus canker, it was observed that both elicitors reduced the severity and incidence of the disease. However, CHI seems not to interfere directly in biofilm formation, but may have hindered the multiplication of X. citri in the plant. The SA slowed down the entry of the bacteria into the plant and, apparently, inhibited the formation of biofilm more efficiently than the CHI. Comparisons of gene expression between elicitors reinforce the idea that CHI has higher potential to induce resistance to citrus canker than SA. In the experiment for the control of CVC, it was observed that the CHI induced important genes of the SA (NPR1, TGA, EDS1) and ethylene (EIN-3, PR-4) pathways 24h after inoculation. Exogenous applications of SA potentiated its endogenous effect in the plant, since there was induction of EDS-1, NPR1, TGA and PRs. However, it was not possible to establish a clear relationship between the multiplication of X. fastidiosa, the incidence of the disease and the use of CHI and SA in 'Pera' sweet orange, since most of the assessments did not show reduction of bacterial populations in leaf samples and there was no reduction of the incidence in treated plants. Based upon the results of this study, it was observed that CHI and SA induced several genes involved in defense responses in 'Pera' sweet orange. However, these responses can be modulated differentially depending on the pathogen that affects the plant. This fact was demonstrated in this study, as elicitors were effective in controlling X. citri, a pathogen that colonizes the mesophyll of the plant, but were not effective in controlling X. fastidiosa, a pathogen that colonizes the xylem of the plant, although defense responses were expressed in the early stages (24 h) after inoculation with X. fastidiosa
Doutorado
Bioquimica
Doutora em Biologia Funcional e Molecular
4
Wright, Glenn C., and Jack Kelly. "Pruning Citrus." College of Agriculture and Life Sciences, University of Arizona (Tucson, AZ), 2008. http://hdl.handle.net/10150/146998.
Full textAbstract:
4 pp.Publication contains an introduction to the rationale for pruning as well as sections on when to prune, what part of the tree to prune, techniques for best pruning, and how to protect the tree following pruning. Six figures are included.
5
Felisberto, Patrícia Aparecida de Carvalho. "Rutáceas como potenciais hospedeiros de Diaphorina citri e reservatório de Candidatus Liberibacter asiaticus." Jaboticabal, 2018. http://hdl.handle.net/11449/157512.
Full textAbstract:
Orientador: Silvio Aparecido LopesResumo: Huanglongbing (HLB) é a doença mais devastadora dos citros. Está associada a bactérias de floema disseminadas eficientemente pelo psilídeo Diaphorina citri, inseto altamente prolífico e com ampla gama de hospedeiros dentre as rutáceas. Diversas espécies desta família ocorrem em matas onde o inseto poderia estar se reproduzindo e reinfestando pomares além de servir como fonte de multiplicação de Candidatus Liberibacter asiaticus (CLas), dificultando o controle do HLB. Nesse sentido foram realizados dois estudos, sendo o primeiro para avaliar a sobrevivência de D. citri em folhas jovens recém-diferenciadas e totalmente expandida e a reprodução de D. citri em brotos em 20 espécies de rutáceas. E o segundo para avaliar a reação dessas espécies após inoculação do patógeno por meio de enxertia de tecidos infectados e uso de adultos infectivos de D. citri. No primeiro, classificou-se as espécies quanto a favorabilidade em reproduzir D. citri em quatro grupos de plantas: Grupo I (altamente favorável ao inseto) incluiu Citrus ×aurantium 'Valência', Citrus limonia, Murraya paniculata (syn. Murraya exotica L.) (Aurantioideae: Aurantieae) e Bergera koenigii (Aurantioideae: Clauseneae). As espécies do Grupo II (de intermédiio a baixa favorabilidade) incluiu Citrus (Poncirus) trifoliata ‘Pomeroy’, Citrus wintersii, Swinglea glutinosa (Aurantieae) e Clausena lansium (Clauseneae). O grupo III (não favorável) incluiu Aegle marmelos, Atalantia buxifolia e Citrus (‘Microcitrus’) sp. (Aurantieae... (Resumo completo, clicar acesso eletrônico abaixo)
Abstract: Huanglongbing (HLB) is the most devastating disease of citrus. It is associated with phloem bacteria efficiently disseminated by the psilid Diaphorina citri, a highly prolific insect with a wide range of hosts among the rutaceous. Several species of this family occur in forests where the insect could be reproducing and reinfesting orchards besides serving as a source of multiplication of Candidatus Liberibacter asiaticus (CLas), hindering the control of HLB. In this sense, two investigations were carried out, the first one to evaluate the survival of D. citri on newly differentiated and fully-expanded soft leaves and the shoots reproduction of D. citri in 20 species of rutaceous. And the second to evaluate the reaction of these species after inoculation of the pathogen by grafting of infected tissues and use of infective adults of D. citri. In the first, this allowed suitability of the plants as hosts of the psyllid to be separated into 4 groups of plants. Group I (highly suitable to the insect) species included Citrus ×aurantium ‘Valencia’, Citrus limonia, and Murraya paniculata (syn. Murraya exotica L.) (Aurantioideae: Aurantieae), and Bergera koenigii (Aurantioideae: Clauseneae). Group II (intermediate to low suitability) species included Citrus (Poncirus) trifoliata ‘Pomeroy’, Citrus wintersii, and Swinglea glutinosa (Aurantieae), and Clausena lansium (Clauseneae). Group III (not suitable) included Aegle marmelos, Atalantia buxifolia, and Citrus (‘Microcitrus’) sp. (Auran... (Complete abstract click electronic access below)
Doutor
6
Amaral, Ingrid [UNESP]. "Biologia e tabela de vida de Brevipalpus yothersi (Acari: Tenuipalpidae) oriundos de diferentes regiões citrícolas do Estado de São Paulo." Universidade Estadual Paulista (UNESP), 2016. http://hdl.handle.net/11449/137926.
Full textAbstract:
Submitted by Ingrid Amaral null (ingridamaral88@hotmail.com) on 2016-04-12T11:56:46Z
No. of bitstreams: 1
Dissertação_Mestrado_Ingrid_Amaral.pdf: 455312 bytes, checksum: 62dbe25fd5fc9414cda40cf6b569d002 (MD5)Approved for entry into archive by Felipe Augusto Arakaki (arakaki@reitoria.unesp.br) on 2016-04-13T14:55:59Z (GMT) No. of bitstreams: 1 mariano_jlm_dr_prud.pdf: 21534624 bytes, checksum: 2f32b2e3ce64ced881d3b801c0ff70c5 (MD5)
Made available in DSpace on 2016-04-13T14:55:59Z (GMT). No. of bitstreams: 1 mariano_jlm_dr_prud.pdf: 21534624 bytes, checksum: 2f32b2e3ce64ced881d3b801c0ff70c5 (MD5) Previous issue date: 2016-02-29
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
O ácaro Brevipalpus yothersi Baker é vetor da leprose dos citros, principal doença viral da citricultura mundial. Informações sobre a biologia de B. yothersi são essenciais para compreender a dinâmica populacional do ácaro no campo e inferir se mudanças no manejo do pomar em função da região pode alterar a biologia do ácaro. O objetivo do trabalho foi determinar a biologia e elaborar a tabela de vida de fertilidade de B. yothersi coletados em diferentes regiões citrícolas do estado de São Paulo. Os experimentos foram realizados no Laboratório de Acarologia, pertencente à Faculdade de Ciências Agrárias e Veterinárias - FCAV/UNESP, Jaboticabal - SP. Os ácaros foram coletados em pomares cítricos das regiões de Barretos, Jales e Santa Cruz do Rio Pardo, posteriormente, em laboratório, foram multiplicados em frutos de laranja. Os parâmetros biológicos avaliados foram duração das fases de desenvolvimento, oviposição, período de incubação, viabilidade dos ovos, longevidade, taxa líquida de reprodução (Ro), tempo médio de geração (T), taxa intrínseca de crescimento populacional (rm) e taxa finita de crescimento populacional (λ). Estes parâmetros foram avaliados em dois experimentos, o primeiro consistiu na biologia de B. yothersi em frutos isentos de resíduos de produtos fitossanitários à 23±1ºC e o segundo sob frutos com resíduo de espirodiclofeno à 25±1ºC. As observações foram realizadas diariamente, pela manhã e ao fim da tarde. A duração do desenvolvimento, longevidade, período de pré-oviposição, taxa de oviposição e número de ovos de B. yothersi apresentaram diferenças entre as populações. O ciclo biológico de B. yothersi criados sobre frutos de laranja varia de 18 a 24 dias, considerando os intervalos de 22º a 26 ºC, 50 a 70% de umidade relativa e fotofase de 14 horas. As diferenças biológicas entre populações de B. yothersi indicam que há diferenças na dinâmica populacional do ácaro no campo, necessitando de manejos adequados para cada região para melhor controle da leprose.
The mite Brevipalpus yothersi Baker is the vector of the citrus leprosis, major viral disease of citrus worldwide. Information about B. yothersi's biology are essential to understanding the population dynamics of the mite in the field and infer whether changes in orchard management by region can change the mite biology. The objective was to determine the biology and prepare the fertility life table of B. yothersi collected in different citrus regions of São Paulo state. The experiments were performed in Acarology Laboratory, belonging to the Faculty of Agricultural and Veterinary Sciences - FCAV/UNESP, Jaboticabal - SP. The mites were collected in citrus orchards in the regions of Barretos, Jales and Santa Cruz do Rio Pardo, later in the laboratory were multiplied in orange fruits. The biological parameters assessed were duration of the stages of development, oviposition, incubation period, egg viability, longevity, net reproductive rate (Ro), mean generation time (T), intrinsic rate of increase (rm) and finite rate increase (λ). These parameters were evaluated in two experiments, the first consisted the biology of B. yothersi in fruits free of residues of pesticides at 23 ± 1°C and the second consisting of the biology of B. yothersi under fruit with spirodiclofen residue at 25 ± 1°C . The observations were performed daily, in the morning and in the afternoon. The duration of the development, longevity, pre-oviposition period, oviposition rate and number of B. yothersi eggs showed differences between populations. The life cycle of B. yothersi created on orange fruit ranges from 18 to 24 days, considering the ranges of 22 to 26°C, 50-70% relative humidity and 14 hours. The biological differences between populations of B. yothersi indicate that there are differences in the population dynamics of the mite in the field, requiring adequate management practices for each region for better control of leprosis.
7
McGinley, Susan. "Researching Desert Citrus: A Visit to the Citrus Ag Center." College of Agriculture and Life Sciences, University of Arizona (Tucson, AZ), 1999. http://hdl.handle.net/10150/622296.
Full text
8
Lopes, Aline Cristina [UNESP]. "Expressão gênica de Xanthomonas citri subsp. citri colonizando laranja doce ‘pêra rio’ (Citrus sinensis (L.) Osbeck) e lima ácida ‘galego’ (Citrus aurantifolia Swingle)." Universidade Estadual Paulista (UNESP), 2016. http://hdl.handle.net/11449/138221.
Full textAbstract:
Submitted by ALINE CRISTINA LOPES null (line.cl@hotmail.com) on 2016-05-02T12:42:00Z
No. of bitstreams: 1
Dissertação_Aline_Cristina_Lopes.pdf: 1995885 bytes, checksum: 09268565881925cc85d0cdbe17aa6d6c (MD5)Approved for entry into archive by Felipe Augusto Arakaki (arakaki@reitoria.unesp.br) on 2016-05-04T14:14:37Z (GMT) No. of bitstreams: 1 lopes_ac_me_jabo.pdf: 1995885 bytes, checksum: 09268565881925cc85d0cdbe17aa6d6c (MD5)
Made available in DSpace on 2016-05-04T14:14:37Z (GMT). No. of bitstreams: 1 lopes_ac_me_jabo.pdf: 1995885 bytes, checksum: 09268565881925cc85d0cdbe17aa6d6c (MD5) Previous issue date: 2016-04-01
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
A citricultura é uma das principais atividades do agronegócio brasileiro. Entretanto, inúmeras pragas e doenças atacam os citros, causando grandes prejuízos econômicos. O cancro cítrico, causado pela bactéria Xanthomonas citri subsp. citri (Xac), é um grave problema para o setor, não havendo ainda um método eficaz para o seu controle. Neste estudo, utilizando RNASeq, foram analisados os perfis transcricionais de Xac inoculada em duas espécies de citros contrastantes à doença: laranja doce ‘Pêra Rio’ (Citrus sinensis L. Osbeck), menos suscetível e lima ácida ‘Galego’ (Citrus aurantifolia Swingle), altamente suscetível, às 48 e 72 horas após a infecção (hai), com o objetivo de identificar genes de Xac envolvidos no processo de infecção. Foram identificados 80 genes de Xac diferencialmente expressos (GDEs) no hospedeiro laranja doce ‘Pêra Rio’, sendo 41 e 39 nos tempos de 48 e 72 hai, respectivamente. Em lima ácida ‘Galego’ foram identificados 82 GDEs, sendo 40 no tempo de 48 hai e 42 em 72 hai. Alguns destes genes diferencialmente expressos foram avaliados pela técnica de PCR quantitativa em tempo real, sendo estes hpa1, hrpE, hrpW, virK, ahpC, katE, katG, cydA e cydB, os quais estão envolvidos na patogenicidade e virulência, na defesa ao estresse oxidativo e na fosforilação oxidativa. Os genes de patogenicidade e virulência foram induzidos em Xac em ambos os hospedeiros, enquanto que os genes relacionados à cadeia respiratória foram inibidos em ambos os hospedeiros, com maior inibição em lima ácida ‘Galego’. No entanto, os genes relacionados ao estresse oxidativo apresentaram um perfil de expressão maior em Xac na interação com laranja doce ‘Pêra Rio’ do que em lima ácida ‘Galego’, principalmente ahpC e katG. A determinação da concentração de H2O2 nas folhas revelou que laranja doce ‘Pêra Rio’, espécie menos suscetível ao cancro cítrico, possui maior quantidade de H2O2 do que lima ácida ‘Galego’, espécie altamente suscetível. Isso sugere que a menor susceptibilidade ao cancro cítrico da laranja ‘Pêra Rio’ pode estar relacionada com a maior quantidade de H2O2 presente nesta espécie, o que leva a bactéria a ativar seu arsenal de enzimas para combater o estresse oxidativo do meio, retardando a infecção.
The citrus industry is one of the main activities of Brazilian agribusiness. However, many pests and diseases attack citrus, causing great economic losses. The citrus canker, caused by Xanthomonas citri subsp. citri (Xac), is a major problem for the sector, there is not yet an effective method for its control. In this study, the transcriptional profiles of Xac inoculated in two species of contrasting citrus disease were analyzed using RNA-Seq : sweet orange 'Pêra Rio' (Citrus sinensis L. Osbeck), moderately tolerant and Mexican Lime 'Galego' (Citrus aurantifolia Swingle) highly susceptible at 48 and 72 hours after infection (hai) aiming to identify Xac genes involved in the infection process. We identified 80 Xac differentially expressed genes (DGE) in sweet orange 'Pera Rio', 41 and 39 at 48 and 72 hai, respectively. In Mexican Lime 'Galego' 82 DGE were identified, 40 at 48 and 42 at 72 hai. Some of these differentially expressed genes were evaluated by real time quantitative PCR : hpa1, hrpE, hrpW, Virk, ahpC, KatE, katG, cyda and cydB, which are involved in pathogenicity and virulence, oxidative stress defense and oxidative phosphorylation. The pathogenicity and virulence genes were induced in Xac in both hosts, whereas the respiratory chain-related genes were inhibited in both hosts with greater inhibition in Mexican lime 'Galego'. However, genes related to oxidative stress showed a higher expression profile in Xac interaction with sweet orange 'Pera Rio' than with Mexican lime 'Galego', mainly ahpC and katG. The determination of H2O2 concentration in leaves revealed a higher amount of H2O2 in sweet orange 'Pêra Rio' moderately tolerant to citrus canker, than in Mexican Lime 'Galego' highly susceptible to citrus canker. The results suggests that the lower susceptibility to citrus canker orange 'Pera Rio' may be related to the greater amount of H2O2 present in this specie, which leads the bacteria to activate their arsenal of enzymes to fight oxidative stress environment, slowing the infection.
9
Lopes, Aline Cristina. "Expressão gênica de Xanthomonas citri subsp. citri colonizando laranja doce 'pêra rio' (Citrus sinensis (L.) Osbeck) e lima ácida 'galego' (Citrus aurantifolia Swingle) /." Jaboticabal, 2016. http://hdl.handle.net/11449/138221.
Full textAbstract:
Orientador: Jesus Aparecido FerroCoorientador: Roberto Hirochi Herai
Coorientador: Juliana da Silva Vantini
Banca: José Belasque Júnior
Banca: Priscila Lupino gatão
Resumo: A citricultura é uma das principais atividades do agronegócio brasileiro. Entretanto, inúmeras pragas e doenças atacam os citros, causando grandes prejuízos econômicos. O cancro cítrico, causado pela bactéria Xanthomonas citri subsp. citri (Xac), é um grave problema para o setor, não havendo ainda um método eficaz para o seu controle. Neste estudo, utilizando RNASeq, foram analisados os perfis transcricionais de Xac inoculada em duas espécies de citros contrastantes à doença: laranja doce 'Pêra Rio' (Citrus sinensis L. Osbeck), menos suscetível e lima ácida 'Galego' (Citrus aurantifolia Swingle), altamente suscetível, às 48 e 72 horas após a infecção (hai), com o objetivo de identificar genes de Xac envolvidos no processo de infecção. Foram identificados 80 genes de Xac diferencialmente expressos (GDEs) no hospedeiro laranja doce 'Pêra Rio', sendo 41 e 39 nos tempos de 48 e 72 hai, respectivamente. Em lima ácida 'Galego' foram identificados 82 GDEs, sendo 40 no tempo de 48 hai e 42 em 72 hai. Alguns destes genes diferencialmente expressos foram avaliados pela técnica de PCR quantitativa em tempo real, sendo estes hpa1, hrpE, hrpW, virK, ahpC, katE, katG, cydA e cydB, os quais estão envolvidos na patogenicidade e virulência, na defesa ao estresse oxidativo e na fosforilação oxidativa. Os genes de patogenicidade e virulência foram induzidos em Xac em ambos os hospedeiros, enquanto que os genes relacionados à cadeia respiratória foram inibidos em ambos os hospedeiros, com maior ... (Resumo completo, clicar acesso eletrônico abaixo)
Abstract: The citrus industry is one of the main activities of Brazilian agribusiness. However, many pests and diseases attack citrus, causing great economic losses. The citrus canker, caused by Xanthomonas citri subsp. citri (Xac), is a major problem for the sector, there is not yet an effective method for its control. In this study, the transcriptional profiles of Xac inoculated in two species of contrasting citrus disease were analyzed using RNA-Seq : sweet orange 'Pêra Rio' (Citrus sinensis L. Osbeck), moderately tolerant and Mexican Lime 'Galego' (Citrus aurantifolia Swingle) highly susceptible at 48 and 72 hours after infection (hai) aiming to identify Xac genes involved in the infection process. We identified 80 Xac differentially expressed genes (DGE) in sweet orange 'Pera Rio', 41 and 39 at 48 and 72 hai, respectively. In Mexican Lime 'Galego' 82 DGE were identified, 40 at 48 and 42 at 72 hai. Some of these differentially expressed genes were evaluated by real time quantitative PCR : hpa1, hrpE, hrpW, Virk, ahpC, KatE, katG, cyda and cydB, which are involved in pathogenicity and virulence, oxidative stress defense and oxidative phosphorylation. The pathogenicity and virulence genes were induced in Xac in both hosts, whereas the respiratory chain-related genes were inhibited in both hosts with greater inhibition in Mexican lime 'Galego'. However, genes related to oxidative stress showed a higher expression profile in Xac interaction with sweet orange 'Pera Rio' than with Mexica... (Complete abstract click electronic access below)
Mestre
10
Julião, Maria Heloisa Moreno. "Genomic identification of MATE, ABC, and MFS transporters in Citrus sinensis and expression analysis of Citrus species interacting with Xanthomonas citri subsp. citri /." Jaboticabal, 2020. http://hdl.handle.net/11449/192658.
Full textAbstract:
Orientador: Alessandro de Mello VaraniResumo: As plantas como organismos sésseis requerem a síntese e o acúmulo de uma ampla variedade de moléculas envolvidas no crescimento, desenvolvimento e processos relacionados à defesa. Os transportadores Proteínas de Extrusão Multi- Antimicrobianas (MATE), Cassette de Ligação de ATP (ABC) e Superfamília dos Facilitadores Maioritários (MFS) são as principais famílias de transportadores de membrana em plantas, desempenhando um papel central nos processos relacionados à defesa nas interações planta-patógenos. Por exemplo, protegem as células das espécies de Citros sob a infecção de Xanthomonas citri subsp. citri (Xac), o agente etiológico do Cancro Cítrico tipo A, uma das doenças de Citros mais devastadoras envolvidas em sérios impactos econômicos e ambientais. Aqui, identificamos genes e transcritos das famílias MATE, ABC e MFS usando o genoma disponível de Citrus sinensis (v2.0 HZAU) e o Transcriptoma Referência de Citros (CRT) re-anotado da base de dados CitrusKB (http://bioinfo.deinfo.uepg.br). Foram identificados 67 genes MATE, 91 MFS e 143 ABC no genoma de C. sinensis e 82 transcritos MATE, 139 MFS e 226 ABC no CRT. Os transcritos foram mapeados no genoma de C. sinensis, revelando uma alta taxa de genes parálogos e putativos eventos de splicing alternativo (AS), cujos perfis de expressão gênica e potenciais papéis na interação Citros-Xac foram propostos. As cópias de genes em tandem e cópias dispersas juntamente com genes que possivelmente sofreram eventos de AS representam fon... (Resumo completo, clicar acesso eletrônico abaixo)
Abstract: Plants as sessile organisms require the synthesis and accumulation of a large array of molecules involved in growth, development, and defense-related processes. The Multi-Antimicrobial Extrusion Protein (MATE), ATP-Binding Cassette (ABC) and Major Facilitator Superfamily (MFS) transporters are the largest families of membrane transporters in plants, playing a central role in the defense-related processes in plant- pathogen interactions. For instance, protecting Citrus species cells under the infection of Xanthomonas citri subsp. citri (Xac), the etiologic agent of the Citrus Canker type A, one of the most devastating Citrus diseases involved with serious economic and environmental impacts. Herein, we identified genes and transcripts from MATE, ABC, and MFS families using the available Citrus sinensis genome (v2.0 HZAU) and the re-annotated Citrus Reference Transcriptome (CRT) from CitrusKB Knowledge Base (http://bioinfo.deinfo.uepg.br). We identified 67 MATE, 91 MFS, and 143 ABC genes in the C. sinensis genome and 82 MATE, 139 MFS, and 226 ABC transcripts in the CRT. The transcripts were mapped in the C. sinensis genome revealing a high rate of paralogs genes and probably alternative splicing (AS) events, whose expression profiles and potential roles in the Citrus-Xac interaction were proposed. The tandem and dispersed copies along with genes that underwent AS events represents sources of transporters’ genes diversity and complexity. Moreover, we also highlighted potential bi... (Complete abstract click electronic access below)
Mestre
Books on the topic "Citrus"
1
Giovanni, Dugo, and Di Giacomo Angelo, eds. Citrus: The genus citrus. London: Taylor & Francis, 2002.
Find full text
2
Albrigo, L. G., L. L. Stelinski, and L. W. Timmer, eds. Citrus. Wallingford: CABI, 2019. http://dx.doi.org/10.1079/9781845938154.0000.
Full text
3
Davies, Frederick Stanley. Citrus. Wallingford, Oxon, UK: CAB International, 1994.
Find full text
4
Walheim, Lance. Citrus. Tucson, Ariz: Ironwood Press, 1996.
Find full text
5
Brennan, Ethel. Citrus. San Francisco: Chronicle Books, 1996.
Find full text
6
Books, Sunset, ed. Citrus. Menlo Park, Calif: Sunset Pub. Corp., 1996.
Find full text
7
translator, Tamosaitis Amber, and Fay Shannon author, eds. Citrus. [Los Angeles, California]: Seven Seas Entertainment, LLC, 2018.
Find full text
8
Spiegel-Roy, Pinchas. Biology of citrus. Cambridge: Cambridge University Press, 1996.
Find full text
9
Ghosh, S. P. Citrus fruits. New Delhi: Directorate of Information and Publications of Agriculture, Indian Council of Agricultural Research, 2007.
Find full text
10
Berhow, Mark A., Shin Hasegawa, and Gary D. Manners, eds. Citrus Limonoids. Washington, DC: American Chemical Society, 2000. http://dx.doi.org/10.1021/bk-2000-0758.
Full textBook chapters on the topic "Citrus"
1
Bährle-Rapp, Marina. "citrus." In Springer Lexikon Kosmetik und Körperpflege, 115. Berlin, Heidelberg: Springer Berlin Heidelberg, 2007. http://dx.doi.org/10.1007/978-3-540-71095-0_2154.
Full text
2
Ollitrault, Patrick, and Luis Navarro. "Citrus." In Fruit Breeding, 623–62. Boston, MA: Springer US, 2011. http://dx.doi.org/10.1007/978-1-4419-0763-9_16.
Full text
3
Rao, Madhugiri Nageswara, Jaya R. Soneji, and Leela Sahijram. "Citrus." In Wild Crop Relatives: Genomic and Breeding Resources, 43–59. Berlin, Heidelberg: Springer Berlin Heidelberg, 2011. http://dx.doi.org/10.1007/978-3-642-20447-0_3.
Full text
4
Ait-Oubahou, Ahmed, Mohamed Benichou, Maha Sagar, Amar Kaanane, and Elhadi M. Yahia. "Citrus." In Fruit and Vegetable Phytochemicals, 1003–22. Chichester, UK: John Wiley & Sons, Ltd, 2017. http://dx.doi.org/10.1002/9781119158042.ch49.
Full text
5
Lado, Joanna, Paul JR Cronje, Maria Jesús Rodrigo, and Lorenzo Zacarías. "Citrus." In Postharvest Physiological Disorders in Fruits and Vegetables, 377–98. Boca Raton : Taylor & Francis, 2018.: CRC Press, 2019. http://dx.doi.org/10.1201/b22001-17.
Full text
6
Hazarika, T. K. "Citrus." In Fruit and Nut Crops, 1–44. Singapore: Springer Nature Singapore, 2023. http://dx.doi.org/10.1007/978-981-99-1586-6_15-1.
Full text
7
Febres, V., L. Pe�a, S. Y. Folimonova, and G. Moore. "Citrus." In Biotechnology of fruit and nut crops, 621–44. Wallingford: CABI, 2020. http://dx.doi.org/10.1079/9781780648279.0621.
Full text
8
Orbović, Vladimir, and Jude W. Grosser. "Citrus." In Agrobacterium Protocols Volume 2, 177–89. Totowa, NJ: Humana Press, 2006. http://dx.doi.org/10.1385/1-59745-131-2:177.
Full text
9
Korsten, Lise, and Peter Taverner. "Citrus." In Crop Post-Harvest: Science and Technology, 43–87. Oxford, UK: Wiley-Blackwell, 2012. http://dx.doi.org/10.1002/9781444354652.ch4.
Full text
10
Narayana, C. K. "Citrus." In Phytochemicals in Fruits and their Therapeutic Properties, 68–76. London: CRC Press, 2021. http://dx.doi.org/10.1201/9781003245292-13.
Full textConference papers on the topic "Citrus"
1
Grafton-Cardwell, Elizabeth E. "Asian citrus psyllid (Diaphorina citri) and huanglongbing radically alter California citrus IPM." In 2016 International Congress of Entomology. Entomological Society of America, 2016. http://dx.doi.org/10.1603/ice.2016.110290.
Full text
2
Ko, Andrew J., and Brad A. Myers. "Citrus." In the 18th annual ACM symposium. New York, New York, USA: ACM Press, 2005. http://dx.doi.org/10.1145/1095034.1095037.
Full text
3
Van Vliet, Ashley C. "Knowledge of California residents on Asian citrus psyllid (Diaphorina citri) and citrus greening disease." In 2016 International Congress of Entomology. Entomological Society of America, 2016. http://dx.doi.org/10.1603/ice.2016.115500.
Full text
4
Berdis, Elizabeth, John Buckley, and John Kraft. "Citrus Flavor Technologies: Citrus Oils — Processing, Separation, Application." In ASME 2003 Citrus Engineering Conference. American Society of Mechanical Engineers, 2003. http://dx.doi.org/10.1115/cec2003-4906.
Full textAbstract:
Citrus flavors play a significant role in the beverage industry. Citrus-based beverages and those containing citrus flavor components lead the flavor category for beverages today. The essential oils used in flavors are obtained during fruit juice processing. In order to process these essential oils for flavor applications, various separation technologies are used. The purpose of this paper is to present an overview of various aspects of citrus flavor technology. It will give a brief review of factors that affect oil quality during processing operations. Basic distillation principles and factors affecting distillation are presented as well as flavor application, separation technology and alternative process technologies. Paper published with permission.
5
Davis, Dennis. "Integrated Citrus Information System." In ASME 1994 Citrus Engineering Conference. American Society of Mechanical Engineers, 1994. http://dx.doi.org/10.1115/cec1994-4002.
Full textAbstract:
To manage the business of citrus processing, Coca-Cola Foods re-engineered the information systems that supports their fruit processing functions. The single, integrated system that was developed is called Citrix: the CITRus Information exchange. This new information system starts with information about procured fruit and adds additional information as the fruit is delivered, processed, and paid for. “State of the art” computer technology and techniques are used to deliver the best possible tool to those involved in the business of citrus processing for Coca-Cola Foods. Paper published with permission.
6
Johnson, Teiko M. "Citrus Pulp Recovery." In ASME 1987 Citrus Engineering Conference. American Society of Mechanical Engineers, 1987. http://dx.doi.org/10.1115/cec1987-3301.
Full textAbstract:
The growing interest in citrus pulp, or frozen, stabilized juice sacs, stems from the rapid influx of high quality citrus juices and juice added beverages into the market. Juice sacs have been recovered for many years and it has not been until the past few years that this practice evolved into a sophisticated technology. Paper published with permission.
7
Schuermans, Alex. "Brazil: Citrus Benchmarking." In ASME 2003 Citrus Engineering Conference. American Society of Mechanical Engineers, 2003. http://dx.doi.org/10.1115/cec2003-4901.
Full textAbstract:
More and more, the Citrus Business is becoming a global operation, narrowing the technological opportunities gap between processors around the world. Most of the largest Brazilian processors already have process units or commercial partners in the United States, which makes any new technology available worldwide virtually instantaneously. However, there are several market and environmental differences that directly impact the best use of the available technology according to the individual market. Paper published with permission.
8
Arivazhagan, S., R. Newlin Shebiah, S. Selva Nidhyanandhan, and L. Ganesan. "Classification of citrus and non-citrus fruits using texture features." In 2010 International Conference on Computing, Communication and Networking Technologies (ICCCNT'10). IEEE, 2010. http://dx.doi.org/10.1109/icccnt.2010.5591562.
Full text
9
Mao, Runqian. "Study on control effectiveness of huanglongbing based on eradication of Asian citrus psyllid,Diaphorina citri, surrounding citrus orchard." In 2016 International Congress of Entomology. Entomological Society of America, 2016. http://dx.doi.org/10.1603/ice.2016.106668.
Full text
10
REIS, ROBERTA CRISTINA RODRIGUES DOS, Ana Carolina Hermes, and MINEIA WEBER BLATTES. "ATIVIDADE ANTIMICROBIANA DOS CITRUS LIMON E CITRUS SINENSIS: UMA BREVE REVISÃO." In Simpósio de Ensino, Pesquisa e Extensão (SEPE 2022). sepebr, 2022. http://dx.doi.org/10.48195/sepe2022.26253.
Full textReports on the topic "Citrus"
1
Audsley, Neil, Gonzalo Avila, Claudio Ioratti, Valerie Caron, Chiara Ferracini, Tibor Bukovinszki, Marc Kenis, et al. Asian citrus psyllid, Diaphorina citri (Kuwayama). Euphresco, 2023. http://dx.doi.org/10.1079/20240228459.
Full textAbstract:
The Asian citrus psyllid, Diaphorina citri, poses a significant threat to citrus crops worldwide as a vector of the devastating citrus greening disease. Classical biological control efforts have focused on 2 parasitoid species, i.e. Tamarixia radiata and Diaphorencytrus aligarhensis. T. radiata, native to south east Asia, has been successfully introduced and established in several countries, including Reunion Island, Guadeloupe, Taiwan, California and Florida, leading to notable reductions in D. citri populations. D. aligarhensis, native to East Asia, has also been imported and released in Reunion Island, Taiwan and Florida, but with less success due to competition with T. radiata. T. radiata demonstrates higher effectiveness and establishment rates, attributed in part to lower rates of hyperparasitism compared to D. aligarhensis. Predatory beetles, such as Olla v-nigrum, Harmonia axyridis and Curinus coeruleus have also shown promise in suppressing D. citri populations. Additionally, fungal entomopathogens, such as Isaria fumosorosea and Hirsutella citriformis have demonstrated potential for biological control in citrus orchards. These biological control agents offer promising strategies for managing D. citri and reducing the spread of citrus greening disease.
2
Blumwald, Eduardo, and Avi Sadka. Citric acid metabolism and mobilization in citrus fruit. United States Department of Agriculture, October 2007. http://dx.doi.org/10.32747/2007.7587732.bard.
Full textAbstract:
Accumulation of citric acid is a major determinant of maturity and fruit quality in citrus. Many citrus varieties accumulate citric acid in concentrations that exceed market desires, reducing grower income and consumer satisfaction. Citrate is accumulated in the vacuole of the juice sac cell, a process that requires both metabolic changes and transport across cellular membranes, in particular, the mitochondrial and the vacuolar (tonoplast) membranes. Although the accumulation of citrate in the vacuoles of juice cells has been clearly demonstrated, the mechanisms for vacuolar citrate homeostasis and the components controlling citrate metabolism and transport are still unknown. Previous results in the PIs’ laboratories have indicated that the expression of a large number of a large number of proteins is enhanced during fruit development, and that the regulation of sugar and acid content in fruits is correlated with the differential expression of a large number of proteins that could play significant roles in fruit acid accumulation and/or regulation of acid content. The objectives of this proposal are: i) the characterization of transporters that mediate the transport of citrate and determine their role in uptake/retrieval in juice sac cells; ii) the study of citric acid metabolism, in particular the effect of arsenical compounds affecting citric acid levels and mobilization; and iii) the development of a citrus fruit proteomics platform to identify and characterize key processes associated with fruit development in general and sugar and acid accumulation in particular. The understanding of the cellular processes that determine the citrate content in citrus fruits will contribute to the development of tools aimed at the enhancement of citrus fruit quality. Our efforts resulted in the identification, cloning and characterization of CsCit1 (Citrus sinensis citrate transporter 1) from Navel oranges (Citrus sinesins cv Washington). Higher levels of CsCit1 transcripts were detected at later stages of fruit development that coincided with the decrease in the juice cell citrate concentrations (Shimada et al., 2006). Our functional analysis revealed that CsCit1 mediates the vacuolar efflux of citrate and that the CsCit1 operates as an electroneutral 1CitrateH2-/2H+ symporter. Our results supported the notion that it is the low permeable citrateH2 - the anion that establishes the buffer capacity of the fruit and determines its overall acidity. On the other hand, it is the more permeable form, CitrateH2-, which is being exported into the cytosol during maturation and controls the citrate catabolism in the juice cells. Our Mass-Spectrometry-based proteomics efforts (using MALDI-TOF-TOF and LC2- MS-MS) identified a large number of fruit juice sac cell proteins and established comparisons of protein synthesis patterns during fruit development. So far, we have identified over 1,500 fruit specific proteins that play roles in sugar metabolism, citric acid cycle, signaling, transport, processing, etc., and organized these proteins into 84 known biosynthetic pathways (Katz et al. 2007). This data is now being integrated in a public database and will serve as a valuable tool for the scientific community in general and fruit scientists in particular. Using molecular, biochemical and physiological approaches we have identified factors affecting the activity of aconitase, which catalyze the first step of citrate catabolism (Shlizerman et al., 2007). Iron limitation specifically reduced the activity of the cytosolic, but not the mitochondrial, aconitase, increasing the acid level in the fruit. Citramalate (a natural compound in the juice) also inhibits the activity of aconitase, and it plays a major role in acid accumulation during the first half of fruit development. On the other hand, arsenite induced increased levels of aconitase, decreasing fruit acidity. We have initiated studies aimed at the identification of the citramalate biosynthetic pathway and the role(s) of isopropylmalate synthase in this pathway. These studies, especially those involved aconitase inhibition by citramalate, are aimed at the development of tools to control fruit acidity, particularly in those cases where acid level declines below the desired threshold. Our work has significant implications both scientifically and practically and is directly aimed at the improvement of fruit quality through the improvement of existing pre- and post-harvest fruit treatments.
3
Lee, Richard, Moshe Bar-Joseph, K. S. Derrick, Aliza Vardi, Roland Brlansky, Yuval Eshdat, and Charles Powell. Production of Antibodies to Citrus Tristeza Virus in Transgenic Citrus. United States Department of Agriculture, September 1995. http://dx.doi.org/10.32747/1995.7613018.bard.
Full textAbstract:
Citrus tristeza virus (CTV) is the most important virus disease of citrus in the world. CTV causes death of trees on sour orange rootstock and/or stem pitting of scions regardless of rootstock which results in trees of low vigor, reduced yield with reduction in size and quality of fruit. The purpose of this project was to produce monoclonal antibodies (MABs) to CTV coat protein (CP), develop single domain antibodies (dAbs) or Fab fragments which neutralize the infection by binding to the virus, and to produce transformed plants which express the dAbs. The objectives of this research have been met and putative transgenic tobacco and citrus plants have been developed. These putative transgenic plants are presently undergoing evaluation to determine the level of dAbs expression and to determine their resistance to CTV. Additionally, the CTV genome has been sequenced and the CP gene of several biologically characterized CTV strains molecular characterized. This has indicated a correlation between CP sequence homology and biological activity, and the finding of DI RNAs associated with some CTV strains. Several MABs have been produced which enable broad spectrum identification of CTV strains while other MABs enable differentiation between mild and severe strains. The use of selected MAbs and determination of the CP gene sequence has enabled predictions of biological activities of unknown CTV isolates. The epitopes of two MABs, one reacting selectively with severe CTV strains and the other reacting with all strains, have been characterized at the molecular level.
4
Bar-Joseph, Moshe, and J. S. Semancik. Characterization of Citrus Viroids as Potential Dwarfing Agents of Citrus. United States Department of Agriculture, December 1992. http://dx.doi.org/10.32747/1992.7600051.bard.
Full text
5
Karel Grohman and Scott Stevenson. Citrus Waste Biomass Program. Office of Scientific and Technical Information (OSTI), January 2007. http://dx.doi.org/10.2172/898345.
Full text
6
Sadka, Avi, Mikeal L. Roose, and Yair Erner. Molecular Genetic Analysis of Citric Acid Accumulation in Citrus Fruit. United States Department of Agriculture, March 2001. http://dx.doi.org/10.32747/2001.7573071.bard.
Full textAbstract:
The acid content of the juice sac cells is a major determinant of maturity and fruit quality in citrus. Many citrus varieties accumulate acid in concentrations that exceed market desires, reducing grower income and consumer satisfaction. Pulp acidity is thought to be dependent on two mechanisms: the accumulation of citric acid in the vacuoles of the juice sac cells, and acidification of the vacuole. The major aim of the project was to direct effort toward understanding the mechanism of citric acid accumulation in the fruit. The following objectives were suggested: Measure the activity of enzymes likely to be involved in acid accumulation and follow their pattern of expression in developing fruit (Sadka, Erner). Identify and clone genes which are associated with high and low acid phenotypes and with elevated acid level (Roose, Sadka, Erner). Convert RAPD markers that map near a gene that causes low acid phenotype to specific co dominant markers (Roose). Use genetic co segregation to test whether specific gene products are responsible for low acid phenotype (Roose and Sadka). Objective 1 was fully achieved. Most of the enzymes of organic acid metabolism were cloned from lemon pulp. Their expression was studied during fruit development in low and high acid varieties. The activity and expression of citrate synthase, aconitase and NADP-isocitrate dehydrogenase (IDH) were studied in detail. The role that each enzyme plays in acid accumulation and decline was evaluated. As a result, a better understanding of the metabolic changes that contribute to acid accumulation was achieved. It was found that the activity of the mitochondrial aconitase is greatly reduced early in high-acid fruits, but not in acidless ones, suggesting that this enzyme plays an important role in acid accumulation. In addition, it was demonstrated that increases in the cytosolic forms of aconitase and NADP-IDH towards fruit maturation play probably a major role in acid decline. Our studies also demonstrated that the two mechanisms that contribute to fruit acidity, vacuolar acidification and citric acid accumulation, are independent, although they are tightly co-regulated. Additional, we demonstrated that sodium arsenite, which reduce fruit acidity, causes a transient inhibition in the activity of citrate synthase, but an induction in the gene expression. This part of the work has resulted in 4 papers. Objective 3 was also fully achieved. Using bulked segregant analysis, three random amplified polymorphic DNA (RAPD) markers were identified as linked to acitric, a gene controlling the acidless phenotype of pummelo 2240. One of them, which mapped 1.2 cM from acitric was converted into sequence characterized amplified region (SCAR marker, and into co dominant restriction length polymorphism (RFLP) marker. These markers were highly polymorphic among 59 citrus accessions, and therefore, they should be useful for selecting seedling progeny heterozygous for acitric in nearly all crosses between pummelo 2240 and other citrus genotypes. This part of the project resulted in one paper. Objective 4 was also fully achieved. Clones isolated by the Israeli group were sent to the American laboratory for co segregation analysis. However, none of them seemed to co segregate with the low acid phenotype. Both laboratories invested much effort in achieving the goals of Objective 2, namely the isolation of genes that are elevated in expression in low and high acid phenotypes, and in tissue cultures treated with arsenite (a treatment which reduces fruit acidity). However, conventional differential display and restriction fragment differential display analyses could not identify any differentially expressed genes. The isolation of such genes was the major aim of a continuation project, which was recently submitted.
7
Blumwald, Eduardo, and Avi Sadka. Sugar and Acid Homeostasis in Citrus Fruit. United States Department of Agriculture, January 2012. http://dx.doi.org/10.32747/2012.7697109.bard.
Full textAbstract:
Citrus fruit quality standards have been determined empirically, depending on species and on the particular growing regions. In general, the TSS (total soluble solids) to total acidity (TA) ratio determines whether citrus fruit can be marketed. Soluble sugars account for most of the TSS during harvest while TA is determined almost solely by the citric acid content, which reaches levels of 1-5% by weight in many cultivated varieties. Acid and sugar homeostasis in the fruit is critical for the management of existing cultivars, the development of new cultivars, the improvement of pre- and post-harvest strategies and the control of fruit quality and disorders. The current proposal (a continuation of a previous proposal) aimed at: (1) completing the citrus fruit proteome and metabolome, and establish a citrus fruit functional database, (2) further characterization of the control of fruit acidity by studying the regulation of key steps affecting citrate metabolism, and determine the fate of citrate during acid decline stage, and (3) Studying acid and sugar homeostasis in citrus fruits by characterizing transport mechanisms across membranes. These aims were completed as the following: (1) Our initial efforts were aimed at the characterization and identification of citric acid transporters in citrus juice cells. The identification of citrate transporters at the vacuole of the citrus juice cell indicated that the steady-state citrate cytosolic concentration and the action of the cytosolic aconitase were key elements in establishing the pH homeostat in the cell that regulates the metabolic shift towards carbon usage in the fruit during the later stages of fruit development. We focused on the action of aconitase, the enzyme mediating the metabolic use of citric acid in the cells, and identified processes that control carbon fluxes in developing citrus fruits that control the fruit acid load; (2) The regulation of aconitase, catalyzing a key step in citrate metabolism, was further characterized by using two inhibitors, citramalte and oxalomalte. These compounds significantly increased citrate content and reduced the enzyme’s activity. Metabolite profiling and changes of amino-acid metabolizing enzymes in oxalomalate- treated cells suggested that the increase in citrate, caused by aconitase inhibition, induces amino acid synthesis and the GABA shunt, in accordance with the suggested fate of citrate during the acid decline stage in citrus fruit. (3) We have placed a considerable amount of time on the development of a citrus fruit proteome that will serve to identify all of the proteins in the juice cells and will also serve as an aid to the genomics efforts of the citrus research community (validating the annotation of the fruit genes and the different ESTs). Initially, we identified more than 2,500 specific fruit proteins and were able to assign a function to more than 2,100 proteins (Katz et al., 2007). We have now developed a novel Differential Quantitative LC-MS/MS Proteomics Methodology for the identification and quantitation of key biochemical pathways in fruits (Katz et al., 2010) and applied this methodology to identify determinants of key traits for fruit quality (Katz et al., 2011). We built “biosynthesis maps” that will aid in defining key pathways associated with the development of key fruit quality traits. In addition, we constructed iCitrus (http://wiki.bioinformatics.ucdavis.edu/index.php/ICitrus), a “functional database” that is essentially a web interface to a look-up table that allows users to use functional annotations in the web to identify poorly annotated citrus proteins. This resource will serve as a tool for growers and field extension specialists.
8
Castillo Galindo, Nicolle Tatiana. Contexto de cadena cítricos (Citrus spp.). Corporación colombiana de investigación agropecuaria - AGROSAVIA, 2020. http://dx.doi.org/10.21930/agrosavia.fichascontexto.2020.23.
Full textAbstract:
En esta ficha de contexto se mencionan los aspectos importantes de la cadena de cítricos (Citrus spp.) enfocados a su marco productivo, regional, económico, comercio internacional, así como sus perspectivas y tendencias frente al mercado, dando a conocer su entorno de Ciencia y Tecnología e Innovación.
9
Vandenberg, Ted. Inhibition of Mammary Cancer by Citrus Limonoids. Fort Belvoir, VA: Defense Technical Information Center, August 2001. http://dx.doi.org/10.21236/ada398201.
Full text
10
Taiz, Lincoln. Regulation of Vacuolar pH in Citrus limon. Office of Scientific and Technical Information (OSTI), June 2005. http://dx.doi.org/10.2172/841076.
Full text