Journal articles on the topic 'Castillo de Cardona (Spain)'

To see the other types of publications on this topic, follow the link: Castillo de Cardona (Spain).

Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles

Select a source type:

Consult the top 50 journal articles for your research on the topic 'Castillo de Cardona (Spain).'

Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.

You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.

Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.

1

Casado Arboniés, Manuel. "Un contexto temprano de política educativa regia: El “estudio general” de Alcalá de Henares (1293) = An Early Royal Educational Policy Context: the Study General of Alcalá de Henares (1293)." CIAN-Revista de Historia de las Universidades 21, no. 1 (June 1, 2018): 151. http://dx.doi.org/10.20318/cian.2018.4195.

Full text
Abstract:
Abstract: The University of Alcalá de Henares. In terms of origin it was the fourth to be created in Spain after the short-lived University of Palencia (1212), the University of Salamanca (1218) and the University of Valladolid (1241). The University of Alcalá de Henares with its General or Advanced Studies was founded on 20 May 1293 by the Archbishop of Toledo, Gonzalo Pérez Gudiel, and King Sancho IV by royal privilege. The most distant precedent in at the time of theUniversity have set up from the 13 April 1499 Cardinal Francisco Jiménez de Cisneros.Keywords: Origin, University of Alcalá de Henares, General or Advanced Studies,Sancho IV, Archbishop of Toledo Gonzalo Pérez Gudiel, Cardinal Francisco Jiménez de Cisneros.Resumen: La Universidad de Alcalá de Henares. Su origen histórico la sitúa en cuarto lugar de las creadas en España, después de la de Palencia (1212), la primera pero de muy corta duración, la de Salamanca (1218) y la de Valladolid (1241). La Universidad de Alcalá de Henares, con sus Estudios Generales, -estudios superiores-, fue creada el 20 de mayo de 1293 por el Arzobispo de Toledo GonzaloPérez Gudiel y por el rey de Castilla Sancho IV, por privilegio real. El precedente más alejado en al tiempo de la universidad configuró a partir del 13 de abril de 1499 el Cardenal Francisco Jiménez de Cisneros.Palabras clave: Origen, Universidad de Alcalá de Henares, Estudios Generales, Sancho IV, Arzobispo de Toledo Gonzalo Pérez Gudiel, Cardenal Francisco Jiménez de Cisneros.
APA, Harvard, Vancouver, ISO, and other styles
2

Castillo-Esparcia, Antonio, Ángeles Moreno, and Paul Capriotti-Peri. "Presentación Vol 10 No 19." Relaciones Públicas en tiempos del confinamiento 10, no. 19 (June 26, 2020): 01–06. http://dx.doi.org/10.5783/rirp-19-2020-01-01-06.

Full text
Abstract:
Presentation of the new issue by Dr. Antonio Castillo-Esparcia (University of Malaga, Spain), Dra. Ángeles Moreno (University Rey Juan Carlos, Spain) y Dr. Paul Capriotti-Peri (University Rovira i Virgili, Spain).
APA, Harvard, Vancouver, ISO, and other styles
3

Ramos-Sánchez, Jacobo, Álvaro García-Valero, Ricardo Menor-Albero, María José Tarruella-Rodenas, José Luis Fernández-Terrer, Teodoro Martínez-García, and Jesús Miguel Evangelio-Pinach. "First records of Onychogomphus cazuma Barona, Cardo et Díaz, 2020 (Odonata: Gomphidae) for the Castilla-La Mancha region (Spain)." Anales de Biología, no. 42 (December 2020): 167–71. http://dx.doi.org/10.6018/analesbio.42.18.

Full text
Abstract:
En el presente documento se aportan los primeros datos sobre la biología de Onychogomphus cazuma Barona, Cardo et Díaz, 2020 en la región de Castilla-La Mancha (centro-este de España), confirmando su reproducción en dicho territorio mediante el hallazgo de exuvias y una hembra recién emergida. Hasta la fecha la especie solo se había detectado en la provincia de Valencia, en localidades situadas a más de 100 km. The first data on the biology of Onychogomphus cazuma Barona, Cardo et Díaz, 2020 in Castilla-La Mancha region are provided. Its reproduction in this territory is confirmed by the detection of exuvians and a teneral female. The species had been only detected in the province of Valencia, in locations more than 100 km away.
APA, Harvard, Vancouver, ISO, and other styles
4

Vernuccio, Angelo, and Alexandra Georgescu Paquín. "Creación de un paisaje sonoro como herramienta de mediación y de experiencia de visita. El caso del Castell de Cardona." ROTUR. Revista de Ocio y Turismo 14, no. 1 (January 30, 2020): 72–80. http://dx.doi.org/10.17979/rotur.2020.14.1.5946.

Full text
Abstract:
La museografía inmersiva proporciona un tipo de experiencia centrado en la percepción del visitante, dándole un papel activo en una visita patrimonial. El presente trabajo se plantea como objetivo principal la conceptualización de un recurso de mediación complementario, novedoso y diferenciador, para el entorno patrimonial del castillo de Cardona, fundamentado en el uso de una herramienta de tipo tecnológico, que emplea el sonido inmersivo (binaural ) como medio de transmisión.Para ello se plantean una investigación historiográfica, para determinar nuevos temas interpretativos, una valoración de la actual museografía y de las posibilidades del entorno. Se crean ambientaciones sugerentes, para que el visitante pueda sentirse protagonista de la experiencia de visita y se configura además como un recurso sostenible para el gestor turístico y con un gran potencial comunicativo para la puesta en valor de los elementos patrimoniales.
APA, Harvard, Vancouver, ISO, and other styles
5

Bernaldo de Quirós, Federico, José-Manuel Maíllo-Fernández, Pedro Castaños, and Ana Neira. "The Gravettian of El Castillo revisited (Cantabria, Spain)." Quaternary International 359-360 (March 2015): 462–78. http://dx.doi.org/10.1016/j.quaint.2014.07.060.

Full text
APA, Harvard, Vancouver, ISO, and other styles
6

Mills, Patti A. "FINANCIAL REPORTING AND STEWARDSHIP ACCOUNTING IN SIXTEENTH-CENTURY SPAIN." Accounting Historians Journal 13, no. 2 (September 1, 1986): 65–76. http://dx.doi.org/10.2308/0148-4184.13.2.65.

Full text
Abstract:
This paper examines an early modern contribution to the literature on stewardship accounting, the Tratado de Cuentas or Treatise on Accounts, by Diego del Castillo, a sixteenth-century Spanish jurist.
APA, Harvard, Vancouver, ISO, and other styles
7

Miralles, L., M. Sans, J. J. Pueyo, and P. Santanach. "Recrystallization salt fabric in a shear zone (Cardona diapir, southern Pyrenees, Spain)." Geological Society, London, Special Publications 174, no. 1 (2000): 149–67. http://dx.doi.org/10.1144/gsl.sp.1999.174.01.09.

Full text
APA, Harvard, Vancouver, ISO, and other styles
8

Saurí-Pujol, David, and Joan Carles Llurdés-Coit. "Embellishing nature: the case of the salt mountain project of Cardona, Catalonia, Spain." Geoforum 26, no. 1 (February 1995): 35–48. http://dx.doi.org/10.1016/0016-7185(95)00016-e.

Full text
APA, Harvard, Vancouver, ISO, and other styles
9

Ros-Fábregas, Emilio. "THE CARDONA AND FERNÁNDEZ DE CÓRDOBA COATS OF ARMS IN THE CHIGI CODEX." Early Music History 21 (September 4, 2002): 223–58. http://dx.doi.org/10.1017/s0261127902002061.

Full text
Abstract:
The Chigi Codex occupies a place of honour among music manuscripts of the Renaissance; thirteen masses by Ockeghem along with L'homme armé masses by Josquin, Busnoys, Brumel and Compère figure prominently among its contents. According to Herbert Kellman, it was copied between 1498 and 1503 for the Burgundian nobleman Philippe Bouton. Several coats of arms of the Spanish families Cardona and Fernández de Córdoba appear in different places in the manuscript and Kellman suggested that the transfer of the Chigi Codex to the Spaniards occurred after the death of its first owner in 1515. Seven works, the foliation in the upper right margin of the recto folios and a table of contents with a heading that reads Tabla de missas y motetes were added by a Spanish scribe. Since Mouton's motet Quis dabit oculis, written on the death of Anne of Brittany in 1514, is also among the added works, Kellman concluded that these additions to the Chigi Codex were made after that date. The assumption that the manuscript travelled to Spain is further supported by a seventeenth-century inscription written in Italian on the flyleaf of the manuscript, which affirms that the book was used in Spain.
APA, Harvard, Vancouver, ISO, and other styles
10

Rink, W. J., H. P. Schwarcz, H. K. Lee, V. Cabrera Valdés, F. Bernaldo de Quirós, and M. Hoyos. "ESR dating of Mousterian levels at El Castillo Cave, Cantabria, Spain." Journal of Archaeological Science 24, no. 7 (July 1997): 593–600. http://dx.doi.org/10.1006/jasc.1996.0143.

Full text
APA, Harvard, Vancouver, ISO, and other styles
11

Loira. "Imagining Public Libraries in Sixteenth-Century Spain: Juan Páez de Castro and Juan Bautista Cardona." Pacific Coast Philology 52, no. 2 (2017): 184. http://dx.doi.org/10.5325/pacicoasphil.52.2.0184.

Full text
APA, Harvard, Vancouver, ISO, and other styles
12

d'Errico, Francesco, Laure Dayet Bouillot, Marcos García-Diez, Africa Pitarch Martí, Daniel Garrido Pimentel, and João Zilhão. "The technology of the earliest European cave paintings: El Castillo Cave, Spain." Journal of Archaeological Science 70 (June 2016): 48–65. http://dx.doi.org/10.1016/j.jas.2016.03.007.

Full text
APA, Harvard, Vancouver, ISO, and other styles
13

Garralda, María‐Dolores, José‐Manuel Maíllo‐Fernández, Thomas Higham, Ana Neira, and Federico Bernaldo de Quirós. "The Gravettian child mandible from El Castillo Cave (Puente Viesgo, Cantabria, Spain)." American Journal of Physical Anthropology 170, no. 3 (August 8, 2019): 331–50. http://dx.doi.org/10.1002/ajpa.23906.

Full text
APA, Harvard, Vancouver, ISO, and other styles
14

Reina, J., G. Morilla, E. R. Bejarano, M. D. Rodríguez, and D. Janssen. "First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus." Plant Disease 83, no. 12 (December 1999): 1176. http://dx.doi.org/10.1094/pdis.1999.83.12.1176d.

Full text
Abstract:
Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.
APA, Harvard, Vancouver, ISO, and other styles
15

Батурин, Алексей, and Aleksey Baturin. "Event tourism and event management according to the materials of historical reconstruction in Spain." Servis Plus 10, no. 2 (July 4, 2016): 80–86. http://dx.doi.org/10.12737/19461.

Full text
Abstract:
The article analyzes the experience of the organization of event tourism and event management in the framework of the historical reconstruction in Spain. For consideration of the involved material of historical reenactment at Castillo Conde de Alfaz and Villajoyosa, which is part of the popular tourist centre of Spain. These tourist destinations are located in the area of Benidorm, attracting a large number of Spanish and foreign tourists, not only due to the unique natural conditions (combination of sea beaches, mountains and numerous cultural and commercial centre of Benidorm), but also due to the possibility to dive into one of the most striking historical eras of Spain – ​middle Ages, thanks to well-organized historical reconstruction. The article considers the main forms and methods of historical reconstruction, contributing to the successful promotion of tourism products. The material can serve as a guide for organizers of tourism and potential tourists interested in the history and culture of Spain.
APA, Harvard, Vancouver, ISO, and other styles
16

Jurado, Valme, Jose Luis Gonzalez-Pimentel, Angel Fernandez-Cortes, Tamara Martin-Pozas, Roberto Ontañon, Eduardo Palacio, Bernardo Hermosin, Sergio Sanchez-Moral, and Cesareo Saiz-Jimenez. "Early Detection of Phototrophic Biofilms in the Polychrome Panel, El Castillo Cave, Spain." Applied Biosciences 1, no. 1 (April 19, 2022): 40–63. http://dx.doi.org/10.3390/applbiosci1010003.

Full text
Abstract:
European caves contain some of the world’s greatest Paleolithic paintings, and their conservation is at risk due to the use of artificial lighting. Both lighting and high CO2 promotes the growth of phototrophic organisms on walls, speleothems and ground sediments. In addition, the combined effect of increases in CO2, vapor concentration and temperature variations induced by visitors can directly affect the development of corrosion processes on the cave rock surfaces. An early detection of the occurrence of phototrophic biofilms on Paleolithic paintings is of the utmost importance, as well as knowing the microorganisms involved in the colonization of rocks and walls. Knowledge of the colonizing species and their ecology will allow the adoption of control measures. However, this is not always possible due to the limited amount of biomass available for molecular analyses. Here, we present an alternative approach to study faint green biofilms of Chlorophyta in the initial stage of colonization on the Polychrome Panel in El Castillo Cave, Cantabria, Spain. The study of the biofilms collected on the rock art panel and in the ground sediments revealed that the lighting of the cave promoted the development of the green algae Jenufa and Coccomyxa, as well as of complex prokaryotic and eukaryotic communities, including amoebae, their endoparasites and associated bacteria and fungi. The enrichment method used is proposed as a tool to overcome technical constraints in characterizing biofilms in the early stages, allowing a preliminary characterization before deciding for direct or indirect interventions in the cave.
APA, Harvard, Vancouver, ISO, and other styles
17

Ripoll, Sergio, Vicente Bayarri, Francisco J. Muñoz, Ricardo Ortega, Elena Castillo, José Latova, Jesús Herrera, David Moreno-Salinas, and Ignacio Martín. "Hands Stencils in El Castillo Cave (Puente Viesgo, Cantabria, Spain). An Interdisciplinary Study." Proceedings of the Prehistoric Society 87 (October 11, 2021): 51–71. http://dx.doi.org/10.1017/ppr.2021.11.

Full text
Abstract:
Our Palaeolithic ancestors did not make good representations of themselves on the rocky surfaces of caves and barring certain exceptions – such as the case of La Marche (found on small slabs of stone or plaquettes) or the Cueva de Ambrosio – the few known examples can only be referred to as anthropomorphs. As such, only hand stencils give us a real picture of the people who came before us. Hand stencils and imprints provide us with a large amount of information that allows us to approach not only their physical appearance but also to infer less tangible details, such as the preferential use of one hand over the other (i.e., handedness). Both new and/or mature technologies as well as digital processing of images, computers with the ability to process very high resolution images, and a more extensive knowledge of the Palaeolithic figures all help us to analyse thoroughly the hands in El Castillo cave. The interdisciplinary study presented here contributes many novel developments based on real data, representing a major step forward in knowledge about our predecessors.
APA, Harvard, Vancouver, ISO, and other styles
18

Rink, W. J., H. P. Schwarcz, H. K. Lee, V. Cabrera Valdés, F. Bernaldo de Quirós, and M. Hoyos. "ESR Dating of Tooth Enamel: Comparison with AMS14C at El Castillo Cave, Spain." Journal of Archaeological Science 23, no. 6 (November 1996): 945–51. http://dx.doi.org/10.1006/jasc.1996.0088.

Full text
APA, Harvard, Vancouver, ISO, and other styles
19

Сим, Надежда Михайловна. "An Architectural Scenography of the Humanist Ideas of the Spanish Renaissance." Академический вестник УралНИИпроект РААСН, no. 2(53) (June 30, 2022): 57–66. http://dx.doi.org/10.25628/uniip.2022.53.2.009.

Full text
Abstract:
В статье рассматривается историческая роль кардинала Педро Гонсалеса де Мендосы и его наследников как меценатов и благотворителей, которые, подобно Медичи, внесли богатый вклад в культурное наследие испанского Возрождения. На примерах культовой и дворцовой архитектуры Кастилии и Андалусии, где Мендосы выступали основными заказчиками и авторами проектов, проанализирован поиск художественных тенденций от строгого следования итальянским образцам до синтеза восточных и западных культур, определивших в итоге характерные национальные черты иберийской архитектуры. The article examines the activities of Cardinal Pedro González de Mendoza and his heirs as patrons and benefactors of Spain, who, like the Medici family, made their rich contribution to the cultural heritage of the Spanish Renaissance. Considering the examples of cult and palace architecture of Castile and Andalusia, where the Mendoza family acted as major customers and designers, the author explores the processes of searching for artistic trends, from strict adherence to Italian models to the harmonious synthesis of Eastern and Western cultures. This determined the characteristic national features of Iberian architecture.
APA, Harvard, Vancouver, ISO, and other styles
20

JORDANA, RAFAEL, and ENRIQUE BAQUERO. "Two new species of Entomobrya (Collembola, Entomobryomorpha) from the cave collembolan collection of Bonet from Asturias and Cantabria (north of Spain)." Zootaxa 1153, no. 1 (March 17, 2006): 17. http://dx.doi.org/10.11646/zootaxa.1153.1.2.

Full text
Abstract:
Two new species of Entomobrya are described from two caves of Asturias and Cantabria (north of Spain). The specimens were found in the Bonet collembolan collection at the “Museo Nacional de Ciencias Naturales” of Madrid (Spain). Entomomobrya boneti n. sp. was found in three slides containing 11, 4 and 1 specimens respectively, from the “Cueva del Castillo”, Puente el Viesgo (Santander). Entomobrya luquei n. sp. was found in a slide with 11 specimens from “Cueva de Cuetu-Lledías”, Llanes (Asturias). The species are described considering a set of 39 morphological and chaetotaxy characters. Both species appear to be troglophiles by the pigment reduction, although there are no other troglomorphic characters present. The gut content is composed of organic matter and fungus spores.
APA, Harvard, Vancouver, ISO, and other styles
21

ChiMón, Palma, Francisco B. Ortega, Jonatan R. Ruiz, Ilse De Bourdeaudhuij, David Martínez-Gómez, Germán Vicente-Rodriguez, Kurt Widhalm, et al. "Active Commuting and Physical Activity in Adolescents From Europe: Results From the HELENA Study." Pediatric Exercise Science 23, no. 2 (May 2011): 207–17. http://dx.doi.org/10.1123/pes.23.2.207.

Full text
Abstract:
Chillón and Ruiz are with the Department of Physical Education and Sport, University of Granada, Spain. Chillón and Ward are with the Center for Health Promotion and Disease Prevention, University of North Carolina at Chapel Hill, NC, USA. Ortega, Ruiz and Sjöström are with the Unit for Preventive Nutrition, Department of Biosciences and Nutrition, Karolinska Institutet, Sweden. Ortega and Castillo are with the Department of Medical Physiology, University of Granada, Spain. De Bourdeaudhuij is with the Department of Movement and Sport Sciences, Ghent University, Belgium. Martínez-Gómez is with the Immunonutrition Research Group, Department of Metabolism and Nutrition, ICTAN, Spanish National Research Council (CSIC), Spain. Vicente-Rodríguez and Moreno are with Growth, Exercise, Nutrition and Development (GENUD) Research Group, Universidad de Zaragoza, Spain. Widhalm is with the Department of Paediatrics, Division of Clinical Nutrition, Medical University of Vienna, Austria. Molnar is with the Deprtment of Paediatrics, Clinical Center, University of Pécs, Hungary. Gottrand is with Inserm U995, University Lille2 and CIC-9301-CH&U-Inserm, University Hospital of Lille, France. González-Gross is with the Department of Health and Human Performance, Universidad Politécnica de Madrid, Spain.
APA, Harvard, Vancouver, ISO, and other styles
22

Mottershead, D. N., W. J. Duane, R. J. Inkpen, and J. S. Wright. "An investigation of the geometric controls on the morphological evolution of small-scale salt terrains, Cardona, Spain." Environmental Geology 53, no. 5 (April 20, 2007): 1091–98. http://dx.doi.org/10.1007/s00254-007-0736-4.

Full text
APA, Harvard, Vancouver, ISO, and other styles
23

Cardona Linares, Antonio José, Julio Ángel Herrador Sánchez, and África Calvo Lluch. "Descripción de la metodología aplicada en una investigación cualitativa en Expresión Corporal y Danza: la vida y obra de Patricia Stokoe (Description of the methodology applied in a qualitative research in Body Expression and Dance: the life and work of." Retos 45 (January 16, 2022): 1–11. http://dx.doi.org/10.47197/retos.v45i0.91423.

Full text
Abstract:
Los inicios de la Expresión Corporal (EC) han sido y están siendo analizados desde diferentes perspectivas. Este trabajo ha pretendido profundizar en los comienzos acaecidos a lo largo del siglo XX, en donde esta disciplina emergente se nutrió de múltiples fuentes: de lo social, las artes, la educación, la psicología, etc. Patricia Stokoe (1919-1996), dedicó su vida al estudio de la Expresión Corporal-Danza (ECy D). Considerada como una de las iniciadoras en este campo (Kalmar, 2005; Cardona, 2009; Ruano & Sánchez, 2009). Su obra sigue siendo referente en la actualidad y está presente en gran parte de la producción científica que se genera en esta disciplina. Es la investigación de Cardona (2009), en donde se ha profundizado en el estudio de la vida y la obra de la autora. Exponemos aquí cómo se llevó a cabo dicha investigación cualitativa. Se hizo un tratamiento descriptivo transversal, utilizando el análisis de documentos y las entrevistas. Realizamos más de treinta entrevistas entre Buenos Aires y España. Estableciéndose 4 dimensiones/campos que aportaron estructura y claridad al estudio: análisis de la vida; análisis de las influencias en la vida y la obra; análisis de la obra; ensayo bibliográfico de la obra. Se obtuvieron unos resultados y conclusiones que convierte a Patricia Stokoe en una de las pioneras en la construcción y génesis de la Expresión Corporal. Abstract: The beginnings of corporal expression have been and are being analyzed from different perspectives. This work has attempted to delve into the beginnings that occurred throughout the 20th century, when this emerging discipline was nourished by multiple sources: society, arts, education, psychology, etc. Patricia Stokoe (1919-1996), devoted her life to the study of body language-dance. Considered one of the initiators in this field (Kalmar, 2005; Cardona, 2009; Ruano & Sánchez, 2009), her work continues to be a reference nowadays and it is present in a large part of the scientific production generated in this discipline. It is in the research by Cardona (2009), who carried out a doctoral thesis, where the study of the life and work of the author has been deepened. We present here how this qualitative research was carried out. A cross-sectional descriptive treatment was carried out, using the analysis of documents and interviews. We conducted more than thirty interviews between Buenos Aires and Spain, establishing 4 dimensions / fields that provided structure and clarity to the study: life analysis; analysis of the influences on life and work; analysis of the work; bibliographic essay of the work. We obtained results that make the life and work of Patricia Stokoe one of the pioneers in the construction and genesis of corporal expression.
APA, Harvard, Vancouver, ISO, and other styles
24

Madrid de la Fuente, Carmen, and Francisco Montes Tubío. "Reconstrucción fotorrealista tridimensional del castillo de Aguilar de la Frontera (Córdoba)." Virtual Archaeology Review 1, no. 1 (April 11, 2010): 129. http://dx.doi.org/10.4995/var.2010.5133.

Full text
Abstract:
<p>The object of the present work is the obtaining photorrealistic images of Aguilar de la Frontera's castle (Cordoba) of which only some ruins remain in the hill on which it was settled. The study of the archaeological raisings of Aguilar's castle together with the review of the documents that describe it and the engravings that exist on it have constituted the documentary base for its virtual reconstruction. From this information we have made a three-dimensional model which has been used as base for the obtaining of the photorrealistic images of the castle. The virtual reconstruction obtained does not try to be the final resolution of the structures of Aguilar's castle but it’s the first milestone in the reconstruction work of one of the most beautiful castles in Spain..</p>
APA, Harvard, Vancouver, ISO, and other styles
25

ORTIZ ZAMORA, FRANCISCO JOSE, CARMEN LADRON DE GUEVARA MUÑOZ, LAIA MIRAVET GARRET, JORGE PEREZ GARCIA, RAFAEL MARTIN DOMINGUEZ, JAVIER SALGADO FERNANDEZ, and ANGEL LORA NUÑEZ. "AUGMENTED REALITY APPLIED TO THE RESTORATION OF HISTORICAL HERITAGE." DYNA 98, no. 1 (January 1, 2023): 86–90. http://dx.doi.org/10.6036/10651.

Full text
Abstract:
Spain occupies a prominent position among the countries with the most UNESCO World Heritage Sites. The possibilities offered by the application of AR-VR technologies for some of these elements’ virtual reconstruction brings a great opportunity to give visibility and support the transmission of cultural heritage, especially in those cases where physical restoration is not possible. It is increasingly common to find virtual reconstructions of monuments, since these do not damage either put at risk the element being represented. In this work, the process of modelling and reconstructing the Castillo de la Estrella, located in the town of Teba (Malaga), as well as the subsequent development of an Augmented Reality application is presented. This allows the Castillo de la Estrella reconstruction to be displayed virtually on mobile devices such as smartphones or tablets, and might potentially be implemented in the museum that houses the castle itself, providing a tool that improves the visitor experience and completes the range of cultural activities carried out in the monument. Keywords: Augmented Reality, Virtual Reality, Historical Heritage, 3D Modelling
APA, Harvard, Vancouver, ISO, and other styles
26

Bayarri, Vicente, Elena Castillo, Sergio Ripoll, and Miguel A. Sebastián. "Improved Application of Hyperspectral Analysis to Rock Art Panels from El Castillo Cave (Spain)." Applied Sciences 11, no. 3 (February 1, 2021): 1292. http://dx.doi.org/10.3390/app11031292.

Full text
Abstract:
Rock art is one of the most fragile and relevant cultural phenomena in world history, carried out in shelters or the walls and ceilings of caves with mineral and organic substances. The fact it has been preserved until now can be considered as fortunate since both anthropogenic and natural factors can cause its disappearance or deterioration. This is the reason why rock art needs special conservation and protection measures. The emergence of digital technologies has made a wide range of tools and programs available to the community for a more comprehensive documentation of rock art in both 2D and 3D. This paper shows a workflow that makes use of visible and near-infrared hyperspectral technology to manage, monitor and preserve this appreciated cultural heritage. Hyperspectral imaging is proven to be an efficient tool for the recognition of figures, coloring matter, and state of conservation of such valuable art.
APA, Harvard, Vancouver, ISO, and other styles
27

Eguíluz, L., A. Apraiz, and B. Ábalos. "Structure of the Castillo granite, Southwest Spain: Variscan deformation of a late Cadomian pluton." Tectonics 18, no. 6 (December 1999): 1041–63. http://dx.doi.org/10.1029/1999tc900037.

Full text
APA, Harvard, Vancouver, ISO, and other styles
28

Fisher, John. "The True History of The Conquest of New Spain - by Díaz del Castillo, Bernal." Bulletin of Latin American Research 33, no. 4 (September 3, 2014): 484–85. http://dx.doi.org/10.1111/blar.12212.

Full text
APA, Harvard, Vancouver, ISO, and other styles
29

Valdes, Victoria Cabrera, and James L. Bischoff. "Accelerator 14C dates for early upper paleolithic (basal Aurignacian) at El Castillo Cave (Spain)." Journal of Archaeological Science 16, no. 6 (November 1989): 577–84. http://dx.doi.org/10.1016/0305-4403(89)90023-x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
30

Bischoff, James L., Jose Francisco Garcia, and Lawrence G. Straus. "Uranium-series isochron dating at El Castillo Cave (Cantabria, Spain): The “Acheulean”/“Mousterian” question." Journal of Archaeological Science 19, no. 1 (January 1992): 49–62. http://dx.doi.org/10.1016/0305-4403(92)90006-o.

Full text
APA, Harvard, Vancouver, ISO, and other styles
31

Rodriguez-Lloveras, Xavier, Carolina Puig-Polo, Nieves Lantada, Jose A. Gili, and Jordi Marturià. "Two decades of GPS/GNSS and DInSAR monitoring of Cardona salt mines (NE of Spain) – natural and mining-induced mechanisms and processes." Proceedings of the International Association of Hydrological Sciences 382 (April 22, 2020): 167–72. http://dx.doi.org/10.5194/piahs-382-167-2020.

Full text
Abstract:
Abstract. Cardona area presents surface rising and subsidence active movements. In 1999 a series of sinkholes appeared due to the infiltration of Cardener River water into the mine tunnels, damaging surface infrastructures. Since then, high precision GNSS/GPS was used annually to position a network of 40 points spread over the area. GNSS/GPS work is carried out with the Fast-Static (FS) method. Additionally the surface movements have been monitored with satellite Differential Interferometry Synthetic Aperture Radar (DInSAR). Results indicate that the movement has a complex spatial distribution although consistent along time. Some areas show surface rising during the last two decades, while other areas show subsidence. The use of the two techniques allowed to determine the most plausible causes of these movements generated by a set of interwoven natural and human-induced complex processes.
APA, Harvard, Vancouver, ISO, and other styles
32

Lucha, P., F. Cardona, F. Gutiérrez, and J. Guerrero. "Natural and human-induced dissolution and subsidence processes in the salt outcrop of the Cardona Diapir (NE Spain)." Environmental Geology 53, no. 5 (April 12, 2007): 1023–35. http://dx.doi.org/10.1007/s00254-007-0729-3.

Full text
APA, Harvard, Vancouver, ISO, and other styles
33

Dias, I., I. Gonzalez, S. Prates, and E. Galan. "Palygorskite occurrences in the Portuguese sector of the Tagus basin: a preliminary report." Clay Minerals 32, no. 2 (June 1997): 323–28. http://dx.doi.org/10.1180/claymin.1997.032.2.14.

Full text
Abstract:
Palygorskite and sepiolite occurrences and deposits are frequent in the Iberian Peninsula, mainly in the Tagus basin, in central Spain and Portugal (Galán & Castillo, 1984).In Portugal, the first palygorskite occurrence was reported by Carvalho (1964) in the region of Ponte do Sor, Tagus basin, in Paleogene sediments. Later, Carvalho (1968) reported palygorskite occurrences in coarse detrital sediments that were occasionally carbonatic or hardened by silicification, and built up the Cenozoic base for the Tagus and Sado basins. Carvalho referred to such formations as the 'Attapulgite complex'. Overlying this attapulgite complex is the 'Montmorillonite complex', probably of Miocene age.
APA, Harvard, Vancouver, ISO, and other styles
34

Glazer-Eytan, Yonatan. "Conversos, Moriscos, and the Eucharist in Early Modern Spain: Some Reflections on Jewish Exceptionalism." Jewish History 35, no. 3-4 (December 2021): 265–91. http://dx.doi.org/10.1007/s10835-021-09424-0.

Full text
Abstract:
AbstractSacrilegious attitudes toward the Eucharistic host are one of the most commonplace accusations leveled against Jews in premodern Europe. Usually treated in Jewish historiography as an expression of anti-Judaism or antisemitism, they are considered a hallmark of Jewish powerlessness and persecution. In medieval and early modern Spain, however, Jews and conversos (Jewish converts to Christianity and their descendants) were not the only proclaimed enemies of the Eucharist. Reports about avoidance, rejection, criticism, and even ridicule and profanation of the consecrated host were similarly leveled against Muslims and moriscos (Muslim converts to Christianity). This essay seeks to assess the parallels and connections between the two groups through a comparative examination of accusations of sacrilegious behavior towards the host. The first part of the essay analyzes religious art, legal compendia, and inquisitorial trials records from the tribunals of Toledo and Cuenca in order to show some evident homologies between the two groups. The second part of the essay focuses on the analysis of the works of Jaime Bleda and Pedro Aznar y Cardona, two apologists of the expulsion of the moriscos, and draws direct connections between Jewish and morisco sacrilege. By exploring the similarities and differences between accusations against conversos and moriscos, this essay aims to offer a broader reflection on Jewish exceptionalism.
APA, Harvard, Vancouver, ISO, and other styles
35

Luret, Mathieu, Ariane Burke, Federico Bernaldo de Quiros, and Marie Besse. "El Castillo cave (Cantabria, Spain): Archeozoological comparison between the Mousterian occupation level (unit 20) and the “Aurignacien de transition de type El Castillo” (unit 18)." Journal of Archaeological Science: Reports 31 (June 2020): 102339. http://dx.doi.org/10.1016/j.jasrep.2020.102339.

Full text
APA, Harvard, Vancouver, ISO, and other styles
36

Lindberg, Svante. "Michel del Castillo’s Works in Sweden and Spain: Translation and Reception." Moderna Språk 110, no. 3 (December 5, 2016): 132–48. http://dx.doi.org/10.58221/mosp.v110i3.7831.

Full text
Abstract:
In this study the translations and the reception in Sweden and Spain of the works of the French language author of Spanish origin, Michel del Castillo, are examined in the light of two concepts in the sociology of literature: consecration and legitimization. Consecration refers to the status accorded to an author by means of acts of recognition (literary prizes, etc.) while legitimization refers to the active part played by an author in the literary debate in a certain society. Whereas the first is a single, irrevocable act, the second is of longer duration but is subject to change. The books published in Michel del Castillo's early career (the late nineteen fifties and early sixties) made him a legitimized author in Sweden at that time. In Spain he did not become a legitimized author until the early years of the new millennium, when his subject matter coincided with the topics addressed in many other Spanish novels written at that time.
APA, Harvard, Vancouver, ISO, and other styles
37

Sanz de Ojeda, P., E. Sanz, R. Galindo, J. I. Escavy, and I. Menéndez-Pidal. "Retrospective analysis of the Pico del Castillo de Vinuesa large historical landslide (Cordillera Iberica, Spain)." Landslides 17, no. 12 (June 18, 2020): 2837–48. http://dx.doi.org/10.1007/s10346-020-01459-7.

Full text
APA, Harvard, Vancouver, ISO, and other styles
38

Prevedorou, Eleanna, Marta Díaz-Zorita Bonilla, Alejandro Romero, Jane E. Buikstra, M. Paz de Miguel Ibáñez, and Kelly J. Knudson. "Residential Mobility and Dental Decoration in Early Medieval Spain: Results from the Eighth Century Site of Plaza del Castillo, Pamplona." Dental Anthropology Journal 23, no. 2 (September 2, 2018): 42–52. http://dx.doi.org/10.26575/daj.v23i2.74.

Full text
Abstract:
Excavations at Plaza del Castillo in Pamplona (northern Spain) revealed a large Islamic necropolis dating to the eighth century A.D., including the skeleton of an adult female showing intentional dental modification (PLA-159). While the practice of dental decoration was virtually absent in Medieval Spain, it is common in Africa and suggests that this individual was born in Africa and brought to Spain later in life. The historically documented occupation of Pamplona by Muslim groups from northern Africa between ca. 715 and 799 A.D. also supports an African origin. As an additional line of evidence, we investigated the geographic origins of two individuals from the cemetery, including PLA-159, via radiogenic strontium and stable oxygen isotope analyses on enamel hydroxyapatite. The human isotopic signatures were measured following established methodologies and compared to the local geochemical composition and modern precipitation values. The data analysis showed a non-local isotopic signature for both individuals, suggesting that they moved to Pamplona following childhood, probably from northern Africa, during the Islamization of the city. Stable carbon isotope analysis revealed a diet heavily based on C3 terrestrial plants. Overall, this preliminary data set exemplifies the use of biogeochemistry as an analytical tool, and provides unique insight about the diffusion of Muslim groups into the Early Medieval Iberian Peninsula.
APA, Harvard, Vancouver, ISO, and other styles
39

Rabazo-Rodríguez, Ana María, Mario Modesto-Mata, Lucía Bermejo, and Marcos García-Díez. "New data on the sexual dimorphism of the hand stencils in El Castillo Cave (Cantabria, Spain)." Journal of Archaeological Science: Reports 14 (August 2017): 374–81. http://dx.doi.org/10.1016/j.jasrep.2017.06.022.

Full text
APA, Harvard, Vancouver, ISO, and other styles
40

Fernández-Contreras, M. M., L. Cardona, C. H. Lockyer, and A. Aguilar. "Incidental bycatch of short-beaked common dolphins (Delphinus delphis) by pairtrawlers off northwestern Spain." ICES Journal of Marine Science 67, no. 8 (June 16, 2010): 1732–38. http://dx.doi.org/10.1093/icesjms/fsq077.

Full text
Abstract:
Abstract M. M. Fernández-Contreras, L. Cardona, C. H. Lockyer, and A. Aguilar. 2010. Incidental bycatch of short-beaked common dolphins (Delphinus delphis) by pairtrawlers off northwestern Spain. – ICES Journal of Marine Science, 67: 1732–1738. The numbers of short-beaked common dolphins captured annually by pairtrawlers operating off Galicia (northwestern Spain) and the operational factors influencing the bycatch were evaluated using on-board observations. Hauling time, fishing depth, and season of the year were identified as the key factors involved in the incidental capture. The dolphins were most vulnerable to trawls at night from May to September, around the continental shelf break. Most of the dolphins in the bycatch were males, and the average age was 13.4 ± 4.4 years for males and 11.5 ± 4.8 years for females. The sex ratio was male-biased owing to a few capture events involving several males each, supporting the notion that bachelor groups exist in the area. The annual bycatch in 2001 and 2002 was an estimated 394 dolphins [95% confidence interval (CI) 230–632], most taken from May to September (mean 348 dolphins, 95% CI 200–590) and just a few from October to April (mean 46 dolphins, 95% CI 0–132). This level of bycatch could be reduced significantly if trawlers were restricted to operating in water deeper than 250 m and likely avoided entirely if they were restricted to water deeper than 300 m.
APA, Harvard, Vancouver, ISO, and other styles
41

Dayet, Laure, Francesco d’Errico, Marcos García Diez, and João Zilhão. "Critical evaluation of in situ analyses for the characterisation of red pigments in rock paintings: A case study from El Castillo, Spain." PLOS ONE 17, no. 1 (January 24, 2022): e0262143. http://dx.doi.org/10.1371/journal.pone.0262143.

Full text
Abstract:
Paint technology, namely paint preparation and application procedures, is an important aspect of painting traditions. With the expansion of archaeometric studies and in situ non-destructive analytical methods, a renewal of technological studies is being observed in rock art. In situ analyses have several limitations that are widely discussed in the literature, however. It is not yet clear whether they provide accurate information on paint technology, except under certain conditions. Here, we evaluated digital microscopic and pXRF in situ analyses for the characterisation of a large set of red and yellow paintings from the El Castillo cave, Cantabria, Spain. We have set experiments and used statistical methods to identify differences between paint components and determine factors impacting pXRF measurements. We found that the compositional heterogeneity of the paintings’ environment, especially variations in secondary deposits, was responsible for most of the differences observed between the pXRF signals recorded on the paintings. We concluded that the El Castillo cave environment is not suitable for non-destructive technological studies, but that more favourable contexts might exist. Following previous works and our own results, we advocate a combination of both in situ and laboratory invasive analyses for the study of paint composition and paint technology. Our research protocol, based on the comparison of rock paintings, their substrate, experimental paintings and Fe-normalisation of the signals can improve the reliability of pXRF results. We also propose to include more systematic characterisation of rock wall heterogeneity and the use of microscopic analyses in non-destructive approaches.
APA, Harvard, Vancouver, ISO, and other styles
42

Pérez Azcárate, Marta, Susana Duque Valero, Joan Ramon Aromi Folch, and Marc Campeny Creco. "The showcase of salt rocks from Cardona in the Barcelona Natural Sciences Museum: conservation and adaptation for passive climate control." Ge-conservacion 24, no. 1 (November 3, 2023): 110–20. http://dx.doi.org/10.37558/gec.v24i1.1198.

Full text
Abstract:
The results of the conservation work carried out on an exhibition set-up dating from the early twentieth century are presented. The exhibition set-up consists of a wooden showcase containing about twenty evaporite rocks from the collection of the Museu de Ciències Naturals de Barcelona (Spain). The work involved the remedial conservation of the rock specimens and showcase, and the improvement of the original environmental control system using sustainability criteria. An interdisciplinary team worked on the different phases of the project, which included prior historical and environmental studies. The remedial conservation of all elements in the collection has improved its accessibility and the monitoring of the environmental conditions of the new installation has confirmed the efficiency of the proposed passive environmental control system.
APA, Harvard, Vancouver, ISO, and other styles
43

Bayarri, Vicente, Elena Castillo, Sergio Ripoll, and Miguel A. Sebastián. "Control of Laser Scanner Trilateration Networks for Accurate Georeferencing of Caves: Application to El Castillo Cave (Spain)." Sustainability 13, no. 24 (December 7, 2021): 13526. http://dx.doi.org/10.3390/su132413526.

Full text
Abstract:
There is a growing demand for measurements of natural and built elements, which require quantifiable accuracy and reliability, within various fields of application. Measurements from 3D Terrestrial Laser Scanner come in a point cloud, and different types of surfaces such as spheres or planes can be modelled. Due to the occlusions and/or limited field of view, it is seldom possible to survey a complete feature from one location, and information has to be acquired from multiple points of view and later co-registered and geo-referenced to obtain a consistent coordinate system. The aim of this paper is not to match point clouds, but to show a methodology to adjust, following the traditional topo-geodetic methods, 3DTLS data by modelling references such as calibrated spheres and checker-boards to generate a 3D trilateration network from them to derive accuracy and reliability measurements and post-adjustment statistical analysis. The method tries to find the function that best fits the measured data, taking into account not only that the measurements made in the field are not perfect, but that each one of them has a different deviation depending on the adjustment of each reference, so they have to be weighted accordingly.
APA, Harvard, Vancouver, ISO, and other styles
44

Bassett, Molly H. "The History of the Conquest of New Spain - By Bernal Díaz del Castillo. Edited by Davíd Carrasco." Religious Studies Review 36, no. 4 (December 2010): 305. http://dx.doi.org/10.1111/j.1748-0922.2010.01471_1.x.

Full text
APA, Harvard, Vancouver, ISO, and other styles
45

RODRIGUEZ, S. "Taphonomic alterations in upper Viséan dissepimented rugose corals from the Sierra del Castillo unit (Carboniferous, Córdoba, Spain)." Palaeogeography, Palaeoclimatology, Palaeoecology 214, no. 1-2 (November 4, 2004): 135–53. http://dx.doi.org/10.1016/s0031-0182(04)00396-7.

Full text
APA, Harvard, Vancouver, ISO, and other styles
46

Rodríguez, Sergio. "Taphonomic alterations in upper Viséan dissepimented rugose corals from the Sierra del Castillo unit (Carboniferous, Córdoba, Spain)." Palaeogeography, Palaeoclimatology, Palaeoecology 214, no. 1-2 (November 2004): 135–53. http://dx.doi.org/10.1016/j.palaeo.2004.07.026.

Full text
APA, Harvard, Vancouver, ISO, and other styles
47

Domingo, Rafael, José Luis Peña-Monné, Trinidad de Torres, J. Eugenio Ortiz, and Pilar Utrilla. "Neanderthal highlanders: Las Callejuelas (Monteagudo del Castillo, Teruel, Spain), a high-altitude site occupied during MIS 5." Quaternary International 435 (April 2017): 129–43. http://dx.doi.org/10.1016/j.quaint.2015.09.088.

Full text
APA, Harvard, Vancouver, ISO, and other styles
48

Lozano, G., E. Moriones, and J. Navas-Castillo. "First Report of Sweet Pepper (Capsicum annuum) as a Natural Host Plant for Tomato chlorosis virus." Plant Disease 88, no. 2 (February 2004): 224. http://dx.doi.org/10.1094/pdis.2004.88.2.224a.

Full text
Abstract:
Since 1997, epidemics of a tomato yellowing disease have occurred in the Málaga and Almería provinces of southern Spain. These epidemics have been associated with infections of Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) (2). During the past few years, an increasing incidence of the disease was observed and it spread to new areas including eastern Spain and the Balearic and Canary Islands (G. Lozano, E. Moriones, and J. Navas-Castillo, unpublished results and [1]). In 1999, plants of sweet pepper (Capsicum annuum L.) exhibiting symptoms of interveinal yellowing, mild upward leaf curling, and stunting were observed in greenhouses of Almería that were heavily infested with the whitefly, Bemisia tabaci. Symptomatic plants were tested for the presence of the begomovirus, Tomato yellow leaf curl virus, a virus previously reported in sweet pepper (3) by molecular hybridization or polymerase chain reaction (PCR). Some of these plants tested positive. Total RNA extracts from the symptomatic plants were also analyzed for the presence of tomato criniviruses using reverse transcription (RT)-PCR with primers MA59 and MA60 for the HSP70h gene (2). A PCR DNA product of the expected size (587 bp) was obtained from several samples. The cloning and sequencing of the PCR product obtained from one of these samples confirmed the presence of ToCV, with a sequence 100% identical to the equivalent region of the first ToCV isolated from tomato in Málaga (2). Total RNA extracts from plants that tested positive using RT-PCR were also positive with molecular hybridization using a probe for the HSP70h gene of ToCV. To our knowledge, this is the first report of sweet pepper as a natural host of a tomato crinivirus, which may have important epidemiological consequences in regions where both crops are grown. Association between ToCV infection and specific symptoms observed in sweet pepper plants is under study. References: (1) M. I. Font et al. Bol. San. Veg. Plagas 29:109, 2003. (2) J. Navas-Castillo et al. Plant Dis. 84:835, 2000. (3) J. Reina et al. Plant Dis. 83:1176, 1999.
APA, Harvard, Vancouver, ISO, and other styles
49

Minwer-Barakat, Raef, Antonio García-Alix, and Elvira Martín Suárez. "Validation of the species Stephanomys progressus, a murid (Rodentia) from the early Pleistocene of Spain." Journal of Paleontology 85, no. 2 (March 2011): 392–94. http://dx.doi.org/10.1666/10-131.1.

Full text
Abstract:
The genus Stephanomys (Muridae, Rodentia) is one of the most common elements in the late Miocene to Early Pleistocene mammal faunas from the Ibero-Occitan region. Its geographic distribution is limited to this area with only two mentions in the late Miocene of Italy (de Giuli, 1989) and Algeria (Coiffait et al., 1985). The genus has been subject of numerous studies, some of them suggesting different interpretations on the phylogenetic relationships between the various described species (Gmelig-Meyling and Michaux, 1973; Cordy, 1978; Adrover, 1986; Bachelet and Castillo-Ruiz, 1990; Aguilar et al., 1993). The most extensive and significant study of the genus is the Ph.D. dissertation of Cordy (1976), who studied in detail several samples of Stephanomys, analyzed the changes observed in successive populations and defined four species (S. medius, S. michauxi, S. thaleri and S. progressus), which are considered as nomina nuda because this work was never published. Only one of these species, S. thaleri from the French locality of Seynes, was validated later by López-Martinez et al. (1998).
APA, Harvard, Vancouver, ISO, and other styles
50

Pettitt, Paul, Alfredo Maximiano Castillejo, Pablo Arias, Roberto Ontañón Peredo, and Rebecca Harrison. "New views on old hands: the context of stencils in El Castillo and La Garma caves (Cantabria, Spain)." Antiquity 88, no. 339 (March 2014): 47–63. http://dx.doi.org/10.1017/s0003598x00050213.

Full text
Abstract:
Hand stencils are an intriguing feature of prehistoric imagery in caves and rockshelters in several parts of the world, and the recent demonstration that the oldest of those in Western Europe date back to 37 000 years or earlier further enhances their significance. Their positioning within the painted caves of France and Spain is far from random, but responds to the shapes and fissures in the cave walls. Made under conditions of low and flickering light, the authors suggest that touch—‘palpation’—as much as vision, would have driven and directed the locations chosen for these stencils. Detailed study of the images in two Cantabrian caves also allows different individuals to be distinguished, most of whom appear to have been female. Finally, the project reveals deliberate associations between the stencils and features on the cave walls.
APA, Harvard, Vancouver, ISO, and other styles
We offer discounts on all premium plans for authors whose works are included in thematic literature selections. Contact us to get a unique promo code!

To the bibliography