To see the other types of publications on this topic, follow the link: Campbell Report.
Journal articles on the topic 'Campbell Report'
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Campbell Report.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
David, Bruno. "Echidna's Rest, Chillagoe: a site report." Queensland Archaeological Research 7 (January 1, 1990): 73–94. http://dx.doi.org/10.25120/qar.7.1990.128.
Full textAbstract:
Archaeological excavation of the Echidna's rest site was undertaken in 1985 as part of an M.A. thesis research project at the Australian National University (David 1987). The project concerned patterns of cultural change and stability during the Holocene in the Chillagoe region of Northern Queensland and included an investigation of past foraging behaviour. When this research began very little was known of the prehistory of the region (see Campbell 1982, David 1984). Echidna's Rest was therefore excavated primarily to obtain information about the human antiquity and paleoenvironment of the region.
2
Waisel, David B. "Urologist Meredith Campbell Published the First Report on Pediatric Caudal Anesthesia." Journal of Anesthesia History 3, no. 4 (October 2017): 152. http://dx.doi.org/10.1016/j.janh.2017.10.009.
Full text
3
Kornhauser, Ruth, and Travis Hirschi. "The Girls in the Gang: A Report from New York City.Anne Campbell." American Journal of Sociology 92, no. 2 (September 1986): 514–16. http://dx.doi.org/10.1086/228538.
Full text
4
Durlak, Joseph A., and Margaret R. Kasimatis. "Convergent and Discriminant Validity of Self-Report Death Scales." OMEGA - Journal of Death and Dying 19, no. 2 (October 1989): 163–74. http://dx.doi.org/10.2190/7t2t-vkay-d1a5-gun0.
Full textAbstract:
This research was a multitrait-multimethod investigation of the convergent and discriminant validity of seven self-report death scales, each designed to measure one of three death-related attitudes. These attitudes relate to one's own death, reaction to reminders of death, and reluctance to interact with the dying. A structured, but open-ended interview schedule was developed to measure these same attitudes. College students at two universities completed the scales and were then interviewed. Application of Campbell and Fiske's multitrait-multimethod validation model indicated there was moderate support for the convergent and discriminant validity of three of the seven scales. Further analyses indicated that these three measures most effectively discriminated respondents at the extremes of the distribution of scale scores.
5
Van Dulmen, Sandra, and Juan Mezzich. "Summary Report of the Ninth Geneva Conference on Person Centered Medicine." International Journal of Person Centered Medicine 6, no. 2 (July 13, 2016): 126–30. http://dx.doi.org/10.5750/ijpcm.v6i2.581.
Full textAbstract:
For the 9th time, the International College for Person-Centered Medicine (ICPCM) held its annual conference on Person-Centered Medicine in Geneva, Switzerland. Like previous years, the conference was formally co-sponsored by the World Health Organization, the World Medical Association, the World Organization of Family Doctors, the International Council of Nurses, the International Alliance of Patients' Organizations and thirty other global health professional and academic institutions. The organizing committee was composed of the ICPCM Board members, Ruth Wilson as program director and Islene Araujo de Carvalho, Jim Campbell and Nuria Toro Polanco from WHO. Material support was provided by the World Medical Association, the World Health Organization, the Geneva University Hospital, and the Paul Tournier Association.
6
Mitra, Sukla, Anadi Roy Chowdhury, and Goutam Bandyopadhyay. "Williams-Campbell syndrome-a rare entity of congenital bronchiectasis: A case report in adult." International Journal of Medical Research & Health Sciences 4, no. 4 (2015): 913. http://dx.doi.org/10.5958/2319-5886.2015.00185.x.
Full text
7
Fitzjarrald, David. "Peer review report 1 On “An inter-comparison between Gill and Campbell sonic anemometers”." Agricultural and Forest Meteorology 201 (January 2015): 400–402. http://dx.doi.org/10.1016/j.agrformet.2015.08.240.
Full text
8
Fitzjarrald, David. "Peer review report 2 On “An inter-comparison between Gill and Campbell sonic anemometers”." Agricultural and Forest Meteorology 201 (January 2015): 419–21. http://dx.doi.org/10.1016/j.agrformet.2015.08.241.
Full text
9
Yoong-Hee Jo. "Joseon and Her People Shown in the Travel Report of Campbell in the Late 19th Century." Review of Korean Studies 11, no. 1 (March 2008): 47–66. http://dx.doi.org/10.25024/review.2008.11.1.003.
Full text
10
Liu, Meng, Qing Yuan, Haimeng Zhao, and Yuguang Wang. "Williams‐Campbell syndrome complicated with pulmonary hypertension and Type 2 respiratory failure: An adult case report." Clinical Respiratory Journal 13, no. 12 (October 10, 2019): 795–99. http://dx.doi.org/10.1111/crj.13090.
Full text
11
Lepper, Kenneth, Alex W. Buell, Timothy G. Fisher, and Thomas V. Lowell. "A Chronology for glacial Lake Agassiz shorelines along Upham's namesake transect." Quaternary Research 80, no. 1 (July 2013): 88–98. http://dx.doi.org/10.1016/j.yqres.2013.02.002.
Full textAbstract:
Four traditionally recognized strandline complexes in the southern basin of glacial Lake Agassiz are the Herman, Norcross, Tintah and Campbell, whose names correspond to towns in west-central Minnesota that lie on a linear transect defined by the Great Northern railroad grade; the active corridor for commerce at the time when Warren Upham was mapping and naming the shorelines of Lake Agassiz (ca.1880–1895). Because shorelines represent static water planes, their extension around the lake margin establishes time-synchronous lake levels. Transitions between shoreline positions represent significant water-level fluctuations. However, geologic ages have never been obtained from sites near the namesake towns in the vicinity of the southern outlet. Here we report the first geologic ages for Lake Agassiz shorelines obtained at field sites along the namesake transect, and evaluate the emerging chronology in light of other paleoclimate records. Our current work from 11 sampling sites has yielded 16 independent ages. These results combined with a growing OSL age data set for Lake Agassiz's southern basin provide robust age constraints for the Herman, Norcross and Campbell strandlines with averages and standard deviations of 14.1 ± 0.3 ka, 13.6 ± 0.2 ka, and 10.5 ± 0.3 ka, respectively.
12
Lima, Áurea, Isa Peixoto, Susana Sarandão, Daniel Melo, Ângelo Rodrigues, and Helena Pereira. "Breast Cancer Metastasis in a Renal Carcinoma Pulmonary Metastasis: A Rare Example of Tumor-to-Tumor Metastasis." Case Reports in Oncological Medicine 2021 (June 23, 2021): 1–6. http://dx.doi.org/10.1155/2021/3054232.
Full textAbstract:
The tumor-to-tumor metastasis phenomenon remains fairly uncommon, with fewer than 100 cases described to present time. Virtually any tumor can be a donor or a recipient neoplasm. Nevertheless, renal carcinomas have been implicated as the most common malignant tumors to harbor metastasis, while lung and breast tumors are the most frequent donors. This article reports an extremely rare case of a breast cancer metastasis in a lung metastasis of clear cell type renal cell carcinoma that met all Campbell and coworkers’ tumor-to-tumor metastasis criteria. Additionally, we present the literature case reports of breast cancer metastasis in renal cell carcinomas and try to discuss the mechanisms underlying its occurrence. Since this phenomenon identification will impact the therapeutic strategy and it is not easily detected by image, the anatomopathological study of any and all suspicious lesions is of crucial importance. To the best of our knowledge, this is the first report of a metastasis inside a metastasis.
13
Ryan, Wendy A., Nolan J. Doesken, and Steven R. Fassnacht. "Evaluation of Ultrasonic Snow Depth Sensors for U.S. Snow Measurements." Journal of Atmospheric and Oceanic Technology 25, no. 5 (May 1, 2008): 667–84. http://dx.doi.org/10.1175/2007jtecha947.1.
Full textAbstract:
Abstract Ultrasonic snow depth sensors are examined as a low cost, automated method to perform traditional snow measurements. In collaboration with the National Weather Service, nine sites across the United States were equipped with two manufacturers of ultrasonic depth sensors: the Campbell Scientific SR-50 and the Judd Communications sensor. Following standard observing protocol, manual measurements of 6-h snowfall and total snow depth on ground were also gathered. Results show that the sensors report the depth of snow directly beneath on average within ±1 cm of manual observations. However, the sensors tended to underestimate the traditional total depth of snow-on-ground measurement by approximately 2 cm. This is mainly attributed to spatial variability of the snow cover caused by factors such as wind scour and wind drift. After assessing how well the sensors represented the depth of snow on the ground, two algorithms were created to estimate the traditional measurement of 6-h snowfall from the continuous snow depth reported by the sensors. A 5-min snowfall algorithm (5MSA) and a 60-min snowfall algorithm (60MSA) were created. These simple algorithms essentially sum changes in snow depth using 5- and 60-min intervals of change and sum positive changes over the traditional 6-h observation periods after compaction routines are applied. The algorithm results were compared to manual observations of snowfall. The results indicated that the 5MSA worked best with the Campbell Scientific sensor. The Campbell sensor appears to estimate snowfall more accurately than the Judd sensor due to the difference in sensor resolution. The Judd sensor results did improve with the 60-min snowfall algorithm. This technology does appear to have potential for collecting useful and timely information on snow accumulation, but determination of snowfall to the current requirement of 0.1 in. (0.25 cm) is a difficult task.
14
Barry, Christopher, and Philip H. K. Seymour. "Lexical Priming and Sound-to-Spelling Contingency Effects in Nonword Spelling." Quarterly Journal of Experimental Psychology Section A 40, no. 1 (February 1988): 5–40. http://dx.doi.org/10.1080/14640748808402280.
Full textAbstract:
Campbell (1983) demonstrated that nonword spelling may be influenced by the spelling patterns of previously heard, rhyming words (“lexical priming”). We report an experiment that compares two nonword spelling tasks: an experimental (“priming”) task, in which nonwords were preceded by rhyming words of different spellings (as in Campbell's task), and a free-spelling task in which only nonwords are presented. The frequency of production of critical spelling patterns was significantly greater in the experimental task than in the free-spelling task (a lexical priming effect). However, there were, and equally for both tasks, significant and substantial effects of sound-to-spelling contingency (i.e. the frequency with which spelling patterns represent vowel phonemes in words): subjects produced more high-contingency (i.e. common) spelling patterns of vowels than low-contingency (rare) spellings. Further, within high-contingency spelling patterns, subjects more frequently produced the most common spelling correspondence of vowels than the second most common spelling. The results are interpreted within a proposed model of assembled spelling, in which it is suggested that there exist a set of probabilistic sound-to-spelling mappings that relate vowel phonemes to weighted lists of alternative spelling patterns ordered by sound-to-spelling contingency, but that the selection of a spelling pattern from such lists is open to lexical influence.
15
Darbyshire, Julie L., Mark Borthwick, Peter Edmonds, Sarah Vollam, Lisa Hinton, and J. Duncan Young. "Measuring sleep in the intensive care unit: Electroencephalogram, actigraphy, or questionnaire?" Journal of the Intensive Care Society 21, no. 1 (December 5, 2018): 22–27. http://dx.doi.org/10.1177/1751143718816910.
Full textAbstract:
Background Studies consistently report deranged sleep in patients admitted to intensive care unit. Poor sleep has harmful physical and cognitive effects, and an evidence-based intervention to improve sleep is needed. It is, however, difficult to measure sleep in the intensive care unit. ‘Gold standard’ monitoring (polysomnography) is unsuitable for usual care. Methods We collected concurrent sleep data from electroencephalograph recordings, activity monitoring, and nurse- and patient-completed Richards-Campbell Sleep Questionnaires (RCSQ). Results Electroencephalograph data (n = 34) confirm poor sleep. Individual bouts last approximately 1 min and around 2 h of sleep overnight is common. Correlation between electroencephalograph, self-report, nurse-report, actigraphy and overall activity score is low (ρ = 0.123 (n = 24), 0.127 (n = 22), and 0.402 and − 0.201 (n = 13), respectively). Correlation between nurse and patient assessment is limited (ρ = 0.537 (n = 444)). Conclusions No current method of sleep monitoring seems suitable in the intensive care unit. However, to facilitate comparison across studies, the patient-completed RCSQ seems the most meaningful measure.
16
Zeinalov, Shakir, Olga Sidorova, Pavel Sedyshev, Valery Shvetsov, Youngseok Lee, and Uk-Won Nam. "Thermal neutron intensity measurement with fission chamber in current, pulse and Campbell modes." EPJ Web of Conferences 231 (2020): 05009. http://dx.doi.org/10.1051/epjconf/202023105009.
Full textAbstract:
In thermal nuclear reactors, most of the power is generated by thermal neutron induced fission. Therefore, fission chambers with targets that respond directly to slow neutrons are of great interest for thermal neutron flux measurements due to relatively low sensitivity to gamma radiation. However, the extreme conditions associated with experiments at very low cross section demand highly possible thermal neutron flux, leading often to substantial design changes. In this paper we report design of a fission chamber for wide range (from 10 to 1012 n/cm2 sec) measurement of thermal neutron flux. Test experiments were performed at the first beam of IBR2 pulsed reactor using digital pulse processing (DPP) technique with modern waveform digitizers (WFD). The neutron pulses detected by the fission chamber in each burst (5 Hz repetition rate) of the reactor were digitized and recorded to PC memory for further on-line and off-line analysis. New method is suggested to make link between the pulse counting, the current mode and the Campbell technique.
17
Lee, Dong Y., Jee Y. Lee, and Chul H. Kang. "Development and Validation of an Altruism Scale for Adults." Psychological Reports 92, no. 2 (April 2003): 555–61. http://dx.doi.org/10.2466/pr0.2003.92.2.555.
Full textAbstract:
A new self-report scale, the Altruism Scale for Adults, of 28 items was developed. 14 items were from the Altruism subscale of Wrightsman's Philosophies of Human Nature Scale, and the other 14 items were newly constructed. The scale, anchored by 1: true or 2: false, was administered to 592 Korean men and women in eight subgroups. Cronbach alpha internal consistency was .89, and test-retest reliabilities ( n = 52) over 1 and 5 wk. were .90 and .80, respectively. Campbell and Fiske's 1959 multitrait-multimethod analysis showed satisfactory convergent and discriminant validities. Overall results were promising for use of the scale in research and for practical purposes.
18
Stewart, T. E., P. S. Allen, and S. E. Meyer. "First Report of Pyrenophora seminiperda in Turkey and Greece." Plant Disease 93, no. 12 (December 2009): 1351. http://dx.doi.org/10.1094/pdis-93-12-1351b.
Full textAbstract:
Pyrenophora seminiperda (Brittleb. & D.B. Adam) Shoemaker (anamorph Drechslera campanulata (Lév.) B. Sutton) is a generalist seed pathogen that can cause high mortality in the seed banks of annual and perennial grasses and a minor leaf spot disease. Its current reported distribution is mainly temperate grasslands, deserts, and winter cereal-growing regions in Argentina, Australia, Canada, Egypt, New Zealand, South Africa, and the United States (2). P. seminiperda was originally described in France in the mid-1800s, but there are no recent reports from eastern Europe or Asia (2). In May of 2008, we observed what appeared to be P. seminiperda on seeds from seed bank samples collected in Turkey. Evidence of disease was observed as macroscopic black stromata protruding from the seed. The characteristic club-shaped stromata were collected from a Taeniatherum caput-medusae seed near Pamukkale, Turkey and six Bromus tectorum seeds in Love Valley near Goreme, Turkey. An additional collection from a single undispersed B. tectorum seed was obtained from Perissa, Greece. Identity of the pathogen was tentatively established by evaluating morphological characteristics for nine isolates in V8 agar culture. After 4 days of incubation at 20°C with a 12-h photoperiod, the cultures produced white mycelium. Following wounding, the mycelium produced black, club-shaped stromata (2 to 8 × 0.4 to 0.9 mm) in a radial pattern. These produced branched conidiophores bearing crescent-shaped, multicellular conidia (79 to 125 μm long). These attributes are consistent with those of the anamorph of P. seminiperda as described by Shoemaker (4) and Campbell et al. (1). The teleomorph was not observed. The identity of the isolates as P. seminiperda was confirmed with ribosomal DNA internal transcribed spacer (ITS) genetic sequencing analysis. ITS sequences obtained were identical to sequences for North American haplotypes of this species. Four of the Love Valley isolates, (representative isolate: GQ168725, BPI 879142, NRRL 54032) matched the HTA haplotype (GQ168724), while the other four (representative isolate: GQ168736, BPI 879143, NRRL 54033) matched the HTJ haplotype (GQ168735). The isolate from Perissa, Greece (GQ168728, BPI 879144, NRRL 54034) matched the HTC haplotype (GQ168727). Pathogenicity of several Love Valley isolates was confirmed by producing conidia in culture, dusting nondormant B. tectorum seeds with 0.003 g of conidial inoculum per 50 seeds, and incubating for 14 days at 10/20°C with a 12-h photoperiod. Stromata developed on >90% of inoculated seeds and mortality as high as 34% was observed. Morphological similarities combined with ITS sequence data provide conclusive evidence that P. seminiperda occurs in Turkey and Greece. The discovery of this pathogen in these countries indicates that it may be widespread in Eurasia and that it could have arrived in North America on seeds of B. tectorum (3) rather than representing a novel pathogen for this important weed in its North American range. References: (1) M. A. Campbell et al. Plant Pathol. 52:448, 2003. (2) R. W. Medd et al. Australas. Plant Pathol. 32:539, 2003. (3) S. E. Meyer et al. Can J. Plant Pathol. 30:525, 2008. (4) R. A. Shoemaker. Can. J. Bot. 44:1451, 1966.
19
Bobbitt, Mike, Robin Campbell, and Gloria L. Tate. "Safe Return: Working Toward Preventing Domestic Violence When Men Return from Prison." Federal Sentencing Reporter 24, no. 1 (October 1, 2011): 57–61. http://dx.doi.org/10.1525/fsr.2011.24.1.57.
Full textAbstract:
This article is excerpted from Mike Bobbitt, Robin Campbell, and Gloria L. Tate's longer report of the same name published by the Vera Institute of Justice in 2006. Only a very few state and federal institutions offer services that address domestic violence among inmates during incarceration, and a smaller number provide prevention services to those reentering or their families that could reduce the risk of intimate partner violence upon release. Furthermore, only a small portion of domestic violence perpetrators may be identified as needing related in-prison programming. In 2005, the Safe Return Initiative designed a series of roundtable discussions to highlight these important issues and develop appropriate responses. The resulting report stressed that attention must be paid to conducting interventions in a culturally competent manner both before and after release and building on existing family strengths while also offering support to protect families from safety risks.
20
Kulig, H., I. Kowalewska-Łuczak, and M. Kmieć. "Effect of <i>SCD</i> SNPs on milk production traits of Jersey cows (Brief Report)." Archives Animal Breeding 53, no. 1 (October 10, 2010): 116–18. http://dx.doi.org/10.5194/aab-53-116-2010.
Full textAbstract:
Abstract. Studies concerning associations between candidate gene polymorphisms and milk production traits in cattle are carried out on a large scale (CITEK et al. 2007, KULIG 2005). Stearoyl-CoA desaturase (SCD) is the enzyme involved in conversion of saturated fatty acids into monounsaturated fatty acids. The gene encoding SCD was mapped to bovine chromosome 26 (CAMPBELL et al. 2001), where some QTLs for fat yield and other milk production traits as well as for somatic cells count (SCC) were also identified. Some of the SNPs identified within the SCD were significantly associated with fatty acid composition in milk and in carcass fat tissue (MOIOLI et al. 2007, TANIGUCHI et al. 2004). The effect of genotypes on milk production traits and SCC in cattle has not been reported so far. The aim of this study was therefore to establish possible associations between two SNPs in the SCD and milk production traits and SCC in Jersey cows.
21
SØGaard, Rikke, and Jes Lindholt. "Evidence for the Credibility of Health Economic Models for Health Policy Decisionmaking: A Systematic Literature Review of Screening for Abdominal Aortic Aneurysms." Journal of Health Services Research & Policy 17, no. 1 (January 2012): 44–52. http://dx.doi.org/10.1258/jhsrp.2011.010133.
Full textAbstract:
Objective To investigate whether the credibility of health economic models of screening for abdominal aortic aneurysms for health policy decisionmaking has improved since 2005 when a systematic review by Campbell et al. concluded that reporting standards were poor and there was divergence between the findings of studies that was hard to explain. Methods A systematic literature review was carried out following PRISMA reporting principles. Health economic models of the cost-effectiveness of screening for abdominal aortic aneurysms published between 2005-2010 were included. Key characteristics were extracted and the models were assessed for quality against guidelines for best practice by a multidisciplinary team. Results Seven models were identified and found to provide divergent guidance. Only three reports met 10 of the 15 quality criteria. Conclusions Researchers in the field seem to have benefited from general advances in health economic modelling and some improvements in reporting were noted. However, the low level of agreement between studies in model structures and assumptions, and difficulty in justifying these (convergent validity), remain a threat to the credibility of health economic models. Decision-makers should not accept the results of a modelling study if the methods are not fully transparent and justified. Modellers should, whenever relevant, supplement a primary report of results with a technical report detailing and discussing the methodological choices made.
22
Wang, L., and P. Vincelli. "Coniothyrium minitans on Apothecia of Sclerotinia trifoliorum." Plant Disease 81, no. 6 (June 1997): 695. http://dx.doi.org/10.1094/pdis.1997.81.6.695d.
Full textAbstract:
During a study of apothecial dynamics of Sclerotinia trifoliorum at the University of Kentucky Spindletop Farm at Lexington, an apothecium with small black patches on the surface of the hymenium was found. The affected apothecium was incubated in a moist chamber at room temperature. After 3 days, white, cottony mycelium was observed on the surface of the hymenium; pycnidia formed in the mycelium and around the stipe of the apothecium several days later. The apothecium eventually decayed and shrunk. Pycnidia measured 168 to 520 μm (mean 311 μm). Pycnidiospores were dark brown en masse; they were ovoid to ellipsoid, measuring 3.1 to 8.2 μm (mean 6.0 μm) in length and 3.1 to 4.1 μm (mean 3.7 μm) in width, and were faintly verrucose. Fresh sclerotia of S. trifoliorum were produced in vitro and then inoculated with pycnidiospores produced on potato dextrose agar. Inoculated sclerotia were incubated in a moist chamber at room temperature. After 7 to 10 days, inoculated sclerotia shriveled and decayed, pycnidia formed on their surfaces, and the same fungus was isolated. The fungus was identified as Coniothyrium minitans Campbell. Among 58 apothecia examined in the field on 1 November, three were apparently parasitized; pycnidia developed on one of these following a 3-day incubation. Weather conditions during the preceding 2 weeks had been generally humid with above-normal temperatures (daily mean air temperature range and interquartile range were 4.0 to 20.0 and 8.9 to 16.1°C, respectively), which may have favored activity of the mycoparasite. C. minitans was reported by Campbell (1) in California on sclerotia formed in cultures of Sclerotinia sclerotiorum. It causes decay of sclerotia of several Sclerotinia spp., some Botrytis spp., and Sclerotium cepivorum in soil. Consequently, it may have considerable biological control potential. It has been recorded in 29 countries and on all continents except South America (2). The fungus previously has been isolated from only sclerotia or, in a few instances, directly from soil. This is the first report on C. minitans parasitic on apothecia collected from the field. References: (1) W. A. Campbell. Mycologia 39:190, 1947. (2) C. Sandys-Winsch et al. Mycol. Res. 97:1175, 1993.
23
Graña Gómez, José Luis, Jose Manuel Andreu, Heather Lynn Rogers, and Juan Carlos Arango Lasprilla. "STRUCTURAL DIMENSIONS OF THE SOCIAL REPRESENTATION OF AGGRESSION." Social Behavior and Personality: an international journal 31, no. 3 (January 1, 2003): 223–35. http://dx.doi.org/10.2224/sbp.2003.31.3.223.
Full textAbstract:
The principal aim of this study was to analyze the structural dimensions of social representation of aggression through the Expressive Representations of Aggression Scale – EXPAGG (Campbell, Muncer, & Coyle, 1992). This scale is used in many studies of aggressive behavior among youth and in adolescent populations. Moreover, the EXPAGG is one of the self-report techniques most commonly used in the field of aggression research to measure expressive and instrumental attributions. This study uses various statistical procedures to analyze the data from a representative sample of adolescents in the community of Madrid to conclude that the EXPAGG is a reliable and valid test to measure different attribution styles of aggression in youth and adolescents. In addition, a tridimensional structure of social representation of aggression and a significant effect of age and gender were found.
24
Bolaji, Stephen Dele, Sullay Jalloh, Bisi Imonitie, and Abdulai Walon-Jalloh. "Reversing the Trend of Educational Disparity in West Africa." International Journal of Learning and Development 8, no. 2 (June 23, 2018): 130. http://dx.doi.org/10.5296/ijld.v8i2.13089.
Full textAbstract:
This study was an outcome of research report on closing the gap of educational disparities in two West Africa countries (Nigeria and Sierra Leone). Both countries were among the 155 countries that agreed at the World Conference on ‘Education for All’ in Jomtien (1990), to make primary education accessible to all children and to massively reduce illiteracy before the end of the decade. There has been little demonstrated success since the implementation of the UBE program over a decade ago. Findings from the analysed data collected through document analysis and interview with thirty bureaucrats in the capital Territories of the two countries revealed that more than eight million children of school age (six to 15 years) are still not in school in Nigeria (Bolaji, Campbell-Evans and Gray, 2016; NUT, 2008; UENSCO, 2006; World Bank, 2007, UBEC, 2004), and over 28% of school-aged children are out of school and those children that have dropped out of school are engaged in domestic and economic slavery in Sierra Leone(World Bank Report, 2014; UNICEF Report, 2009; 2015). Meeting the United Nations (UN) Millennium Development Goals (MDGs), which aim to achieve compulsory universal basic education for all children 2050, is in serious doubt in both countries because of the issue of implementation. This study advocates regional managerialism of education as alternative approach to achieving education for all in 2050.
25
Pinceratto, E. J. "THE MINERVA GAS FIELD EIA—A CASE STUDY OF COMMUNITY INVOLVEMENT IN DECISIONMAKING." APPEA Journal 41, no. 1 (2001): 767. http://dx.doi.org/10.1071/aj00045.
Full textAbstract:
The Minerva gas field is situated approximately 10 km offshore Port Campbell, Victoria, in the Southern Ocean in water depth of approximately 60 m. The development involves the drilling and completion of two wells, offshore pipelines to the coast, subterranean shore crossing and onshore pipelines to a gas treatment plant where liquids will be removed prior to exporting the gas.From the outset, the project attracted the interest of the local and wider community due to its proximity to the highly regarded Port Campbell National Park. The National Park is known for its unique geomorphological features, its fauna and flora and aboriginal heritage sites.The development has been subject to a dual jurisdiction, State and Federal, Environmental Impact Assessment (EIA) process. The process included the formation of a Community Consultative Committee consisting of representatives from government agencies, local community groups, environmental groups, industry associations and the proponent. The Committee provided input to the scope of the EIA and reviewed and endorsed the studies and report prior to public exhibition. An independent panel hearing and ministerial assessments followed public exhibition.A phased process was adopted in the selection of routes, sites and technologies to achieve the lowest practicable environmental impact. Each phase was supported by studies of environmental aspects, fauna, flora, heritage, visual and social impacts. The process commenced on a regional scale and progressively refined the concept and the study area. Detailed studies of key environmental aspects were conducted for the selected development options.The final development concept addressed the key findings of the baseline and subsequent environmental studies and was largely supported by an independent panel. However, there still remained concerns by sectors of the community on the issue of precedent and integrity of the National Park. The Ministerial assessment reflected the issues of community value above technical, environmental, archaeological and heritage considerations.
26
White, J. F., S. A. Johnston, C. L. Wang, and C. K. Chin. "First Report of Powdery Mildew in Greenhouse-Grown Tomatoes in New Jersey." Plant Disease 81, no. 2 (February 1997): 227. http://dx.doi.org/10.1094/pdis.1997.81.2.227b.
Full textAbstract:
Powdery mildew of tomatoes caused by an Erysiphe sp. has been reported to occur in greenhouses in New York (2). In March and April of 1996, outbreaks of this disease were found in greenhouse-grown tomato plants of cv. PSR55809 at the Cook College campus in New Brunswick, NJ, and in cv. Match in commercial greenhouses in Burlington County, NJ. Identification of an Erysiphe sp. was made by comparative morphology of the conidial state since the perfect stage was not observed. Symptoms included development of patches of white mycelium predominantly on upper surfaces of older leaves followed by chlorosis of tissues colonized by the fungus. Microscopic examination of mycelium revealed the presence of typical Oidium conidiogenous cells and conidia. Conidiogenous cells were short and cylindrical and produce conidia in chains apically. Conidia were hyaline, cylindrical to ellipsoidal, and measured 36 + 4.9 × 16.7 + 2.2 μm (n = 20). Both conidia and symptoms of this powdery mildew are comparable to those previously given for the Erysiphe sp. described in New York (2). Another powdery mildew of tomato, caused by Oidiopsis sicula Scalia, occurs in the western U.S., Mediterranean Basin, Africa, and Asia. However, the conidia of O. sicula are of two types, pyriform and cylindrical, and they are larger than those of an Erysiphe sp. (1). To verify pathogenicity of this Erysiphe sp. to tomatoes, conidia washed from leaves were misted onto uninfected leaves of young tomato plants. After 1 week in a growth chamber (25°C; 80% relative humidity; 12 h of light), typical powdery mildew symptoms were evident on inoculated plants, while unmisted plants remained free of symptoms. Microscopic examination of the fungus on surfaces of leaves confirmed it to be an Erysiphe sp. References: (1) R. N. Campbell and R. W. Scheuerman. Plant Dis. Rep. 63:1087, 1979. (2) D. M. Karasevicz and T. A. Zitter. Plant Dis. 80:709, 1996.
27
Johnson, Michael, and W. Niece. "The PACE Report - Government Contractors Have Patent Rights to Their Inventions - But Only If Proper Notices Are Given; Campbell Plastics Decision Upheld." IEEE Antennas and Propagation Magazine 49, no. 4 (August 2007): 178–80. http://dx.doi.org/10.1109/map.2007.4385630.
Full text
28
Moon Sub Choi, Paul, and Joung Hwa Choi. "Why do firms hold cash? Evidence from Korean stock listings." Investment Management and Financial Innovations 13, no. 3 (October 10, 2016): 311–21. http://dx.doi.org/10.21511/imfi.13(3-2).2016.03.
Full textAbstract:
Corporate governance and the availability of external financing can be important determinants of corporate cash holdings. In this research, in line with Opler et al. (1999), the authors find that Korean firms’ cash holdings are affected by firm-level characteristics including firm size, leverage, market to book, cash flow ratio, net working capital, and cash flow volatility in addition to corporate governance. Rather than agency-prone, the authors can ascribe the increase in cash holdings to the precautionary corporate demand for cash (Campbell et al., 2001). The authors also report that operating risks stemming from cash flow volatility, unavailability of external finance, credit rating downgrades, etc., may be associated with precautionary corporate demand for cash. Lastly, it is documented that corporate governance proxied for by block and/or insider ownership stakes is inversely associated with corporate cash holdings. Keywords: demand for money, corporate governance, corporate cash holding. JEL Classification: G39, E41, G34
29
Nosek, Brian A., and Frederick L. Smyth. "A Multitrait-Multimethod Validation of the Implicit Association Test." Experimental Psychology 54, no. 1 (January 2007): 14–29. http://dx.doi.org/10.1027/1618-3169.54.1.14.
Full textAbstract:
Abstract. Recent theoretical and methodological innovations suggest a distinction between implicit and explicit evaluations. We applied Campbell and Fiske's (1959) classic multitrait-multimethod design precepts to test the construct validity of implicit attitudes as measured by the Implicit Association Test (IAT). Participants (N = 287) were measured on both self-report and IAT for up to seven attitude domains. Through a sequence of latent-variable structural models, systematic method variance was distinguished from attitude variance, and a correlated two-factors-per-attitude model (implicit and explicit factors) was superior to a single-factor-per-attitude specification. That is, despite sometimes strong relations between implicit and explicit attitude factors, collapsing their indicators into a single attitude factor resulted in relatively inferior model fit. We conclude that these implicit and explicit measures assess related but distinct attitude constructs. This provides a basis for, but does not distinguish between, dual-process and dual-representation theories that account for the distinctions between constructs.
30
Berman, Constance H. "The Cistercian Monastery of Zaraka, Greece, edited by Sheila Campbell. Kalamazoo, MI: Medieval Institute Publications, May 2018; pp. xviii, 260." Mediaevistik 31, no. 1 (January 1, 2018): 397–99. http://dx.doi.org/10.3726/med012018_397.
Full textAbstract:
Excavations undertaken by Sheila Campbell and her associates at Zaraka, Greece, beginning in the early 1990s provide much <?page nr="3"?>of the evidence for this volume on this thirteenth-century Cistercian monastery in the eastern Mediterranean established after the Latin Conquest of Constantinople. Ten experts contributed articles that provide evidence about the political and religious context of the Frankish Morea; the architecture and the sculpture of the abbey; a comment on what its library may have contained; its medieval pottery, glass and coins; human and faunal remains, and the archaeology of nearby settlements. More than 200 black and white photos and drawings and four plates in color document the finds and their context. There are very few surviving documents that make mention of the abbey, and it would have been useful to have included them in this publication. The site was probably only occupied by Cistercian monks from circa 1225 to circa 1262. Still this is a very impressive report of the excavations and related topics for the site.
31
McCarthy, D. D., Y. A. Yatskiv, and G. A. Wilkins. "Report of Joint Meeting held on 1985 November 22 to consider the MERIT/COTES recommendations for a new international earth-rotation service." Highlights of Astronomy 7 (1986): 789–95. http://dx.doi.org/10.1017/s1539299600007309.
Full textAbstract:
AbstractA Joint Meeting of Commissions 19 and 31 was held during the IAU General Assembly at Delhi to consider the recommendations for a new international earth-rotation service put forward by the IAU/IUGG Joint Working Groups on the rotation of the Earth and the conventional terrestrial reference system. Wilkins gave summaries of the MERIT programme of activities to monitor earth rotation and intercompare the techniques of observation and analysis and of the COTES programme to establish the basis of a new conventional terrestrial reference system. He reviewed the recommendations of the Groups, and then introduced a draft resolution of the Commissions. An amendment on the continuation of the use of the technique of optical astrometry was accepted and the resolution was then adopted without objection. Four papers on work related to the MERIT/COTES programmes were then presented. Paquet discussed the agreement in the results by different techniques for polar motion and universal time. Preuss presented a paper by Campbell and Schuh on short-period variations in earth-rotation determined by VLBI. Dickey discussed the intercomparisons between the earth-orientation parameters obtained by different techniques and then reviewed the close correlation between the length of the day and the angular momentum of the atmosphere. Finally, Vicente and Verbeiren presented new techniques for processing time and polar motion series.
32
Petkovic, Jennifer, Jennifer L. Barton, Caroline Flurey, Niti Goel, Christie M. Bartels, Cheryl Barnabe, Maarten P. T. de Wit, et al. "Health Equity Considerations for Developing and Reporting Patient-reported Outcomes in Clinical Trials: A Report from the OMERACT Equity Special Interest Group." Journal of Rheumatology 44, no. 11 (February 15, 2017): 1727–33. http://dx.doi.org/10.3899/jrheum.160975.
Full textAbstract:
Objective.Despite advances integrating patient-centered outcomes into rheumatologic studies, concerns remain regarding their representativeness across diverse patient groups and how this affects equity. The Outcome Measures in Rheumatology (OMERACT) Equity Working Group aims to determine whether and how to address equity issues within the core outcome sets of domains and instruments.Methods.We surveyed current and previous OMERACT meeting attendees and members of the Campbell and Cochrane Equity Group regarding whether to address equity issues within the OMERACT Filter 2.0 Core Outcome Sets and how to assess the appropriateness of domains, instruments, and measurement properties among diverse patients. At OMERACT 2016, results of the survey and a narrative review of differential psychosocial effects of rheumatoid arthritis (i.e., on men) were presented to stimulate discussion and develop a research agenda.Results.We proposed 6 moments for which an equity lens could be added to the development, selection, or testing of patient-reported outcome measures (PROM): (1) recruitment, (2) domain selection, (3) feasibility in diverse settings, (4) instrument validity, (5) thresholds of meaning, and (6) consideration of statistical power of subgroup analyses for outcome reporting.Conclusion.There is a need to (1) conduct a systematic review to assess how equity and population characteristics have been considered in PROM development and whether these differences influence the ranking of importance of outcome domains or a patient’s response to questionnaire items, and (2) conduct the same survey described above with patients representing groups experiencing health inequities.
33
Herrera, J. A., M. C. Cebrián, and C. Jordá. "First Report of Melon necrotic spot virus in Panama." Plant Disease 90, no. 9 (September 2006): 1261. http://dx.doi.org/10.1094/pd-90-1261a.
Full textAbstract:
Melon (Cucumis melo L.) represents an important crop in Panama where 1,449 ha were cultivated in 2005 with 920.4 ha of this crop planted in Los Santos Province (southeast region of Panama). During April 2005 and January 2006, several melon plants in commercial fields in that area showed stem necrosis at the crown level, and less frequently, small necrotic spots on leaves. In some cases, wilting and plant death were observed. Symptoms were similar to those caused by the carmovirus Melon necrotic spot virus (MNSV). Cysts of Olpidium bornovanus also were observed in the roots of all affected melon plants. Roots from eight symptomatic plants collected in seven fields were positive using doubleantibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with an antiserum specific for MNSV (BIO-RAD, Life Sciences, Barcelona, Spain). To confirm these results, total RNA was extracted from symptomatic plants and used in one-step reverse transcription-polymerase chain reaction (RT-PCR) with Platinum Taq (Invitrogen Life Technologies, Barcelona, Spain). MNSV specific primers designed to amplify a region of the coat protein gene were used in the assays. Amplicons of the expected size (651 bp) were generated from symptomatic plant tissue, but were not produced from healthy plants or the water used as negative controls. To establish the authenticity of this virus, RT-PCR products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) and directly sequenced. Nucleotide sequences were analyzed by using the basic local alignment search tool (BLAST) (1). The primers produced two amplicons with different but similar sequences. One sequence (GenBank Accession No. DQ443546) showed 92% identity to the coat protein gene of the MNSV Spanish isolate (GenBank Accession No. AY330700) and the MNSV Dutch isolate (GenBank Accession No. M29671) and 88% identity to the Japanese isolate (GenBank Accession No. AB189944). The second sequence (GenBank Accession No. DQ443547) was 93% identical with the Spanish and Dutch MNSV isolates, 88% identical with the Japanese isolate, and 100% identical with sequences from commercial melon seed previously isolated in our laboratory (GenBank Accession No. DQ443545). Infected seed may be a concern with regard to long distance spread of the virus independent of the vector (3) and should be considered in disease management strategies. MNSV has been previously reported in Japan, the Netherlands, the United Kingdom, the United States (2), Guatemala (4), Mexico, Honduras, and Uruguay (C. Jordá, unpublished). To our knowledge, this is the first report of MNSV in Panama. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) R. N. Campbell et al. Phytopathology 86:1294, 1996. (4) C. Jordá et al. Plant Dis. 89:338, 2005.
34
Farzadfar, S., R. Pourrahim, A. R. Golnaraghi, S. Jalali, and A. Ahoonmanesh. "Occurrence of Radish mosaic virus on Cauliflower and Turnip Crops in Iran." Plant Disease 88, no. 8 (August 2004): 909. http://dx.doi.org/10.1094/pdis.2004.88.8.909a.
Full textAbstract:
During the spring and summer of 2003, symptoms of mosaic, mottle, and crinkle were observed in cauliflower (Brassica oleracea) and turnip (Brassica rapa) fields in the Qazvin and Esfahan provinces of Iran, respectively. Leaf extracts of these plants, made infective by mechanical inoculation, caused necrotic local lesions on Chenopodium amaranticolor, chlorotic ring spot on Nicotiana tabacum cv. Samsun, and chlorotic local lesions followed by systemic mosaic on Brassica rapa (1). Using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and specific polyclonal antibodies (As-0120 and PV-0355) that were kindly prepared by S. Winter (DSMZ, Braunschweig, Germany), the samples were tested for the presence of Radish mosaic virus (RaMV) (family Comoviridae, genus Comovirus). ELISA results showed that the original leaf samples and inoculated indicator plants reacted positively to RaMV antibodies. RaMV has been reported in the United States, Japan, and Europe on turnip and other crucifers (1,2). To our knowledge, this is the first report of RaMV occurring in Iran. References: (1) R. N. Campbell. Radish mosaic virus. No. 121 in: Descriptions of Plant Viruses. CMI/AAB, Surrey, England, 1973. (2) D. D. Sutic et al. Handb. Plant Virus Diseases. CRC Press, Boca Raton, FL, 1999.
35
Jeong, M. I., Y. J. Choi, J. H. Joa, K. S. Choi, and B. N. Chung. "First Report of Freesia sneak virus in Commercial Freesia hybrida Cultivars in Korea." Plant Disease 98, no. 1 (January 2014): 162. http://dx.doi.org/10.1094/pdis-05-13-0484-pdn.
Full textAbstract:
In order to investigate the virus infection rate of commercial freesia cultivars in early February 2013, 19 freesia cultivars showing necrotic purple speckles or streaks on leaves, purple streaks parallel to the midrib, and necrotic speckles on leaves were collected from three different regions (Suwon and Icheon in Gyeonggi Province and Jeonju in North Jeonla Province) and used for virus detection. Nucleic acid extracts were analyzed for detection of major freesia-infecting viruses including Freesia sneak virus (FreSV) by reverse transcription (RT)-PCR with specific primer pairs. The FreSV CP gene was amplified using primer pair FreSV-F (5′-TTAGATAGTGAATCCATAAGCTGC-3′) and FreSV-R (5′-ATGTCTGGAAAATACTCCGTCCAA-3′). The approximately 1.3-kb fragment of the FreSV amplified product was cloned and sequenced (GenBank Accession No. KC771891 to 98). The nucleotide sequences of CP gene of FreSV korean isolates showed 99.2 to 99.8% similarity to other FreSV isolates DQ885455, FJ807730, and GU071089, which are registered in GenBank. FreSV was detected from 71.7% of 138 plants tested while the infection rate of Freesia mosaic virus (FreMV) was 34.8%. Neither Bean yellow mosaic virus (BYMV) nor Tobacco rattle virus (TRV) were detected from any plants tested in this study. In certain cultivars, such as ‘Bluebau’ (II) and ‘Pretty women,’ most plants planted in the field showed purple streak symptoms on the leaves. In conclusion, FreSV was detected from some symptomatic freesia cultivars showing purple streak or speckles on leaves with or without necrotic spots and necrotic speckles on leaves. FreSV is currently widespread in Korea and some freesia plants were mixed infected with FreMV. FreSV has been occurring in the Netherlands for over 40 years (2). It is a plant virus in the family Ophioviridae and Ophiovirus genus. Once it occurs in freesia plantation fields, eradication is almost impossible because FreSV is transmitted by zoospores of Olpidium brassicae, which is a soilborne root-infecting fungus (3). Resting spores of O. brassicae can remain dormant in the soil and can be infective for 20 years (1). To produce virus-free freesia plants, growers should consider whether or not their fields are contaminated with O. brassicae carrying FreSV. To our knowledge, this is the first report of FreSV in freesia plants in Korea. References: (1) R. N. Campbell. Can. J. Bot. 63:2288, 1985. (2) Y. Koot et al. Tijdschrift over Plantenziekten 60:157, 1954. (3) H. J. M. van Dorst. Neth. J. Plant Pathol. 81:45, 1975.
36
Martin, R. R., I. E. Tzanetakis, J. E. Barnes, and J. F. Elmhirst. "First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada." Plant Disease 88, no. 5 (May 2004): 575. http://dx.doi.org/10.1094/pdis.2004.88.5.575a.
Full textAbstract:
Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.
37
Verma, V. S., and V. K. Gupta. "First Report of Curvularia lunata Causing Root Rot of Strawberry in India." Plant Disease 94, no. 4 (April 2010): 477. http://dx.doi.org/10.1094/pdis-94-4-0477c.
Full textAbstract:
Diseased strawberry (Fragaria × ananassa Dutch) plants were observed during semimonthly surveys in the Jammu District of Jammu and Kashmir State, India from November 2007 to May 2008. Symptoms included leaf wilt, necrotic roots, and plant death. Small pieces of symptomatic roots were cut from the junction of diseased and healthy tissue, surface sterilized in 0.1% mercuric chloride solution for 1 min, washed in three changes of sterile distilled water, and transferred to potato dextrose agar plates. Cultures were maintained in an incubator at 25 ± 1°C. Dark brown fungal colonies developed in a few days. Mycelium was septate, dark brown-to-blackish brown, and branched. Conidiophores were dark brown, unbranched and septate. Conidia were boat shaped or curved, dark brown, and four-celled with the two central cells larger than the terminal cells. Apical cells were light brown, rounded at the tips, slightly constricted at the base, and 19 to 30 × 9 to 14 μm. The pathogen was identified by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, India (ITCC Accession No. 6680-07) as Curvularia lunata (Wakkar) Boevijn. To conduct pathogenicity tests, 10 healthy runners of strawberry cv. Chandler were planted separately in sterilized pot mix containing loam soil, sand, and peat moss (1:1:1 vol/vol) and allowed to root for a month. Soil near the root zone was then removed to access roots that were gently injured by pricking with a sterilized needle. The soil was replaced after 20 ml of a conidial suspension of 106 conidia/ml of one of the isolates was applied to the roots. Ten healthy strawberry plants grown in noninoculated soil served as controls. After inoculation, the plants were regularly watered. Symptoms similar to those observed in the field developed on all inoculated plants. Roots of the diseased plants turned brown and finally black. Noninoculated plants remained healthy. The pathogen was reisolated from roots of the diseased plants. Curvularia spp. are ubiquitous and are typically considered to be weak pathogens or saprophytes; however they have been reported as minor pathogens of several plants (1,2). Root rot of strawberry caused by Curvularia spp. has been reported (3), but to our knowledge, this is the first report of C. lunata (Wakkar) Boevijn causing root rot of strawberry in India. References: (1) F. C. Butler. Ann. App. Biol. 40:298, 1953. (2) C. F. Hodges and D. A. Campbell. J. Phytopathol. 143:639, 1995. (3) T. Watanabe et al. Phytopathology 67:1324, 1977.
38
Roberts, Megan York, Tara Hensle, and Michael K. Brooks. "More Than “Try This at Home”—Including Parents in Early Intervention." Perspectives of the ASHA Special Interest Groups 1, no. 1 (March 31, 2016): 130–43. http://dx.doi.org/10.1044/persp1.sig1.130.
Full textAbstract:
Current state and federal recommendations encourage the delivery of early intervention services in a child's natural environment with typical communication partners (Individuals With Disabilities Education Act [IDEA], 2004). As such, speech-language pathologists (SLPs) often provide intervention services in homes and work closely with parents. However, only 30% of SLPs have early intervention expertise (ASHA, 2014) and 68% of SLPs report low-levels of competence in working with infants and toddlers (Campbell, Chiarello, Wilcox, & Milbourne, 2009). This may be due to the fact that the majority of graduate programs (60%) provide little or no training in early intervention (Bruder & Dunst, 2005). Working in early intervention is a challenging albeit rewarding task for even the most seasoned therapist. Given that the largest percentage of children served under part C of IDEA are children with language delays (Hebbeler et al., 2007), it is essential that SLPs working in early intervention implement effective strategies for both parents and children. The purpose of this paper is to: (a) explain why including parents in intervention is important; (b) discuss ways of including parents in early intervention; (c) examine strategies used to teach parents; (d) describe a method for teaching parents; (e) compare methods of measuring parent progress; and (f) propose future directions for research.
39
Mavingui, Patrick, Margarita Flores, Xianwu Guo, Guillermo Dávila, Xavier Perret, William J. Broughton, and Rafael Palacios. "Dynamics of Genome Architecture in Rhizobium sp. Strain NGR234." Journal of Bacteriology 184, no. 1 (January 1, 2002): 171–76. http://dx.doi.org/10.1128/jb.184.1.171-176.2002.
Full textAbstract:
ABSTRACT Bacterial genomes are usually partitioned in several replicons, which are dynamic structures prone to mutation and genomic rearrangements, thus contributing to genome evolution. Nevertheless, much remains to be learned about the origins and dynamics of the formation of bacterial alternative genomic states and their possible biological consequences. To address these issues, we have studied the dynamics of the genome architecture in Rhizobium sp. strain NGR234 and analyzed its biological significance. NGR234 genome consists of three replicons: the symbiotic plasmid pNGR234a (536,165 bp), the megaplasmid pNGR234b (>2,000 kb), and the chromosome (>3,700 kb). Here we report that genome analyses of cell siblings showed the occurrence of large-scale DNA rearrangements consisting of cointegrations and excisions between the three replicons. As a result, four new genomic architectures have emerged. Three consisted of the cointegrates between two replicons: chromosome-pNGR234a, chromosome-pNGR234b, and pNGR234a-pNGR234b. The other consisted of a cointegrate of the three replicons (chromosome-pNGR234a-pNGR234b). Cointegration and excision of pNGR234a with either the chromosome or pNGR234b were studied and found to proceed via a Campbell-type mechanism, mediated by insertion sequence elements. We provide evidence showing that changes in the genome architecture did not alter the growth and symbiotic proficiency of Rhizobium derivatives.
40
Kwiecinski, Jakub M. "Merit Ptah, “The First Woman Physician”: Crafting of a Feminist History with an Ancient Egyptian Setting." Journal of the History of Medicine and Allied Sciences 75, no. 1 (November 22, 2019): 83–106. http://dx.doi.org/10.1093/jhmas/jrz058.
Full textAbstract:
Abstract Merit Ptah is widely described as “the first woman physician and scientist” on the Internet and in popular history books. This essay explores the origins of this figure, showing that Merit Ptah came into being in the 1930s when Kate Campbell Hurd-Mead misinterpreted a report about an authentic ancient Egyptian healer. Merit Ptah gradually became a prominent figure in popular historical accounts during second-wave of feminism, and, in the twenty-first century she appeared in Wikipedia and subsequently spread throughout the Internet as a female (sometimes black African) founding figure. The history of Merit Ptah reveals powerful mechanisms of knowledge creation in the network of amateur historians, independently from the scholarly community. The case of Merit Ptah also pinpoints factors enabling the spread of erroneous historical accounts: the absence of professional audience, the development of echo chambers due to an obscured chain of knowledge transmission, the wide reach of the Internet, the coherence with existing preconceptions, the emotional charge of heritage, and even – in the case of ancient Egypt – the tendency to perceive certain pasts through a legendary lens. At the same time, the story of Merit Ptah reveals how important role models have been for women entering science and medicine.
41
Sutton, Deanna A., Malcolm Slifkin, Robert Yakulis, and Michael G. Rinaldi. "U.S. Case Report of Cerebral Phaeohyphomycosis Caused by Ramichloridium obovoideum (R. mackenziei): Criteria for Identification, Therapy, and Review of Other Known Dematiaceous Neurotropic Taxa." Journal of Clinical Microbiology 36, no. 3 (1998): 708–15. http://dx.doi.org/10.1128/jcm.36.3.708-715.1998.
Full textAbstract:
We report a case of cerebral phaeohyphomycosis in a 36-year-old male caused by the neurotropic fungus Ramichloridium obovoideum (Matushima) de Hoog 1977 (Ramichloridium mackenziei Campbell et Al-Hedaithy 1993). This man resided in the Middle East, where the fungus appears to be endemic and, possibly, geographically restricted, since all previous reports of brain abscesses due to this organism have been for patients indigenous to this area. As a servant of the Saudi Arabian royal family, he appeared in the United States seeking treatment for chronic weight loss, fatigue, decreased memory, and a more recent 2-week history of right-hand weakness which worsened to involve the entire right upper extremity. On the day prior to his admission, he had a focal motor seizure with rotation of the head and eyes to the right, followed by secondary generalization. A computerized tomogram showed a ring-enhancing hypodense lesion in the left parietal subcortical region with associated edema and mass effect. Diagnosis of a fungal etiology was made following a parietal craniotomy and excisional biopsy by observation of septate, dematiaceous hyphal elements 2 to 3 μm in width on hematoxylin-and-eosin-stained sections from within areas of inflammation and necrosis. Culture of the excised material grew out a dematiaceous mould which was subsequently identified as R. obovoideum. At two months postsurgery and with a regimen of 200 mg of itraconazole twice a day, the patient was doing well and returned to Saudi Arabia. His condition subsequently deteriorated, however, and following a 7-month course of itraconzole, he expired. We use this case to alert clinicians and personnel in clinical mycology laboratories of the pathogenicity of this organism and its potential occurrence in patients with central nervous system signs and symptoms who have resided in the Middle East and to review and/or compare R. obovoideum with other neurotropic, dematiaceous taxa and similar nonneurotropic, dematiaceous species.
42
Yang, Chung-Chun, Jiunn-Wang Liao, Yun-Chen Yu, and Ju-Po Kao. "CASE REPORT: SPLENIC FIBROSARCOMA IN A CAMPBELL'S HAMSTER." Taiwan Veterinary Journal 40, no. 03 (September 2014): 145–49. http://dx.doi.org/10.1142/s1682648514720020.
Full textAbstract:
A 2.5-year-old intact female hamster (Phodopus campbelli) was referred to the VMTH of NCHU on May 7th, 2013 for a swelling of left abdomen and significant decrease in appetite. Physical examination revealed the enlarged abdomen slightly affected the patient's mobility. A firm mass was palpated in the left abdominal cavity. Tentative diagnosis was an abdominal mass. An exploratory laparotomy and splenectomy was performed together with the removal of a mass of 1 × 1 × 0.8 cm in size and 3.6 g in weight. Grossly, the mass was well capsulated and covered by a sac which filled with blood-like discharge. Histologically, diagnoses were made according to the results of hematoxylin and eosin, Masson's trichrome and vimentin immunohistochemistry stained sections. Based on the histological characteristics, the final diagnosis was a splenic fibrosarcoma in a Campbell's hamster. The patient is fully recovered after surgery but the hamster died of natural causes four months later.
43
Catellani, S., F. Arnone, E. De Bernardis, S. Ferrari, L. Pingani, G. Ziosi, G. Turrini, and M. Rigatelli. "Predictors of dropout from inpatient treatment for eating disorders." European Psychiatry 26, S2 (March 2011): 716. http://dx.doi.org/10.1016/s0924-9338(11)72421-x.
Full textAbstract:
IntroductionDrop-out from treatment for Eating Disorders is increasing (Campbell; 2007), and it is a risk factor for relapse and more chronic and severe course of the illness (Fassino et al.; 2009). Drop-out can be caused by interaction of concurrent, individual, familiar ad environmental factors (Sly; 2009).Aim of the studyTo examine possible risk factors of drop-out from inpatient treatment for eating disorders.Materials and methodsThe sample included 41 patients who voluntarily left the treatment before completion (’droppers’) and 88 patients who completed it (’completers’), in the period between 1st January 2006 and 31st December 2009 at Villa Maria Luigia Hospital (Monticelli Terme, PR, Italy). Patients were administered 2 self-report questionnaires and 3 psychometric tests: Eating Disorders Questionnaire, Predisposing, bringing on and maintaining risk factors for eating disorders, EDI-II, BUT, SCL-90.ResultsDroppers appear to be more aggressive (p = 0.022), get worse scholastic results (p = 0.016) and have less friendships and less social interaction (p = 0.021). Parental break-up (p = 0.015), moving house (p = 0.006), father's death (p = 0.005), abortition (p = 0.040), father's alcohol abuse (p = 0.011) and a mother who suffers of eating disorder (p = 0.008) are more frequent in droppers than completers. Catholic religion seems to be a protective factor from drop-out (p = 0.005).ConclusionDrop-out is a multifactor phenomenon; identification of risk factors can improve treatment strategies and outcome.
44
Johannessen, Dagny Adriaenssen, Trond Nordfjærn, and Amy Østertun Geirdal. "Psychosocial factors associated with coping behaviour after inpatient treatment for substance use disorder: a systematic review study protocol." BMJ Open 9, no. 1 (January 2019): e022673. http://dx.doi.org/10.1136/bmjopen-2018-022673.
Full textAbstract:
IntroductionMuch is known about factors associated with coping with abstinence from substance use. The planned systematic review aims to summarise available studies exploring the change in psychosocial factors associated with coping after long-term (≥3 months) inpatient treatment for substance use disorder (SUD). Examples ofpsychosocial factorsof interest are social support, housing, activity (eg, employment and education) mental health and quality of life.Coping behaviourcan be understood as responses or actions taken in a stressful situation, particularly how psychosocial factors affect a person’s coping behaviour with abstinence from substances in everyday life (characterised as a stressful situation).Methods and analysisA set of text words were developed based on the population (people with SUD), exposure (long-term inpatient SUD treatment), outcome (psychosocial factors) and study design (prospective cohort studies) of interest. A systematic search will be conducted in eight electronic databases: Campbell Collaboration Library, Cochrane Library, EMBASE, Epistemonikos, Medline, PsychINFO, Social Sciences Citation Index and SocINDEX. The titles and abstracts will be screened for relevance before a pre-piloted data collection form will be used to evaluate eligibility and extract data from the search results. The planned review will include peer-reviewed study reports published in English or Scandinavian language.Ethics and disseminationThe target group, people with SUD, might be considered as vulnerable. Based on this, the population will be the group of interest in the planned systematic review of studies that have already been conducted. Patients and the general public will not be involved in the development of this systematic review. The results will be summarised in a study report and submitted to a peer-reviewed international journal. Additionally, results will be disseminated in the mass media and at international research conferences.PROSPERO registration numberCRD42018087408.
45
Robie, David. "‘Drugs, guns and gangs’: Case studies on Pacific states and how they deploy NZ media regulators." Pacific Journalism Review 18, no. 1 (May 31, 2012): 105. http://dx.doi.org/10.24135/pjr.v18i1.292.
Full textAbstract:
Media freedom and the capacity for investigative journalism have been steadily eroded in the South Pacific in the past five years in the wake of an entrenched coup and censorship in Fiji. The muzzling of the Fiji press, for decades one of the Pacific’s media trendsetters, has led to the emergence of a culture of self-censorship and a trend in some Pacific countries to harness New Zealand’s regulatory and self-regulatory media mechanisms to stifle unflattering reportage. The regulatory Broadcasting Standards Authority (BSA) and the self-regulatory NZ Press Council have made a total of four adjudications on complaints by both the Fiji military-backed regime and the Samoan government and in one case a NZ cabinet minister. The complaints have been twice against Fairfax New Zealand media—targeting a prominent regional print journalist with the first complaint in March 2008—and twice against television journalists, one of them against the highly rated current affairs programme Campbell Live. One complaint, over the reporting of Fiji, was made by NZ’s Rugby World Cup Minister. All but one of the complaints have been upheld by the regulatory/self-regulatory bodies. The one unsuccessful complaint is currently the subject of a High Court appeal by the Samoan Attorney-General’s Office and is over a television report that won the journalists concerned an investigative journalism award. This article examines case studies around this growing trend and explores the strategic impact on regional media and investigative journalism.
46
Black, Amy, and Stephen Brooke. "The Labour Party, Women, and the Problem of Gender, 1951–1966." Journal of British Studies 36, no. 4 (October 1997): 419–52. http://dx.doi.org/10.1086/386144.
Full textAbstract:
Following the 1966 General Election, the Labour Party's Home Policy Committee observed that the party had, “for the first time, obtained a majority of the female vote” and remarked, “it would be very satisfactory if we could retain it.” Two years later, the Report of the Committee of Enquiry into Party Organisation emphasized the “imperative that the Party concerns itself with how to win much more support among women.” These comments not only betrayed a serious weakness in Labour's electoral support between 1951 and 1966 but also acknowledged an important lacuna in its broader political outlook.Given the party's electoral difficulties in the period after 1951, the first concern was particularly apposite. Beatrix Campbell, Nicky Hart, and Ina Zweiniger-Bargielowska have underlined the importance of this gender gap favoring the Conservatives after 1950 (see fig. 1). In the elections of 1951 and 1955, for example, Labour's vote among women lagged twelve and thirteen percentage points behind that of the Conservatives. Only in two elections between 1945 and 1970 did Labour enjoy leads among female voters, and these were much less substantial than those held by the Conservatives in 1951, 1955, 1959, and 1964. In rough numerical terms, this difference was potentially very significant. In 1951, for instance, women made up approximately 51.9 percent of the population of England, Scotland, and Wales and roughly 53.8 percent of those of voting age. With an electorate of 28.5 million, this meant a possible political advantage for the Conservatives of 1.2 million votes in an electoral contest where there were only .2 million votes between the two parties.
47
Costlow, Kyrsten, Patricia A. Parmelee, and Tina Harralson. "THE MEDIATING ROLES OF HEALTH LOCUS OF CONTROL AND COPING ON THE PAIN-DEPRESSION PATHWAY." Innovation in Aging 3, Supplement_1 (November 2019): S162. http://dx.doi.org/10.1093/geroni/igz038.579.
Full textAbstract:
Abstract The literature on health locus of control (HLC) suggests that individuals who believe that their health is internally determined are more likely to use active coping strategies than those who believe their health is determined by chance or powerful others (Brosschot, Gebhardt, & Godaert, 1994; Gibson & Helme, 2000). Coping strategies (Klapow et al., 1995) and HLC (Campbell, Hope, & Dunn, 2017) have been found to influence the relation between chronic pain and depression. We hypothesized that the relation between osteoarthritis pain and depression would be serially mediated by HLC and coping. Self-report measures of osteoarthritis pain (Meenan, Mason, Anderson, Guccione, & Kazis, 1992; Parmelee, Katz, & Lawton), HLC (Wallston, Wallston, & DeVellis, 1978), coping strategies (Felton & Revenson, 1984; Rosenstiel & Keefe, 1983), and depression (Radloff, 1977) were examined in 367 older adults with osteoarthritis of the knee. Hayes’ (2013) PROCESS macro was used to test the hypothesized serial multiple mediation for three subscales of HLC: internality (IHLC), chance (CHLC), and powerful others (PHLC). After controlling for age, the hypothesized serial mediation was statistically significant for IHLC and CHLC but not PHLC. More specifically, osteoarthritis pain significantly increased CHLC, which increased negative coping and depression in turn. Osteoarthritis pain significantly decreased IHLC, which was associated with both positive and negative coping strategies in a complex serial mediation. These findings suggest that interventions targeting HLC and/or coping strategies may be able to alter the pain-depression pathway for older adults with chronic osteoarthritis pain. (Supported by R01-MH51800, P. Parmelee, PI).
48
Cady, K. C., A. S. White, J. H. Hammond, M. D. Abendroth, R. S. G. Karthikeyan, P. Lalitha, M. E. Zegans, and G. A. O'Toole. "Prevalence, conservation and functional analysis of Yersinia and Escherichia CRISPR regions in clinical Pseudomonas aeruginosa isolates." Microbiology 157, no. 2 (February 1, 2011): 430–37. http://dx.doi.org/10.1099/mic.0.045732-0.
Full textAbstract:
Here, we report the characterization of 122 Pseudomonas aeruginosa clinical isolates from three distinct geographical locations: Dartmouth Hitchcock Medical Center in New Hampshire, USA, the Charles T. Campbell Eye Microbiology Lab at the University of Pittsburgh Medical Center, USA, and the Aravind Eye Hospital in Madurai, India. We identified and located clustered regularly interspaced short palindromic repeats (CRISPR) in 45/122 clinical isolates and sequenced these CRISPR, finding that Yersinia subtype CRISPR regions (33 %) were more prevalent than the Escherichia CRISPR region subtype (6 %) in these P. aeruginosa clinical isolates. Further, we observed 132 unique spacers from these 45 CRISPR that are 100 % identical to prophages or sequenced temperate bacteriophage capable of becoming prophages. Most intriguingly, all of these 132 viral spacers matched to temperate bacteriophage/prophages capable of inserting into the host chromosome, but not to extrachromosomally replicating lytic P. aeruginosa bacteriophage. We next assessed the ability of the more prevalent Yersinia subtype CRISPR regions to mediate resistance to bacteriophage infection or lysogeny by deleting the entire CRISPR region from sequenced strain UCBPP-PA14 and six clinical isolates. We found no change in CRISPR-mediated resistance to bacteriophage infection or lysogeny rate even for CRISPR with spacers 100 % identical to a region of the infecting bacteriophage. Lastly, to show these CRISPR and cas genes were expressed and functional, we demonstrated production of small CRISPR RNAs. This work provides both the first examination to our knowledge of CRISPR regions within clinical P. aeruginosa isolates and a collection of defined CRISPR-positive and -negative strains for further CRISPR and cas gene studies.
49
Hoeffel, Jean-Claude, and F. Hoeffel. "Commentary on:Loomis PW, Campbell HR. Fatal cervical necrotizing fasciitis (a report of two cases of confirmed odontogenic origin and one of possible odontogenic origin). J Forensic Sci 2001;46(4):959–61." Journal of Forensic Sciences 47, no. 6 (November 1, 2002): 15589J. http://dx.doi.org/10.1520/jfs15589j.
Full text
50
Mathew, F. M., R. S. Goswami, S. G. Markell, L. Osborne, C. Tande, and B. Ruden. "First Report of Ascochyta Blight of Field Pea Caused by Ascochyta pisi in South Dakota." Plant Disease 94, no. 6 (June 2010): 789. http://dx.doi.org/10.1094/pdis-94-6-0789a.
Full textAbstract:
Tan lesions approximately 1.7 × 0.8 cm with distinct dark brown margins and small pycnidia were observed on leaves of field peas (Pisum sativum L. ‘Agassiz’) growing in Campbell County, South Dakota (45°45.62′N, 100°9.13′W) in July 2008. Small pieces of symptomatic leaves were surface sterilized (10% NaOCl for 1 min, 70% EtOH for 1 min, and sterile distilled H2O for 2 min) and placed on potato dextrose agar (PDA) for 7 days under fluorescent lights with a 12-h photoperiod to induce sporulation. A pure culture was established by streaking a conidial suspension on PDA and isolating a single germinated spore 3 days later. The culture was grown on clarified V8 media for 10 days. Conidia were 10 to 16 × 3 to 4.5 μm and uniseptate with a slightly constricted septum, similar to those of Ascochyta pisi Lib. The exuding spore mass from pycnidia growing on the medium was carrot red. No chlamydospores or pseudothecia were observed (1,2). To confirm the identity of A. pisi, DNA was extracted from the lyophilized mycelium of the 10-day-old culture with the DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Internal transcribed spacer (ITS) regions I and II were amplified with PCR primers ITS 5 and ITS 4 (3). PCR amplicons were cleaned and directly sequenced in both directions using the primers. A BLASTN search against the NCBI nonredundant nucleotide database was performed using the consensus sequence generated by alignment of the forward and reverse sequences for this region. The consensus sequence (GenBank Accession No. GU722316) most closely matched A. pisi var. pisi strain (GenBank Accession No. EU167557). These observations confirm the identity of the fungus as A. pisi. A suspension of 1 × 106 conidia/ml of the isolate was spray inoculated to runoff on 10 replicate plants of 2-week-old, susceptible green field pea ‘Sterling’. Plants were incubated in a dew chamber for 48 h at 18°C and moved to the greenhouse bench where they were maintained at 20 to 25°C with a 12-h photoperiod for 1 week. Tan lesions with dark margins appeared 7 days after inoculation and disease was assessed after 10 days (4). No symptoms were observed on water-treated control plants. A. pisi was reisolated from lesions and confirmed by DNA sequencing of the ITS region, fulfilling Koch's postulates. Currently, states bordering South Dakota (North Dakota and Montana) lead the United States in field pea production. Although acreage is limited in South Dakota, the identification of A. pisi in this region is serious. The disease is yield limiting and foliar fungicides are used for disease management (1). To our knowledge, this is the first report of Ascochyta blight on P. sativum caused by A. pisi occurring in South Dakota and the MonDak production region (the Dakotas and Montana). References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:88, 2006. (2) A. S. Lawyer. Page 11 in: The Compendium of Pea Diseases. D. J. Hagedorn, ed. The American Phytopathological Society, St Paul, MN, 1984. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990. (4) J. M. Wroth. Can. J. Bot. 76:1955, 1998.