Journal articles on the topic 'Beer – Ohio'
To see the other types of publications on this topic, follow the link: Beer – Ohio.
Create a spot-on reference in APA, MLA, Chicago, Harvard, and other styles
Consult the top 50 journal articles for your research on the topic 'Beer – Ohio.'
Next to every source in the list of references, there is an 'Add to bibliography' button. Press on it, and we will generate automatically the bibliographic reference to the chosen work in the citation style you need: APA, MLA, Harvard, Chicago, Vancouver, etc.
You can also download the full text of the academic publication as pdf and read online its abstract whenever available in the metadata.
Browse journal articles on a wide variety of disciplines and organise your bibliography correctly.
1
O'Leary, Brendan. "Walker Connor (1926–2017): a tribute†." Nationalities Papers 45, no. 5 (September 2017): 725–29. http://dx.doi.org/10.1080/00905992.2017.1350943.
Full textAbstract:
Walker Connor was born in 1926, and was contemporaneous with my own father, so not surprisingly he was a father figure to me. Unlike my own father Walker made it past 90. Those of us privileged to have been Walker's friend will miss his mischievous humor and twinkling eyes, and his fondness for combining rich conversation with craft beers. Indeed his son Dan told me Walker deliberately had a beer a couple of days before he died. All will be pleased to know that he remained possessed of his faculties and character to the end. He is survived by his two sons Peter and Dan Connor, and their partners; by his daughter, Professor Joan Connor of Athens, Ohio, who has inherited her parents’ writings skills; and by Joan's son, Nils Walker (Kerry) Wessell, who is with us today.
2
Nutting, P. Bradley. "Selling Elegant Glassware During the Great Depression: A. H. Heisey & Company and the New Deal." Business History Review 77, no. 3 (2003): 447–78. http://dx.doi.org/10.1017/s0007680500039209.
Full textAbstract:
The sale of luxury goods during the 1930s represents an incongruous aspect of American business that has been largely ignored by historians. This essay focuses on the efforts of one manufacturer of high-quality, elegant glassware, A. H. Heisey & Company of Newark, Ohio, to survive the Great Depression. Heisey created successful new sales strategies and product designs to meet the changing tastes of its customers. Although difficult to gauge with precision, Heisey's business also benefited from the overlapping influence of several New Deal measures: the Beer–Wine Revenue Act, the National Recovery Act, and the National Housing Act. Paradoxically, Heisey was most hampered by President Roosevelt's adoption of fiscal restraint in 1937, a policy that the company's Republican executives strongly advocated.
3
Braddock, Robert C. "John Hayward. The Life and Raigne of King Edward the Sixth. Edited by Barrett L. Beer. Foreword by Lacey Baldwin Smith. Kent, Ohio: Kent State University Press, 1993 Pp. xii, 195. $35.00." Albion 26, no. 1 (1994): 125–27. http://dx.doi.org/10.2307/4052110.
Full text
4
Babicz, Martin C. "No Money, No Beer, No Pennants: The Cleveland Indians and Baseball in the Great Depression by Scott H. LongertNo Money, No Beer, No Pennants: The Cleveland Indians and Baseball in the Great Depression, by Scott H. Longert. Athens, Ohio University Press, 2016. viii, 285 pp. $55.00 US (cloth), $24.95 US (paper or e-book)." Canadian Journal of History 52, no. 3 (December 2017): 622–23. http://dx.doi.org/10.3138/cjh.ach.52.3.rev29.
Full text
5
Herr, Leonard J. "Relationship of binucleate Rhizoctonia isolates used for biocontrol of rhizoctonia crown rot of sugar beet to anastomosis systems." Canadian Journal of Microbiology 37, no. 5 (May 1, 1991): 339–44. http://dx.doi.org/10.1139/m91-055.
Full textAbstract:
The relationships of 10 binucleate Rhizoctonia isolates used as biocontrol agents of rhizoctonia crown and root rot of sugar beet in Ohio to described binucleate Rhizoctonia anastomosis systems were investigated. Ten Ohio binucleate Rhizoctonia (Ohio BNR) isolates, paired in all combinations, cross anastomosed with one another, indicating that all belong to the same anastomosis group. Four representative Ohio BNR isolates failed to anastomose with any tester isolates of the Ceratobasidium anastomosis grouping system, indicating that none belong in that system. However, all 10 Ohio BNR isolates anastomosed with an AG-B (o) tester isolate (binucleate Rhizoctonia anastomosis grouping system), indicating that the Ohio agents belong in this anastomosis grouping system and to the (o) intraspecific group of AG-B. None of the Ohio BNR isolates anastomosed with either of the other two intraspecific group tester isolates (AG-Ba, AG-Bb) of the AG-B group. Moreover, the AG-B intraspecific group tester isolates, AG-Ba, AG-Bb, AG-B (o), self-anastomosed but did not cross anastomose with one another. Variations in cultural characteristics noted among the 10 Ohio BNR isolates indicated that considerable heterogeneity exists within these AG-B (o) isolates. Key words: binucleate Rhizoctonia, anastomosis, rhizoctonia crown rot, sugar beet.
6
Hannibal, Joseph T., Michael E. Williams, and Gary L. Jackson. "An inexpensive source of dolomite powder for use with airbrasive units." Journal of Paleontology 62, no. 2 (March 1988): 316. http://dx.doi.org/10.1017/s002233600003002x.
Full textAbstract:
In the past few years the Cleveland Museum of Natural History has received several inquiries as to our source of dolomite for use with S.S. White® industrial airbrasive units. We have been using inexpensive, “agricultural” dolomite with these units for several years. This source was “discovered” by testing of a wide variety of dolomite sources by Peter Kotulak, a former preparator at the Museum, under the direction of M.E.W. We are currently using OHSO® Pulverized Limestone, a kiln-dried dolomitic limestone recommended for agricultural, and lawn and garden, use. It is produced by the Ohio® Lime Co., of Woodville, Ohio. A 22.7 kg (50 pound) bag costs $2.25, and is available at building supply companies. The dolomite must be sieved and dried to prevent clogging of the unit's line and nozzle. We use a Ro-Tap® Testing Sieve Shaker to sieve the material, with #30 (595 micron), #60 (250 micron), and #100 (150 micron) U.S.A. standard testing sieves. An incandescent desk lamp can be placed over an open container of the sieved dolomite to keep it dry. Used powder may be re-sieved for reuse if desired.
7
Sarver, Matthew A., and Chris O. Yoder. "First Records of Freckled Madtom (Noturus nocturnus) in Ohio, USA." Ohio Journal of Science 121, no. 2 (August 30, 2021): 48–55. http://dx.doi.org/10.18061/ojs.v121i2.8033.
Full textAbstract:
Two new Ohio localities for the Freckled Madtom (Noturus nocturnus Jordan and Gilbert, 1886) were recently discovered. These are the first, and currently only, Freckled Madtom collected in Ohio waters. A single individual was collected in the Scioto River in Scioto County by the Midwest Biodiversity Institute (MBI) and a previously misidentified specimen was collected in the Ohio River at the Hannibal Locks and Dam by the Ohio River Valley Water Sanitation Commission (ORSANCO). The closest historical records are from the Little Sandy River and Big Sandy River drainages in eastern Kentucky. Other Ohio River collections have been made near the border of Kentucky and Indiana. The origins of the recent Ohio specimens are unknown; whether they emanate from other known populations or have been overlooked altogether is unclear.
8
Thompson, Erin L., P. S. S. Rao, Christopher Hayes, and Catherine Purtill. "Dispensing Naloxone Without a Prescription: Survey Evaluation of Ohio Pharmacists." Journal of Pharmacy Practice 32, no. 4 (February 25, 2018): 412–21. http://dx.doi.org/10.1177/0897190018759225.
Full textAbstract:
Background: The Centers for Disease Control and Prevention (CDC) reports a 200% escalation in the rate of opioid overdose deaths in the United States. Unfortunately, Ohio has been deemed the epicenter of the nation’s opioid epidemic. In 2015, Ohio passed a bill that permits a pharmacist to distribute naloxone without a prescription. Objectives: This survey was aimed to discover pharmacists’ knowledge of naloxone and Ohio law, perceived barriers that may prohibit naloxone dispensing, and Ohio pharmacists’ general confidence, comfort, perception, and experience dispensing naloxone per physician protocol. Methods: Pharmacists’ knowledge of naloxone and Ohio law pertaining to dispensing naloxone; perceived barriers to naloxone distribution; and overall experience, willingness, comfort, and perceptions of personally supplying naloxone were assessed using multiple-choice and Likert-type scale questions through an e-mail survey. Results: Overall, Ohio pharmacists were knowledgeable about naloxone and displayed confidence in their training and ability to provide patient education on naloxone. Pharmacists were less certain about Ohio law pertaining to naloxone distribution, especially those who have been in practice longer. Pharmacists indicated several barriers to dispensing naloxone and the need for more training. Younger pharmacists were more likely to report a concern with clientele who would frequent their pharmacy and moral and ethical concerns as barriers to dispensing naloxone. Conclusion: Additional educational programs should be delivered to Ohio pharmacists to inform them of the state law and policies. Continuing education programs that review substance abuse and attempt to reduce social stigma may assist with increasing naloxone distribution to those in need, especially, if directed toward younger pharmacists in Ohio.
9
Berry, S. Z., and W. A. Gould. "‘Ohio 832’ Tomato." HortScience 21, no. 2 (April 1986): 334. http://dx.doi.org/10.21273/hortsci.21.2.334.
Full textAbstract:
Abstract ‘Ohio 832’ is an early, main-season, processing tomato (Lycopersicon esculentum Mill.) suitable for hand or machine harvest with fruit qualities that make it especially suitable for juice, sauce, and coreless whole-pack. ‘Ohio 832’ was released by Ohio State Univ., 3 Oct 1985. Several thousand acres of this tomato have been grown by the processing industry in the eastern and mid-western United States. It has been well received by growers and processors and use is increasing.
10
Pollay, Richard W., and Banwari Mittal. "Here's the Beef: Factors, Determinants, and Segments in Consumer Criticism of Advertising." Journal of Marketing 57, no. 3 (July 1993): 99–114. http://dx.doi.org/10.1177/002224299305700307.
Full textAbstract:
A comprehensive model of attitudes toward advertising includes three personal utility factors (product information, social image information, and hedonic amusement) and four socioeconomic factors (good for economy, fostering materialism, corrupting values, and falsity/no-sense). The proposed 7-factor model was tested on two independent samples: collegians (188) and householders (195) from Ohio and Mississippi Valley states, explaining 62% and 56% of the variance in their global attitudes, respectively. The model's dimensions were used to profile these publics and to identify attitudinal segments within them. Most respondents exhibited conflict between an appreciation of the personal uses and economic value of advertising and an apprehension of cultural degradation.
11
Poly, William J. "Host and Locality Records of the Fish Ectoparasite, Argulus (Branchiura), From Ohio (U.S.a.)." Crustaceana 70, no. 8 (1997): 867–74. http://dx.doi.org/10.1163/156854097x00483.
Full textAbstract:
AbstractArgulus flavescens and A. appendiculosus were collected from five fish species in two major Ohio river basins during August-October, 1994. The golden redhorse, Moxostoma erythrurum, is a new host record for Argulus. The 1994 records as well as past host and distribution records of Argulus in Ohio and Lake Erie (U.S. and Canadian waters) have been compiled. Six species, A. flavescens, A. appendiculosus, A. lepidostei, A. stizostethii, A. americanus, and A. catostomi have been recorded from 15 Ohio fish species.
12
Stephens, Julie A., James L. Fisher, Jessica L. Krok-Schoen, Ryan D. Baltic, Holly L. Sobotka, and Electra D. Paskett. "Esophageal Adenocarcinoma: Opportunities for Targeted Prevention in Ohio." Clinical Medicine Insights: Gastroenterology 11 (January 1, 2018): 117955221879117. http://dx.doi.org/10.1177/1179552218791170.
Full textAbstract:
Objective: The incidence of esophageal adenocarcinoma, one of the most lethal gastroenterological diseases, has been increasing since the 1960s. Prevention of esophageal adenocarcinoma is important because no early detection screening programs have been shown to reduce mortality. Obesity, gastroesophageal reflux disease, and tobacco smoking are risk factors for esophageal adenocarcinoma. Due to the high prevalence in Ohio of obesity (32.6%) and cigarette smoking (21.0%), this study sought to identify trends and patterns of these risk factors and esophageal adenocarcinoma in Ohio as compared with the United States. Methods: Data from the Ohio Cancer Incidence Surveillance System, Surveillance Epidemiology and End Results Program (SEER), and Behavioral Risk Factor Surveillance System were used. Incidence rates overall, by demographics and by county, as well as trends in incidence of esophageal adenocarcinoma and the percent of esophageal adenocarcinoma among esophageal cancers were examined. Trends in obesity and cigarette smoking in Ohio, and the prevalence of each by county, were reported. Results: There was an increasing trend in esophageal adenocarcinoma incidence in Ohio. Ohio’s average annual esophageal adenocarcinoma incidence rate was higher than the SEER rate overall and for each sex, race, and age group in 2009 to 2013. There was also an increasing prevalence of obesity in Ohio. Although the prevalence of cigarette smoking has been stable, it was high in Ohio compared with the United States. Conclusions: Health care providers and researchers should be aware of the esophageal adenocarcinoma incidence rates and risk factor patterns and tailor interventions for areas and populations at higher risk.
13
Redmond, Brian G. "Hopewell on the Sandusky: Analysis and Description of an Inundated Ohio Hopewell Mortuary-Ceremonial Site in North-Central Ohio." North American Archaeologist 28, no. 3 (July 2007): 189–232. http://dx.doi.org/10.2190/na.28.3.a.
Full textAbstract:
Northern Ohio has traditionally been placed at the “periphery” of Ohio Hopewell interaction. The recent discovery of an inundated mortuary-ceremonial site in Sandusky Bay with characteristic Hopewell artifacts, burial treatments, and deposits has stimulated a reexamination of the relationship between northern Ohio Middle Woodland societies and the Ohio Hopewell core. From this locality, known as the Pumpkin site, amateur archaeologists salvaged burials; Flint Ridge chert bifaces, Lowe cluster points and bladelets; a copper celt and beads; and other distinctive Hopewell funerary and ceremonial objects. Pumpkin site burial treatments and artifact forms also show considerable similarities to the Esch Mounds component located just to the east. A single AMS radiocarbon determination of 1840 ± 40 BP (Beta-221575) on human bone collagen places the Pumpkin component securely within the Middle Woodland period. Information from this unique site indicates that local Middle Woodland ties to the Ohio Hopewell heartland were more significant than previously perceived.
14
McCutcheon, J. S., L. W. Morton, H. N. Zerby, S. C. Loerch, L. Miller, and F. L. Fluharty. "Ohio Livestock Producers’ Perceptions of Producing and Marketing Grass-Based Beef and Lamb." Agroecology and Sustainable Food Systems 39, no. 4 (November 17, 2014): 367–90. http://dx.doi.org/10.1080/21683565.2014.986598.
Full text
15
Berry, Stanley Z., and Wilbur A. Gould. "‘Ohio 8243’ Processing Tomato." HortScience 23, no. 5 (October 1988): 930. http://dx.doi.org/10.21273/hortsci.23.5.930.
Full textAbstract:
Abstract ‘Ohio 8243’ is a main season tomato (Lycopersicon esculentum Mill.) adapted for machine harvest and bulk handling and exhibits processing quality especially suitable for the production of peeled, coreless whole-canned tomatoes (whole-pack), as well as for juice and sauce. Extensive test acreages have been grown by the mid-western and eastern U.S. and Canadian tomato processing industries. The new cultivar has been well received by growers and processors and its use is increasing.
16
Ivanov, Kaloyan. "The ants of Ohio (Hymenoptera, Formicidae): an updated checklist." Journal of Hymenoptera Research 70 (June 28, 2019): 65–87. http://dx.doi.org/10.3897/jhr.70.35207.
Full textAbstract:
I update the last published list of Ohio ants to include 26 new species records and 38 name changes in species already on the list based on literature records, institutional collections, and contemporary collections made by the author or colleagues. At present, 143 species and morphospecies representing 30 native and 5 exotic genera and 7 subfamilies have been recorded for the state. Another seven species are removed from the Ohio ant fauna as they represent distribution anomalies, or are based on erroneous records. Known distribution data suggest that there is still a considerable potential for the discovery of more ant taxa in Ohio.
17
Saja, David B., and Joseph T. Hannibal. "Quarrying History and Use of the Buena Vista Freestone, South-Central Ohio: Understanding the 19th Century Industrial Development of a Geological Resource." Ohio Journal of Science 117, no. 2 (June 29, 2017): 35. http://dx.doi.org/10.18061/ojs.v117i2.5498.
Full textAbstract:
The Buena Vista Member of the Mississippian Cuyahoga Formation is an economically valuable freestone that is homogeneous with almost no sedimentary structures. The Buena Vista was one of the earliest clastic rocks quarried in Ohio. Early quarries dating at least back to 1814 were located in the hills on the north bank of the Ohio River near the village of Buena Vista, south-central Ohio. By the 1830s, quarries had also opened up along the route of the Ohio & Erie Canal in the Portsmouth area to the east; followed by quarries that opened along a railway line that ran north up the Scioto River valley. Waterways transported the Buena Vista to many cities and towns, including Cincinnati, Ohio, Louisville, Kentucky, and Evansville, Indiana, on the Ohio River, New Orleans on the Mississippi River, and Dayton and Columbus on the Ohio canal system. Later railways transported this stone further afield to Illinois, Wisconsin, and Alberta. Census reports, industry magazines, and other historical accounts document the use of this stone across much of the eastern US and into Canada. Historically, it has been used for a variety of items, including entire buildings, canal structures, fence posts, and laundry tubs. Some 19th-century structures built with this stone remain in cities where it was once commonly used. Literature reviews, field observations, and lab analyses are here compiled as a useful reference to both the urban and field geologist in the identification of the Buena Vista Member, a historically important building stone, in buildings and outcrops, respectively.
18
House, M. R., Mackenzie Gordon, and W. J. Hlavin. "Late Devonian ammonoids from Ohio and adjacent states." Journal of Paleontology 60, no. 1 (January 1986): 126–44. http://dx.doi.org/10.1017/s0022336000021582.
Full textAbstract:
Three late Devonian ammonoid-bearing levels are described from the area of Cleveland, Ohio. These appear to represent the German Platyclymenia, Clymenia and Wocklumeria Stufen, clear evidence for which has been lacking previously in eastern North America. The lowest level, around the base of the Cleveland Shale, yieldsSporadoceras, Cyrtoclymenia, Platyclymeniaand a new species,Pleuroclymenia(?)ohioense. The middle level, near the top of the Cleveland Shale, bearsCymaclymenia, SporadocerasandPrionoceras. The highest level, just above the base of the Bedford Shale, hasPrionoceras quadripartitum. This species, and a fauna of the basal Bedford, have been located also in the area of Columbus, Ohio. AnEpiwocklumeria(?) sp. is recorded from Indiana. Attention is drawn to the international importance of the late Famennian and Lower Carboniferous ammonoid sequence which can now be recognized in Ohio.
19
Cobb, Charles R., and Brian M. Butler. "The Vacant Quarter Revisited: Late Mississippian Abandonment of the Lower Ohio Valley." American Antiquity 67, no. 4 (October 2002): 625–41. http://dx.doi.org/10.2307/1593795.
Full textAbstract:
The idea that a substantial portion of the North American midcontinent centered on the Ohio and Mississippi Rivers confluence was largely depopulated around A.D. 1450–1550—Stephen Williams's “Vacant Quarter” hypothesis—has been generally accepted by archaeologists. There has been, however, some disagreement over the timing and extent of the abandonment. Our long-term research along the Ohio River in southern Illinois's interior hill country has yielded a substantial corpus of late Mississippian period radiocarbon dates, indicating that depopulation of the lower Ohio Valley occurred at the early end of Williams's estimate. Furthermore, the abandonment was a widespread phenomenon that involved Mississippian groups living in remote settings, as well as along major drainages. Although causes for the Vacant Quarter are still debated, evidence from other regions indicates that regional abandonment by agricultural groups was not a unique event in the Eastern Woodlands.
20
McDonald, H. Gregory, and Richard Arnold Davis. "Fossil muskoxen of Ohio." Canadian Journal of Zoology 67, no. 5 (May 1, 1989): 1159–66. http://dx.doi.org/10.1139/z89-167.
Full textAbstract:
Two species of muskoxen have been found as fossils in Ohio's Pleistocene deposits, the extinct Symbos cavifrons and the extant Ovibos moschatus. Symbos currently is represented by six specimens, and Ovibos, by two; all specimens are brain-cases. One of the Ovibos was found in Hamilton County, Ohio, in Wisconsinan gravels associated with the Miami Sublobe of the Huron Lobe; this new record is the southernmost for the genus. All records of Symbos in Ohio are Late Pleistocene, suggesting that the genus expanded into the region shortly after deglaciation. Both records of Ovibos from the state are associated with the glacial margin.
21
Gao, Gary Y., James A. Chatfield, Erik A. Draper, and Joseph F. Boggs. "Ohio State University Extension Nursery, Landscape, and Turf Team: Teamwork at Its Best." HortTechnology 11, no. 3 (January 2001): 469–71. http://dx.doi.org/10.21273/horttech.11.3.469.
Full textAbstract:
The Ohio State University (OSU) Extension Nursery, Landscape, and Turf Team (ENLTT) is an innovative and interdisciplinary team comprised of extension agents, extension specialists, researchers, teaching faculty, university arboretum staff, and research assistants. ENLTT has greatly improved the process of acquisition, delivery, and support of accurate, practical, and timely educational resources through interdisciplinary and industry partnerships. The award-winning weekly electronic newsletter Buckeye Yard and Garden Line (BYGL) has been the focal point of our teamwork since 1993. An ornamental research circular, authored and edited by ENLTT members, remains the most requested publication from the Section of Communication and Technology, Ohio Agricultural Research Development Center, OSU. Strong partnership with the green industry in Ohio has resulted in the financial commitment of more than $230,000 from the Ohio Nursery and Landscape Association since 1993. ENLTT members have improved themselves as a result of educating each other through weekly BYGL conference calls from April to October, taking study tours, and conducting joint educational programs. Twenty-two commodity or issue teams, such as, Floriculture Team, Vegetable Crops Team, Tree Fruit Team, Forestry Team, Agronomic Crops Team, Sustainable Agriculture Team, and Dairy Team, have been formed in OSU Extension due to the success of ENLTT.
22
Tennant, P. A., C. G. Norman, and A. H. Vicory. "The Ohio River Valley Water Sanitation Commission's Toxic Substances Control Program for the Ohio River." Water Science and Technology 26, no. 7-8 (October 1, 1992): 1779–88. http://dx.doi.org/10.2166/wst.1992.0621.
Full textAbstract:
The Ohio River Valley Water Sanitation Commission (ORSANCO) is an interstate agency created in 1948 to administer a state compact which calls for the abatement of water pollution in the Ohio Valley. Since 1975, ORSANCO has conducted routine monitoring programs to detect the presence of toxic chemicals in the Ohio River and in fish taken from the river. Such information is particularly important as the Ohio River, a major river in the United States, serves as a water supply to over three million people and is used extensively for recreational purposes. The monitoring results have shown several problems: contamination of fish tissue by PCBs and chlordane, concentrations of certain metals which exceed chronic aquatic life criteria in 10 to 25 percent of the samples analyzed, and levels of certain volatile organic compounds which exceeded criteria established to prevent one additional cancer per one million population in almost half the samples analyzed. In 1986, the Commission initiated a Toxic Substances Control Program which was designed to identify sources of the toxics problems and prescribe corrective actions. Because of the multitude of potential sources of toxics along the Ohio, the river was divided into seven segments for intensive study. To date, studies have been initiated on four segments. In addition, special topic studies have been conducted on the river as a whole to address the suitability of the river as a source of drinking water, trends in parameter levels, and the relationship between surface and ground water quality. Findings to date:Point source discharges to the river do not cause widespread toxics problems.Nonpoint sources, including urban runoff and contaminated ground water, are significant sources of toxics to the river.Levels of certain toxics in tributaries are also an important source.Under “normal ” situations (i.e., excluding spills), the Ohio River provides a suitable source water for public supply after appropriate treatment.Levels of many metals and volatile organic compounds have decreased over the past 10 years.
23
Ausich, William I., and Philip Dravage. "Crinoids from the Brassfield Formation of Adams County, Ohio." Journal of Paleontology 62, no. 2 (March 1988): 285–89. http://dx.doi.org/10.1017/s0022336000029930.
Full textAbstract:
A new species of Ptychocrinus, Ptychocrinus adamsensis, and dendrocrinid, genus and species undetermined, are described from the Lower Silurian (Llandovery) Brassfield Formation of Adams County, Ohio. Unlike previously recognized Ptychocrinus species, P. adamsensis has biserial arms. Accordingly, the generic concept of Ptychocrinus is broadened. Ptychocrinus adamsensis is the youngest North American species of Ptychocrinus. Ptychocrinus is not known from the Brassfield fauna that has been previously described from the Greene–Montgomery County area of Ohio.
24
Mathers, Hannah M., and Michele M. Bigger. "Bark Splitting and Other Cold Hardiness Effects of Ornamental Herbicides." HortScience 41, no. 4 (July 2006): 976C—976. http://dx.doi.org/10.21273/hortsci.41.4.976c.
Full textAbstract:
Many nurseries within Ohio and northeastern, southeastern, and western United States, and Canada have reported severe bark splitting and scald-type problems in 2005. The amount and severity of damage seen in 2005 has been unlike anything seen before. At Ohio State University, samples from across the state started appearing in 2003–04 and increased in incidence in 2005. Growers' reports of exceeding losses of 5% of their inventory or 3000 to 4000 trees per nursery are not uncommon. At an average cost of $125 per tree and with the number of nurseries reporting problems, the stock losses in Ohio have been staggering, in excess of several million dollars. The trees that we have seen problems on in 2005 have been callery pears, yoshino cherry, kwanzan cherry, crab apples, sycamore, serviceberry, hawthorn, mountain ash, black gum, paper bark maple, japanese maples, norway maple `Emerald Queen', red maples, kousa dogwood, magnolia `Elizabeth' and the yellow magnolias such as `Butterflies', `Sawada's Cream', `Yellow Bird', and `Yellow Lantern'. It has long been observed that the actual cause of a bark crack was “preset” by a wound such as the improper removal of a basal sprout, herbicide, leaving of a branch stub, or lack of cold hardiness. Cold and frost may be contributing to the increase in bark splitting across the United States; however, new research results at Ohio State University regarding the effects of DNA preemergent herbicides in the reduction of root hardiness and regrowth potential, sprout removal and other mechanical injuries, and postemergent herbicide application will reveal these are more the causal agents.
25
Andrews, Sara. "The Ohio Data Story in Three Part." Federal Sentencing Reporter 33, no. 4 (April 1, 2021): 237–39. http://dx.doi.org/10.1525/fsr.2021.33.4.237.
Full textAbstract:
The complex, intricate process of felony sentencing in Ohio makes ensuring clear, comprehendible sentences of the utmost import for the administration of justice and promoting confidence in the system. As such, for more than a year, the Ohio Criminal Sentencing Commission worked with justice system partners to develop a package of uniform felony sentencing documents that prescribe the most clear and concise, minimum language required to comply with Criminal Rule 32 and existing case law and establishes standardized, common data essential for identifying relationships and trends common to all felony courts. The adoption of the package of felony sentencing documents is the first step to begin standardized, aggregate felony sentencing data collection in Ohio—the Ohio Sentencing Data Platform. Sentencing data provide opportunities for robust research, including the ability to parse comparative data between counties, recognizing that community standards can drive law enforcement, prosecution, and sentencing decision-making. The Ohio Sentencing Data Platform will improve information about the people we are trying to help in the criminal justice system and has been met with enthusiastic interest and support from judges and courts throughout the state. Our modest, incremental path will ultimately yield high dividends in building public trust in criminal justice processes and outcomes. At the same time, without fiscal or administrative burden, it will help give judges and decision- makers access to the best information available to perform their public service duty in the most impactful way.
26
Cruz, C. D., and A. E. Dorrance. "Characterization and Survival of Cercospora sojina in Ohio." Plant Health Progress 10, no. 1 (January 2009): 17. http://dx.doi.org/10.1094/php-2009-0512-03-rs.
Full textAbstract:
Frogeye leaf spot (FLS) of soybean, caused by Cercospora sojina, has increased in incidence and severity during the last 3 years in Ohio and caused substantial economic losses for the first time during 2006. FLS is common in the southern United States but has only recently been reported to cause losses in the north-central region. This study evaluated several traits of the fungus which may have contributed to the increase in disease incidence such as: the ability of C. sojina to overwinter and sporulate on infested soybean debris; optimum temperatures for mycelial growth; races (pathotypes) present in Ohio; and pathogenicity on cultivars with Rcs gene(s) for FLS resistance. Conidia of C. sojina were recovered from soybean debris collected at two locations from December to May 2007-2008. The optimum temperature for mycelial growth of all isolates evaluated in this study including those from Louisiana and southern Illinois was 25°C. The 50 isolates of C. sojina collected in Ohio were able to infect a mean of 4.9 of 12 differentials and had a total of 20 different pathotypes. The Rcs3 gene conferred resistance to all of the Ohio isolates. Survival of C. sojina in the field during the winters of 2005 to 2007 contributed to the increase of C. sojina during the 2005, 2006, and 2007 production seasons in Ohio. Accepted for publication 11 April 2009. Published 12 May 2009.
27
Smith, Jeffrey. "The Sun Doesn't Always Shine in Ohio: Reevaluating Renewable Portfolio Standards in Light of Changed Conditions." Michigan Journal of Environmental & Administrative Law, no. 5.1 (2015): 289. http://dx.doi.org/10.36640/mjeal.5.1.sun.
Full textAbstract:
In 2014, with the signing of Senate Bill 310 (S.B. 310), Ohio became the first state to put a temporary “freeze” on its renewable portfolio standard (RPS) and energy efficiency mandates. The law has generated nationwide attention and been criticized as a step back in the state’s clean energy policy. This Note examines the central justifications for the passage of S.B. 310, challenging conventional wisdom that the law does not serve the interests of Ohio citizens. After the passage of Ohio’s RPS in 2008, the economic and energy landscape within the state changed dramatically, due in large part to technological advances allowing for the development of the state’s large natural gas deposits. In order to fully assess these changed conditions, as well as the economic impact the energy mandates were having on ratepayers, Ohio lawmakers passed S.B. 310. While renewable resource advocates argue that increased renewable energy benefits the state of Ohio, this Note argues that S.B. 310 was an example of prudent lawmaking and should serve as a model for other states that have undergone changes in their energy landscape and economic situation since implementing their renewable portfolio standards.
28
Knott, Diana, and David Martinelli. "Communication Strategies for State Transportation Research Programs." Transportation Research Record: Journal of the Transportation Research Board 1924, no. 1 (January 2005): 52–58. http://dx.doi.org/10.1177/0361198105192400107.
Full textAbstract:
Transportation research is often open ended and difficult to measure in that its beneficiaries may not know how they have been served by research activities and results. This research project sought to ( a) obtain feedback from Ohio Department of Transportation (Ohio DOT) constituents; ( b) develop a strategic communication plan that supports Ohio DOT's overall mission and goals, keeping in mind research office resources; and ( c) develop a communication template that other departments of transportation could model or use. To accomplish those objectives, existing knowledge, attitudes, and behaviors concerning Ohio DOT's research office were obtained through a number of surveys. Those surveyed included the Ohio general public, internal DOT constituents (technical liaisons, administrators and directors, district deputy directors, district research contacts, and FHWA regional center directors), and external DOT constituents (consultants, contractors, transportation committee legislators, and college civil engineering department heads). In addition, a nationwide survey of department of transportation research office directors was conducted to determine the constituents with whom these offices communicate and the means by which they do so. Common areas of interest among constituents were identified; from those, key research-office message points were proposed, as were constituents’ preferred methods of receiving research office information. The study also found that most research office directors believed that they communicated well internally but did not communicate effectively to external audiences. Part of this problem could lie in their failing to utilize communication office personnel, who have the expertise and contacts to spread the word about transportation research.
29
Lepper, Bradley T., James R. Duncan, Carol Diaz-Granados, and John Soderberg. "Ohio Rock Art and Serpent Mound: Shared Iconography, Shared Stories." Midcontinental Journal of Archaeology 48, no. 2 (July 1, 2023): 147–71. http://dx.doi.org/10.5406/23274271.48.2.03.
Full textAbstract:
Abstract James Swauger's study of Ohio's rock art, Petroglyphs of Ohio, has been the definitive guide to the subject since its publication in 1984. Swauger concluded that the Indigenous American Indian petroglyphs were created during the late precontact period and proposed that the makers of the designs were “proto-Shawnee,” but he deliberately eschewed any attempt to attribute meanings to the designs. Building on Swauger's work, we consider Ohio rock art through the lens of our previous research on Serpent Mound and the rock art of midcontinental North America, particularly the unique suite of pictographs at Picture Cave, as interpreted through the lens of Dhegiha Siouan oral traditions. We argue that several Ohio petroglyph sites include configurations of motifs that represent episodes from an ancient and widespread Indigenous creation story featuring the Great Serpent, Lord of the Beneath World, and First Woman, the mother of all living things.
30
Donnermeyer, Joseph F., Erik Wesner, and Dee Jepsen. "Of Buggies and Blinkers: An Essay on the 2022 Ohio Buggy Lighting Law." Journal of Plain Anabaptist Communities 4, no. 1 (December 7, 2023): 111–30. http://dx.doi.org/10.18061/jpac.v4i1.9605.
Full textAbstract:
Buggy safety long has been an issue in the state of Ohio and elsewhere. As their population grows, and rural roads become increasingly crowded with cars and trucks, safety will continue to be a concern to the Amish, public officials and the general public. In 2022, the governor of Ohio signed a mandatory lighting law for Amish buggies. Even though a large share of the Amish either already had a blinking light on the back of their buggies or conformed to the new law, some conservative groups, especially conservative Swartzentruber Amish groups, have resisted. This article discusses the history of attempts to increase buggy visibility and road safety and the developments behind the current controversy. It includes a brief statistical summary on the number of buggies in the Greater Holmes County settlement who either display a blinking amber light or do not, plus briefs visits to other Amish and buggy-driving Mennonite groups in Ohio. Also included are selected comments about the new Ohio law from readers on the Amish America website. The article concludes with a brief discussion of the possible outcomes from an issue that will likely extend into 2024 and beyond before a solution is found for all Amish affiliations.
31
ORTIZ-PEREZ, E., R. M. A. MIAN, R. L. COOPER, T. MENDIOLA, J. TEW, H. T. HORNER, S. J. HANLIN, and R. G. PALMER. "Seed-set evaluation of four male-sterile, female-fertile soybean lines using alfalfa leafcutting bees and honey bees as pollinators." Journal of Agricultural Science 146, no. 4 (January 21, 2008): 461–69. http://dx.doi.org/10.1017/s002185960700768x.
Full textAbstract:
SUMMARYMale-sterile, female-fertile plants were used to produce hybrid soybean seed. Manual cross-pollination using male-sterile plants to produce large quantities of hybrid seed is difficult and time-consuming because of the low success rate in cross-pollination. Insect pollinators may be suitable vectors to transfer pollen, but the most suitable vector for pollen transfer from the male parent to the female parent has not been identified for soybean. The objective of the present study was to evaluate seed-set on four male-sterile, female-fertile soybean lines by using alfalfa leafcutting bees (Megachile rotundata (F.)) and honey bees (Apis mellifera (L.)) as pollinators. Seed-set was evaluated in summers 2003 and 2005 near Ames, Iowa, USA and in summers 2003, 2004, and 2005 near Wooster, Ohio, USA. Neither the effect of pollinator species nor the interaction effect of pollinator species×location was significant for any year. Honey bees performed similarly to alfalfa leafcutting bees at both locations. The results indicated significant differences for seed-set among male-sterile lines, suggesting preferential pollination. Male-sterile lines, ms1 (Urbana) and ms2 (Ames 2), had higher cross-pollinated seed-set compared to ms6 (Ames 1), and ms6 (Corsoy 79). At the Ames location, ms1ms1 (Urbana) plants had the highest seed-set (50·16 seeds per male-sterile plant in 2005). At the Wooster location, ms1ms1 (Urbana) plants also had the highest seed-set (92·04 seeds per male-sterile plant) in 2005. Costs and local conditions need to be addressed to support the choice of either pollinator species as a pollination vector to produce hybrid soybean seed.
32
Andrew, Angeline S., Erik P. Pioro, Meifang Li, Xun Shi, Jiang Gui, Elijah W. Stommel, Tanya H. Butt, et al. "The Incidence of Amyotrophic Lateral Sclerosis in Ohio 2016–2018: The Ohio Population-Based ALS Registry." Neuroepidemiology 55, no. 3 (2021): 196–205. http://dx.doi.org/10.1159/000515103.
Full textAbstract:
<b><i>Introduction:</i></b> Amyotrophic lateral sclerosis (ALS) is a fatal, neuromuscular disease with no cure. ALS incidence rates have not been assessed specifically in Ohio, yet the state contains both metropolitan and rural areas with a variety of environmental factors that could contribute to disease etiology. We report the incidence of ALS in Ohio residents diagnosed from October 2016 through September 2018. <b><i>Methods:</i></b> We engaged practitioners from 9 Ohio sites to identify newly diagnosed ALS patients and to complete case report forms with demographic and clinical information. ALS was diagnosed according to the Awaji criteria and classified as either definite, probable, or possible. We developed a method to estimate missing cases using a Poisson regression model to impute cases in counties with evidence of undercounting. <b><i>Results:</i></b> We identified 333 newly diagnosed ALS patients residing in Ohio during the 2-year index period and found incidence rates varied in the 88 state counties. After incorporating the estimated 27% of missing cases, the corrected crude annual incidence was 1.96/100,000 person-years, and the age- and gender-standardized incidence was 1.71/100,000 person-years (standardized to the 2010 US census). <b><i>Discussion/Conclusion:</i></b> The estimated Ohio incidence of ALS is overall similar to that reported in other states in the USA. This study reveals a geospatial variation in incidence within the state, and areas with higher rates warrant future investigation.
33
Kline, Anisa. "Setting the Table: A Bahá’i geographer reflects on faith, fieldwork, and farmworkers." CrossCurrents 73, no. 2 (June 2023): 153–72. http://dx.doi.org/10.1353/cro.2023.a904521.
Full textAbstract:
Abstract: For my PhD dissertation, I surveyed agricultural guestworkers, also known as H-2A workers, in Ohio. In the summer of 2022, a research assistant and I drove around Ohio, knocking on doors and surveying the people who agreed to participate. In the end, we drove over 10,000 miles and spoke with 285 male, Spanish-speaking H-2A workers throughout the state. My larger project was focused on gathering demographic data and learning more about the men’s working and living experiences in Ohio. The results of the study have been published elsewhere. This is a personal essay recounting some of my experiences in the field and reflecting on the dialectical relationship between my identity as a Bahá’i and the fieldwork experience. Specifically, I reflect on how my faith informed my approach to fieldwork and how the Bahá’i concept of the oneness of humanity helps me connect with, or at least more clearly see, the “Other.”
34
Leon, Ramon G., Diane C. Bassham, and Micheal D. K. Owen. "Germination and proteome analyses reveal intraspecific variation in seed dormancy regulation in common waterhemp (Amaranthus tuberculatus)." Weed Science 54, no. 02 (April 2006): 305–15. http://dx.doi.org/10.1614/ws-05-115r1.1.
Full textAbstract:
Common waterhemp is an obligate outcrosser that has high genetic variability. However, under selection pressure, this weed shows population differentiation for adaptive traits. Intraspecific variation for herbicide resistance has been studied, but no studies have been conducted to determine the existence of variation for other adaptive traits that could influence weed management. The objective of this study was to examine the existence of different seed dormancy regulatory mechanisms in common waterhemp. Seed dormancy regulation, in response to different temperature and moisture regimes, was studied through germination experiments and proteome analysis using two common waterhemp biotypes (Ames and Everly) collected from agricultural fields in Iowa, and one biotype (Ohio) collected from a pristine area in Ohio. Without stratification, germination percentage among the different biotypes was 9, 29 and 88% for Ames, Everly, and Ohio respectively. The germination rate of seeds from Ames was dramatically increased after incubation at either 4 or 25 C under wet conditions, whereas germination of seeds from Everly was only increased at 25 C under wet conditions. The Ohio biotype showed no change in germination response to any of the incubation treatments. Germination studies indicated that the rate of seed dormancy alleviation differed between biotypes. Seed protein profiles obtained from the three biotypes differed in protein abundance, number, and type. A putative small heat-shock protein (sHSP) of 17.6 kDa and isoelectric point (pI) 6.1 increased whereas a putative glyceraldehyde-3-phosphate dehydrogenase (G3PDH) of 30.9 kDa and pI 6.4 decreased in abundance in the Ames biotype as seed dormancy was reduced in response to incubation at 4 C and wet conditions. These two proteins did not change in the Everly and Ohio biotypes, suggesting that these proteins changed their abundance in response to seed dormancy alleviation. The results of this study suggest that differences in seed dormancy levels between the biotypes were due to different physiological regulatory mechanisms.
35
Dorrance, A. E., D. T. Gordon, A. F. Schmitthenner, and C. R. Grau. "First Report of Bean pod mottle virus in Soybean in Ohio." Plant Disease 85, no. 9 (September 2001): 1029. http://dx.doi.org/10.1094/pdis.2001.85.9.1029a.
Full textAbstract:
Soybean has been increasing in importance and acreage over wheat and corn for the past decade in Ohio and is now planted on 4.5 million acres. Previous surveys in Ohio of viruses infecting soybean failed to identify Bean pod mottle virus (BPMV) and soybean virus diseases have rarely caused economic losses (1). During 1999, producers in Ohio noticed virus-like symptoms in soybeans in a few isolated locations. Soybeans with green stems, undersized and “turned up pods” were collected from Union, Wood and Wyandot Counties during October 1999 and soybeans with crinkled, mottled leaves were collected in Henry, Licking and Sandusky during August 2000. Five to six plants were collected from a single field from each county each year. In 1999, samples were sent to the University of Wisconsin-Madison, where one symptomatic leaflet/sample was ground in 3 ml of chilled phosphate buffered saline (pH 7.2). Leaf sap was placed in 1.5-ml centrifuge tubes and stored at 4°C for 24 h. Sap was assayed for the presence of BPMV using an alkaline phosphatase-labeled double-antibody sandwich enzyme-linked immunosorbent assay (DAS ELISA) for BPMV (AgDia Inc., Elkhart, IN). All samples tested were positive for BPMV. Samples collected in 1999 were also maintained at The Ohio State University in Harosoy soybean and in 2000 assayed serologically along with samples collected in 2000 for BPMV and Soybean mosaic virus (SMV) by ELISA and for Tobacco ringspot virus (TRSV) and Bean yellow mosaic virus (BYMV) by a host-range symptom assay; SMV, BYMV and TRSV had been identified from soybean in previous Ohio surveys. Soybean leaf samples were assayed using F(ab′)2-Protein A ELISA with antiserum prepared in 1968 to a southern U.S. isolate of BPMV and to an Ohio isolate of Soybean mosaic virus (SMV) prepared in 1967, both stored at −20°C. Diseased and non-symptomatic soybean leaf samples were ground in 4 ml 0.025M Tris pH 8.0, 0.015M NaCl and 0.05% Tween 20. Extracts were tested for BPMV and SMV by ELISA following a protocol described elsewhere (2). All of the samples collected during 1999 and maintained in the greenhouse tested positive for both BPMV and SMV while all of those samples collected during 2000 tested positive for BPMV and negative for SMV. Host-range symptom assays were conducted with leaf extracts prepared by grinding 1 g tissue:10 ml potassium phosphate buffer, pH 7.0. Extracts were inoculated by leaf rub method to Harosoy soybean, Phaseolus vulgaris cvs. Red Kidney and Bountiful, cowpea, and cucumber. The host-range symptom assays of both the 1999 and 2000 samples were negative for TRSV and BYMV; cowpea failed to express local lesions and cucumber systemic mosaic characteristic of TRSV infection and the two Phaseolus cultivars the yellow mosaic characteristic of BYMV infection. These results indicate that both BPMV and SMV were present in the samples in 1999 but only BPMV in 2000. The distribution of BPMV within Ohio and economic impact of this virus have yet to be determined. This is the first report of BPMV in Ohio. References: (1) A. F. Schmitthenner and D. T. Gordon. Phytopathology 59:1048, 1969. (2) R. Louie et al. Plant Dis. 84:1133–1139, 2000.
36
Olivo-Marston, Susan E., Shashank Singh, Robert B. Hood, and Olorunfemi Adetona. "Abstract 4218: Cancer prevalence among Ohio firefighters: data from the Ohio Cancer Incidence Surveillance System (OCISS) 1996-2019." Cancer Research 83, no. 7_Supplement (April 4, 2023): 4218. http://dx.doi.org/10.1158/1538-7445.am2023-4218.
Full textAbstract:
Abstract Firefighting is classified as a Group 1 carcinogen or “carcinogenic to humans” by the International Agency for Research on Cancer. Compared to the general population, firefighters have a 9% increased risk of cancer incidence and a 14% increased risk of cancer mortality. Although there have been previous studies of cancer incidence among firefighters in Florida and Massachusetts, there have been no studies examining cancer incidence among firefighters in the state of Ohio. Therefore, this is the first study to examine cancer prevalence among Ohio firefighters. The study utilized data from the Ohio Cancer Incidence Surveillance System (OCISS), the Ohio state cancer registry. This study examined data from 1996-2019, including a total of 1,314,318 people. Occupation was classified as firefighter, police, or general population. The odds of being a firefighter versus a police officer or the general population was calculated for specific cancer types. In addition, this analysis was stratified by gender. Police were used as a comparison group because it is an occupation similar to firefighters with the exception of exposure. There was a total of 3,397 firefighters, 3,341 police, and 1,307,580 people in the general population. Among firefighters, they were mostly male (86.8%), White (92.7%), Non-Hispanic (3.4%), married (67.7%), and never used tobacco (19.8%). The mean age at cancer diagnosis among firefighters was 66 years and most of them were diagnosed between 2010 and 2014. A similar distribution was seen among police except the mean age at cancer diagnosis was 63 years and most of them were current tobacco users (18.5%). The distribution was similar among the general population except the majority of them were female (51.6%). Firefighters had increased odds of esophageal cancer, cancers of the soft tissue including the heart, skin, prostate, testis, bladder, and brain compared to the general population. Cancer of the oral cavity, pharynx, and kidney were also increased among firefighters; however, they did not reach statistical significance. Compared to police, firefighters had increased odds of breast, uterine, prostate, brain, and thyroid cancer. In addition, they had decreased odds of pancreatic and bladder cancer. When stratified by gender, among the 2,948 male firefighters, there were increased odds of cancer of the soft tissue including heart, prostate, brain, cranial nerves, and thyroid cancer compared to the general population. They also had decreased odds of cancer of the larynx, lung & bronchus, and bladder. Number of female firefighters was small generating unstable odds ratios. We observed increased prevalence of several types of cancer among Ohio firefighters, similar to previous studies. Although there were limitations present due to many people lacking data on occupation, the current study supports that Ohio firefighters have an increased risk of many different types of cancer. Citation Format: Susan E. Olivo-Marston, Shashank Singh, Robert B. Hood, Olorunfemi Adetona. Cancer prevalence among Ohio firefighters: data from the Ohio Cancer Incidence Surveillance System (OCISS) 1996-2019. [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 4218.
37
K. Quaye, Randolph. "The Patient Protection and Affordable Care Act (ACA) of 2010 and Ohio physicians." Leadership in Health Services 27, no. 2 (April 28, 2014): 116–25. http://dx.doi.org/10.1108/lhs-10-2012-0037.
Full textAbstract:
Purpose – This paper aims to explore the perspectives of Ohio physicians on the Patient Protection and Affordable Care Act (ACA) of 2010. While much has been debated about ACA, relatively few studies have focused on how ACA will impact on physicians' practice behavior. Design/methodology/approach – The research data came from a mailed survey of ninety physicians randomly selected from the Cigna Directory of Physicians practicing in Ohio. Study examined how informed were physicians about ACA, and explored how much the effect of ACA has been discussed in their practice, how they think ACA will impact their practice, and whether or not they are in favor of the provisions under the Act. Findings – Overwhelmingly, while the physicians surveyed were familiar with the specific provisions of ACA, almost half of them opposed it. Primary care physicians reported generally favorable opinions about ACA. All but one of the physicians concluded that ACA, much like managed care provisions, has undermined and will continue to reduce the autonomy and professional independence of physicians. Research limitations/implications – This study is limited by its small sample and reliance on a small set of physicians. Practical implications – This study has practical implications for examining how Ohio physicians are responding to the new health care reform in the United States. It has broader implications for addressing the problem of the uninsured and the role of the federal government in health care provision. Social implications – If physicians are opposed to this reform as the study seems to suggest, it might have broader implications for future career aspirations for physicians. Originality/value – So far as we can tell, there has not been any exploratory study in Ohio examining the perspectives of physicians on ACA.
38
Staurowsky, Ellen J., Heather Lawrence, Amanda Paule, James Reese, Kristy Falcon, Dawn Marshall, and Ginny Wenclawiak. "Travelers on the Title IX Compliance Highway: How Are Ohio’s Colleges and Universities Faring?" Women in Sport and Physical Activity Journal 16, no. 2 (October 2007): 46–82. http://dx.doi.org/10.1123/wspaj.16.2.46.
Full textAbstract:
As a measure of progress, the experiences today of women athletes in the state of Ohio are far different from those attending institutions of higher learning just after the passage of Title IX of the Education Amendments Act of 1972. But how different, and how much progress has been made? The purpose of this study was to assess the level of progress made by compiling and analyzing data available through the Equity in Athletics Disclosure reports filed by 61 junior colleges, four year colleges, and universities in the State of Ohio over a four year span of time for the academic years 2002-2006.2 The template for this study was the report completed by the Women’s Law Project examining gender equity in intercollegiate athletics in colleges and universities in Pennsylvania (Cohen, 2005), the first study of its kind. Similar to that effort, this study assesses the success with which intercollegiate athletic programs in Ohio have collectively responded to the mandates of Title IX in areas of participation opportunities and financial allocations in the form of operating budgets, scholarship assistance, recruiting and coaching.3
39
Badley, Jessie R., Caleb Ryce, and Pamela J. Lein. "Train derailment in East Palestine, Ohio: The toxic risks of transporting hazardous chemicals." Open Access Government 40, no. 1 (October 25, 2023): 380–81. http://dx.doi.org/10.56367/oag-040-9857.
Full textAbstract:
Train derailment in East Palestine, Ohio: The toxic risks of transporting hazardous chemicals The toxic risks of vinyl chloride have been debated for years, but a recent train derailment in the US brought this debate into the public eye, say Jessie R Badley, Caleb Ryce and Pamela J Lein. Three days after the 3 February 2023 derailment of a 50-car freight train in East Palestine, Ohio, emergency crews from Norfolk Southern, the chemical transportation company, made the decision to vent and burn toxic vinyl chloride from five tank cars to prevent an explosion. A black mushroom plume of toxic gas that could be seen for miles engulfed the town. The subsequent death of more than 43,000 aquatic animals living in the vicinity of East Palestine during the month after the controlled release prompted public concerns about drinking water and air contamination in not only East Palestine but also neighbouring communities since the East Palestine watershed empties into the Ohio River, which is a primary source of water for many municipalities.
40
Han, J., L. L. Domier, A. E. Dorrance, and F. Qu. "First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields." Plant Disease 97, no. 5 (May 2013): 693. http://dx.doi.org/10.1094/pdis-11-12-1050-pdn.
Full textAbstract:
Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5′ CCATCTTTCTTTCCAGGCATTTCA 3′) and SVNaV-S-2421R (5′ GATTCAAGTTCAGCGAGTTCTACAA 3′). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.
41
Cronquist, Carol. "An Ohio librarian makes a ‘find’." Art Libraries Journal 18, no. 4 (1993): 24–27. http://dx.doi.org/10.1017/s030747220000852x.
Full textAbstract:
In the course of researching the life and work of a 19th century British artist, Henry Courtney Selous, several London museums and libraries were visited during 1993. The Royal Academy and the National Portrait Gallery yielded some information, but at the Guildhall Library the author’s attention was drawn to a diary held at the National Art Library which on perusal seemed undoubtedly to have been compiled by Selous. The Library has subsequently revised the diary’s catalogue entry to incorporate this attribution.
42
Vicory, Alan H., and Peter A. Tennant. "A STRATEGY FOR MONITORING THE IMPACTS OF COMBINED SEWER OVERFLOWS ON THE OHIO RIVER." Water Science and Technology 30, no. 1 (July 1, 1994): 167–75. http://dx.doi.org/10.2166/wst.1994.0018.
Full textAbstract:
With the attainment of secondary treatment by virtually all municipal discharges in the United States, control of water pollution from combined sewer overflows (CSOs) has assumed a high priority. Accordingly, a national strategy was issued in 1989 which, in 1993, was expanded into a national policy on CSO control. The national policy establishes as an objective the attainment of receiving water quality standards, rather than a design storm/treatment technology based approach. A significant percentage of the CSOs in the U.S. are located along the Ohio River. The states along the Ohio have decided to coordinate their CSO control efforts through the Ohio River Valley Water Sanitation Commission (ORSANCO). With the Commission assigned the responsibility of developing a monitoring approach which would allow the definition of CSO impacts on the Ohio, research by the Commission found that very little information existed on the monitoring and assessment of large rivers for the determination of CSO impacts. It was therefore necessary to develop a strategy for coordinated efforts by the states, the CSO dischargers, and ORSANCO to identify and apply appropriate monitoring approaches. A workshop was held in June 1993 to receive input from a variety of experts. Taking into account this input, a strategy has been developed which sets forth certain approaches and concepts to be considered in assessing CSO impacts. In addition, the strategy calls for frequent sharing of findings in order that the data collection efforts by the several agencies can be mutually supportive and lead to technically sound answers regarding CSO impacts and control needs.
43
Teferra, Andreas A., Brittney Keller-Hamilton, Megan E. Roberts, and Paul L. Reiter. "HPV Vaccine Coverage Among Adolescent Males in Ohio: Results of a Longitudinal Study." Ohio Journal of Public Health 2, no. 2 (December 1, 2019): 15–23. http://dx.doi.org/10.18061/ojph.v2i2.9030.
Full textAbstract:
Background: Human papillomavirus (HPV) vaccine has been recommended for males in the United States since 2011, yet little is known about vaccine coverage among adolescent males in Ohio. Our longitudinal study examined HPV vaccine coverage among adolescent males in Ohio and identified predictors of vaccination.Methods: The Buckeye Teen Health Study recruited adolescent males aged 11 to 16 years and their parents from 1 urban county and 9 rural counties in Ohio. We report longitudinal vaccination data on 1126 adolescent males, with baseline data from 2015-2016 and follow-up data from 2017-2018. We used multivariable Poisson regression to identify predictors of HPV vaccine initiation that occurred between baseline and follow-up.Results: At baseline, 42.4% of parents reported their sons had initiated the HPV vaccine series. Among parents whose sons were unvaccinated at baseline, 36.3% indicated initiation at follow-up. Initiation at follow-up was more com-mon among sons who had received influenza vaccine (RR = 1.54, 95% CI = 1.08-2.18) or whose parents indicated lack of a recent visit to a doctor as the main reason for not yet vaccinating at baseline (RR = 1.41, 95% CI = 1.02-1.95). Initiation was less common among sons whose parents had an associate degree or some college education (RR = 0.28, 95% CI = 0.46-0.99). Main reasons for not vaccinating changed from baseline to follow-up among parents of unvaccinated sons.Conclusion: Although HPV vaccine initiation increased over time, many adolescent males in Ohio remain unvac-cinated. Findings can help guide future strategies for increasing HPV vaccine coverage among this population.
44
Neal, Maxwell Lewis, and Joseph T. Hannibal. "Paleoecologic and taxonomic implications of Sphenothallus and Sphenothallus-like specimens from Ohio and areas adjacent to Ohio." Journal of Paleontology 74, no. 3 (May 2000): 369–80. http://dx.doi.org/10.1017/s0022336000031644.
Full textAbstract:
Sphenothallus and fossils similar to Sphenothallus are found in Ordovician, Devonian, and Mississippian rock units in Ohio and adjacent states and provinces. Although the Ordovician of Québec, Ontario, and Indiana has yielded parts of tubes, Ordovician specimens from southwest Ohio and nearby areas consist almost entirely of holdfasts on hardgrounds and shelly fossils. Sphenothallus is abundant in the Chagrin Shale (Famennian) of northeast Ohio where it is found in about four percent of concretions that contain identifiable fossils. The Chagrin specimens, usually parts of tubes, are occasionally preserved three-dimensionally. The rate of distal expansion of Chagrin Sphenothallus tubes varies intraspecifically; thus, this rate cannot be used to distinguish species. Some Chagrin specimens are attached to larger, conspecific specimens and to articulate brachiopods. Brachiopods have also been found attached to Chagrin Sphenothallus. Bedford-Berea sequence (Famennian) specimens from northern Kentucky and Meadville Member (Kinderhookian or Osagian) specimens from the Cuyahoga Formation of northeast Ohio are usually preserved as flattened tubes. In both occurrences tubes are similar in width, indicating that individuals in each assemblage are probably the same age. Meadville tubes possess characteristics diagnostic of Sphenothallus, but Bedford-Berea specimens, which lack longitudinal thickenings and exhibit little tube tapering, cannot be assigned to Sphenothallus sensu strictu.Sphenothallus was a gregarious, opportunistic species, tolerant of dysaerobic conditions and able to colonize environments ranging from hardgrounds to soft, muddy sea bottoms. No distinct branching was observed among the Chagrin, Bedford-Berea, or Meadville specimens, suggesting that larval dispersal was the primary mode of reproduction for the genus.
45
Kolmer, J. A. "Virulence of Puccinia triticina, the Wheat Leaf Rust Fungus, in the United States in 2017." Plant Disease 103, no. 8 (August 2019): 2113–20. http://dx.doi.org/10.1094/pdis-09-18-1638-sr.
Full textAbstract:
Samples of wheat leaves infected with the leaf rust fungus, Puccinia triticina, were obtained in 2017 from agricultural experiment station plots, demonstration plots, and farm fields in the Great Plains, the Ohio Valley, the southeastern states, California, and Washington in order to determine the prevalent virulence phenotypes present in the United States. A total of 65 virulence phenotypes were identified among the 469 single uredinial isolates that were tested on 20 near-isogenic lines of Thatcher wheat that differ for leaf rust resistance genes. Virulence phenotypes MBTNB at 11.3% of the overall population, and MCTNB at 7.0%, were the first and third most common phenotypes. Both phenotypes were found mostly in the southeastern states and Ohio Valley region. Phenotype TFTSB at 10.9% was the second most common phenotype and was found mostly in southern Texas. Virulence to leaf rust resistance gene Lr39, which is present in hard red winter wheat cultivars, was highest in the Great Plains region. Virulence to Lr11 and Lr18, which are present in soft red winter wheat cultivars, was highest in the southeastern states and Ohio Valley region. Virulence to Lr21, which is present in hard red spring wheat cultivars, was highest in the northern Great Plains region. The predominate P. triticina phenotypes from the soft red winter wheat regions of the southeastern states and Ohio Valley area differed from those in the hard red winter and hard red spring wheat areas of the Great Plains region. Collections from Washington had unique virulence phenotypes that had not been previously detected.
46
Worley, Robert, and Barua Worley. "Book Review: Mitchel P. Roth, Fire in the Big House: America’s Deadliest Prison Disaster. Athens, OH: Ohio University Press. 2019." Theory in Action 14, no. 2 (April 30, 2021): 101–9. http://dx.doi.org/10.3798/tia.1937-0237.2116.
Full textAbstract:
In his book, Fire in the Big House, criminal justice historian, Mitchel P. Roth provides readers with an in-depth analysis of America’s deadliest penal disaster. The book specifically examines a horrific fire which occurred at the Ohio State Penitentiary in Columbus, Ohio on April 21, 1930—Easter Monday. Even though 320 prisoners perished in this devastating event (plus two more inmates who died later of gunshots indirectly related to the fire), the author notes that there has never been a scholarly book devoted to this topic. Although this event caused only $11,000 in damage to the Columbus institution, Roth contends that it still ranks as America’s third-worst fire (excluding 9/11).
47
Davis, Allison Pitinii. "The Neighborhood and Surrounding City, 1926–2019, and: The Neighborhood Girls Catch Lordstown Syndrome, and: The Neighborhood Girls Fantasize about the WKBN Meteorologist, and: The Neighborhood Girls Ask the WKBN Meteorologist, and: 10¢ Beer Night at Municipal Stadium, Cleveland, Ohio, June 4, 1974, and: The Neighborhood Girls Go on Strike, and: he WKBN Meteorologist Finally Stops by the Dairy Queen, and: The Neighborhood Girls Offer Me." Missouri Review 43, no. 2 (2020): 9–19. http://dx.doi.org/10.1353/mis.2020.0016.
Full text
48
Seeman, Mark F., and Kevin C. Nolan. "Building the Ohio Hopewell Chronology: An Incremental Approach to Historical Reckoning." American Antiquity 88, no. 2 (April 2023): 144–62. http://dx.doi.org/10.1017/aaq.2023.6.
Full textAbstract:
AbstractOhio Hopewell is an archaeological concept that is known worldwide but that suffers from “a disarray of radiocarbon results” (Lynott 2015:60). Here, we establish a comprehensive dataset of 425 14C dates from Ohio Hopewell sites and apply formal chronometric hygiene criteria to all dates. We then iteratively assess the temporal placement and span of the six most important Ohio Hopewell sites—the Hopewell Mound Group, Liberty, Mound City, Seip, Tremper, and Turner. A staged relaxation of hygiene criteria for our best three categories (Classes 1–3) permits alternate but generally consistent conclusions. As the first large-scale analyses of Ohio Hopewell temporality since the publication of IntCal20 (Reimer et al. 2020), the available data show a ritual complex that begins 90 or more years later than generally has been recognized circa 2010 14C BP, or as Bayesian modeled, AD 90–120. Our analysis reveals site histories of differing spans, more late dates than early dates, and with most Hopewell activity ending across these sites circa 1640 14C BP, or as Bayesian modeled, AD 395–430. An increased consideration of contingency in contemporary temporal reckoning increases the utility of the historical narratives that we as archaeologists can construct.
49
Sehic, Andrea. "Government’s involvement in regional policy and development in the state of Ohio, USA." Spatium, no. 19 (2009): 51–55. http://dx.doi.org/10.2298/spat0919051s.
Full textAbstract:
Brownfield redevelopment has been playing a leading role in urban development in the state of Ohio for some time now. Being one of the most industrialized states in the US, Ohio has been struggling for a long time with numerous consequences of businesses that were shutting down, moving out of Ohio, or restructuring. The State officials have been addressing and taking care of these issues very carefully, and with a lot of concern and attention. Furthermore, the officials have been cooperating on all levels of government, which created a very positive and encouraging environment for successful redevelopment projects. The State has been focusing on comparative advantages of regions, and assisting where the demand is. The State has also been encouraging regional development by providing programs especially designed for ones in need, or valuing projects that propose a regional component/strategy. With establishing public-private partnerships between applicants and the government as the fund provider, a very important way of cooperation is established, and maintained, throughout the funding process. With the evident burden that brown fields impose on all participants in the process of redevelopment, it is sometimes difficult to see the overall benefit of such actions. The crucial role of government?s support has proved to be the key to successful implementation of brown field projects. Enabling continuous flow of funds, establishing intergovernmental relations, along with enabling public-private partnerships, and tightly linking the participants in the process of redevelopment resulted in successfully completed projects, which brought new life and brighter perspective to communities that haven?t been able to struggle through this complex process on their own.
50
Dixon, Robert S. "The Ohio SETI Program - the First Decade." Symposium - International Astronomical Union 112 (1985): 305–14. http://dx.doi.org/10.1017/s0074180900146637.
Full textAbstract:
A full-time dedicated SETI progam has been in operation at Ohio State University since 1973. A 50-channel narrowband filter bank is in use near the 21 cm. hydrogen-line. All data is processed in real time and permanently recorded. A large portion of the northern sky has been surveyed and analyzed for large-scale structure. The only obvious non-random structure is caused by isolated narrowband pulses, which are anti-correlated with galactic latitude, and congregate in two specific areas. The origin of these pulses is unknown, although they may be partially due to instrumental effects.